EPo

KDP

R

cadpdt1oeTpcttetittmwtg

stFCFWp

f

2

Biochemical and Biophysical Research Communications 273, 705–711 (2000)

doi:10.1006/bbrc.2000.3001, available online at http://www.idealibrary.com on

xpression and Binding Properties of a Soluble Chimericrotein Containing the N-Terminal Domainf the Duffy Antigen

azimiera Wasniowska,1 Marcin Czerwinski, Wojciech Jachymek, and Elwira Lisowskaepartment of Immunochemistry, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy,olish Academy of Sciences, Rudolfa Weigla 12, 53-114 Wrocław, Poland

eceived May 25, 2000

modium vivax and Plasmodium knowlesi, and as ap4dstrcDap

epnfatbDescanocmtmgNltsml

s

The blood group Duffy antigen of human erythro-ytes, which exists in two allelic forms, Fya and Fyb, ispromiscuous chemokine receptor. In this report we

escribe the expression and purification of a chimericrotein composed of the amino-terminal extracellularomain of the Duffy antigen (aa 3–60), C-terminal in-racellular fragment of glycophorin A (GPA, aa 104–31), and the hexahistydyl tag. We obtained two formsf the recombinant protein containing the Fya or Fyb

pitope, denoted Fya/GPA and Fyb/GPA, respectively.hese constructs were expressed in Escherichia coli aseriplasmic proteins and were purified by affinityhromatography on the Ni-NTA-agarose. Both pro-eins bound the monoclonal antibodies recognizinghe common Fy6 epitope of the Duffy antigen and anpitope of the C-terminal fragment of GPA, and onlyhe Fya/GPA bound anti-Fya antibody. However, bind-ng of IL-8 to the recombinant proteins was not de-ected, which indicated that an N-terminal domain ofhe Duffy antigen is not sufficient for an effective che-okine binding. The lack of the chemokine bindingas not likely to be due to the lack of glycosylation of

he Fy/GPA, since IL-8 was effectively bound to de-N-lycosylated erythrocytes. © 2000 Academic Press

Key Words: Duffy antigen; chemokine receptor.

The Duffy protein of human erythrocytes is respon-ible for the blood group system which consists ofwo major antigens, Fya and Fyb. Three phenotypesy(a1b2), Fy(a2b1), and Fy(a1b1) were identified inaucasian population. The absence of both, Fya andyb antigens on erythrocytes, which is frequent inest Africans, is designated as the Duffy negative

henotype, Fy(a2b2) (for refs. see 1–3).The Duffy protein is a subject of interest, since it

unctions as a receptor for the malaria parasites Plas-1 To whom correspondence should be addressed. Fax: 48-71-373-

587. E-mail: wasniows@immuno.iitd.pan.wroc.pl.

705

romiscuous receptor of CXC and CC chemokines (1,). Chemokine receptor on human red blood cells wasiscovered by Darbonne et al. (5). Further studieshowed that the red blood cell chemokine receptor andhe Duffy blood group antigen are identical (4) and theeceptor was designated the Duffy antigen receptor forhemokine (DARC). DARC is expressed not only byuffy-positive erythrocytes, but also by endothelialnd other cells of nonerythroid lineage, in both, Duffy-ositive and Duffy-negative individuals (6–8).Cloning and sequencing of the cDNAs showed the

xistence of two isoforms of the Duffy protein, com-osed of 336 aa (9) and 338 aa (10) (all amino acidumbers used in this report refer to the longer iso-orm). These isoforms have different sequence of sixnd eight N-terminal amino acids, respectively, buthey do not differ in binding of known anti-Duffy anti-odies and chemokines. The polypeptide chain of theuffy antigen consists of an over 60 aa N-terminalxtracellular domain with three N-glycosylation sites,even membrane-spanning segments, and 28 aa intra-ellular C-terminal portion. The Fya and Fyb antigensre encoded by the allelic genes differing by a singleucleotide (G/A), which results in the presence of Glyr Asp, respectively, at position 44 of the polypeptidehain (11, 12). The amino-terminal extracellular do-ain contains the blood group Fya or Fyb epitopes, and

he common Fy6 epitope which has been preciselyapped to the sequence Gln21-Val27 of the Duffy anti-

en (13). There are several lines of evidence that the-terminal domain of the Duffy antigen carries ma-

aria and chemokine-binding sites (14–16). However,he chemokine binding site seems to be more complex,ince the close association of the 1st (N-terminal) do-ain and the 4th extracellular domain (3rd external

oop) of DARC is required for chemokine binding (15).It is difficult to study the isolated Duffy antigen,

ince this protein has a strong tendency to aggregate in

0006-291X/00 $35.00Copyright © 2000 by Academic PressAll rights of reproduction in any form reserved.

