extracellular dna in pancreatic cancer promotes cell ... · molecular and cellular pathobiology...

Molecular and Cellular Pathobiology

Extracellular DNA in Pancreatic Cancer Promotes CellInvasion and Metastasis

Fushi Wen1, Alex Shen1, Andrew Choi1, Eugene W. Gerner2, and Jiaqi Shi3

AbstractAggressive metastasis is the chief cause of the highmorbidity andmortality associated with pancreatic cancer,

yet the basis for its aggressive behavior remains elusive. Extracellular DNA (exDNA) is a recently discoveredcomponent of inflammatory tissue states. Here, we report that exDNA is present on the surface of pancreaticcancer cells where it is critical for drivingmetastatic behavior. exDNAwas abundant on the surface and vicinity ofcultured pancreatic cancer cells but absent from normal pancreas cells. Strikingly, treatment of cancer cellcultures with DNase I to degrade DNA nonspecifically reduced metastatic characters associated with matrixattachment, migration, and invasion. We further assessed the role of exDNA in pancreatic cancer metastasisin vivo using an orthotopic xenograft model established by implantation of pancreatic cancer cells expressingfirefly luciferase. Noninvasive bioluminescent imaging confirmed that DNase I treatment was sufficient tosuppress tumor metastasis. Mechanistic investigations suggested the existence of a positive feedback loop inwhich exDNA promotes expression of the inflammatory chemokine CXCL8, which leads to higher production ofexDNA by pancreatic cancer cells, with a significant reduction in CXCL8 levels achieved by DNase I treatment.Taken together, our results strongly suggest that exDNA contributes to the highly invasive and metastaticcharacter of pancreatic cancer. Cancer Res; 73(14); 4256–66. �2013 AACR.

IntroductionPancreatic cancer is the fourth leading cause of cancer-

related death in the United States and one of the most lethalmalignancies, with a 5-year survival rate less than 5% and adeath/incidence ratio of approximately 0.99 (1). Of note, 80% to90% of patients with pancreatic cancer have already developedmetastatic cancer at the time of diagnosis (2). Themechanismsunderlying the development of metastases during pancreaticcarcinogenesis are poorly understood (3). Understanding thesemechanisms may provide novel approaches to pancreaticcancer treatment and/or prevention.

The development of metastasis is determined by bothgenetic alterations in tumor cells and by the surroundingmicroenvironment (4, 5). Inflammation has been shown tofacilitate tumor metastasis, from dissemination of cancer cellsat the primary tumor site to their implantation at secondarysites (6–8). The link between inflammation and pancreatic

cancer development has been well recognized. Chronic pan-creatitis/inflammation is among the few high risk factors ofdeveloping pancreatic cancer (1, 9–13).

Inflammation mediators including CXCL8 have been shownto induce the production of extracellular DNA (exDNA)–con-taining fibers by neutrophils (nicknamed neutrophil extracel-lular traps or NET; ref. 14). exDNA traps have been associatedwith several chronic inflammatory diseases, including cysticfibrosis, small-vessel vasculitis, and deep vein thrombosis(14–18). It has been recently reported that cytokine-inducedproduction of NETs contributes to cancer-associated throm-bosis (19). Production of exDNAhas been reported in a numberof inflammatory cell types in addition to neutrophils, includingmacrophages, mast cells, platelets, dendritic cells, B, and Tlymphocytes. These inflammatory cells have all been found inthe stroma of pancreatic cancer (20, 21) and have beenimplicated in angiogenesis and tumor metastasis by secretingcytokines and chemokines (22).

Others have shown significantly elevated production andsecretion of the chemokine CXCL8 in the highly liver-meta-static pancreatic cancer cell line BxPC3 in comparisonwith theimmortalized normal human pancreatic ductal epitheliumhuman pancreatic ductal epithelial (HPDE) cell line (23). Inthis study, we asked whether normal or neoplastic pancreaticcells produced exDNA. We observed a large amount of exDNAon the surfaces and in the vicinity of the cultured BxPC3 andMiaPaCa-2 pancreatic cancer cell lines but not the normalpancreas HPDE cell line. We went on to assess the relationshipbetween exDNA, CXCL8, and features ofmetastasis in both celland tumor models of pancreatic cancer. This is the first reportof the association of an abundant amount of surface exDNA

Authors' Affiliations: 1Department of Surgery, Arizona Cancer Center;2BIO5 Institute and Arizona Cancer Center, BIO5 Oro Valley, University ofArizona, Tucson, Arizona; and 3Department of Pathology, University ofMichigan, Ann Arbor, Michigan

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Authors: Fushi Wen, Arizona Cancer Center, University ofArizona, 1501 N. Campbell Ave, Tucson, AZ 85724. Phone: 520-203-3845;Fax: 520-626-6898; E-mail: [email protected]; and Jiaqi Shi,Department of Pathology, University of Michigan, 1301 Catherine St., AnnArbor, MI 48105. E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-12-3287

�2013 American Association for Cancer Research.

CancerResearch

Cancer Res; 73(14) July 15, 20134256

on February 18, 2021. © 2013 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst May 30, 2013; DOI: 10.1158/0008-5472.CAN-12-3287

http://cancerres.aacrjournals.org/

with pancreatic cancer cells and its possible role in pancreaticcancer metastasis. This discovery may provide a new targetandnovel strategies for prevention, diagnosis, and treatment ofthis lethal cancer.

Materials and MethodsCell culture and DNase I treatment of cellsWe obtained MiaPaCa-2, BxPc3, and Panc-1 human pan-

creatic cancer cell lines from American Type Culture Collec-tion. The cells were cultured at 37�Cwith 5%CO2 in RPMI-1640medium (Mediatech, Inc.), supplemented with 10% FBS(Omega Scientific, Inc.), 2.5 mg/mL glucose, 1% L-glutamine,and 1% penicillin/streptomycin (Invitrogen). Immortalizednormal HPDE cells and HPDE-KRASG12D cells expressingmutated KRAS were kindly provided by Dr. Ming-Sound Tsao(University of Toronto, Toronto, Canada; ref. 24). HPDE cellswere cultured in keratinocyte serum-free medium supplemen-tedwith EGF and bovine pituitary extract (Invitrogen). DNase Itreatment of 105 cells was at the concentration of 3 U/100 mL.All the in vitro DNase I treatments lasted for 24 to 72 hoursdepending on different assays.

MTT cell viability and cell growth assayCell survival and growth was measured by MTT assay as

previously described (25, 26). HPDE control cell line andpancreatic cancer cell lines BxPc3 and MiaPaCa-2 were exam-ined with or without DNase I treatment (3 U/well/10,000 cells)24 hours after cells were treated with DNase I.

Wound-healing assayCells were grown in 24-well plates in 500mLmediumperwell

until confluence was reached. A wound was made by scratch-ing the cells with a 10-ml pipette tip in PBS, followed byreplacement by culture media with and without DNase I (15U/well for up to 3 days). The wounded monolayer was photo-graphed overtime and cell migration was assessed by measur-ing gap sizes at multiple fields using ImageJ (National Instituteof Mental Health, Bethesda, MD).

