Eur. J. Biochem. IY3 , 319-324 (1990) 0 FEBS 1990

Expression of three plant glutamine synthetase cDNA in Escherichia coli Formation of catalytically active isoenzymes, and complementation of a glnA mutant

Malcolm BENNETT and Julie CULLIMORE Department of Biological Sciences, University of Warwick, Coventry, England

(Received March 28/June 8, 1990) - EJB 90 0346

Three cDNA clones encoding the closely related glutamine synthetase (GS) a, p and y polypeptides of Phaseolus vulgaris (French bean) were recombinantly expressed in Escherichia coli. The GS expression plasmids correctly synthesised the recombinant a, /3 and y polypeptides which then assembled into catalytically active homo-octameric isoenzymes. These isoenzymes behaved similarly to their native homologues on ion-exchange and gel-filtration chromatography. Furthermore, the M and y isoenzymes complemented a GS(g1nA)-deficient mutant, thus demon- strating their physiological activity in E. coli. Differences were observed between the three recombinant GS plasmids in their quantitative expression of the GS polypeptides and their ability to complement the E. coli mutant. These differences were correlated to the degree of solubility of the polypeptide, which was observed to be dependent on the temperature of expression. The production of active GS isoenzymes in E. coli facilitates the isolation and characterisation of the individual P . vulgaris homo-octameric GS isoenzymes.

Glutamine synthetase (GS) catalyses the ATP-dependent formation of glutamine from glutamate and ammonium. In higher plants, GS is responsible for the assimilation of am- monium released from a number of diverse metabolic path- ways in a variety of organs, such as photorespiration in leaves, nitrate reduction in roots or leaves, and in legumes, dinitrogen fixation in root nodules (Miflin & Lea, 1980).

GS has been most extensively characterised from enteric bacteria where a single gene (glnA) encodes a GS polypeptide of 52 kDa, which assembles into a dodecameric enzyme of 600 kDa. The regulation of enteric GS has been particularly well characterised featuring both transcriptional control and regulation of the enzyme by feedback inhibition and covalent modification by adenylylation (Reitzer & Magasanik, 1987). In contrast to enteric GS, higher plant GS is encoded by a number of genes which direct the synthesis of multiple GS polypeplides that assemble into octameric isoenzymes of 380 kDa (Coruzzi et al., 1988; Forde & Cullimore, 1989). In the legume Phaseolus vulgaris L. (French bean) four actively transcribed nuclear genes (gln-a,,gln-p, gln-y and gln-6 encode three cytosolic GS polypeptides (termed M , p and y) and a precursor to the plastid GS (6) polypeptide. Each gene exhibits marked differences in organ and developmental expression patterns. For example, gln-y is expressed at high levels in the root nodule, and to a lesser extent in cotyledons, stems and petioles, and gln-6 is predominantly expressed in 'green tissue (see Fosde & Cullimore, 1989, for a review). However, little is known about the assembly, kinetic characteristics and regu- lation of the individual GS isoenzymes. Attempts to purify and characterise the respective clg , pS and y8 cytosolic

Correspondence to M. J. Bennett, Department of Biological Sci-

Abbreviations. GS, glutamine synthetase; GS,, GS transferase

Enzymes. Glutamine synthetase, L-glutamate: ammonia ligase

ences, University of Warwick, Coventry, CV4 7AL, England

activity; 1,B medium, Luria-Bertani medium.

(ADP-forming) (EC 6.3.1.2).

isoenzymes are complicated by the ability of the cytosolic GS polypeptides to assemble, perhaps randomly, to produce hetero-octamers if they are expressed in the same cell at the same time (Bennett & Cullimore, 1989).