solution (17–20). However, it was shown that chemo-kergsnbdpDmtpp

M

GGmMwtIpS(pMvhc(XfF

wwraap

Tp1dcpt

T(wli

protein. The final construct, consisting of 183 bp encoding the Fyb

pwpvs

bTfip

Tlp(lSeafspa

t(wFtswn(lF

1wsbst(b(st

w0b25(itwtIs

Vol. 273, No. 2, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ines bind with a similar high affinity to a receptor onrythrocytes and to the 47-kDa glycoprotein of eryth-ocyte membranes (later identified as the Duffy anti-en) solubilized in nonionic detergent (21). In order totudy binding properties of the extracellular N-termi-al domain of the Duffy antigen, we applied a recom-inant protein approach. In this communication weescribe the expression and purification of chimericroteins containing the N-terminal domain of theuffy antigen (Fya or Fyb, aa 3–60), C-terminal frag-ent of glycophorin A (aa 104–131) and hexahistydyl

ag. Binding of monoclonal antibodies and IL-8 to theseroteins was examined with the use of the microtiterlate ELISA.

ATERIALS AND METHODS

Materials. Monoclonal mouse antibodies i3A (anti-Fy6, epitopeln21-Val27) (13), and 4E4 (anti-GPA cytoplasmic tail, epitope Ser119-lu124) (22) were kindly provided by Dr. D. Blanchard, and humanonoclonal antibody 5T72A (anti-Fya) was obtained from Drs. M.artin and J. Andre (23). IL-8 and anti-IL-8 biotinylated antibodyere from R&D, 125I-IL-8 was from Amersham. Alkaline phospha-

ase-conjugated antibodies, goat anti-mouse Ig and goat anti-humang, were from Bio-Rad. ExtrAvidin/alkaline phosphatase, and phos-hatase substrates (Sigma 104 Tablets and BCIP/NBT) were fromigma. The pcDNA3 vector containing cDNA encoding the Duffy

Fyb) protein was obtained from Dr. S. C. Peiper (14). The GPA(M)-SG5 vector, containing cDNA encoding human glycophorin A-type, was obtained from Dr. S. L. Spitalnik (24). The pComb3H

ector was obtained from Scripps Research Clinics (25). The vectoras been modified by adding a double-stranded oligonucleotide en-oding six histidine residues, a C-terminal glycine, and a stop codonpCom3HHis) (26). Restriction enzymes Eco R1, Hind III, Nar I,ba I, Bam HI, Nhe I, Klenow enzyme and T4 ligase were purchased

rom Gibco BRL. Spe I was from New England Biolab, Xho I was fromermentas, Taq polymerase was from Perkin Elmer Cetus.

Plasmid construction. The pComb3HHis vector was digestedith Eco RI-Xba I in order to remove light chain stuffer, overhangsere filled with Klenow enzyme, and the resulting blunt ends were

eligated. The fragment of the Duffy protein cDNA, encoding aminocid residues 3–60 of the longer isoform, was amplified by polymer-se chain reaction, using FybpcDNA3 as a template and the followingrimers:

Fyb-59-primer: ccgctcgagtcctctgggtatgtcctcccaggFyb-39-primer: cccttcgaacatccagcaggttacaggagtgg

he restriction sites: Xho I and Hind III are underlined. The PCRroduct was digested with Xho I and Hind III and the resulting83-bp fragment was ligated to the pBluescript vector, previouslyigested with Xho I and Hind III. The fragment of glycophorin ADNA, encoding amino acid residues 104–131, was amplified byolymerase chain reaction, using GPA-M-pSG5 as a template andhe following primers:

GPA-59-primer: gggaagcttctgatgtaaaacctctccccGPA-39-primer: cgccctaggcgatcgttgatcacttgtctctgg

he restriction sites: Hind III (in the 59primer), Bam HI and Nhe Iin the 39-primer) are underlined. The PCR product was digestedith Hind III and Bam HI and the resulting 93-bp fragment was

igated into Hind III-Bam HI sites of the pBluescript vector contain-ng the cDNA fragment encoding N-terminal domain of the Fyb