Cell migration assayCell migration assays were conducted using a modified 24-

well Boyden chamber. The top chamber (Transwell) with 8.0-mm pores on the filter membrane (BD Labware) was insertedinto a 24-well plate (bottom chamber). Ten percent FBS-containing medium was placed in the bottom chambers tobe used as a chemoattractant. Cells (3 � 105) in a 300 mLvolume of serum-free medium with or without DNase I wereplaced in the top chambers and incubated at 37�C for 24 hours.Migrated cells on the bottom surface of thefilter werefixed andstained with crystal violet.

Crystal violet stainingTwenty-four hours after culturing cells in the top chamber,

medium in the Transwell was siphoned off and the chamberwas moved to the bottom chamber containing 4% parafor-maldehyde to fix cells for 10 minutes. Top chamber was rinsedin PBS and inverted for staining. Fifty microliter of 5% crystalviolet (Sigma-Aldrich) in 25% methanol was applied onto the

bottom of the filter of the top chamber and cells were stainedfor 10minutes. Excess crystal violet waswashed off by plungingthe top chamber into distilled water in a beaker several times.Finish washing in a second beaker till water is clear. Cells ontop side of filter (cell that did not migrate) were removed usinga moist cotton swab. The filter was then air-dried. Cells in fiveto seven random fields were counted at �40 objective lensunder an inversion microscope.

Cell invasion assayThe system setup for invasion assay using Boyden chamber

was exactly the same as for cell migration assay, except thatthe Transwell filter was coated with 40 mL Matrigel (BD Bio-sciences) and cells were stained 48 hours instead of 24 hoursafter culture.

Fluorescent dye stainingCells (1 � 105/well) were seeded on sterile cover slips that

were placed in 6-well plate. Two days later, culture mediumwas aspirated and the cover slips were rinsed with PBS. Cellsthat grew on the cover slips were then fixed in 4% parafor-maldehyde for 10minutes, followed by rinsingwithwater. Cellswere stained with 40,6-diamidino-2-phenylindole (DAPI) orSYTOX Green by mounting the cover slip with the mountingmediumcontainingDNAdyeDAPI (Vector Laboratories), or bymounting the cover slip on a regular glass slide with KPLmounting medium containing another DNA fluorescence dyeSYTOX Green (Molecular Probes), a nonliving cell-permeantDNA-binding dye. For staining exDNA induced by CXCL8,SYTOX Green was added to cells cultured in a 24-well cultureplate at 1 mmol/L final concentration.

For staining cells in paraffin sections, tissue slides weredeparaffinized with 100% xylene twice, 10 minutes each andhydrolyzed in 100% ethanol twice (5 minutes each), 95%ethanol twice (5 minutes each), 80% ethanol twice (5 minuteseach), and water twice (5 minutes each). Then, DNA wasstained by mounting the slides with the mounting mediumcontaining DAPI (Vector Laboratories).

Immunofluorescence staining with DNA antibodyCells (1 � 105/well) were seeded on sterile cover slips that

were placed in 6-well plate. Two days later, culture mediumwas aspirated and the cover slips were rinsed with PBS. Cellsthat grew on the cover slips were then fixed in 4% parafor-maldehyde for 10 minutes, followed by cold methanol andacetone treatment (5 minutes/each) for cell fixation andpermeabilization, then by PBS rinsing. Some cells were nottreated for permeabilization after the fixation in paraformal-dehyde. Next, cells were blocked with 5% bovine serum albu-min (BSA) in PBS for 1 hour at room temperature, followed byrinsing with PBS three times, 3 minutes/each. Then cells wereprobed with mouse DNA antibody (1:100 dilution in 5%BSA/PBS) either 1 hour at room temperature or at 4�C overnight.DNA antibody was purchased from Santa Cruz Biotechnology.After the primary antibody reaction, cells were rinsed with PBSthree times, followed by secondary antibody (1:800 dilution in5%BSA/PBS) reaction at room temperature for 40minutes. Thesecondary antibody was Alexa Fluor 680–conjugated bovine

Role of Extracellular DNA in Pancreatic Cancer Metastasis

www.aacrjournals.org Cancer Res; 73(14) July 15, 2013 4257




antimouse (Life Technologies). Following secondary antibodyreaction, cover slips were rinsed in PBS and water separately,three time each solution. Finally, cover slips were mounted onregular glass slides either with KPL mounting medium or withthe mounting medium containing DAPI.

Immunofluorescence staining with integrin-b-1antibody and DNA antibody

Cells and cover slips were prepared the same way as abovefor staining with DNA antibody alone. Cells were not treatedfor permeabilization after the fixation. Here, 1:100 dilution ofboth mouse DNA and rat integrin-b-1 (a gift from Dr. AnneCress, Arizona Cancer Center, University of Arizona, Tucson,AZ) primary antibodies weremixed to probe cells. Alexa Fluor680/488–conjugated bovine anti-mouse/anti-rat secondaryantibodies for DNA and for b-1 separately were mixed forsecondary antibody reaction.

Immunohistochemistry staining with DNA antibodyTissue slides were deparaffinized and hydrolyzed as

described in the "Fluorescent dye staining" section. After thehydration, antigen retriever step was followed. Slides wereemerged in the antigen retriever solution (0.01 mol/L sodiumcitrate, 0.05% Tween-20, pH 6.0) and heated in a microwave.The solution was brought to boil and the power was turned off.Then heatwas turned on again to bring the solution to boil. Thepower "on and off" was repeated for 10 minutes to keep thesolution to boil, but was kept from boiling out of the container.At the end of 10 minutes, the container was left on ice for 20minutes. Then, slides were rinsed with PBS three times beforethey were subjected to immunoreaction. Procedures for block-ing, primary antibody reaction, and secondary antibody reac-tion were the same as for the immunofluorescence stain asdescribed earlier, except for using houseradish peroxidase–conjugated mouse secondary antibody (Santa Cruz Biotech-nology) instead of Alexa Fluor 680–conjugated secondary anti-body. NovaRED substrate (Vector Laboratories) was used fordetection. After secondary antibody reaction, slideswere rinsedand mounted the same as for immunofluorescence stain.

Orthotopic xenograft mouse modelAll procedures involving animal were approved by the

University of Arizona Institutional Animal Care and Use Com-mittee (IACUC) protocol #07029. Pancreatic cancer cell lineMIA PaCa-2/LucE expressingfirefly luciferasewas used. A totalof 2 � 106 cells in 100 ml Matrigel (Becton Dickenson) wereinjected into severe combined immunodeficient (SCID) donormice. After 4 days,Matrigel plugswere removed from thedonormice and implanted in the body-tail of the pancreases ofreceiving SCID mice at age of 6 to 8 weeks. Two groups ofSCID mice were used. Group A: 10 SCID mice were injectedwith MIA PaCa-2/LucE cells and received an intraperitonealinjection of saline every other day as a control treatment.Group B: 14 SCID mice were injected with MIA PaCa-2/LucEcells together with DNase I at a concentration of 1 U/mouse insubgroup 1 (n ¼ 7) and at a concentration of 50 U/mouse insubgroup 2 (n ¼ 7). Group B mice received intraperitonealinjections ofDNase I every other day at the samedosage as used

in the first injection. Mice were purchased and maintainedthrough the Experimental Mouse Shared Service in Universityof Arizona Cancer Center (EMSS/UACC). Mouse xenograft andDNase I application were carried out by specialists at the EMSSfacility. In vivo tumor growth and spontaneousmetastasis weremonitored and recorded noninvasively every week by biolumi-nescence imaging (BLI) measuring the bioluminescence fromtumor cells using an In Vivo Imaging System (AMI-1000;Spectral Instrument Imaging). At the end of the project, themice were sacrificed and various organs were harvested forhematoxylin and eosin (H&E) staining and histology, and exvivo bioluminescence analysis to confirm the tumormetastasis.

