expression patterns of sirtuin genes in porcine preimplantation embryos and effects of sirtuin...

g

(dssd1iif(gCssee©

Available online at www.sciencedirect.com

Theriogenology 78 (2012) 1597–1610

0h

Expression patterns of sirtuin genes in porcine preimplantationembryos and effects of sirtuin inhibitors on in vitro embryonic

development after parthenogenetic activation and in vitro fertilization

Seong-Sung Kwak, Seung-A Cheong, Junchul David Yoon, Yubyeol Jeon, Sang-Hwan Hyun*Laboratory of Veterinary Embryology and Biotechnology, College of Veterinary Medicine, Chungbuk National University, Chungbuk,

South Korea

Received 24 April 2012; received in revised form 6 July 2012; accepted 6 July 2012

Abstract

We examined the expression patterns of porcine sirtuin 1 to 3 (Sirt1–3) genes in preimplantation embryos derived from partheno-enetic activation (PA), in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT). We also investigated the effects of sirtuin

inhibitors (5 mM nicotinamide [NAM] and 100 �M sirtinol) on embryonic development of PA and IVF embryos under in vitro cultureIVC). The expression patterns of Sirt1–3 mRNA in preimplantation embryos of PA, IVF, and SCNT were significantly (P � 0.05)ecreased from metaphase stage of oocyte to blastocyst stage. Especially, the expressions of Sirt1–3 in SCNT blastocysts wereignificantly (P � 0.05) lower and Sirt2 in PA blastocyst was significantly higher compared with the IVF blastocysts. Treatment withirtuin inhibitors during IVC resulted in significantly (P � 0.05) decreased blastocyst formation and total cell number of blastocysterived from PA (NAM: 29.4% and 29.6, sirtinol: 31.0% and 30.3, and control: 40.9% and 41.7, respectively) and IVF embryos (NAM:0.4% and 30.9, sirtinol: 6.3% and 30.5, and control: 16.7% and 42.8, respectively). There was no significant difference in cleavage raten both PA and IVF embryos. The early and expanded blastocyst formations at Day 7 were significantly lower in the sirtuinnhibitors-treated groups than the control. It was demonstrated that sirtuin inhibitor (NAM) influenced the percentage of blastocystormation and total cell number of PA derived blastocyst when NAM was added during Day 4 to 7 (22.1% and 32.4) or Day 0 to 723.1% and 31.6) of IVC compared with the control (41.8% and 41.5). No significant difference in cleavage rates appeared among theroups. The blastocysts derived from PA embryos treated with sirtuin inhibitors showed lower (P � 0.05) expressions of POU5F1 anddx2 genes. Also, Sirt2 mRNA expression was significantly decreased in sirtinol treated group and Sirt3 mRNA expression was also

ignificantly decreased in both NAM and sirtinol treated groups compared with the control. In conclusion, these results suggest thatirtuins may have a physiological and important role in embryonic development of porcine preimplantation embryos by regulatingssential gene expressions of developing embryos. These findings could have implications for understanding the role of sirtuins duringmbryo development and for improving SCNT and related techniques.

2012 Elsevier Inc. All rights reserved.

Keywords: Sirtuins; Porcine embryo; Nicotinamide; Sirtinol; In vitro culture

www.theriojournal.com

* Corresponding author. Tel.: �82 43 261 3393; fax: �82 43 2673150.

E-mail address: [email protected] (S.-H. Hyun).

093-691X/$ – see front matter © 2012 Elsevier Inc. All rights reserved.ttp://dx.doi.org/10.1016/j.theriogenology.2012.07.006

1. Introduction

Livestock have been considered as useful biomedi-cal models for studying human physiology and disease.However, livestock reproduction using fertilized or
cloned embryos is still inefficient, mainly because of
mailto:[email protected]

www.theriojournal.com

http://dx.doi.org/10.1016/j.theriogenology.2012.07.006

bdctsp

tsistmvecr

t

2

2

aSU(wm�tc

2

owcfecCtg

hfma

2

stw

1598 S.-S. Kwak et al. / Theriogenology 78 (2012) 1597–1610

early developmental failure before and during implan-tation [1–3]. Although various bioactive factors, suchas leukemia inhibitory factor [4], granulocyte-macro-phage colony-stimulating factor [5], and vascular en-dothelial growth factor [6] have been proposed to affectpreimplantation embryo development, little is knownregarding the mechanisms underlying the effects ofintrinsic factors, such as sirtuins, in determining devel-opmental competence.

Recently, the sirtuins, nicotinamide (NAM) ade-nine dinucleotide-dependent protein deacetylase andadenosine diphosphate (ADP)-ribosyltransferase proteinwith homology to the yeast silent information regulator2, have been shown to be active in various biologicalevents, including gene silencing, cell metabolism,aging, apoptosis, and cell cycle regulation [7]. Inmammals, seven silent information regulator 2 homo-logues (Sirtuin 1–7 or Sirt1–7) have been identified. Theseproteins possess primarily histone deacetylase (Sirt1,Sirt2, Sirt3, and Sirt5) or monoribosyltransferase ac-tivity (Sirt4 and Sirt6) [8,9], which target histone andvarious nonhistone proteins in distinct subcellularlocations. Mammalian sirtuins are localized in thenucleus (Sirt1, Sirt6, and Sirt7), cytoplasm (Sirt2),and mitochondria (Sirt3, Sirt4, and Sirt5) [10].

In the mouse, all sirtuins are expressed in eggs andthe expression levels gradually decrease during preim-plantation development. Among the sirtuins, Sirt3plays a protective role against stress conditions duringin vitro fertilization and culture in preimplantation em-ryos [11]. Sirtuin inhibitors (NAM and sirtinol) causeevelopmental defects and increase the levels of mito-hondrial reactive oxygen species (ROS) in preimplan-ation embryos [11]. Additionally, NAM has beenhown to suppress blastocyst formation and subsequentostimplantation development [12].

A number of studies have been conducted to identifyhe physiologic functions and biological activities ofirtuins for human therapeutic purposes; however, lim-ted information is available regarding the effects ofirtuins on livestock embryonic development. Althoughhere have been several studies relating to sirtuins inouse embryos, studies have not been conducted in-

estigating porcine embryos. In the present study, thexpression patterns of sirtuin mRNA (Sirt1–3) in por-ine mature oocytes and preimplantation embryos de-ived from parthenogenetic activation (PA), in vitro

fertilization (IVF) and somatic cell nuclear transfer(SCNT) were investigated and compared for the firsttime. This study also investigated whether sirtuins
might serve as an important factor for the developmen- s
tal competence of porcine preimplantation embryos.We examined the effects of sirtuin inhibitor (NAM andsirtinol) treatment to in vitro culture (IVC) medium onthe development of porcine embryos after PA and IVF.Additionally, we observed the expression of a numberof transcription factors (PCNA, POU5F1, Cdx2, Bax,Bak, Bcl-2, Sirt1, Sirt2, and Sirt3) in PA-derived blas-ocysts.