706

rotein fragment fused with 93-bp fragment of glycophorin A cDNA,as cut out from pBluescript with Xho I and Nhe I and ligated intoComb3HHis vetor, previously digested with Xho I and Nhe I. Suchector, designated Fyb-GPA-pComb3HHis, was used for the expres-ion of the Fyb protein.The Fya cDNA was constructed using a polymerase chain reaction-

ased method of site-directed mutageneis by overlap extension (27).o achieve this, two fragments of the Fyb-GPA cDNA were ampli-ed using Fyb-GPA-pComb3HHis as a template, and the followingrimers:

Fya-59-primer (i): aaatgaaatacctattgcctFya-39-primer (i): caggttggcgccatagtctccatctggFya-59-primer (ii): gactatggcgccaacctggaagcagctFya-39-primer (ii): cagagccaccaccggaaccgc

he primers: Fya-39-(i) and Fya-59-(ii) introduced a Nar I site (under-ined) at amino acid positions 44–45 of the Fyb protein. The PCRroduct (i) was digested with Xho I and Nar I, while the PCR productii) was digested with Spe I and Nar I. Both PCR products wereigated into pComb3HHis vector, previously digested with Xho I andpe I. The vector, designated Fya-GPA-pComb3HHis, was used forxpression of the Fya protein, in which Asp44 present in the Fyb

ntigen was changed into Gly present in Fya. All constructed cDNAragments were sequenced by dideoxy method using Sequenase 2.0equencing kit (Amersham, UK) and the following universal pComb3rimers: aaatgaaatacctattgcct (59-primer) and aaacggctaaagccggata-gg (39-primer).

Expression and purification of soluble recombinant Fy/GPA pro-eins. The methods used closely followed those described earlier26, 28). Briefly, bacteria (Escherichia coli SURE cells) transformedith the vectors encoding soluble hexahistidine-tagged recombinanty/GPA protein, were cultured in the presence of isopropyl-D-hiogalactopyranoside, an inducer of recombinant protein(s) expres-ion. The bacteria were then collected, and the periplasmic proteinsere released by osmotic shock. The hexahistidine-tagged recombi-ant Fy/GPA proteins were purified on nickel nitrilotriacetic acidNi-NTA) as described previously (26, 28). The fractions were ana-yzed by dot-blotting with the MoAb i3A, and fractions containingy/GPA protein were collected and concentrated by ultrafiltration.

SDS–PAGE and Western blotting. SDS–PAGE was performed in5% polyacrylamide gels (29). Proteins were visualized in the gelsith Coomassie Brilliant Blue R-250, or were transferred from un-

tained gels to an Immobilon P membrane (30). The membrane waslocked for 1 h at room temperature with TBS containing 5% bovineerum albumin and 0.1% Tween-20 (Bio-Rad). The bands were de-ected by consecutive incubations with the MoAbs i3A and 4E4,overnight at 4°C), the alkaline phosphatase-conjugated goat anti-ody against mouse Ig for (1 h at room temperature) and BCIP/NBTSigma) as a phosphatase substrate. For the dot blotting, 10 mlamples were applied onto nitrocellulose membrane which was thenreated as Immobilon P blots.

The microtiter plate ELISA. Maxisorp microtiter plates (Nunc)ere coated with 50 ml of recombinant protein solution (20 mg/ml) in.06 M carbonate buffer of pH 9.6 overnight at 4°C. The plates werelocked for 1 h at room temperature with TTBS (TBS/0.05% Tween0) containing 5% bovine serum albumin. After washing with TTBS,0 ml samples of either primary antibodies (i3A, 4E4, 5T72A) or IL-8at concentrations of up to 5 mg/ml) were added to the wells andncubated for 2 h at room temperature, or overnight at 4°C, respec-ively. The plates were washed with TTBS, and incubated eitherith an appropriate secondary alkaline phosphatase-conjugated an-

ibody (anti-mouse Ig or anti-human Ig), or with biotinylated anti-L-8 antibody (1 h), and then with ExtrAvidin/alkaline phosphataseolution. After 1 h incubation, the plates were washed four times and

iS9d

VicfsmIfycMb

iKATp

R

rNpo(pwrXfdwssaF1

tai

Vol. 273, No. 2, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ncubated with p-nitrophenyl phosphate (Sigma 104 Phosphataseubstrate 5-mg Tablets) dissolved in 0.05 M carbonate buffer of pH.6, containing 1 mM MgCl2 (1 tablet/5 ml). The absorbance wasetermined at 405 nm in a microtiter plate reader.