Histology of pancreatic xenograftsThe pancreas, livers, spleens, diaphragms, and lungs were

harvested, visually inspected, fixed in 10% formalin buffer,processed, embedded, sectioned, H&E, and immunohis-tochemistry (IHC) stained with DNA antibody, and analyzedby a pathologist for the presence of tumors.

Cell adhesion assayThe 96-well microtiter plate was coated with Matrigel to

assess cell adhesion to extracellular matrix as described before(27). A 150-mL cell suspension of MiaPaCa-2, BxPc3, and HPDEcells were added to the coated wells (1 � 104/well) with orwithout the presence of 7UDNase I/well and incubated at 37�Cfor 1 hour. After washing off unattached cells, attached cellswere stainedwith crystal violet and counted under an invertingmicroscope.

Hanging drop assayCellswere harvested and suspended in correspondingmedia

as single cells. Drops (30-mL/drop) of media containing 20,000cells per drop of HPDE or MiaPaCa-2 cells were pipetted ontothe inner surface of a lid of a 24-well plate. The lid was placedupright on the plate so that the dropswere hanging from the lidwith cells suspended within them. The corresponding bottomwells contained media to maintain humidity. After culturingcells at 37�C overnight, hanging drops were transferred tomicrofuge tubes and were pipetted seven times up and downwith a 200-mL standard tip, fixed with 2% paraformaldehyde,and aliquots were spread on regular microscope glass slidescovered with cover slips. Images of five random fields weretaken and clusters containing 10 or more cells were counted.

Real-time PCR and CXCL8 ELISACells (3 � 105 in 500 mL/well) were seeded in 24-well plate.

In 24 hours, media were changed and DNase I was added (15U/wells) to treatment wells. Cells without DNase I additionwere controls. Two days later, culture media were collectedfor CXCL8 ELISA, whereas cells were lysed for total RNAextraction and real-time PCR. Media were pulse-centrifugedat 1,000 rpm. Supernatant were transferred to new tube andstored at �80�C for later ELISA analysis. The secreted CXCL8level was measured by using a CXCL8 ELISA assay kit(QuantiGlo Chemiluminescent Immunoassay; R&D Systems).Total RNA extraction and real-time PCR were conducted asdescribed before (26). CXCL8 forward primer sequence

Wen et al.

Cancer Res; 73(14) July 15, 2013 Cancer Research4258




is ATGACTTCCAAGCTGGCCGTGGCT; and CXCL8 reverseprimer sequence is TCTCAGCCCTCTTCAAAAACTTCTC.

Measurement of exDNA induced by CXCL8Of note, 100mL of 10,000 cells perwell were seeded in a 96-well

plate togetherwith80ng/mLofCXCL8protein (BDBiosciences).Cells without CXCL8 treatment are control cells. After overnightincubation, 1 mmol/L of SYTOX Green was added to the cells todetect exDNA. The plates were read within 15 minutes in aSpectraMAXGeninifluorescencemicroplate readerwith a filtersetting of 485 nm (excitation)/538 nm (emission). For nonquan-titive observation of exDNA after CXCL8 treatment, cells wereseeded in a 24-well plate with or without 80 ng/mL CXCL8. Afterovernight incubation, 1 mmol/L SYTOXGreenwere added to thecells. Cells were observed under a Carl Zeiss fluorescent micro-scope. Images were captured using the AxioVisionE software.

Statistical analysesAll data are reported as mean� SD. Statistical comparisons

between treatment groups were done by the Student t test andby the single factor ANOVA analysis. For all analyses, differ-ences were considered significant at P < 0.05.

ResultsexDNA on the surface of pancreatic cancer cells in vitroWe detected exDNA on the surface and in the vicinity of

cultured pancreatic cancer cell lines.We used fluorescent DNA

dyes DAPI and SYTOX Green to stain cells cultured on coverslips. DAPI is a fluorescent stain that binds strongly to A–T–rich regions in DNA. To validate the DAPI stain, we usedanother DNA fluorescent dye: SYTOX Green. Unlike DAPI, thisdye shows little base selectivity. exDNA associated with cancercell lines BxPc3 and MiaPaCa-2 was observed (Fig. 1B–D), butno exDNA was visible associated with the immortalized nor-mal HPDE cell line (Fig. 1A). All cells were testedMycoplasma-free.

To confirm that the fluorescent dyes were detecting DNAmolecules, we used a DNA antibody (Santa Cruz Biotechnol-ogy) to carry out the immunofluorescence assay (IFA) with afluorochrome Alexa Fluor 594–conjugated secondary anti-body. In agreementwith thefluorescent dye staining, abundantexDNA associated with pancreatic cancer cell lines wasobserved (Fig. 1F) by IFA, whereas no exDNA but only nucleiDNA positively reacted to the DNA antibody in the control cellline HPDE (Fig. 1E). The IFA results were examined under bothregular fluorescence microscope (Fig. 1E–G) and the confocalmicroscope (Fig. 1H–J). When MiaPaCa-2 cells were treatedwith DNase I before IFA, only trace amount of extracellularfluorescent materials were seen (Fig. 1G, arrows). The exDNAassociated with cancer cells does not seem to be produced bydying cells, because HPDE has a higher apoptosis level thanBxPC3 cells but no associated exDNA (Supplementary Fig. S1).We also used fluorescein diacetate to conduct a viability assayand showed that DNase I treatment did not affect cell viability

A B C D

HPDE DAPI MiaPaCa-2 DAPI BxPc3 DAPI MiaPaCa-2 SYTOX Green

E F G

H I J

HPDE DNA Ab MiaPaCa-2 DNA Ab MiaPaCa-2 DNase I DNA Ab

MiaPaCa-2 DAPI MiaPaCa-2 DNA Ab MiaPaCa-2 Merge

Figure 1. exDNA associated withpancreatic cancer cells, but notwith normal pancreas cells.Immortalized normal HPDE andhuman pancreatic cancer cell linesBxPC3 and MiaPaCa-2 cells werecultured on cover slips, and thenfixed and stained with fluorescentDNA dyes DAPI (A–C) and SYTOXGreen (D). exDNA appears asfibrous materials (arrows). Bar, 20mm. Immunofluoerescent stainusing DNA antibody (Ab) wasconducted on HPDE, MiaPaCa-2,and BxPc3 cells. E, DNA antibodyreacts to nuclei DNA in HPDE cells.F, DNA antibody reacts to exDNAandnuclei DNA inMiaPaCa-2 cells.G,MiaPaCa-2 cells were subjectedto DNase I treatment beforeimmunofluorescence. E–G, imageswere taken under the regularfluorescent microscope. H–J,MiaPaCa-2 cells were doublestained with DAPI and DNAantibody and images were takenunder the confocal microscope.DAPI stain was done after DNAantibody. Cells in H–J were notpermeabilized before staining,whereas cells in E–G werepermeabilized. Bar, 20 mm.