. Materials and methods

.1. Chemicals

Unless otherwise indicated, all chemicals and re-gents used in the present study were purchased fromigma-Aldrich Chemical Company (St. Louis, MO,SA). Sirtinol was dissolved in dimethyl sulfoxide

DMSO) to make a 25.4 mM stock solution and NAMas dissolved in porcine zygote medium-3 (PZM-3) toake a 50 mM stock solution. Solutions were stored at20 °C until required, at which time they were added

o the embryo culture medium in specific amounts ac-ording to the experimental protocol.

.2. Oocyte collection and in vitro maturation

Retrieval and in vitro maturation (IVM) of porcineocytes, from local slaughterhouse-derived ovaries,ere performed as previously described [5]. Briefly, the

umulus oocyte complexes (COCs) were aspiratedrom superficial follicles that were 3 to 6 mm in diam-ter and matured in groups of 50 to 60 in 500 �L ofulture medium (TCM-199; Invitrogen Corporation,arlsbad, CA, USA) supplemented with 0.6 mM cys-

eine, 0.91 mM sodium pyruvate, 10 ng/mL epidermalrowth factor, 75 �g/mL kanamycin, 1 �g/mL insulin,

10% (vol/vol) porcine follicular fluid, 10 IU/mL equinechorionic gonadotropin, and 10 IU/mL hCG (Intervet,Boxmeer, Netherland). For IVM, the selected COCswere incubated at 39 °C in a humidified atmosphere of5% CO2 and 95% air. After 22 h of maturation withormones, the COCs were washed twice in hormone-ree IVM medium and cultured in hormone-free IVMedium for an additional 18 h (SCNT) and 22 h (IVF

nd PA).

.3. Donor cell preparation

Donor cell preparation was performed as previously de-cribed [6]. Briefly, fetal fibroblasts were isolated from fe-uses at Day 40 of gestation. Trypsinized fibroblast cells wereashed once by centrifugation at 300 X g for 10 min and

eeded into 100-mm plastic culture dishes. The seeded cells

wwn

U

m0

Pedua

2

awa

zcPTwf5

2

nstbebobtbb

1599S.-S. Kwak et al. / Theriogenology 78 (2012) 1597–1610

were cultured for 6 to 8 days in Dulbecco’s modified Eagle’smedium (Gibco, Grand Island, NY, USA) supplementedwith 10% (vol/vol) fetal bovine serum (Invitrogen), 1 mMsodium pyruvate, 1% (vol/vol) nonessential amino acids (In-vitrogen), and 10 mg/mL penicillin-streptomycin solution at37 °C in a humidified atmosphere of 5% CO2 and 95% air.Subculturing was performed at intervals of 5 to 7 daysby trypsinization for 2 min using 0.1% trypsin and0.02% EDTA. The cells were stored in freezing me-dium in liquid nitrogen after one passage. BeforeSCNT, the cells were thawed and subsequently culturedinto four-well culture plates and grown in 10% fetalbovine serum with Dulbecco’s modified Eagle’s me-dium for 3 to 4 days until 80% confluence. The indi-vidual cells were retrieved from the monolayer bytrypsinization and subsequently used for SCNT. Donorcells of the same passage (2 to 7 passages) were used ineach replicate for SCNT.

2.4. Micromanipulation for somatic cell nucleartransfer, fusion, and activation

After 40 h of IVM, denuded oocytes wereincubated for 5 min in manipulation medium (calci-um-free HEPES-buffered Tyrode’s medium [TLH]containing 0.4% [wt/vol] bovine serum albumin[TLH-BSA]) containing 5 �g/mL Hoechst 33342 and

ashed twice with fresh manipulation medium. Theashed oocytes were transferred into a drop of ma-ipulation medium containing 5 �g/mL cytochalasin

B. Oocytes were enucleated by aspirating the polarbody and metaphase (M)II chromosomes using a16-�m glass pipette (Humagen, Charlottesville, VA,

SA). After enucleation, a 14 to 15 �m trypsinizedfetal fibroblast with a smooth cell surface was trans-ferred into the perivitelline space of an enucleatedoocyte using a fine injecting pipette. The coupletswere equilibrated with a 280 mM mannitol solutioncontaining 0.001 mM CaCl2 and 0.05 mM MgCl2

[13] for 2 to 3 min and transferred to a fusionchamber containing two electrodes overlaid withmannitol solution. Membrane fusion was induced byapplying an alternating current of 2 V cycling at 1MHz for 2 sec, followed by two pulses of 160 V/mmdirect current for 60 �sec using a cell fusion gener-ator (LF101; NepaGene, Chiba, Japan). Fusedoocytes were washed three to four times with TLH-BSA. After 1 h, the oocytes were evaluated for mem-brane fusion under a stereomicroscope prior to acti-
vation. d
2.5. PA of oocytes

Reconstructed oocytes were activated with twopulses of 120 V/mm direct current for 60 �sec in 280

M mannitol solution containing 0.1 mM CaCl2 and.05 mM MgCl2. For PA, oocytes that reached the MII

stage at 44 h of IVM were activated using the sameprocedures used to activate the SCNT oocytes. Follow-ing electrical activation, the SCNT and PA embryoswere treated with 2 mM 6-dimethylaminopurine and0.4 �g/mL demecolcine and 5 �g/mL cytochalasin B in

ZM-3 for 4 h, respectively [13]. The SCNT and PAmbryos were washed three times in fresh IVC me-ium, transferred into 30 �L IVC droplets of mediumnder mineral oil, and cultured at 39 °C in a humidifiedtmosphere of 5% O2, 5% CO2, and 90% N2 for 7 days.

.6. In vitro fertilization and culture

IVF and IVC were performed according to Kwak etl. [5]. Briefly, the denuded oocytes were coincubatedith fresh sperm of 5 � 105/mL for 20 min at 39 °C inhumidified atmosphere of 5% CO2 and 95% air. After

a 20 min coincubation with the sperm, the looselyattached sperm were removed from the zona pellucidaby gentle pipetting. The oocytes were then washedthree times in modified Tris-buffered medium and in-cubated in modified Tris-buffered medium withoutsperm for 5 to 6 h at 39 °C in a humidified atmo-sphere of 5% CO2 and 95% air. Thereafter, putativeygotes were washed three times with the embryoulture medium and cultured in 30 �L microdrops ofZM-3 [14] according to the experimental design.he embryos in the culture medium were coveredith prewarmed mineral oil and incubated at 39 °C

or 168 h (Day 7) under a humidified atmosphere of% O2, 5% CO2, and 90% N2.