DasSarma et al. (1986) and Snustad et al. (1988) have demonstrated the feasibility of expressing single plant GS cDNA in E. coli to produce active recombinant GS enzymes. In an attempt to isolate P . vulgaris homo-octameric GS isoenzymes, individual plant GS cDNA have been expressed in E. coli. The following describes the cloning, expression and complementation studies performed using three plant GS cDNA, pcGS-ctl and pcGS-pl (Gebhardt et al., 1986) and pcGS-yl (Bennett et al., 1989) in an E. coli gZnA mutant. Such a system allows us to study in isolation the assembly of the plant GS enzyme, and facilitates the characterisation of the kinetic properties and differences between the individual P. vulgaris homo-octameric GS isoenzymes.

MATERIALS AND METHODS Materials

Reagents were obtained from the following sources. Re- striction endonucleases, E. coli DNA polymerase large frag- ment (Klenow fragment), phage T4 DNA Iigase and bio- tinylated protein-A/streptavidin-linked horse radish peroxi- dase were purchased from Amersham, UK. Calf intestinal alkaline phosphatase was obtained from Boehringer- Mannheim. Ampicillin, nalidixic acid, tetracycline and 4- chloro-1 -naphthol were from the Sigma Chemical Company. ATP and dNTP were purchased from Pharmacia P-L Bio- chemicals. All other chemicals were reagent grade.

Strains, plasmids, media and growth conditions Recombinant strains and plasmids are listed in Table 1.