(data not shown). Inactivated DNase I had no effect on exDNA(Supplementary Fig. S2).

exDNA association with metastasized pancreatic cancercells in situ

To examine the presence of exDNA in pancreatic cancertissue in vivo, we conducted IFA using the DNA antibody onmouse tissue sections. Figure 2A shows IFA of exDNA inmetastatic pancreatic cancer in diaphragm of an orthotopicxenograft mouse model. Figure 2B shows exDNA detected byIHC in metastatic pancreatic cancer in liver. These resultssuggest exDNAmay be related to pancreatic cancermetastasis.

exDNA does not affect cell growth in vitroMTT colorimetric assay is an established method of deter-

mining cell viability and cell growth (25). To assess if exDNAaffect cell proliferation, we usedMTT assay tomeasure the cellgrowth of different cell lines with and without DNase I treat-ment. Our results show that cell growth and cell viability werenot affected by DNase I treatment (Fig. 3A). The degradation ofcell surface exDNA by DNase I is shown in Fig. 1G by arrows.These data indicate that the presence or absence of cell surface

exDNA does not affect cell viability and growth. Also, theseresults show that at the concentration we used in our experi-ments, DNase I can digest exDNA but does not affect cellviability and cell growth, which is important for using DNase Ito study cancer cell metastasis in vitro.

exDNA affects pancreatic cancer cells' metastaticpotential in vitro

Weusedwound-healing and Transwell cell migration assaysto assess the effect of exDNA on cell migration. We usedTranswell with Matrigel-coated membrane to examine cellinvasion. At the concentration of 10 U/5 � 105 cells, DNase Itreatment did not affect cell viability, but significantly reducedthe rate of pancreatic cancer cell migration (Fig. 3B–E) andinvasion (Fig. 3F and G). The same DNase I treatment did notaffect cell migration and invasion of the normal pancreas cells(HPDE). In addition to cell migration and invasion, cancer celladhesion to each other and to cell matrix is another importantcharacteristic correlated with their metastatic potential (28).We used hanging drop assay to examine the cell–cell adhesionability. Figure 4A and B shows that exDNA increasedMiaPaCa-2 cancer cell aggregation ability, which may help them to

H&E

a b

DAPI

d

Merge

c

IF w/ DNA Ab

A

B

a

H&E

T T

NN

T N

b

T N

Figure 2. exDNA detected in vivo inmouse tissues. A, pancreaticcancer metastasized to thediaphragm in a xenograftedmouse. a, H&E of a tumor-growingdiaphragm (inset) section. b–d,double staining of a tumor-growingdiaphragm section with DAPI andimmunofluorescent stain with DNAantibody (Ab), imaged under aconfocal microscope. b, DAPIstain; c, immunofluorescent (IF)stain with DNA antibody; and d,merge image of b and d. Arrowspoint to exDNA. Bar, 40 mm.B, exDNA detected in themetastasized tumor. IHC usingDNA antibody revealed abundantexDNA (b, arrows) in a pancreaticcancer metastasized to liver tissueharvested from an orthotopicallyxenografted mouse. a, thecorresponding H&E of IHC (b). NoexDNA were observed in thenormal liver tissue. Insets are lowermagnification image using a �5objective lens. T, tumor; L, liver;N, normal liver. Bar, 20 mm.

Wen et al.





survive circulating system during the metastasis and promotemetastasis by increase cancer cell arrest in microvasculature(29). To assess the effect of exDNA on cell's attachment abilityto extracellularmatrix, we conducted the cell attachment assayon Matrigel that consists of assortment of extracellular matrixproteins and is used in vitro asbasementmembrane (30). Figure4C and D showed that exDNA aids pancreatic cancer cellattachment to Matrigel, which may facilitate the invasion ofmetastatic cancer cells through the basement membrane invivo. Furthermore, we examined the effect of DNase I onintegrin-b-1, an integrin protein important for cell adhesion

and metastasis, to see if DNase I affect other surface proteins.Supplementary Fig. S3 showed DNase I did not abolish b-1 oncell surface.

DNase I inhibits pancreatic tumor cells metastasis inorthotopic xenograft mouse model

We established an orthotopic pancreatic cancer mousemodel, using cancer cells genetically modified to expressluciferase. This cell line was established by the EMSS/UACCand has the unique feature that it spontaneously metasta-sizes. Using an In Vivo Imaging System, a bioluminescence

F

Day 0 Day 1 Day 2 Day 3

DNase I

ControlDNase IControl

DNase IControl

DNase IControl

DNase I

Control

DNase I

DNase I

Control

2

1.5

1

0.5

0

605040302010

0

8070605040302010

0Day 0 Day 1 Day 2 Day 3 Day 0 Day 1 Day 2 Day 3 Day 0 Day 1 Day 2 Day 3

6050403020100

–10

10,000

1,000

100

10

1

100

50

0

A

C

B

**

**

HPDE MiaPaCa-2 BxPc3




Control

DNase I

Control

DNase I

*

*

D E

GHPDE MiaPaCa-2 BxPc3

Inv

ad

ed

ce

lls

Ab

so

rban

ce

Rela

tive w

ou

nd

are

a


Rela

tive w

ou

nd

are

a

Mig

rate

d c

ells

Rela

tive w

ou

nd

are

a

*

*

Control

Figure 3. exDNA affects cell migration and invasion, but not cell growth in pancreatic cancer cell lines. A, cell proliferation was assayed by MTT methodand the absorbance was read at 595 nm. Absorbance value positively correlated with cell numbers. Three triplicates sample in each plate per experiment.The results were reported as mean value of 3 experiments. B, wounded areas were measured for 3 days after scratching the monolayer of cells in 3cell lines. Images are representative of the wound healing by MiaPaCa-2 cells. C, DNase I delays the wound healing in cancer cell lines, but not theHPDE normal cell line. Charts are plots of wounded areas of 3 cell lines measured through ImageJ of three random areas in 3 days. Data from three repeatedexperiments arepresented asmean�SD (�,P<0.05;n¼9). D, representativephotographsof Transwell-migrationassay.Cellswere seeded inTranswell in theabsence (control) and presence of DNase I (15 U/well); after 24 hours, cells migrated to the basal side of the Transwell membranes were stained with0.5% crystal violet and seven random views were counted. E, bar graph shows migrated cell numbers in normal pancreas HPDE cell line and two cancer celllines. Data from three repeated experiments are presented as mean � SD (�, P < 0.05; n ¼ 21). F, cell invasion setting is the same as for cell migration in D,except for Transwell membranes coated with Matrigel. G, bar graph shows numbers of cells invading throughMatrigel in normal pancreas HPDE cell line andtwo cancer cell lines. Data from three repeated experiments are presented as mean � SD (�, P < 0.01; n ¼ 21).






technology, we were able to noninvasively monitor theorthotopic tumor growth/metastasis in the whole mouseand to confirm the distant metastasis ex vivo after organswere harvested at the end of the experiment. BLI allowed usto quantitatively measure the tumor development, as bio-luminescence intensity measured in photons/second/regionof interest (ph/s/ROI) is proportional to tumor burden.Figure 5A and B shows that tumor burden was significantlyinhibited by DNase I treatment at weeks 4 and 5 after tumorimplantation.