.7. Embryo evaluation and total cell count

The day that PA or IVF was performed was desig-ated as Day 0. The embryos were evaluated under atereomicroscope for cleavage on Day 2 (48 h). Blas-ocyst formation was assessed at Day 7 (168 h), andlastocysts were classified according to the degree ofxpansion and hatching status as follows [5]: earlylastocyst (small blastocyst with a blastocoel equal tor less than half of the embryo volume), expandedlastocyst (a large blastocyst with a blastocoel greaterhan half of the embryo volume or blastocyst with alastocoel completely filling the embryo), and hatchedlastocyst (hatching or already hatched blastocyst). To
etermine the total cell number of blastocysts at Day 7,

abcgsT

2

peeSneSttdtcmp


blastocysts were collected and washed in phosphatebuffered saline (PBS) containing 1% (wt/vol) BSA andstained with 10 �g/mL Hoechst 33342 for 5 min. After

final wash in PBS-BSA, the embryos were fixedriefly in 4% paraformaldehyde in PBS. The blasto-ysts were mounted on glass slides in a drop of 100%lycerol, gently squashed under a cover slip, and ob-erved using a fluorescence microscope (Nikon, Corp.,okyo, Japan) at magnification X 400.

.8. Gene expression analysis by real-time PCR

The expression patterns of Sirt1–3 mRNA in theorcine mature (MII stage) oocytes and preimplantationmbryos (two to three cells, four to five cells, six toight cells, and blastocysts) derived from PA, IVF, andCNT, and fetal fibroblasts (passages from three toine) were examined. Additionally, the expression lev-ls of PCNA, POU5F1, Cdx2, Bax, Bak, Bcl-2, andirt1–3 mRNA in PA-derived blastocysts treated or notreated with sirtuin inhibitors were analyzed using real-ime polymerase chain reaction (PCR), as previouslyescribed [5,6]. Briefly, total RNA was extracted fromhe mature oocyte, developing embryos, and blasto-ysts using Trizol reagent (Invitrogen), according to theanufacturer’s instructions. Complementary DNA was

repared by subjecting 1 �g of total RNA to reversetranscription using Moloney murine leukemia virus re-verse transcriptase (Invitrogen) and random primers(9-mers; Takara Bio, Inc., Otsu, Shiga, Japan). Quan-

Table 1Primers used for gene expression analysis.

Gene Primer sequences (5=–3=)

PCNA F: CCTGTGCAAAAGATGGAGTGR: GGAGAGAGTGGAGTGGCTTTT

POU5F1 F: GCGGACAAGTATCGAGAACCR: CCTCAAAATCCTCTCGTTGC

Cdx2 F: GGAACCTGTGCGAGTGGATGR: GCTCGGCCTTTCTCCGAATG

Bak F: GCGGAAAACGCCTATGAGTAR: GCAGTGATGCAGCATGAAGT

Bax F: TGCCTCAGGATGCATCTACCR: AAGTAGAAAAGCGCGACCA

Bcl-2 F: AGGGCATTCAGTGACCTGACR: CGATCCGACTCACCAATACC

Sirtuin3 F: GATCTGCTGCTCATCCTTGGR: AGAAGCTCCACCAGCCTTTT

Sirtuin2 F: AGGAGGCATGGACTTCGATTR: AAGCTGAAGTGGTGGGATTG

Sirtuin1 F: GGACAGTTCCAGCCATCTCTR: CCTCGTACAGCTTCACAGTCA

GAPDH F: GTCGGTTGTGGATCTGACCTR: TTGACGAAGTGGTCGTTGAG

titative real-time PCR (Mx3000P qPCR, Agilent Tech-

nologies, Santa Clara, CA, USA) was performed using1 �L of the complementary DNA template added to 10�L 2 � Sybr Premix Ex Taq (Takara Bio, Inc.) con-taining specific primers. The reactions were performedfor 40 cycles and the cycling parameters were as fol-lows: denaturation at 95 °C for 30 sec, annealing at55 °C (Sirt1–3 at 57 °C) for 30 sec, and extension at 72°C for 30 sec. All primer sequences are presented inTable 1. The expression of each target gene was quanti-fied relative to that of the internal control gene (GAPDH).The relative quantification was based on a comparison ofthreshold cycle (Ct) at constant fluorescence intensity. Therelative mRNA expression (R) was calculated using theequation, R � 2-[�Ct sample - �Ct control]. To determine anormalized arbitrary value for each gene, every value wasnormalized to that of GAPDH. The experiments wererepeated at least three times.

2.9. Experimental design

In experiment 1, the expression patterns of sirtuinmRNA (Sirt1–3) in the mature (MII stage) oocytes andporcine preimplantation embryos (two to three cells,four to five cells, six to eight cells, and blastocysts)derived from PA, IVF, and SCNT, and fetal fibroblasts(passages from three to nine) were evaluated and com-pared with mature oocytes. We obtained samples ofmature oocytes (150 MII oocytes per one sample) 44 hafter IVM, two- to three-cell embryos (60 to 70 em-bryos per sample) 24 h after IVC, four- to five-cell

Product size (base pair) GenBank accession number

187 XM_003359883

200 NM_001113060

168 CK_458871

189 XM_001928147

199 XM_003127290

193 NM_214285

194 NM_001110057

191 NM_001114271

200 NM_001145750

207 NM_001206359

embryos (35 to 40 embryos per sample) 48 h after IVC,

(ctlElSwo(1S(csileustatedPeecbc

3

acgtN(


six- to eight-cell embryos (25–30 embryos per onesample) 60 h after IVC and blastocysts (five to sixblastocysts per sample) 168 h after IVC. In experiment2, the effects of sirtuin inhibitors (5 mM NAM and 100�M sirtinol) during IVC on embryonic development ofPA and IVF embryos were examined. Experiment 3was conducted to investigate the embryonic stage atwhich the sirtuin inhibitor (5 mM NAM) affects the invitro embryo culture. Thus, four groups were estab-lished. After PA, embryos were cultured with NAM forDay 0 to 3 (early stage), Day 4 to 7 (late stage), Day 0to 7 (whole stage), and without NAM (control). Inexperiment 4, the effects of sirtuin inhibitor treatmentduring IVC on the mRNA expression levels of PCNA,POU5F1, Cdx2, Bax, Bak, Bcl-2, Sirt1, Sirt2, and Sirt3in PA-derived blastocysts was analyzed.