Recombinant colonies were grown either on Luria-Bertani

3 20

Table 1. Ructeriul strain5 and plusmids ~~

E coli strain Dcscriplion or plasmid

Reference

ET8894 ET8894/cI ts

pEV3

pcGS-ctl

pcGS-[jl

pcGS-y 1

pcCS-ExZ

PcCS-Efll

pcGS-E,sl

pDCl pRK248cIts

~~~~~ ~~~ ~~ ~~~~ ~ ~~ ~~

rhs IucZ : IS1 gyrA hutC, (glnA-ntrC) ET8894 containing pRK248cIts

Ap'; E. coli expression plasmid containing a i, PL promoter and restriction sites for trans- lational fusion

Ap'; GS cDNA encoding the c( GS polypeptide in pucX

Ap'; GS cDNA encoding the p GS polypeptide in pUC8

Ap'; GS cDNA encoding the y GS polypeptide in pUCl9

Ap'; GS ct cDNA cloned into pEV3

Ap'; GS f l cDNA cloned into pEV3

Ap': GS 7 cDNA cloned into pEV3

Ap' Tc'; pHR325 containing the glnA gene from M . capsulutus (Bath) Tc' ; low copy number plasmid compatible with pBR322 derivatives, encoding a tem- perature sensitive cI repressor

MacNeil et al. (1981) this study

Crowl et al. (1 985)

Gebhardt et al (1986)

Gebhardt et a1 (1986)

Bennett et al (1989)

this study

thi5 study this study

Cardy & Murrcll (1990)

Bernard & Helinski (1979)

(LB) medium plates containing ampicillin (100 pg/ml), or for the complementation analysis they were grown on M9 mini- mal medium plates containing ampicillin and nalidixic acid (20 pgjml), with or without a glutamine supplement (250 pg/ ml) at 30°C. For liquid culture, recombinant cells were grown at 30'C in LB medium with ampicillin until late log phase. Alternatively, temperature induced expression was obtained by initially growing cultures at 30°C in LB medium with ampicillin and tetracycline until reaching an A600 of 0.5, then increasing the growth temperature to 42°C for a further 2 h.

Cons tr uc t ion ?f plasm ids

The P. vulgaris GS cDNA pcGS-al, pcGS-PI (Gebhardt et al., 1986) and pcGS-yl (Bennett et al., 1989) were cloned into the pEV3 expression plasmid. pcGS-a1 was initially restricted with BgZII then partially digested with HindIII. A 1300-bp BgZII-Hind111 fragment was isolated and cloned into the pEV3 BamHI site via a three-way ligation involving an ad- ditional BamHI ~ HindIII pUC19 polylinker fragment. A plasmid with the desired insert orientation was named pcGS- E d . pcGS-pl was digested with BglII then partially cleaved with BamHI. A 1400-bp BgnI -BamHI DNA fragment was gel purified and cloned into the pEV3 BamHI site, and a plasmid containing the insert in the correct orientation was isolated and termed pcGS-EP1. Double-stranded M13mp18/ cGS-yl DNA containing the complete pcGS-yl cDNA insert was restricted with HincII, releasing a 1400-bp blunt-ended fragment that was gel isolated and cloned into the pEV3 ClaI site. The resulting plasmid with the correctly orientated insert was called pcGS-Eyl. All manipulations used standard meth- odology as described by Maniatis et al. (1982), and resulted in the in-frame fusion of the plant GS-cDNA-coding sequences downstream of the initiating ATG of the expression vector (see Fig. 1).

Preparation qf hataterial ce1Lfrc.e extracts

Bacterial cell pellets, taken from approximately 250 ml LB liquid media, were extracted using a French press in 2.5 ml GS extraction buffer (as described by Bennett & Cullimore, 1989). The homogenate was centrifuged in microfuge tubes in

a Beckman TLA-100.3 rotor at 108000 x g for 20 min. The supernatant was decanted from the pelleted cellular debris, and the latter washed with 0.5 ml GS extraction buffer at least twice, repelleting in a microfuge at 11 600 x g for 5 min. All procedures were carried out at 0 -4'C.

High-perjormance liquid chromatography The bacterial cell-free supernatant was desalted on a 5.0 ml

Sephadex G-50 column. The sample was then filtered through a 0.2-pm filter, made up to 2.5 ml total volume with GS running buffer (see Bennett & Cullimore, 1989), and 0.5 ml used for enzyme activity measurements and 2.0 ml used for chromatography on HPLC columns. Conditions used for ion- exchange chromatography and gel-filtration HPLC are as de- scribed by Bennett & Cullimore (1989) and Chen & Cullimore (1988), respectively.