At the end of the mouse experiment, the In Vivo ImagingSystem allowed us to detect luciferase-expressing tumor cellsin each harvested organs quickly and quantitatively. Figure 5Cand D shows that DNase I treatment significantly inhibitedtumormetastasis from pancreas to liver and to the diaphragm.Although all pancreases developed high level of pancreaticcancer reflected by the highest level of the bioluminescence inBLI, there was no difference in the primary pancreatic tumorgrowth between control mouse group and DNase I–treatedmouse group.

We recorded tumor growth and metastasis in differentorgans by gross examination. Table 1 shows visible tumor inmice organs from control group and from DNase I–treatedgroup. Positive (þ) indicates that tumor(s) was/were visible,whereas negative (�) indicates that no visible tumor on theorgan examined. Although not as sensitive as bioluminescenceimaging, data from gross examination in Table 1 also showed

DNase I–inhibited orthotopic pancreatic tumor metastasizingto different organs.

exDNA affects CXCL8 production in pancreatic cancercell lines

To elucidate the mechanism of exDNA in cancer metastasis,we examined the effect of DNase I treatment on cell productionof cytokines with the Human Cytokine ELISA Plate Array I(Signosis) by following the manufacturer's instructions. TheELISA array test showed that only CXCL8, one of the majorinflammatory mediator, was affected by the DNase I treatment(data not shown). We then focused on CXCL8 for furtherexamination. After treating cells with DNase I for 48 hours, wemeasured secretedCXCL8protein level in the culturemedia andCXCL8 mRNA level in cells. Figure 6 shows both the transcrip-tion level of CXCL8mRNA (Fig. 6A) and secretedCXCL8 proteinlevel (Fig. 6B) are much higher in BxPc3 and MiaPaCa-2 cellscompared with in HPDE cells, and the DNase I treatmentsignificantly reduced CXCL8 mRNA (Fig. 6A) and secretedCXCL8 protein levels (Fig. 6B) in two cancer cell lines, but notin the normal HPDE cell line. The high CXCL8 level correlateswith the high amount of cell surface exDNA in these cancer cells.

CXCL8 elevates exDNA production in cancer cell linesTo further evaluate whether there is a feedback loop of

CXCL8 on exDNA production, we then examined if CXCL8 canincrease exDNA production in pancreatic cancer cells as well

0

2

4

6

8

10

12

14

HPDE MiaPaCa-2


1201101009080706050403020100

Clu

ste

r #

/vie

w

Control

DNase I

ControlDNase I

C HPDE MiaPaCa-2

HPDE MiaPaCa-2

BxPc3

Control

DNase I

*

*Att

ac

he

d c

ell

nu

mb

ers

A B

D

Control

DNase I *

Figure 4. DNase I inhibits pancreatic cancer cells aggregate to each other and attach to Matrigel. A, hanging drop assay shows cell's ability to aggregateto form clusters. MiaPaCa-2 cells form clusters, which was inhibited by DNase I treatment. B, clusters with 10 or more cells were counted in fiverandom views in three repeated experiments. Bar chart shows the mean cluster numbers, �, P < 0.01. C, cell attachment assay where 1� 104 cells of normalpancreas HPDE cell line and pancreatic cancer cell lines MiaPaCa-2 and BxPc3 were seeded in each well of the Matrigel-coated 96-well plate with andwithout the presence of DNase I (15 U/well). One hour after incubate cells at 37�C, unattached cells were washed off and attached cells were stainedwith 0.5% crystal violet and five random views were counted under an inverted microscope. D, bar chart shows attached cell numbers presented as mean�SD; �, P < 0.01 as determined by the Student unpaired t test.

Wen et al.





as HPDE cells with mutated KRAS gene. We added CXCL8 toMiaPaCa-2 and HPDE-KRASG12D cells cultured in 96- and 24-well plates. Figure 6C showed CXCL8 treatment significantlyelevated the exDNA production quantitatively (Fig. 6C, a) andmicroscopically in both cell lines (Fig. 6C, b–e). DNase Itreatment also reduced exDNA associated with HPDE-KRASG12D cells the same as in pancreatic cancer cells (Sup-plementary Fig. S4).

DiscussionOur study provides the first evidence that exDNA is asso-

ciated with pancreatic cancer cells in culture and in tissuesections, but not with normal pancreas cells. Our data indicatethat cancer cell–related exDNA is involved in cell metastaticpotential in vitro and that DNase I treatment significantlydecreased cancer metastasis in the orthotopic xenograft pan-creatic cancer mouse model. Our data are consistent with

* *

D

Control

DNase I

DNase I

8

6

4

2

00 2 4 6

wk 0 wk 1 wk 2 wk 3 wk 4 wk 5

*

*

A8

6 Control

Bio

lum

inescen

ce

(ph

/s/R

OI)

×× 1

08

Bio

lum

inescen

ce

(ph

/s/R

OI

in

1 ×

10

8)

Bio

lum

inescen

ce

(ph

/s/R

OI

in

1 ×

10

8)

Weeks

DiaphragmLiver

DNase I

ControlDNase IControl

20

15

10

5

0

4

3

2

1

0

4 × 108

2

0ph/s/ROI

Control

DNase I

Pancreas Liver Spleen Diaphragm LungC 8

6

4 × 108

2

0ph/s/ROI

BFigure 5. BLI monitoring of tumorgrowth and metastasis. A,representative bioluminescenceimages of xenografts mice incontrol and DNase I–treated groupover 5 weeks of the experiment.Bioluminescence is from cancercells genetically modified toexpress luciferase. Mice wereimaged after injection of D-luciferin.B, chart shows intensity ofbioluminescence measured asph/s/ROI that positively correlatedwith tumor burden. The data arepresented as mean � SD (n ¼ 7);�, P < 0.05 as determined by theStudent t test. C, ex vivo detectionof distant tumor metastasis. At theend of the experiment, organswereharvested and BLI were taken fromdifferent organs. The circle aroundeach organ is the defined area thatis the same for every image toquantify the BLI. D, DNase Itreatment significantly inhibitedpancreatic cancermetastasizing toliver and diaphragm. Data arepresented as mean � SD (n ¼ 7);�, P < 0.05 as determined by theStudent t test and the single factorANOVA analysis.