2.10. Statistical analysis

Each experiment consisted of at least three repli-cates, and in each replicate, oocytes were from the samegroup of slaughterhouse-derived ovaries collected onthe same day. Oocytes were randomly distributed ineach experimental group. Statistical analyses were per-formed using SPSS 17.0 software (SPSS, Inc., Chicago,IL, USA). Percentage data (e.g., rates of cleavage, blas-tocyst formation, and number of nuclei) were comparedusing a one-way analysis of variance (ANOVA), fol-lowed by Duncan’s multiple range test. Data were pre-sented as mean � SEM. Differences were considered tobe significant if the P value was less than 0.05.

3. Results

3.1. Expression patterns of Sirt1–3 mRNA in porcinemature oocytes and preimplantation embryos derivedfrom PA, IVF, and SCNT

To evaluate the possible involvement of sirtuins inporcine preimplantation embryo development and tocompare the expression patterns of sirtuin genes amongPA, IVF, and SCNT embryos, we first examined theexpression of the Sirt1–3 genes in porcine matureoocytes and preimplantation embryos (two to threecells, four to five cells, six to eight cells, and blasto-cysts) derived from PA (Fig. 1A), IVF (Fig. 1B), andSCNT (Fig. 1C). In mature oocytes and developingembryos of PA, IVF, and SCNT, the expression ofSirt1–3 mRNA was detected (Figs. 1 and 2). Addition-ally, the expression of Sirt1–3 mRNA in fetal fibro-blasts (Fig. 3), which were used as donor cells of
SCNT, was also examined. In PA and SCNT embryos, t
the expression patterns of Sirt1–3 mRNA were signif-icantly (P � 0.05) decreased as compared with matureoocytes during the blastocyst stage (Fig. 1A and C). Inthe IVF embryos, Sirt1 expression was significantlyP � 0.05) upregulated in the two-cell embryos asompared with the MII oocytes (Fig. 1B, Sirt1). Afterhe two-cell embryos, Sirt1 expression was downregu-ated following a distinct time course (Fig. 1B, Sirt1).xpression of Sirt2 was also significantly downregu-

ated except in the six- to eight-cell embryos (Fig. 1B,irt2). Expression of Sirt3 was significantly decreasedith distinct time courses (Fig. 1B, Sirt3). Expressionf Sirt1–3 mRNA in donor cells were significantlyP � 0.05) lower compared with the MII oocytes (Fig.C). Between PA and IVF embryos, the expression ofirt1 in PA-derived two-cell embryos was significantlyP � 0.05) lower as compared with IVF-derived two-ell embryos (compared by Student t test). The expres-ion of Sirt1–3 in SCNT-derived blastocysts and Sirt3n SCNT-derived four-cell embryos were significantlyower as compared with IVF embryos (Fig. 2A). Thexpression of Sirt2 in PA blastocysts was significantlypregulated compared with the IVF blastocyst. Ashown in Figure 2, the expression patterns of each ofhe Sirt1–3 genes differed at each developmental stagemong PA, IVF, and SCNT embryos. Expression pat-erns of Sirt1 and Sirt3 among PA, IVF, and SCNTmbryos during embryonic development were sharplyecreased, whereas Sirt2 was gradually decreased inA embryos as compared with the SCNT and IVFmbryos (Fig. 2B). In porcine fetal fibroblast cells,xpression of Sirt1 and Sirt2 showed no significanthanges according to the cell passages (three to nine),ut Sirt3 was significantly decreased in passage nineompared with passage three (Fig. 3).

.2. Effects of sirtuin inhibitors (5 mM NAM and 100�M sirtinol) treatment during IVC on embryonicdevelopment of PA and IVF embryos (experiment 2)

During IVC the rate of blastocyst formation and thetotal cell number in each blastocyst were significantlyreduced after the addition of the sirtuin inhibitors, al-though the percentage of cleaved embryos was not altered(Tables 2 and 3). The cleavage patterns at Day 2 after PAnd IVF differed among the groups. There were signifi-antly more two- to three-cell embryos in the NAMroup; concurrently, there were significantly fewer four-o five-cell embryos and six- to eight-cell embryos in theAM group as compared with the other groups after PA

Fig. 4A). Additionally, there were significantly fewer six-
o eight-cell embryos in the NAM group as compared with

3te

tu rs with


the other groups after IVF (Fig. 5A). Early and expandedblastocyst formation at Day 7 after PA and IVF weresignificantly lower in the sirtuin inhibitor treatment groupscompared with the control (Figs. 4B and 5B). However,no differences were observed in hatched blastocyst for-

Fig. 1. Sirt1–3 mRNA expression in porcine mature (metaphase II [MII]fertilized (B), and somatic cell nuclear transferred (C). MII oocytes amaturation (IVM) and in vitro culture (IVC) using parthenogenetic activafor each stage as follows: MII oocytes, two- to three-cell, four- to five-cealso collected (passages three to seven because we used donor cells in pcontrol. Relative quantification of Sirt1–3 mRNA levels was measuredhe SCNT graph, the exact number of replication of SCNT-derived embrndetectable in some samples. Within each group of end points, the ba

mation after PA and IVF (Figs. 4B and 5B). f

.3. Effects of 5 mM NAM according to the day ofreatment on embryonic development of PA porcinembryos (experiment 3)

As shown in Table 4, there was no significant dif-

oocytes and preimplantation embryos that were parthenotes (A), in vitromplantation embryos were collected for RNA sampling after in vitro), IVF, and somatic cell nuclear transfer (SCNT) at the appropriate time

o eight-cell embryos, and blastocysts. Porcine fetal fibroblast cells weretwo to seven for the SCNT). GAPDH expression served as an internal

time polymerase chain reaction (PCR). N, * Number of replications. Inarked as (n) in the bottom of the bar, as threshold cycle (Ct) values weredifferent letters A–D, are significantly (P � 0.05) different.

stage)nd preition (PAll, six- tassagesby real-yos is m

erence in the cleavage rate among the groups (P �

ea


0.05). However, the cleavage pattern differed accordingto the time of treatment: significantly more embryoswith two to three cells and fewer with four to eight cells

Fig. 2. Based on the results of Figure 1, the expression levels of Sirt1–activation (PA), IVF, and SCNT embryos (two to three cells, four to fi(A). The expression of Sirt1–3 mRNA in six to eight cells were rumbryos. The expression patterns of Sirt1–3 mRNA were shown in lre significantly (P � 0.05) different. * P � 0.035 (compared by St

embryos; BL, blastocysts.