Determination of enzyme activity Cell-free extracts were assayed for GS transferase (GS,)

activity as described by Cullimore & Sims (1980). Molecular mass markers were assayed as described by Cullimore et al. (1 983). Protein was determined by the method of Bradford (1976) and enzyme activities then expressed as nkat . mg pro- tein- '.

Gel electrophoresis and Western immunoblotting Protein samples were separated on one-dimensional 12.5%

SDSjPAGE according to the method of Laemmli (1970). Pro- teins were transferred to nitrocellulose sheets and GS polypep- tides colour visualised using an anti-GS antiserum (Cullimore & Miflin, 1983) in conjunction with biotinylated protein-Alstreptavidin peroxidase, as described by Bennett & Cullimore (1989).

RESULTS Complementation of an E. coli glnA mutant using re- combinantly expressedplant G S cDNA

Recombinant expression of P. vulgaris GS polypeptides was performed using the pEV3 vector (Crowl et al., 1985)

321

A I I I I I I

B pEV3 M N K N S D P S I

ATGAATAAGAATTCG GATCCATCG ATA t L

pcGS-uVpcGS-Pl pcGS-11 M S L S D D L I N M S S I S D L V N

ATGTCNYTGCTYTCA GATCTCATCAAC ATGTCATCAATCTCCGATCTTGTT AAC L 1

pcGS-Egl M N K N S D P S N

1' pcGS-Eul/pcGS-Epl

M N K N S D L I N ATGAATAAGAATTCGGATCTCATCAAC ATGAATAAGAATTCGGATCCATCGAAC

Fig. 1. Construction of pcGS-Ed, pcGS-Ebl andpcGS-Eyl expression plasmids. (A) DNA manipulations used to clone the P. vulguris pcGS- al , pcGS-jl and pcGS-yl cDNA sequences into the pEV3 expression plasmid. Restrictions sites that were directly used during cloning are indicated with an arrow. (B) N-terminal GS amino acid and nucleotide sequences prior to and following in-frame fusion to the bacterial translational signals from the pEV3 expression plasmid. Restriction sites are B, BamHI; Bg, BglII; C, CluI; E, EcoRI; H, HindIII; Hc, HincII

which features a A PL promoter, a Shine and Dalgarno se- quence with an ATG initiating codon, and an open reading frame containing EcoRI, BumHI and CluI restriction sites. Expression from the promoter can be regulated by a tempera- ture-sensi tive repressor encoded on a compatible tetracycline- resistant plasmid pRK248cIts (Table 1). In the presence of the repressor, expression can be induced at 42 "C. Alternatively, in the absence of the repressor, expression is constitutive. Recombinant expression plasmids pcGS-Eal , pcGS-EP1 and pcGS-Eyl were constructed by inserting the pcGS-a1 and pcGS-01 cDNA into the BurnHI site, and the pcGS-yl cDNA into the CluI filled-in site, of the pEV3 expression vector (see Fig. 1 A). The resulting translational fusions have either five (pcGS-Ed and pcGS-EP1) or eight (pcGS-Eyl) amino acids at the N-termini of the GS polypeptides exchanged for an equal number of vector encoded residues (Fig. 1 B). However, as the N-termini of GS polypeptides are poorly conserved (Forde & Cullimore, 1989) and are not considered to be near the active site of the enzyme (Eisenberg et al., 1987) it is considered unlikely that such minor N-terminal modifications will affect the catalytic activity of the enzyme.

To determine whether the recombinant products of the pcGS-Eal, pcGS-EP1 and pcGS-Eyl expression vectors were

functional in E. coli, each plasmid was transformed separately into the glnA deletion mutant strain ET8894, which is a gluta- mine auxotroph (see Table 1). In addition, plasmids pEV3 and pDCl [a pBR325-based plasmid containing the Meth- ylococcus capsulutus (Bath) glnA gene (Cardy & Murrell, 1990)] were also transformed separately into ET8894, thus providing negative and positive controls for complementation analysis, respectively. Transformants were streaked out on to minimal media containing ammonium as the nitrogen source, in the absence or presence of a glutamine supplement. Com- plementation enabling growth on ammonium was clearly observed for ET8894 