Table 1. Harvested organs with visible tumor (tmþ) or without visible tumor (tm�) in each mouse (ms#)

Pancreas Spleen Liver MesenteryDiaphragm tumor

coverage, %

Controlgroup

DNase Itreated

Controlgroup

DNase Itreated

Controlgroup

DNase Itreated

Controlgroup

DNase Itreated

Controlgroup

DNase Itreated

ms# tm ms# tm ms# tm ms# tm ms# tm ms# tm ms# tm ms# tm ms# tm ms# tm

1 þ 1 þ 1 þ 1 þ 1 þ 1 þ 1 þ 1 � 1 100 1 102 þ 2 þ 2 � 2 � 2 þ 2 � 2 � 2 � 2 10 2 13 þ 3 þ 3 þ 3 � 3 � 3 þ 3 � 3 � 3 1 3 104 þ 4 þ 4 � 4 � 4 � 4 � 4 � 4 � 4 0 4 05 þ 5 þ 5 þ 5 � 5 þ 5 þ 5 þ 5 � 5 90 5 306 þ 6 þ 6 þ 6 � 6 þ 6 � 6 þ 6 � 6 35 6 17 þ 7 þ 7 � 7 � 7 � 7 þ 7 � 7 � 7 5 7 308 þ 8 þ 8 þ 8 � 8 45100% þ 100% þ 63% þ 14% þ 63% þ 57% þ 38% þ 0% þ Avg. 35.8 Avg. 11.7






studies dating to the 1960s, when reports appeared implicatingexDNA in cancer development (29, 31, 32). This area of researchfell dormant until recent reports of the suppressive effect ofDNase I on the metastasis of pulmonary and liver cancers inmurine tumor models (33). Studies identifying NETs and otherexDNA traps have provided a mechanistic rationale for exDNAin carcinogenesis (14–16, 18, 19, 34).

The exDNA in our cell culture experiments is found inpancreatic cancer cell cultures and is not dependent onmicroenvironmental factors. Thus, the results of our cellculture experiments are likely affected by extracellular trapsmade up of pancreatic cellular exDNA. The results frommousemodels could involve traps containing tumor and/or stromalexDNA. Our current findings do not address the pathway(s) forproducing exDNA in either tumor or stromal cells. Apoptosis,necrosis, inflammatory cell lysis, and active cell secretion allcan release exDNA (35). Our apoptosis assessment, however,does not suggest that exDNA is associated with cell apoptosis.Supplementary Fig. S1 shows significant higher level of caspaseactivity in HPDE cells, but we did not observe cell surfaceexDNA in this cell line. Micronuclei or microparticles areanother possible source of exDNA. These are small, extranu-

clear bodies that are formed during mitosis from laggingchromosomes, often related to DNA damages. DNA in micro-nuclei/microparticles is ultimately eliminated from cells (36).Levels ofmicronuclei in the blood are elevated in awide varietyof diseases (37). It has recently been shown that micronuclei inperipheral lymphocytes were associated with pancreatic can-cer (38). We have frequently observed micronuclei in pancre-atic cancer cells; micronuclei were often found connected withexDNA (Supplementary Fig. S5). Further examination ofmicro-nuclei would be important for tracing the origin and the fate ofexDNA, further for understanding its function.

Cancer cell surface–associated DNA has been reported inother types of cancer cells (39–41). We found exDNA on thesurfaces and in the vicinity of cultured pancreatic cancer celllines, also observed abundant exDNA associated with metas-tasized pancreatic cancer cells in the tissue section from thexenograft mouse model (Fig. 2). We cross-examined the pres-ence of pancreatic cancer cell–associated exDNA using DNAfluorescent dyes, immunofluoresent, and immunohistochem-ical stainings using DNA antibody both in cultured cells andmouse tissue sections. The extracellular nature of exDNA wasclearly shown by immunofluorescent assays using DNA

MiaPaCa-2KrasG12D

Flu

ore

sc

en

ce

ab

so

rba

nc

e

ControlCXCL8

80

60

40

20

0

KrasG12D+ CXCL8KrasG12D

C

a

e

b c

d

*P < 0.01

0

0.002

0.004

0.006

0.008

0.01

0.012

0.014


Re

lati

ve

IL

-8 /

GA

PD

H m

RN

A

Control

DNase I

**

0

1

2

3

4

5

6

7

8


Se

cre

ted

IL

-8 p

rote

in f

old

ch

an

ge

Control

Dnase I

*

*

A B

**

**

*P < 0.05*P < 0.01

MiaPaCa-2 MiaPaCa-2 + CXCL8

Figure 6. Feedback loop betweenexDNA and CXCL8. Normalpancreatic HPDE cells, pancreaticcancer BxPc3 cells, and MiaPaCa-2 cells were treated with DNase I.Of note, 500 mL of 105 cells per wellwere seeded in absence andpresence of DNase I (3 U/100 mL) ina 24-well plate. Forty-eight hoursafter treatment, cells wereharvested for total RNA isolationand quantitative PCR (qPCR) tomeasure interleukin (IL)-8 mRNA.Relative fold changes of IL-8mRNA level were normalized toglyceraldehyde-3-phosphatedehydrogenase (GAPDH) mRNA(A), and media were collected forELISA assay to examine secretedIL-8 protein level. Fold changes ofIL-8 protein level were against thelevel of IL-8 secreted from HPDEcells (B). C, MiaPaCa-2 and HPDE-KRASG12D cells were treated with80 ng/mL exogenous CXCL8 for 18hours, then cells were stained withSYTOX Green. exDNA werequantitatively measured (a) andwere microscopically observed(b–e). Data from three repeatedexperiments are presented asmean � SD.

Wen et al.





antibody on permeabilized (Fig. 1F) or nonpermeabilized cells(Fig. 1I). DNA antibody reacted with both nuclei DNA andexDNA (Fig. 1F) in the permeabilized cells, whereas it reactedonly with exDNA in the nonpermeabilized cells (Fig. 1I). Thefact that we observed abundant cell surface–bound exDNA inpancreatic cancer cell lines, but not in normal pancreas cell lineand the early studies of using DNase to control cancer metas-tasis prompted us to test the hypothesis that exDNAassociatedwith pancreatic cancer cells plays a role in pancreatic cancermetastasis.A significant higher level of CXCL8 mRNA and secreted