Binding of IL-8 to erythrocytes. Erythrocytes were treated withibrio cholerae sialidase (Serva), trypsin, chymotrypsin and papain

n a routine way. For de-N-glycosylation, 2% suspension of erythro-ytes in PBS was incubated with 2 U/ml of N-glycanase, (Genzyme)or 2 h at 37°C. Untreated and treated erythrocytes (100 ml of 1%uspension in PBS) were incubated with 125I-IL-8 (200,000 cpm/20l) for 1 h at 4°C in the presence or absence of 100 nM unlabeledL-8. The incubation was terminated by separating erythrocytesrom the buffer by centrifugation through a mixture of dibuth-lphthalate and bis-ethylexylphthalate (1:1.1, v/v) (31). The nonspe-ific binding was less than 2% of the total 125I-IL-8 added. Binding ofoAbs to untreated and enzyme treated erythrocytes was measured

y the Coombs test.

Mass spectrometry analysis. Matrix-assisted laser-desorptiononization (MALDI) mass spectrometry was run on the Kratosompact SEQ time of flight (TOF) instrument (Schimadzu Kratosnalytical, U.K.) using a-cyano-4-hydroxycinnamic acid as a matrix.he spectrometer was operated at 20 kV accelerating voltage withulsed extraction optimized for ions of 10000 Da.

FIG. 1. Nucleotide and deduced amino acid sequence of the Fya/

ype. The numbering of amino acid residues is according to Barbas annd Siebert and Fukuda (35) (glycophorin A). The amino acid residndicated by frame.

707

ESULTS

Plasmid construction, expression, and purification ofecombinant proteins. The plasmids encoding the-terminal portion of Fya or Fyb protein, fused withelB prokaryotic leader peptide, C-terminal fragmentf glycophorin A and oligohistydyl tag were constructedFig. 1). The alteration in the cDNA encoding the Duffyrotein fragment, which gave in effect the product inhich original Met-Ala sequence at positions 1–2 was

eplaced by Leu-Glu, was introduced to create theho I restriction site. The plasmids were used to trans-

orm E. coli SURE strain. The pelB leader peptideirects expressed proteins to the periplasmic space,here the leader sequence is cut off. The resulted fu-

ion proteins, denoted Fya/GPA and Fyb/GPA, con-isted of N-terminal extracellular domain of the Duffyntigen (aa 3–60) containing epitopes Fy6 and Fya oryb, respectively), C-terminal tail of glycophorin A (aa04–131) with 4E4 epitope, and hexahistydyl tag. The

A. The sequence of the secreted fusion protein is indicated in boldurton (25) (pelB leader peptide), Chaudhuri et al. (10) (Duffy protein)44, which is aspartic acid (gat) in Fyb and glycine (ggc) in Fya, is

b/GPd Bue

ic(

sNdsepedimmt;blp(

the Fy/GPA recombinant protein was obtained byMmFpnsFbpmpab

GaMtbFtepg

TMcbwatibbse

((F

w

Vol. 273, No. 2, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

mmunoreactive tags allowed identification of the re-ombinant proteins by respective antibodies, and aHis)6 sequence served for their purification.

Periplasmic proteins were isolated, and after exten-ive dialysis, the fusion proteins were purified on thei-NTA agarose column, using a step gradient of imi-azole. The dot-blot analysis of the eluates showed thatmall amounts of the Fy/GPA proteins were alreadyluted with 10 mM and 20 mM imidazole, but a majorortion was eluted with 50 mM imidazole. In furtherxperiments the preparations eluted with 50 mM imi-azole were used. CBB-stained SDS–PAGE gels andmmunoblotting of purified fusion proteins showed a

ajor band (reacting with the MoAbs i3A and 4E4)igrating at approximately 19-kDa (Fig. 2). However,

he calculated molecular mass of the fusion proteins is10.6 kDa. This difference is not due to glycosylation,ecause proteins expressed in E. coli are not glycosy-ated. The unusually slow mobility for recombinantrotein expressed in E. coli was observed by others32). Direct evidence confirming the molecular mass of

FIG. 2. SDS–PAGE of 50 mM imidazole fraction of the Fyb/GPA.A) Coomasie Blue staining. (B) Immunoblotting with the i3A MoAbthe same pattern was obtained with MoAb 4E4). Results for theya/GPA were similar.