transformants containing either pcGS- Ecll or pcGS-Eyl, together with the positive control pDC1, whereas pEV3-transformed ET8894 was unable to grow in the absence of glutamine (Fig. 2). The incubation temperature .was observed to be of importance for successful complementa- tion. Strains containing either pcGS-Eal and pcGS-Eyl plasmids were complemented most effectively below 37 "C (having growth optima of approximately 30 "C), whereas the pDCl plasmid, encoding a thermotolerant bacterial GS, ef- fected greater growth at higher temperatures (data not shown). In contrast to the results using pcGS-Ed and pcGS-Eyl, no stable transformants of ET8894 containing pcGS-EP1 could

322

Table 2. Activities of recombinant G S enzymes in E. coli n.d., not detected

+gln - gln

Fig. 2. Compleii~eiiiatioti of the glnA mutant ET8894. Cultures of ETX894 containing either pcGS-Ex1 (A), pcGS-Eyl (G), pEV3 (V) or pDCl (D) were streaked on to an ammonium minimal medium with (+) or without (-) a glutaminc supplement, and incubated at 30°C

7, P'

-L5

-31

-20 1 2 3 L

Fig. 3. Western iinniunorki~tec.tion uf recombinant a , /J' andy GSpolypep- tides in E. coli. Soluble extracts of temperature-induced ET8894/cIts cxpressing pcGS-Ezl, pcGS-ED1 and pcGS-Eyl were assayed for GS, activity. Approximately 1500 nkat nodule (1) and recombinant CS tc (2), /J' (3) and y (4) enzyme activity was separated on a 12.5% SDS/ PAGE gel. and the GS polypeptides visualised by Western immunodetection. The positions of the nodule 1 and y GS polypep- tides, and the molecular mass markers (ovalbumin, 45 kDa; carbonic anhydrase, 31 kDa: soybean trypsin inhibitor, 20 kDa) are indicated

be isolated. either in the absence or presence of a glutamine supplement. However, stable transformants of ET8894 con- taining pcGS-EP1 could be obtained if the pcGS-EP1 plasmid was transformed into a strain containing pRK248cIts (ET8894/clts). and cultured in nutrient-rich media at the non- expressing temperature of 30 "C.

Strains of ET8894jclts containing either pcGS-Eal or pcGS-Eyl were also isolated, thus enabling the temperature- induced regulation of expression of the three recombinant GS products to be studied. Soluble extracts from these strains and pEV3 were analysed by SDSjPAGE and Coomassie blue staining, but no bands of the expected size for GS were visible in the GS recombinants (data not shown). However, when employing the more sensitive Western immunodetection method using a plant anti-GS antiserum, recombinant a, P and y GS polypeptides with apparent molecular masses com- parable with their native GS polypeptides were detectable (Fig. 3). Thus the GS expression plasmids were being correctly transcribed and translated, but the polypeptides were not ac- cumulating to the expected abundance.

E. coli Expression Tempera- GS specific Active GS host plasmid ture of activity

expression

C

ET8894/ pEV3 42 CIts PcGS-EMl 42

PCGS-E~I 42 pcGS-E/l 42

ET8894 pEV3 30 pcGS-Eal 30 pcGS-Eyl 30

nkatimg protein

TI. d. 5.20 1.56 0.27

n.d. 63.43 6.00

moleculelcell

n .d . 5700 1500 430

n.d. 70 000

9500

-31

-20 1 2 3 L 5 6 1 2 3 L

A B

Fig. 4. Determination of GS polypeptide solubility in relation to ex- pression temperature. Extracts of E. coli expressing the GS polypep- tides by temperature induction in ET8894/cIts at 4 2 T (A) or consti- tutively at 30'C in ET8894 (B), were separated into soluble (odd numbers) and insoluble (even numbers) fractions. (A) pcGS-Ed ( I .

(3,4). Approximately 300 pg soluble protein and an equal fraction of insoluble material was loaded onto a 12.5% SLISiPAGE gel, and the GS polypeptides visualised by Western immunodetection (n. b. 3 mg protein was loaded in the case of ET8894,kIts expressing pcCS-Eyl). Molecular mass markers are as described in Fig. 3

2); pcGS-Eb1 (3,4); ~CGS-E)J I (5,6); (B) pcCS-Eal (1,2); pcCS-Eyl

The solubility ojrecombinantly expressed GS is rrlrrted to the temperature of expression