CXCL8 protein were detected in pancreatic cancer cell linescompared with that in normal HPDE cells (Fig. 6), which is inagreement with earlier studies (23, 42). Our study showed thatthe levels of CXCL8 mRNA and secreted CXCL8 protein cor-respond to the level of exDNA in each cell lines, and DNase Itreatment can reduce CXCL8 mRNA and secreted CXCL8protein levelswhile degrading exDNA. The correlation betweenCXCL8 and exDNA has never been shown in cancer cells,although this relationship has been reported in inflammatorycells (14, 18). Our current study suggests that exDNA could verywell be another mediator molecule common to cancer andinflammation. It has been shown that the production andsecretion of cytokines in the inflammatory cells can be inducedby bacterial DNA and by DNA-containing immune complex(43). In inflammatory neutrophils, production of exDNA in theformofNEThas been reported to be induced byCXCL8 (14, 18).A possible exDNA and CXCL8 feedback loop may exist ininflammatory cells. Our results indicated for the first time anexDNA and CXCL8 feedback loop in pancreatic cancer cells.The elevated production of CXCL8 has been recently shown

in transformed HPDE cells expressing mutated KRAS. Theincreased production of cytokine CXCL8 was shown to pro-mote invasion and angiogenesis of cancers including pancre-atic cancer cells (44–47). Our results showed the presence ofexDNA in HPDE-KRASG12D cells, and exogenous CXCL8 treat-ment increased exDNA production significantly in this cell lineas in other pancreatic cancer cell line. Our study also showedthat DNase I treatment reduced cell migration and invasionabilities in HPDE-KRASG12D cells (Supplementary Fig. S4C).Results from our in vitro experiments showed that exDNA

plays a novel role in cancer cell metastasis potential, includingcell migration, cell invasion, and cell adhesion to each otherand to extracellular matrix. These are all vital steps in cancermetastasis (27, 48, 49). These findings provide a mechanisticexplanation and insight into previous reports on the correla-tion between cell surface exDNA and circulating exDNA and

cancer development (35, 39, 40, 50). The role of exDNA inpancreatic cancer metastasis was further delimited by theMTT assay, which showed that DNase I treatment did notaffect the viability and proliferation of cancer cells. The studyby Sugihara and colleagues (29) also showed that exDNA hadno effect on primary tumor growth when tumor was treatedwith DNase I.

Here, we showed for the first time that DNase I inhibitspancreatic cancer metastasis. Our in vivo mouse model vali-dated the role of exDNA in pancreatic cancer metastasis.Tumor cell metastasis is confirmed by ex vivo BLI measure-ment in different organs harvested at the end of the experi-ment. Higher concentration of DNase I treatment gave rise tosimilar result as that from the lower concentration DNase Itreatment (data not shown). Our mouse data are in agreementwith other mouse model studies showing that DNase I inhibitsmetastasis of other types of cancer (36, 39, 40). These findingsunveiled that exDNA could be a potential novel hallmark inpancreatic cancer metastasis, which may lead to new drugdiscoveries and cancer detection methods.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: F. Wen, J. ShiDevelopment of methodology: F. Wen, J. ShiAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): F. Wen, A. Shen, A. Choi, J. ShiAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): F. Wen, E.W. GernerWriting, review, and/or revision of the manuscript: F. Wen, E.W. Gerner,J. ShiAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): F. Wen, A. Shen, A. Choi, J. ShiStudy supervision: F. Wen, J. Shi

AcknowledgmentsThe authors thank Dr.Wenxin Zheng for his critical reading of our article and

giving helpful suggestions and Dr. Haiyan Cui for her help with statisticalanalysis. The authors also thank EMSS/UACC for their service of the mousemodel, and the University of Arizona TACMASS core facility for tissue sectioningand H&E services.

Grant SupportThis work was supported by NCI/NIH grant CA158895, Arizona Foundation

Faculty Seed Grant, NIH University of Arizona Cancer Center Support GrantCA23074, and NIH GI SPORE CA095060.

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisementin accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received August 21, 2012; revised April 19, 2013; accepted April 20, 2013;published OnlineFirst May 30, 2013.

References1. Raimondi S, Maisonneuve P, Lowenfels AB. Epidemiology of pan-

creatic cancer: an overview. Nat Rev Gastroenterol Hepatol 2009;6:699–708.

2. Barkin JS, Goldstein JA. Diagnostic and therapeutic approach topancreatic cancer. Biomed Pharmacother 2000;54:400–9.

3. Tuveson DA, Neoptolemos JP. Understanding metastasis in pan-creatic cancer: a call for new clinical approaches. Cell 2012;148:21–3.

4. Kopfstein L, Christofori G. Metastasis: cell-autonomous mechanismsversus contributions by the tumor microenvironment. Cell Mol Life Sci2006;63:449–68.

5. Pollard JW. Tumour-educated macrophages promote tumour pro-gression and metastasis. Nat Rev Cancer 2004;4:71–8.

6. Mantovani A. CANCER Inflaming metastasis. Nature 2009;457:36–7.7. Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflamma-

tion. Nature 2008;454:436–44.






8. Colotta F, AllavenaP, SicaA,GarlandaC,Mantovani A.Cancer-relatedinflammation, the seventh hallmark of cancer: links to genetic insta-bility. Carcinogenesis 2009;30:1073–81.

9. Uomo I, Miraglia S, Pastorello M. Inflammation and pancreatic ductaladenocarcinoma: a potential scenario for novel drug targets. J Pan-creas 2010;11:199–202.

10. Farrow B, Evers BM. Inflammation and the development of pancreaticcancer. Surg Oncol 2002;10:153–69.

11. Coussens LM, Werb Z. Inflammation and cancer. Nature 2002;420:860–7.

12. Karlson BM, Ekbom A, Josefsson S, McLaughlin JK, Fraumeni JF,Nyren O. The risk of pancreatic cancer following pancreatitis: anassociation due to confounding? Gastroenterology 1997;113:587–92.

13. Ekbom A, McLaughlin JK, Nyren O. Pancreatitis and the risk ofpancreatic-cancer. N Engl J Med 1993;329:1502-.

14. Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, WeissDS, et al. Neutrophil extracellular traps kill bacteria. Science 2004;303:1532–5.

15. Fuchs TA, Brill A, Duerschmied D, Schatzberg D, Monestier M, MyersDD Jr, et al. Extracellular DNA traps promote thrombosis. Proc NatlAcad Sci U S A 2010;107:15880–5.

16. Kessenbrock K, Krumbholz M, Schonermarck U, Back W, Gross WL,Werb Z, et al. Netting neutrophils in autoimmune small-vessel vascu-litis. Nat Med 2009;15:623–5.

17. Bass JIF, Russo DM, Gabelloni ML, Geffner JR, Giordano M, CatalanoM, et al. Extracellular DNA: a major proinflammatory component ofpseudomonas aeruginosa biofilms. J Immunol 2010;184:6386–95.

18. Amulic B, Cazalet C, Hayes GL, Metzler KD, Zychlinsky A. Neutrophilfunction: from mechanisms to disease. Annu Rev Immunol 2012;30:459–89.

19. DemersM, KrauseDS, Schatzberg D,Martinod K, Voorhees JR, FuchsTA, et al. Cancers predispose neutrophils to release extracellular DNAtraps that contribute to cancer-associated thrombosis. ProcNatl AcadSci U S A 2012;109:13076–81.

20. Esposito I, Menicagli M, Funel N, Bergmann F, Boggi U,Mosca F, et al.Inflammatory cells contribute to the generation of an angiogenicphenotype in pancreatic ductal adenocarcinoma. J Clin Pathol2004;57:630–6.

21. Erkan M, Reiser-Erkan C, Michalski CW, Kleeff J. Tumor microenvi-ronment and progression of pancreatic cancer. Exp Oncol 2010;32:128–31.