FIG. 3. Binding of serially diluted monoclonal antibodies anti-Fyells of ELISA plates coated with Fya/GPA and Fyb/GPA.

708

ALDI mass spectrometry. By this method the twoajor ions were observed of m/z ;10707 and ;9971 foryb/GPA, and for ;10649 and ;9913 Fya/GPA, accom-anied by lower molecular mass peaks, and no compo-ents of higher molecular mass were present. Ob-erved difference of 58 Da between Fyb/GPA andya/GPA mass values corresponds to the differenceetween masses of different amino acid residues atosition 44 (Asp or Gly, respectively, Fig. 1). The lowerolecular mass component of Fy/GPA recombinant

rotein is probably a truncated form lacking severalmino acid residues. This result can explain the twoands observed on the blot (Fig. 2B).

Binding of antibodies to recombinant proteins. Fya/PA and Fyb/GPA reacted similarly in ELISA withnti-Fy6 MoAb i3A and anti-GPA cytoplasmic tailoAb 4E4 (Fig. 3), which indicated that epitopes for

hese antibodies are expressed at the same level inoth recombinant proteins. A strong reaction of anti-ya MoAb 5T72A with Fya/GPA and a negligible reac-ion with Fyb/GPA indicated the presence of the Fya

pitope only on Fya/GPA. These results confirmed theroper effect of the site-directed mutagenesis, whichave transformation of the Fyb into Fya antigen.

Binding of IL-8 to de-N-glycosylated erythrocytes.he binding of the radiolabeled IL-8 and the 5T72AoAb to untreated and enzymatically treated erythro-

ytes was compared. The similar binding pattern ofoth reagents and their binding to erythrocytes treatedith trypsin (which does not digest the Duffy antigen),nd the lack of binding after treatment with chymo-rypsin and papain (both digest the Duffy antigen)ndicated that IL-8, similarly as the 5T72A MoAb, wasound specifically to the Duffy antigen. The radiola-eled IL-8 was also bound to erythrocytes, treated withialidase and N-glycanase (Fig. 4). The effectiveness ofrythrocyte treatment with N-glycanase was confirmed

T72A), anti-Fy6 (i3A) and anti-C terminal tail of GPA (4E4) to the

a (5

bDbrg

Btrsscfnp

D

Nsmrmb

findings indicating that the chemokine bindingp(ebTbFscsitaartepcNg

sDieatsftsTDbtacbtm

A

SMtvovm

R

ecdei(t

Vol. 273, No. 2, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

y finding the change of electrophoretic mobility of theuffy antigen (from 43 kDa to 32 kDa) in Westernlotting with the use of the i3A MoAb (not shown). Thisesult indicated that binding of IL-8 to the Duffy anti-en was independent of the antigen glycosylation.

The lack of binding of IL-8 to recombinant proteins.inding of the chemokine to recombinant proteins was

ested by the plate ELISA and by the microtiter plateadioimmunoassay using 125I-IL-8. In these assaysome unspecific binding of IL-8 to the plates was ob-erved, but after introducing proper controls, no spe-ific binding of IL-8 to the recombinant proteins wasound. In addition, our constructs (at 500 mg/ml) didot inhibit the binding of radiolabeled IL-8 to Duffyositive erythrocytes (not shown).

ISCUSSION

Localization of a chemokine binding site in the-terminal domain of the Duffy antigen was initially

uggested by inhibition of the binding by anti-Fy6onoclonal antibodies. The results presented in this

eport indicate that nonglycosylated N-terminal do-ain of the Duffy antigen is not sufficient for IL-8

inding. Our results are in agreement with earlier

FIG. 4. Binding of 125I-IL-8 and 5T72A MoAb to untreated andnzymatically treated erythrocytes. A 100 ml sample of 2% erythro-yte suspension was incubated with 200,000 cpm of 125I-IL-8 and theifference between 125I-IL-8 binding in the presence or absence of anxcess of unlabeled IL-8 is shown. Erythrocytes were also tested byndirect hemagglutination with the use of the human MoAb anti-Fya

5T72A) and anti-human IgG antibodies. For other details see Ma-erials and Methods.