Fig. 3. Sirt1–3 mRNA expression in porcine fetal fibroblasts (passage
the bars with different letters A and B, are significantly (P � 0.05) differen
were observed when the zygotes were cultured withNAM from Day 0 to 3 and Day 0 to 7 as compared withthe control and Day 4 to 7 groups (Fig. 6A). The rate of

A among the mature oocytes (metaphase II; MII) and parthenogenetics, and blastocysts) were reconstituted according to each Sirt1–3 genebecause of the low number of samples of SCNT six- to eight-cellithin each group of end points, the bars with different letters (a–c)

test). 2 cells, two- to three-cell embryos; 4 cells, four- to five-cells

nine). N, * Number of replications. Within each group of end points,

3 mRNve cell

led outine B. Wudent t

three to
t.

s

TE


blastocyst formation and the total cell number of blas-tocysts were significantly lower in the Day 4 to 7 andDay 0 to 7 NAM treatment groups compared with thecontrol and Day 0 to 3 groups (Fig. 6B). In addition,the blastocyst formation rate was significantly lower inthe Day 0 to 3 NAM treatment group, but there was nodifference in the total cell number of blastocysts com-pared with the control (Table 4).

3.4. Effects of sirtuin inhibitors treatment during IVCon gene expressions in the PA-derived blastocysts(experiment 4)

As shown in Figure 7, sirtuin inhibitors significantlydecreased the mRNA levels of POU5F1 (by NAM andirtinol treatment) and Cdx2 (by sirtinol treatment) in

PA-derived blastocysts, but had no effect on the mRNAexpression of Bak, Bcl-2, and PCNA. Bax transcriptlevels were also significantly lower in the NAM treatedgroup as compared with the control. Sirt3 mRNA levelswere significantly decreased in both the NAM andsirtinol treatment groups, but Sirt2 mRNA levels weresignificantly decreased in the sirtinol group comparedwith the control. However, there was no significantdifference in Sirt1 mRNA level among the groups.

Table 2Effect of sirtuin inhibitors on in vitro embryonic development after

Groups Embryoscultured, N*

Numbe

� Two-ce

Control 223 195 (87.5 �NAM‡ 230 204 (88.6 �Sirtinol§ 255 221 (86.5 �

Values with different superscript letters within a column differ signi* Five times replicated.† Number of examined blastocysts.‡ 5 mM nicotinamide.§ 100 �M sirtinol.

able 3ffect of sirtuin inhibitors on in vitro embryonic development after

Groups Embryoscultured, N*

Numbe

� Two-ce

Control 288 209 (71.2 �NAM‡ 269 190 (70.2 �Sirtinol§ 273 189 (69.5 �

Values with different superscript letters within a column differ signi* Five times replicated.† Number of examined blastocysts.‡ 5 mM nicotinamide.
§ 100 �M sirtinol.
4. Discussion

To our knowledge, the present study is the first toinvestigate the expression patterns of Sirt1–3 in porcinemature oocytes and preimplantation embryos using PA,IVF, and SCNT. It is also the first report investigatingthe effects of sirtuin inhibitors on embryonic develop-ment in porcine. Expression patterns and developmen-tal arrest by sirtuin inhibitors suggest that sirtuins arestrongly involved in porcine embryonic development.This study indicates that sirtuins, which are transcribedand stored during oocyte maturation, may play a role inthe upstream regulation of gene expression in the de-veloping embryos by regulating essential gene and apo-ptosis-related gene expression.

Sirt1–3 mRNAs were expressed in mature oocytes,fetal fibroblasts, and preimplantation embryos fromPA, IVF, and SCNT. The expression levels were sig-nificantly decreased during embryo development, asseen in mouse embryos [11], indicating that sirtuinswere transcribed and stored during oocyte maturation.Our unpublished data, which examined the expressionof Sirt1–3 in immature oocytes (germinal vesicle stage)compared with the mature oocytes, supported the find-

ogenetic activation of porcine oocyte.

f embryos developed to Total cell number inblastocyst (N)†Blastocyst

93 (40.9 � 1.2)a 41.7 � 1.4 (53)a

68 (29.4 � 0.9)b 29.6 � 1.2 (54)b

80 (31.0 � 2.1)b 30.3 � 1.2 (50)b

(P � 0.05).

fertilization of porcine oocyte.

f embryos developed to Total cell number inblastocyst (N)†Blastocyst

46 (16.7 � 2.0)a 42.8 � 2.8 (26)a

28 (10.4 � 1.1)b 30.9 � 1.4 (24)b

17 (6.3 � 1.1)b 30.5 � 2.0 (15)b

(P � 0.05).

parthen

r (%) o

ll

0.2)1.0)1.2)

ficantly

in vitro

r (%) o

ll

3.5)3.6)2.1)

ficantly

iSeIebefddewIb

bISiSiat

ominp

b AM, 5


ing that the expression of Sirt1–3 was significantlyncreased during oocyte maturation. Unlike PA andCNT, the increase of Sirt1 in IVF-derived two-cellmbryos might be caused by the penetration of sperm.n SCNT embryos, donor cells were injected into thenucleated oocyte. However, there was no differenceetween MII oocytes and the two-cell embryos. In PAmbryos, there was nothing to be inseminated; there-ore, Sirt1 expression in the two-cell embryos wasownregulated and significantly lower than the IVF-erived two-cell embryos. In PA-derived blastocysts,xpression of Sirt2 was significantly higher comparedith the IVF-derived blastocysts. Between SCNT and

VF embryos, the expression levels of Sirt1–3 in SCNT

Fig. 4. Effect of sirtuin inhibitors on embryo cleavage (A) and blastooocyte. The patterns of embryo cleavage (A) and blastocyst formatiothe bars with different letters (a and b) are significantly (P � 0.05)lastocyst; Frag, fragmented embryos; Hat BL, hatched blastocyst; N

lastocysts and Sirt3 in SCNT-derived four-cell em- d

ryos were significantly lower as compared with theVF embryos. The different expression patterns ofirt1–3 might be due to their specific localization: Sirt1s localized in the nucleus, Sirt2 in the cytoplasm, andirt3 in the mitochondria [10]. These findings alsondicate that different sources of embryos (PA, IVF,nd SCNT) might explain the different expression pat-erns of sirtuin genes during embryo development.