22. Waugh DJJ, Wilson C. The interleukin-8 pathway in cancer. ClinCancer Res 2008;14:6735–41.

23. Matsuo Y, Sawai H, Funahashi H, Takahashi H, Sakamoto M, Yama-moto M, et al. Enhanced angiogenesis due to inflammatory cytokinesfrom pancreatic cancer cell lines and relation to metastatic potential.Pancreas 2004;28:344–52.

24. Liu N, Furukawa T, Kobari M, Tsao MS. Comparative phenotypicstudies of duct epithelial cell lines derived from normal human pan-creas and pancreatic carcinoma. Am J Pathol 1998;153:263–9.

25. Sylvester P. Optimization of the tetrazolium dye (MTT) colorimetricassay for cellular growth and viability. Methods Mol Biol 2011;716:157–68.

26. Wen F, Zhou R, Shen A, Choi A, Uribe D, Shi J. The tumor suppressiverole of eIF3f and its function in translation inhibition and rRNA degra-dation. PLoS ONE 2012;7:e34194.

27. Jiang J, Liu W, Guo X, Zhang R, Zhi Q, Ji J, et al. IRX1 influencesperitoneal spreading and metastasis via inhibiting BDKRB2-depen-dent neovascularization on gastric cancer. Oncogene 2011;30:4498–508.

28. Deer EL, Gonzalez-Hernandez J, Coursen JD, Shea JE, Ngatia J,Scaife CL, et al. Phenotype and genotype of pancreatic cancer celllines. Pancreas 2010;39:425–35.

29. Sugihara S, Yamamoto T, Tanaka H, Kambara T, Hiraoka T, MiyauchiY. Deoxyribonuclease treatment prevents blood-borne liver metasta-

sis of cutaneously transplanted tumor-cells in mice. Br J Cancer1993;67:66–70.

30. Hughes CS, Postovit LM, Lajoie GA. Matrigel: a complex proteinmixture required for optimal growth of cell culture. Proteomics2010;10:1886–90.

31. Delamirande G. Action of deoxyribonuclease and ribonuclease ongrowth of Ehrlich ascites carcinoma in mice. Nature 1961;192:52–4.

32. Salganik RI, Martynova RP, Matienko NA, Ronichevskaya GM. Effectof deoxyribonuclease on the course of lymphatic leukaemia in AKRmice. Nature 1967;214:100–2.

33. Patutina O, Mironova N, Ryabchikova E, Popova N, Nikolin V, KaledinV, et al. Inhibition of metastasis development by daily administration ofultralow doses of RNase A and DNase I. Biochimie 2011;93:689–96.

34. Wen FS, White GJ, VanEtten HD, Xiong ZG, Hawes MC. ExtracellularDNA is required for root tip resistance to fungal infection. Plant Physiol2009;151:820–9.

35. Swarup V, RajeswariMR. Circulating (cell-free) nucleic acids—a prom-ising, non-invasive tool for early detection of several human diseases.Febs Lett 2007;581:795–9.

36. Shimizu N. Molecular mechanisms of the origin of micronuclei fromextrachromosomal elements. Mutagenesis 2011;26:119–23.

37. Pisetsky DS, Gauley J, Ullal AJ. Microparticles as a source of extra-cellular DNA. Immunol Res 2011;49:227–34.

38. Chang P, Li YN, Li DH. Micronuclei levels in peripheral blood lympho-cytes as a potential biomarker for pancreatic cancer risk. Carcinogen-esis 2011;32:210–5.

39. Aggarwal SK, Wagner RW, McAllister PK, Rosenberg B. Cell-surface-associated nucleic-acid in tumorigenic cells made visible with plati-num-pyrimidine complexes by electron-microscopy. Proc Natl AcadSci U S A 1975;72:928–32.

40. Juckett DA, Rosenberg B. Actions of cis-diamminedichloroplatinumon cell-surface nucleic-acids in cancer-cells as determined by cellelectrophoresis techniques. Cancer Res 1982;42:3565–73.

41. Russell JL, Golub ES. Leukemia in AKR mice—defined suppressorcell-population expressing membrane-associated DNA. Proc NatlAcad Sci U S A 1978;75:6211–4.

42. MatsuoY,Ochi N, Sawai H, YasudaA, TakahashiH, Funahashi H, et al.CXCL8/IL-8 and CXCL12/SDF-1 alpha co-operatively promote inva-siveness and angiogenesis in pancreatic cancer. Int J Cancer2009;124:853–61.

43. Tian J, Avalos AM, Mao SY, Chen B, Senthil K, Wu H, et al. Toll-likereceptor 9-dependent activation by DNA-containing immune com-plexes is mediated by HMGB1 and RAGE. Nat Immunol 2007;8:487–96.

44. Matsuo Y, Campbell PM, Brekken RA, Sung B, Ouellette MM, FlemingJB, et al. K-Ras promotes angiogenesis mediated by immortalizedhuman pancreatic epithelial cells through mitogen-activated proteinkinase signaling pathways. Mol Cancer Res 2009;7:799–808.

45. Rial NS, Lazennec G, Prasad AR, Krouse RS, Lance P, Gerner EW.Regulation of deoxycholate induction of CXCL8 by the adenomatouspolyposis coli gene in colorectal cancer. Int J Cancer 2009;124:2270–80.

46. Mizukami Y, JoWS, Duerr EM, GalaM, Li J, Zhang X, et al. Induction ofinterleukin-8 preserves the angiogenic response in HIF-1 alpha-defi-cient colon cancer cells. Nat Med 2005;11:992–7.

47. Arenberg DA, Kunkel SL, Polverini PJ, Glass M, Burdick MD, StrieterRM. Inhibition of interleukin-8 reduces tumorigenesis of human non–small cell lung cancer in SCID mice. J Clin Invest 1996;97:2792–802.

48. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation.Cell 2011;144:646–74.

49. Talmadge JE, Fidler IJ. AACR centennial series: the biology of cancermetastasis: historical perspective. Cancer Res 2010;70:5649–69.

50. Lefebure B, Charbonnier F, Di Fiore F, Tuech JJ, Le Pessot F,Michot F,et al. Prognostic value of circulating mutant DNA in unresectablemetastatic colorectal cancer. Ann Surg 2010;251:275–80.

Wen et al.





2013;73:4256-4266. Published OnlineFirst May 30, 2013.Cancer Res Fushi Wen, Alex Shen, Andrew Choi, et al. MetastasisExtracellular DNA in Pancreatic Cancer Promotes Cell Invasion and

Updated version

10.1158/0008-5472.CAN-12-3287doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2013/05/30/0008-5472.CAN-12-3287.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/73/14/4256.full#ref-list-1

This article cites 50 articles, 12 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/73/14/4256.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/73/14/4256To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-12-3287

http://cancerres.aacrjournals.org/content/suppl/2013/05/30/0008-5472.CAN-12-3287.DC1

http://cancerres.aacrjournals.org/content/73/14/4256.full#ref-list-1

http://cancerres.aacrjournals.org/content/73/14/4256.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/73/14/4256


extracellular dna in pancreatic cancer promotes cell ... · molecular and cellular pathobiology...

Documents