709

ocket of Duffy includes sequences located in the 1stN-terminal) and 4th (the 3rd loop, carrying the Fy3pitope) extracellular domains (ECDs) which arerought into close vicinity by a disulfide bridge (15).his conclusion resulted from inhibition of chemokineinding to erythrocytes not only by anti-Fy6 and anti-ya/b antibodies, but also by anti-Fy3, and from theite-directed mutagenesis, including replacements ofysteine residues. Recently reported new results of theite-directed mutagenesis analysis of the Duffy antigenndicated that in addition to the disulfide bond betweenhe 1st and 4th ECDs, a disulfide bond between the 2ndnd 3rd ECDs is also required for the creation of anctive chemokine-binding pocket (33). Moreover, theesults of Asn/Ala substitutions at potential N-glycosyla-ion sites of the Duffy antigen showed, similarly as ourxperiments, that its chemokine binding site is inde-endent of N-glycosylation (33). These data allow toonclude that the lack of binding of IL-8 to the soluble-terminal Duffy domain is not due to the lack of itslycosylation.Despite the lack of chemokine binding, the obtained

oluble constructs containing the N-terminal domain ofuffy were shown to be useful target antigens for stud-

es on antibodies recognizing their linear peptidicpitopes. It allows to assume that a change in aminocid sequence at position 1 and 2 of recombinant pro-ein, did not affect its binding properties. Moreover aimilar change, was introduced to recombinant Fabragments, and did not result in any change in proper-ies (26, 34). Another possible application of our con-tructs are studies on the binding of malaria parasites.he character of Plasmodium vivax binding site ofuffy seems to be not so complex as the chemokine-inding site, since the synthetic peptide correspondingo the sequence of amino acids 10–34 of the Duffyntigen inhibited the binding of erythrocytes to COSells transfected with region II of the P. vivax Duffy-inding protein (16). Therefore, our constructs andheir potential mutation products may be applied forapping the binding site of malaria parasites.

CKNOWLEDGMENTS

We gratefully thank Dr. D. Blanchard (Etablissement de Transfusionanguine, Nantes, France) for the i3A and 4E4 antibodies, Drs. M.artin and J. Andre (Sanofi, Diagnostic Pasteur, Marnes, France) for

he 5T72A antibody, Dr. S. C. Peiper (University of Louisville, Louis-ille, KY) for the FybpcDNA3 vector, and Dr. S. L. Spitalnik (Universityf Rochester Medical Center, Rochester, NY) for the GPA(M)pSG5ector. This work was supported by Grant 6P04A 05509 of the Com-ittee for Scientific Studies (K.B.N.), Warsaw.

EFERENCES

1. Hadley, T. J., and Peiper, S. C. (1997) From malaria to chemo-kine receptor: The emerging physiologic role of the Duffy bloodgroup antigen. Blood 89, 3077–3091.

2. Cartron, J. P., Bailly, P., Le Van Kim, C., Cherif-Zahar, B.,

1

1

1

1

1

1

1

binding Plasmodium vivax and P. knowlesi malarial parasites to

1

1

1

2

2

2

2

2

2

2

2

2

2

3

3

3

Vol. 273, No. 2, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Mattassi, G., Bertrand, G., and Colin, Y. (1998) Insights into thestructure and function of membrane polypeptides carrying bloodgroup antigens. Vox Sang. 74, 29–64.

3. Wasniowska, K., and Hadley, T. J. (1994) The Duffy blood groupantigen: An update. Trans. Med. Rev. 4, 281–286.

4. Horuk, R., Chitnis, C. E., Darbonne, W. C., Colby, T. J., Rybicki,A., Hadley, T. J., and Miller, L. H. (1993) A receptor for malarialparasite Plasmodium vivax: The erythrocyte chemokine recep-tor. Science 261, 1182–1184.

5. Darbonne, W. C., Rice, G. C., Mohler, M. A., Apple, T., Hegert,C. A., Valente, A. J., and Baker, J. B. (1991) Red blood cells area sink for interleukin 8, a leukocyte chemotaxin. J. Clin. Invest.88, 1362–1369.