It is known that SCNT embryos show lower devel-pmental potential than IVF embryos because they areore vulnerable to the IVC conditions and may show

ncorrect epigenetic reprogramming of the donor celluclei [15,16]. Based on our experiments, aberrant ex-ression of Sirt1–3 may be one reason for the lower

mation (B) patterns after parthenogenetic activation (PA) of porcineere evaluated at Day 2 and 7, respectively. Within each end point,

nt among the groups. Ear BL, early blastocyst; Exp BL, expandedmM nicotinamide; Sirtinol, 100 �M sirtinol.

cyst forn (B) wdiffere

evelopmental competence seen in the SCNT embryos.

ups. A

t


Sirtuins are classified as a class III histone deacetylase,which is related to epigenetic reprogramming [7,17]. Inthe mouse, Sirt3 plays a protective role in preimplan-

Fig. 5. Effect of sirtuin inhibitors on embryo cleavage (A) and blasembryo cleavage (A) and blastocyst formation (B) were evaluated aletters (a and b) are significantly (P � 0.05) different among the gro

Table 4Effect of sirtuin inhibitor (nicotinamide) on in vitro embryonic devehe day.

Nicotinamidetreatment*

Embryoscultured, N†

No

� Two-

Control 194 174 (88.8 �Day 0–3 159 140 (88.1 �Day 4–7 162 143 (88.3 �Day 0–7 148 132 (88.9 �

Values with different superscript letters within a column differ signi* 5 mM nicotinamide.† Four times replicated.
‡ Number of examined blastocysts.
tation embryos against stress conditions during IVC[11]. Because Sirt3 is localized in the mitochondria[11,18] and involved in the regulation of mitochondrial

ormation (B) patterns after IVF of porcine oocyte. The patterns ofand 7, respectively. Within each end point, the bars with different

bbreviations are same as in Fig. 4.

t after parthenogenetic activation of porcine oocyte according to

f embryos developed to Total cell number inblastocyst (N)‡Blastocyst

82 (41.8 � 1.8)a 41.5 � 1.7 (37)a

51 (32.4 � 1.4)b 38.5 � 1.8 (40)a

36 (22.1 � 1.0)c 32.4 � 1.3 (30)b

35 (23.1 � 2.2)c 31.6 � 1.2 (32)b

(P � 0.05).

tocyst ft Day 2

lopmen

. (%) o

cell

2.2)1.2)1.3)2.2)

ficantly

mtccpsmS

bc

tfiapd


proteins, such as acetyl-CoA synthase 2 through itsdeacetylation activity [19], lower expression of Sirt3

ay cause the SCNT embryos to be more vulnerable tohe environmental conditions. Additionally, it has re-ently been postulated that the function of the mito-hondria, which are not only the site of oxidative phos-horylation and energy production, but also a majorource of ROS, is a possible determinant of develop-ental competence in preimplantation embryos [20].

Fig. 6. Effect of sirtuin inhibitor (nicotinamide) on cleavage (A) aporcine oocytes according to day. The patterns of embryo cleavrespectively. Within each end point, the bars with different leAbbreviations are the same as in Fig. 4.

irt2 also modulates stress resistance through Forkhead

ox O3 and plays a role in lipid metabolism and theellular response to oxidative stress [21].

Generally, the number of viable SCNT-derived blas-ocysts is improved if the donor cells are from fetalbroblasts as opposed to adult fibroblasts [22,23]. Inddition, the culturing of a donor cell line for longereriods of time in vitro generally results in decreasedevelopment to the blastocyst stage and to term [24]. In

our experiment, the expression of Sirt3 was signifi-

stocyst formation (B) patterns after parthenogenetic activation of) and blastocyst formation (B) were evaluated at Days 2 and 7,– c) are significantly (P � 0.05) different among the groups.

nd blaage (Atters (a

cantly decreased during the late cell passage (passage

ignifica


nine) compared with the early passage (passage three).Taken together, donor cells of early passage fetal fibro-blasts for SCNT would provide improved results ascompared with late passaged cells.

In the present study, we used 5 mM NAM and 100�M sirtinol, which are known as specific inhibitors ofsirtuins in mammalian cells [25,26] and embryos[11,27]. Sirtuin inhibitors, both of NAM and sirtinol,were shown to exhibit detrimental effects on the em-bryonic development of PA and IVF embryos. It wasalso evaluated that the same concentration of DMSOused in this study showed no significant differences inrates of embryos cleavage and blastocysts formation,and total cell number of blastocysts derived by parthe-nogenetic activation compared with the control group(data not shown). Specifically, they decreased (P �0.05) the formation rate of blastocysts at Day 7 and thetotal cell numbers present in the blastocysts. Theseresults are consistent with those of earlier studies in themouse in which sirtuin inhibitors (NAM, sirtinol, andBML-210) significantly increased intracellular ROSlevels and decreased blastocyst formation [11]. Addi-tionally, the blastocyst development and cell numbersin blastocysts were significantly reduced when Sirt1was inhibited by sirtinol in the mouse embryo [27]. Ithas been shown in Xenopus laevis that NAM inhibitsoocyte maturation [28]. Taken together, sirtuins arestrongly involved in porcine embryonic development.

Interestingly, treatment with NAM during IVCshowed a significantly different cleavage pattern in PAand IVF embryos as compared with the control andsirtinol groups. Treatment with NAM significantly de-

Fig. 7. Effect of sirtuin inhibitors on gene expression in blastocysts deWithin each end point, the bars with different letters (a and b) are s

layed the cleavage of PA and IVF embryos. Nicotin-

amide is known, not only as an inhibitor of sirtuins, butalso as an inhibitor of poly ADP-ribose polymerase,inducing cell death by apoptosis [29]. Additionally,NAM induces cell cycle (G2) arrest in various cell lines[30]. In Xenopus laevis, NAM inhibited oocyte matu-ration by increasing the intracellular level of cyclicadenosine monophosphate and by blocking the actionof maturation promoting factor [28]. It is also knownthat NAM has toxic effects in human epithelial cells viaan alternative mechanism, and not via Sirt1 inhibition[31]. Collectively, NAM may be involved in embryocleavage as well as having a role in sirtuin inhibition.

It has been demonstrated that sirtuin inhibition(NAM) is detrimental to embryonic development dur-ing the late preimplantation embryo stage (morula toblastocysts). Additionally, treatment with NAM dur-ing the early preimplantation embryo stage (Day 0 to3 of IVC) also showed detrimental effects on theblastocyst formation rate at Day 7, but there was nodifference in total cell numbers. Therefore, sirtuinsmay play an important role during the preimplanta-tion development of the embryo, especially the mo-rula to blastocyst stage.