Measurements of GS, activity from temperature-induced samples of ET8894/cIts identified that only strains harbouring either pcGS-Eal, pcGS-EP1 or pcGS-Eyl, but not pEV3, contained assayable levels of activity (Table 2). However. the specific activities obtained varied widely between the ET8894/ cIts-; pcGS-Eal, pcGS-EP1 and pcGS-Eyl containing strains. In addition, far greater activity values could be obtained from ET8894 expressing GS constitutively at 30 "C. The differences were in the order of 12-fold and 23-fold for pcGS-Eal and pcGS-Ey I, respectively.

These variations in specific activity were found to reflect differences in the solubility of the recombinant GS products. Soluble and insoluble fractions of extracts of the above strains were examined by SDSjPAGE and Western immunodetection (Fig. 4). It was observed that the recombinant K, and 7 polypeptides were mainly insoluble when expressed in ET8894/cIts at 42°C. In contrast, !x and y polypeptides were coinpletely soluble when expressed constitutively in ET8894 at 30°C. Furthermore, the 7 polypeptide had an approxi- mately 20-fold higher abundance (and the x polypeptide a 10-fold higher abundance) at 30 C, relative to 42"C, thus correlating with the observed differences in specific activity

323

c ._ > ._ c

g o - ' I " " " "

25 i I \ 0

10 18 26 3 1 1 2 Fraction number

Fig. 5. Native molecular mass determination of the recombinant c1, P and y GS isoenzymes. Soluble extracts of temperature-induced ET8894/cIts expressing pcCS-Ed (a) or pcGS-El1 (b), and ET8894 expressing pcGS-Eyl (c) were separated by HPLC gel filtration and the eluted fractions assayed for GS, activity. All samples included an internal P-galactosidase control which consistently eluted at fraction 11 (designated by the thick arrow). Molecular mass calibration markers include thyroglobulin (670 kDa), /i'-galactosidase (540 kDa), ferritin (443 kDa), catalase (232 kDa), alcohol dehydrogenase (150 kDa) and haemoglobin (60 kDa). The position of elution of P. vulgaris root GS is also indicated (380 kDa)

obtained under these conditions (Table 2). Notably, the insol- uble fraction was inactive (data not shown), since no GS, activity could be detected from the pellet. Thus, the apparent specific activity of plant GS expressed in E. coli was related to the abundance of the polypeptide and the degree of solubility.

Physical characterisation of the recombinant G S enzymes

Crude soluble extracts were prepared from ET8894 ex- pressing pcGS-Ey 1, or ET8894jcIts expressing pcGS-Ep1 or pcGS-Eal , and were analysed by HPLC gel filtration (Fig. 5) . All three recombinant a, p and y GS enzymes eluted as single peaks of activity in about the same position as GS activity isolated from P. vulgaris roots. The molecular masses of the enzymes in comparison to markers (Fig. 5 ) were about 380 kDa, in agreement with previously published values for octameric plant GS (Cullimore et al., 1983). Fractions contain- ing proteins of lower molecular masses were Western blotted but no GS polypeptides were detected (data not shown), thus suggesting that all the soluble GS polypeptides had assembled into the higher molecular mass octamers.

The crude extracts containing recombinant GS, were further analysed using HPLC ion-exchange chromatography. This technique has been shown to separate the native a, p and y P . vulgcwis GS isoenzymes, which elute at the positions indicated (Fig. 6; Bennett & Cullimore, 1989). Such analysis resolved each recombinant GS enzyme into a single peak of activity each of which eluted at a different position from the column (Fig. 6). The pcGS-Eyl-encoded GS activity eluted in

10

-- 5

u o : r; 10

C 0 ._ 1

L

Y t I

x 5 c ._ > ._ c

g o

c3 10

5

- ln

0

x_; j::: ,. 0.1

0.2

0.1 5 15 25 35 1 5 0

Fraction number