6. Hadley, T. J., Lu, Z. H., Wasniowska, K., Martin, A. W., Peiper,S. C., Hesselgesser, J., and Horuk, R. (1994) Poscapillary venuleendothelial cells in kidney express a multispecific chemokinereceptor that is structurally and functionally identical to theerythroid isoform, which is the Duffy blood group antigen.J. Clin. Invest. 94, 985–990.

7. Peiper, S. C., Wang, Z., Neote, K., Martin, A. W., Showel, H. J.,Conklyn, M. J., Ogborne, K., Hadley, T. J., Lu, Z. H., Hessel-gesser, J., and Horuk, R. (1995) The Duffy antigen/receptor forchemokine (DARC) is expressed in endothelial cells of Duffynegative individuals who lack the erythrocyte receptor. J. Exp.Med. 181, 1311–1317.

8. Chaudhuri, A., Nielsen, S., Elkjaer, M. L., Zbrzezna, V., Fang, F.,and Pogo, O. (1997) Detection of Duffy antigen in the plasmamembranes and caveolae vascular endothelial and epithelialcells of nonerythroid organs. Blood 89, 701–717.

9. Iwamoto, S., Li, J., Omi, T., Ikemoto, S., and Kajii, E. (1996)Identification of a novel exon and spliced form of Duffy mRNAthat is predominant transcript in both erythroid and postcapil-lary endothelium. Blood 87, 378–385.

0. Chaudhuri, A., Polyakova, J., Zbrzezna, V., Williams, K., Gu-latti, S., and Pogo, A. O. (1993) Cloning of glycoprotein D cDNA,which encodes the major subunit of the Duffy blood group systemand the receptor for the Plasmodium vivax malaria parasite.Proc. Natl. Acad. Sci. USA 90, 10793–10797.

1. Iwamoto, S., Omi, T., Kajii, E., and Ikemoto, S. (1995) Genomicorganization of the glycoprotein D gene: Duffy blood group Fya/Fyb alloantigen system is associated with a polymorphism at the44-amino acid residue. Blood 85, 622–626.

2. Mallinson, G., Soo, K. S., Schall, T. J., Pisacka, M., and Anstee,D. J. (1995) Mutations in the erythrocyte chemokine receptor(Duffy) gene: The molecular basis of the Fya/Fyb antigens andidentification of a deletion in the Duffy gene of an apparentlyhealthy individual with the Fy (a2b2) phenotype. Br. J. Haema-tol. 90, 823–829.

3. Wasniowska, K., Blanchard, D., Jauvier, D., Wang, Z. X., Peiper,S. C., Hadley, T. J., and Lisowska, E. (1996) Identification of theFy6 epitope recognized by two monoclonal antibodies in theN-terminal extracellular portion of the Duffy antigen receptorfor chemokines. Mol. Immunol. 33, 917–923.

4. Lu, Z., Wang, Z., Horuk, R., Hesselgesser, J., Yan-chun, L.,Hadley, T. J., and Peiper, S. C. (1995) The promiscuous chemo-kine binding profile of the Duffy Antigen/Receptor for chemo-kines is primarily localized to sequences in the amino-terminaldomain. J. Biol. Chem. 270, 26239–26245.

5. Tournamille, C., Le Van Kim, C., Gane, P., Blanchard, D., Proud-foot, A. E., Cartron, J. P., and Colin, Y. (1997) Close associationof the first and fourth extracellular domains of the DuffyAntigen/Receptor for chemokines by a disulfide bond is requiredfor ligand binding. J. Biol. Chem. 272, 16274–16280.

6. Chitnis, C. E., Chaudhuri, A., Horuk, R., Pogo, A. O., and Miller,L. H. (1996) The domain on the Duffy blood group antigen for

710

erythrocytes. J. Exp. Med. 184, 1531–1536.7. Lisowska, E., Duk, M., and Wasniowska, K. (1983) Duffy anti-

gens: Observation on biochemical properties. In Red Cell Mem-brane Glycoconjugates and Related Genetic Markers (Cartron,J. P., Rouger, P., and Salmon, C., Eds.), pp. 87–96, LibrairieArnette, Paris.

8. Chaudhuri, A., Zbrzezna, V., Jonson, C., Nichols, M., Rubinstein,P., Marsh, W. L., and Pogo, A. O. (1989) Purification and char-acterization of erythrocyte membrane protein complex carryingDuffy blood group antigenicity. J. Biol. Chem. 264, 13770–13774.