Gene expression is one of the major events occur-ring during embryo development, and its perturbationin the culture system may contribute to the limitedproduction of high quality blastocysts [32,33]. Treat-ment by sirtuin inhibitors resulted in the downregula-tion of POU5F1, Cdx2, Bax, Sirt2, and Sirt3 in PA-derived blastocysts. It is well known that POU5F1 andCdx2 expression are essential for the early developmentof mouse and human embryos [34–36]. In the present

om parthenogenetic activated embryos. n* � Number of replications.ntly (P � 0.05) different among groups.

rived fr

study, lower expression of POU5F1 and Cdx2 might

csiIRqsTmb

capfitaHcSi

rw[isgIdtwtse(pptaahssBmmt

ptsbcceedcer

A

GR

R


cause detrimental effects on embryonic development.Additionally, Sirt2 and Sirt3 expression were signifi-antly decreased when the embryos were treated withirtuin inhibitors leading to harmful effects on the qual-ty and formation of blastocysts. In the mouse IVF andVC embryos, Sirt3 inactivation caused an increase inOS production, leading to p53 activation and subse-uent developmental arrest [11]. Additionally, Sirt3 is atress-responsive deacetylase in other cell types [37].herefore, Sirt3 may play an important role in deter-ining the developmental competence of porcine em-

ryos against stress-related conditions, such as IVC.PCNA is an essential component of the DNA repli-

ation and repair machinery [38] and has been used asparameter for the evaluation of the developmental

otential of bovine embryos [39]. In mouse and humanbroblasts, Sasaki et al. [40] found a significant posi-

ive correlation between the levels of Sirt1 and PCNA,DNA processing factor expressed during the S-phase.owever, in the present study, there was no significant

orrelation between Sirt1 and PCNA. The levels ofirt1 and PCNA decreased during treatment with sirtuinnhibitors, but the difference was not significant.

The Bcl-2 family consists of proteins that play keyoles in regulating apoptosis, and the Bcl-2 gene is aell-known antiapoptotic gene in oocytes and embryos

41]. Although expression of Bcl-2 was downregulatedn the sirtuin inhibitor-treated groups, there was noignificant difference. Bax is known as a proapoptoticene and is useful for evaluating embryo quality [42].nterestingly, despite the lower blastocyst quality andevelopmental arrest in sirtuin-inhibitor treated groups,he expression level of Bax was significantly decreasedhen NAM was treated. It was also demonstrated that

reatment of NAM during IVM of porcine oocytesignificantly downregulated Bax and POU5F1 mRNAxpression in mature oocytes compared with the controlunpublished data). The Bax gene is well known as aroapoptotic gene, but is also important during postim-lantation embryonic development for the death of ec-opic primordial germ cells during their migration [43]nd early organogenesis [44]. Based on our findingsnd previous studies, it is speculated that sirtuinsave a role as an upstream regulator in gene tran-cription and cell cycle regulation, and may betrongly involved in the regulation of POU5F1 andax gene expressions during embryonic develop-ent. Further studies are needed to elucidate theechanisms of Bax and POU5F1 regulations by sir-

uins during embryonic development.

The present study suggests that sirtuins play an im-ortant role in the developing embryo as indicated byhe inhibitory effects of NAM and sirtinol, which arepecific inhibitors of sirtuins. Additionally, Sirt3 maye used as a marker for determining the developmentalompetence of porcine preimplantation embryos. Inonclusion, sirtuins may play a physiological role in thembryonic development of porcine preimplantationmbryos by regulating essential gene expression in theeveloping embryos. These findings could have impli-ations for understanding the role of sirtuins duringmbryo development and for improving SCNT andelated techniques.

cknowledgments

This work was supported by a grant from Next-eneration BioGreen 21 program (# PJ008121012011),ural Development Administration, Republic of Korea.

eferences

[1] Yang X, Smith SL, Tian XC, Lewin HA, Renard JP, WakayamaT. Nuclear reprogramming of cloned embryos and its implica-tions for therapeutic cloning. Nat Genet 2007;39:295–302.

[2] Hashizume K, Ishiwata H, Kizaki K, Yamada O, Takahashi T,Imai K, et al. Implantation and placental development in so-matic cell clone recipient cows. Cloning Stem Cells 2002;4:197–209.

[3] Abeydeera LR. In vitro production of embryos in swine. The-riogenology 2002;57:257–73.

[4] Anegon I, Cuturi MC, Godard A, Moreau M, Terqui M,Martinat-Botté F, et al. Presence of leukaemia inhibitory factorand interleukin 6 in porcine uterine secretions prior to conceptusattachment. Cytokine 1994;6:493–9.

[5] Kwak SS, Jeung SH, Biswas D, Jeon YB, Hyun SH. Effects ofporcine granulocyte-macrophage colony-stimulating factor onporcine in vitro-fertilized embryos. Theriogenology 2012;77:1186–97.

[6] Biswas D, Jung EM, Jeung EB, Hyun SH. Effects of vascularendothelial growth factor on porcine preimplantation embryosproduced by in vitro fertilization and somatic cell nuclear trans-fer. Theriogenology 2011;75:256–67.

[7] Finkel T, Deng CX, Mostoslavsky R. Recent progress in thebiology and physiology of sirtuins. Nature 2009;460:587–91.

[8] Frye RA. Characterization of five human cDNAs with homol-ogy to the yeast SIR2 gene: Sir2-like proteins (sirtuins) metab-olize NAD and may have protein ADP-ribosyltransferase activ-ity. Biochem Biophys Res Commun 1999;260:273–9.

[9] Liszt G, Ford E, Kurtev M, Guarente L. Mouse Sir2 homologSIRT6 is a nuclear ADP-ribosyltransferase. J Biol Chem 2005;280:21313–20.

[10] Haigis MC, Guarente LP. Mammalian sirtuins–emerging rolesin physiology, aging, and calorie restriction. Genes Dev 2006;20:2913–21.

[11] Kawamura Y, Uchijima Y, Horike N, Tonami K, Nishiyama K,
Amano T, et al. Sirt3 protects in vitro-fertilized mouse preim-

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[


plantation embryos against oxidative stress-induced p53-medi-ated developmental arrest. J Clin Invest 2010;120:2817–28.

12] Tsai FC, Gardner DK. Nicotinamide, a component of complexculture media, inhibits mouse embryo development in vitro andreduces subsequent developmental potential after transfer. FertilSteril 1994;61:376–82.

13] Song K, Hyun SH, Shin T, Lee E. Post-activation treatment withdemecolcine improves development of somatic cell nucleartransfer embryos in pigs by modifying the remodeling of donornuclei. Mol Reprod Dev 2009;76:611–9.