Fig. 6. 6 exchange chromatographic characterisation of the re- combinan, ' S isoenzymes. Soluble extracts prepared from tempera- ture induc ET8894/cIts expressing pcGS-Ed (a) or pcGS-ED1 (b), and ET88! expressing pcGS-Eyl (c), were fractionated by ion-ex- change HP ' and the eluted fractions assayed for GS, activity. Elu- tion positio for the analogous native rig, ps and ys isoenzymes are marked by i 3ws. (- - - -) KC1 gradient used for elution

the same pc ion as the analogous native GS y isoenzyme on the void voL.ie of the column. However, the enzyme products of pcGS-Eal and pcGS-Ej1 both eluted approximately five fractions prior to the elution position of their analogous native a and p isoenzymes. Such differences are consistent with the engineered introduction of one positively charged lysine residuejsubunit, into the N-terminal sequences of the GS- coding regions during the original DNA manipulations (see Fig. 1 B).

DISCUSSION

We have reported the successful expression of three related plant GS cDNAs encoding the a, p and y GS polypeptides of P. vulgaris in E. coli. SDSjPAGE and Western immunodetection analysis of these recombinant polypeptides has identified that they are synthesised as the correct molecular mass (Fig. 3). Furthermore, each GS polypeptide was able to assemble into an octameric isoenzyme of about 380 kDa (Fig. 5 ) , which retained ion-exchange chromatographic characteristics com- parable to its native a, j or y homologues (Fig. 6). We can conclude, therefore, firstly that each plant cytosolic GS poly- peptide can successfully assemble into a homo-octameric form in the absence of other related GS polypeptides, and secondly, that they must do so without the aid of any special plant assembly factors. However, we cannot rule out the possibility that an endogenous E. coli assembly protein, such as groEL which has a homologue in plants (Hemmingsen et al., 198S), may be substituting for a plant factor.

Complementation studies have shown that two of the re- combinantly expressed plant GS polypeptides form physio- logically active enzymes in E. coli and can integrate into its nitrogen-assimilatory pathways (Fig. 2) . Similarly, both

324

DasSarma et al. (1986) and Snustad et al. (1988) have also observed such complementation. Furthermore, Snustad et al. (1 988) have used complementation as a powerful genetic screen to isolate a number of plant GS cDNA from a cDNA library. However, our observation that pcGS-Ectl and pcGS- Eyl, but not pcGS-EB1. were able to complement the ET8894 glnA mutant suggests that cloning by complementation may not obtain a representative population of GS cDNA.

This variable ability to complement an E. coliglnA mutant, and the large differences in the specific activities of the three recombinant GS isoenzymes in E. coli (Table 2), were surpris- ing since the GS sequences are very similar with amino acid identities between 85.7% and 89.6% (Forde & Cullimore, 1989). However, large differences in activity have also been observed by other groups attempting to recombinantly express closely related cDNA sequences encoding isoenzymes (Lozoya et al., 1988; Schultz et al., 1989). In our system we have shown that the specific activity of recombinant GS in E. coli appears to be related to GS polypeptide abundance and its degree of solubility (Fig. 4), and that both these factors are related to the expression temperature (Table 2). For example, the GS y polypeptide abundance and enzyme activity were approxi- mately 20-fold higher at 30°C relative to 42°C. In addition, the GS y polypeptide was completely soluble at 30 ”C, whereas at 42°C the y polypeptide was approximately 50% insoluble. Temperature-dependent protein solubility has also been ob- served for a number of other recombinantly expressed proteins including the ricin A chain (O’Hara et al., 1989) and a hepatitus-B-virus-surface-antigen - j-galactosidase fusion protein (Lee et al., 1990). Lee et al. (1990) have proposed that it is the folding intermediate, not the mature protein, that yields insoluble aggregates, and have postulated that higher temperature could lead to instability of the folding intermedi- ate, favouring ‘off-pathway’ folding and eventual aggregation. Clearly the reason for the insolubility of foreign proteins in E. coli needs to be investigated further.