9. Hadley, T. J., David, P. H., McGinniss, M. H., and Miller, L. H.(1984) Identification of an erythrocyte component carrying theDuffy blood group Fya antigen. Science 223, 597–599.

0. Wasniowska, K., Eichenberger, P., Kugele, F., and Hadley, T. J.(1993) Purification of a 28 kD non-aggregating tryptic peptide ofthe Duffy blood group protein. Biochem. Biophys. Res. Commun.192, 366–372.

1. Horuk, R., Colby, T. J., Darbonne, W. C., Schall, T. J., and Neote,K. (1993) The human erythrocyte inflammatory peptide (chemo-kine) receptor. Biochemical characterization, solubilization, anddevelopment of a binding assay for soluble receptor. Biochemis-try 32, 5733–5738.

2. Rasamoelisolo, M., Czerwinski, M., Bruneau, V., Lisowska, E.,and Blanchard, D. (1997) Fine characterization of a series of newmonoclonal antibodies directed against glycophorin. Vox Sang.72, 185–191.

3. Martin, M., Andre, J., Chaude, J., Petit Le Roux, Y., Blanchard,D., and Willets, W. (1998) Characterization and evaluation of ahuman IgG monoclonal antibody against the Fya (Fy1) bloodgroup antigen. Vox Sang. 74, abstr. 1477.

4. Remaley, A. T., Ugorski, M., Wu, N., Litzky, L., Burger, S. R.,Moore, S. J., Fukuda, M., and Spitalnik, S. L. (1991) Expres-sion of human glycophorin A in wild type and glycosylation-deficient Chinese hamster ovary cells. J. Biol. Chem. 266,24176 –24182.

5. Barbas, C. F., and Burton, D. R. (1994) Cold Spring HarborCourse on Monoclonal Antibodies from Combinatorial Libraries:Course Materials, Cold Spring Harbor Laboratory Press, ColdSpring Harbor.

6. Czerwinski, M., Siemaszko, D., Siegel, D. L., and Spitalnik, S. L.(1998) Only selected light chains combine with a given heavychain to confer specificity for a model glycopeptide antigen.J. Immunol. 160, 4406–4417.

7. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease,L. R. (1989) Site-directed mutagenesis by overlap extension us-ing the polymerase chain reaction. Gene 77, 51–56.

8. Wojczyk, B. S., Czerwinski, M. E., Stwora-Wojczyk, M. M., Sie-gel, W. H., and Spitalnik, S. L. (1996) Purification of a secretedrecombinant form of rabies virus glycoprotein: Comparison oftwo affinity tags. Protein Exp. Purif. 7, 183–193.

9. Laemmli, U. K. (1970) Cleavage of structural proteins duringthe assembly of the head of bacteriophage T4. Nature 227,680 – 685.

0. Towbin, H., Staehelin, T., and Gordon, J. (1979) Electroforetictransfer of proteins from polyacrylamide gel to nitrocellulosesheets: Procedure and some applications. Proc. Natl. Acad. Sci.USA 76, 4350–4354.

1. Alexander, E. L., Titus, J. A., and Segal, D. M. (1979) Humanleukocyte Fc (IgG) receptors: Quantitation an affinity with ra-diolabeled affinity cross-linked rabbit IgG. J. Immunol. 123,295–302.

2. Stone, M. J., Ruf, W., Miles, D. J., Edgington, T. J., and Wright,P. E. (1995) Recombinant soluble human tissue factor secreted

by Saccharomyces cereviviae and refolded from Escherichia coli

3

34. Czerwinski, M., Krop-Watorek, A., Siegel, D. L., and Spitalnik,

3

Vol. 273, No. 2, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

inclusion bodies: Glycosylation of mutants, activity and physicalcharacterization. Biochem. J. 310, 605–614.

3. Le van Kim, C., Tornamille, R., Dryselius, C., Sylva-Lages, P.,Cartron, J. P., and Colin, Y. (1999) Partial site-directed mu-tagenesis analysis of the Duffy antigen/receptor for chemokines.Blood 94, 189a, Abstr. 823.

711

S. L. (1999) A molecular approach for isolating high-affinity Fabfragments that are useful in blood group serology. Transfusion39, 363–371.

5. Siebert, P. M., and Fukuda, M. (1996) Isolation and characteri-sation of human glycophorin A cDNA clones by a syntheticstructure. Proc. Natl. Acad. Sci. USA 83, 1665–1669.