14] Yoshioka K, Suzuki C, Tanaka A, Anas IM, Iwamura S. Birthof piglets derived from porcine zygotes cultured in a chemicallydefined medium. Biol Reprod 2002;66:112–9.

15] Han YM, Kang YK, Koo DB, Lee KK. Nuclear reprogrammingof cloned embryos produced in vitro. Theriogenology 2003;59:33–44.

16] Rideout WM, Eggan K, Jaenisch R. Nuclear cloning and epi-genetic reprogramming of the genome. Science 2001;293:1093–8.

17] Hirata S, Fukasawa H, Tagaya H, Shoda T, Wakayama T, HoshiK. Effects of Sirtinol on early development of the cloned murineembryos. Yamanashi Medical Journal 2008;23:97–107.

18] Scher MB, Vaquero A, Reinberg D. SirT3 is a nuclear NAD�-dependent histone deacetylase that translocates to the mitochon-dria upon cellular stress. Genes Dev 2007;21:920–8.

19] Hallows WC, Lee S, Denu JM. Sirtuins deacetylate and activatemammalian acetyl-CoA synthetases. Proc Natl Acad Sci U S A2006;103:10230–5.

20] Van Blerkom J. Mitochondria in early mammalian develop-ment. Semin Cell Dev Biol 2009;20:354–64.

21] Wang F, Nguyen M, Qin FX, Tong Q. SIRT2 deacetylatesFOXO3a in response to oxidative stress and caloric restriction.Aging Cell 2007;6:505–14.

22] Lee GS, Hyun SH, Kim HS, Kim DY, Lee SH, Lim JM, et al.Improvement of a porcine somatic cell nuclear transfer tech-nique by optimizing donor cell and recipient oocyte prepara-tions. Theriogenology 2003;59:1949–57.

23] Hiiragi T, Solter D. Reprogramming is essential in nucleartransfer. Mol Reprod Dev 2005;70:417–21.

24] Hill JR, Winger QA, Long CR, Looney CR, Thompson JA,Westhusin ME. Development rates of male bovine nucleartransfer embryos derived from adult and fetal cells. Biol Reprod2000;62:1135–40.

25] Denu JM. The Sir 2 family of protein deacetylases. Curr OpinChem Biol 2005;9:431–40.

26] Kang HT, Lee HI, Hwang ES. Nicotinamide extends replicativelifespan of human cells. Aging Cell 2006;5:423–36.

27] Mitchell M, O’Neill C, Filby A, Cashman K, Lane M. 152.Involvement of Trp53 in Sirt1 function during embryo devel-opment. Reprod Fertil Dev 2009;21:70.

28] Godeau F, Sahni MK, Boquet P, Koide S. Nicotinamide inhi-bition of Xenopus laevis oocyte maturation. Gamete Res 1986;14:159–70.

29] Saldeen J, Welsh N. Nicotinamide-induced apoptosis in insulinproducing cells is associated with cleavage of poly(ADP-ribose)
polymerase. Mol Cell Endocrinol 1998;139:99–107.
30] Saldeen J, Tillmar L, Karlsson E, Welsh N. Nicotinamide- andcaspase-mediated inhibition of poly(ADP-ribose) polymeraseare associated with p53-independent cell cycle (G2) arrest andapoptosis. Mol Cell Biochem 2003;243:113–22.

31] Solomon JM, Pasupuleti R, Xu L, McDonagh T, Curtis R,DiStefano PS, et al. Inhibition of SIRT1 catalytic activity in-creases p53 acetylation but does not alter cell survival followingDNA damage. Mol Cell Biol 2006;26:28–38.

32] Kikuchi K, Onishi A, Kashiwazaki N, Iwamoto M, Noguchi J,Kaneko H, et al. Successful piglet production after transfer ofblastocysts produced by a modified in vitro system. Biol Reprod2002;66:1033–41.

33] Pomar FJ, Teerds KJ, Kidson A, Colenbrander B, Tharasanit T,Aguilar B, et al. Differences in the incidence of apoptosisbetween in vivo and in vitro produced blastocysts of farmanimal species: a comparative study. Theriogenology 2005;63:2254–68.

[34] Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsak-sophak K, Beck F, et al. Cdx2 is required for correct cell fatespecification and differentiation of trophectoderm in the mouseblastocyst. Development 2005;132:2093–102.

[35] Cauffman G, Van de Velde H, Liebaers I, Van Steirteghem A.Oct-4 mRNA and protein expression during human preimplan-tation development. Mol Hum Reprod 2005;11:173–81.

[36] Kawasumi M, Unno Y, Matsuoka T, Nishiwaki M, Anzai M,Amano T, et al. Abnormal DNA methylation of the Oct-4enhancer region in cloned mouse embryos. Mol Reprod Dev2009;76:342–50.

[37] Sundaresan NR, Samant SA, Pillai VB, Rajamohan SB, GuptaMP. SIRT3 is a stress-responsive deacetylase in cardiomyocytesthat protects cells from stress-mediated cell death by deacety-lation of Ku70. Mol Cell Biol 2008;28:6384–401.

[38] Kelman Z. PCNA: structure, functions and interactions. Onco-gene 1997;14:629–40.

[39] Makarevich AV, Markkula M. Apoptosis and cell proliferationpotential of bovine embryos stimulated with insulin-like growthfactor I during in vitro maturation and culture. Biol Reprod2002;66:386–92.

[40] Sasaki T, Maier B, Bartke A, Scrable H. Progressive loss ofSIRT1 with cell cycle withdrawal. Aging Cell 2006;5:413–22.

[41] Boumela I, Assou S, Aouacheria A, Haouzi D, Dechaud H, DeVos J, et al. Involvement of BCL2 family members in theregulation of human oocyte and early embryo survival anddeath: gene expression and beyond. Reproduction 2011;141:549–61.

[42] McElroy SL, Kim JH, Kim S, Jeong YW, Lee EG, Park SM, etal. Effects of culture conditions and nuclear transfer protocolson blastocyst formation and mRNA expression in pre-implan-tation porcine embryos. Theriogenology 2008;69:416–25.

[43] Stallock J, Molyneaux K, Schaible K, Knudson CM, Wylie C.The pro-apoptotic gene Bax is required for the death of ectopicprimordial germ cells during their migration in the mouse em-bryo. Development 2003;130:6589–97.

[44] Sun F, Akazawa S, Sugahara K, Kamihira S, Kawasaki E,Eguchi K, et al. Apoptosis in normal rat embryo tissues duringearly organogenesis: the possible involvement of Bax and
Bcl-2. Arch Histol Cytol 2002;65:145–57.

expression patterns of sirtuin genes in porcine preimplantation embryos and effects of sirtuin...

Documents