The aim of our work is to determine whether the GS isoenzymes, encoded by the divergent GS genes, have kinetic differences. We are particularly interested in determining whether there is a functional relationship between kinetic properties of the isoenzymes and their tissue localisation. It has been shown that GS genes in P. vulgaris are expressed in different organs and cell types (Forde & Cullimore, 1989; Forde et al., 1989). Whether this represents a regulatory ad- vantage at the transcriptional level or a metabolic advantage in expressing kinetically different GS isoenzymes, needs to be determined. The successful recombinant expression of the P. vulgaris GS isoenzymes in E. coli will help us address this question.

We are grateful to Dr D.A. Lightfoot (Department of Horticul- ture. University of Oregon, Corvallis) for helpful discussion. M. J. B. gratefully acknowledges receipt of a studentship and post-doctoral

grant from the Science and Engineering Research Council and a post- doctoral grant from thc Agriculture and Food Research Council.

REFERENCES Bennett, M. J. & Cullimore, J. V. (1989) Plunta (Berl.) 179, 433-440. Bennett, M. J., Lightfoot, D. A. & Cullimore, J. V. (1989) Plant. Mol.

Bernard, H.-U. & Helinski, D. R. (1979) Methods Enzynzol. 68,482-

Bradford, M. M. (1976) Anal. Biochem. 72.248-254. Cardy, D. L. N. & Murrell, J. C. (1990)J. Gen. Microhiol. 136,343-352. Chen, F.-L. & Cullimore, J. V. (1988) Plant Phj~siol. 88. 1411 - 1417. Coruzzi, G. M., Edwards, J. W., Tingey, S. V., Tsai, F.-Y. &Walker,

E. L. (1988) in The molecular basis uf plant development (Goldberg, R., ed.) pp. 223-232, A. R. Liss Tnc.. New York.

Crowl, R., Seamans, C., Lomedico, P. & McAndrew, S. (1985) Gene

Cullimore, J. V. & Sims, A. P. (1980) Planta (Berl.) 150. 392-396. Cullimore, J. V., Lea, P. J. & Miflin, B. J. (1983) Plantu (Bed . ) 157,

Cullimore, J. V. & Miflin, B. J. (1983) FEBS Lett. 158, 107- 112. DasSarma, S., Tischer, E. & Goodman, H. M. (1986) Science 232,

Eisenberg, D., Almassy, R. J., Janson, C. A., Chapman, M. S., Suh, S. W., Cascio, D. & Smith, W. W. (1987) Cold Spring Harbor Symp. Quant. B id . L11,483-490.

Forde, B. G., Day, H. M., Turton, J. F., Shen, W.-J., Cullimore, J . V. & Oliver, J. E. (1989) Plant Cell 1, 391 -401.

Forde, B. G. & Cullimore, J. V. (1989) in Oxford surveys of plant molecular and cell hiolugy (Miflin, B. J., ed.) pp. 247-296, Oxford University Press, Oxford.

Gebhardt, C. G., Oliver, J. E., Forde, B. G., Saarlainen, R. & Miflin,

Hemmingsen, S. E., Woolford, C., van der Vies. S. M., Tilly, K., Dennis, D. T., Georgopoulos, C. P., Hendrix, R. W. & Ellis, R. J. (1988) Nuture33-3, 330-334.

Bid . 12, 553 - 565.

492.

38, 31 - 38.

245 -253.

1 242 - 1244.

B. J . (1986) EMBO J . 5, 1429-1435.

Laemmli, U. K. (1970) Nature 227. 680-685. Lee, S. C., Choi, Y. C. & Yu, M.-H. (1990) Eur. J . Biochem. 187.

Lozoya, E., Hoffman, H., Douglas, C., Schultz, W., Scheel, D. &

Maniatis, T., Fritsch, E. & Sambrook, J . (1982) Molecular cloning: a

MacNeil, D. (1981) J. Bacteriol. 146, 260-268. Miflin, B. J. & Lea, P. J. (1980) in The biochemistry ojplants (Miflin.

B. J . ed.) vol. 5, pp. 169-202, Academic Press, New York. O’Hare, M., Roberts, L. M.. Thorpe, P. E., Watson, G. J., Prior, B. &

Lord, J. M. (1987) FEBS Lett. 216, 73-78. Reitzer, L. J. & Magasanik, B. (1987) in Escherichia coli and Salmon-

ella typhimurium cellular and molecular biology (Neidhardt, F. C., eds) pp. 302-320, American Society for Microbiology, Washington.

Schultz, W., Eiben, H.-B. & Hahlbrock, K. (1989) FEBS Lett. 258,

Snustad, D. P., Hunsperger, J. P., Chereskin, B. M. & Messing, J .

41 I - 424.

Hahlbrock, K. (1988) Eur. J . Bioclzem. 176, 661 -667.

laboratory manual, Cold Spring Harbor, New York.

335-338.

(1988) Genetics 120, 11 11 - 1124.