Proc. Natl. Acad. Sci. USAVol. 87, pp. 9168-9172, December 1990Biochemistry

Cloned yeast and mammalian transcription factor TFIID geneproducts support basal but not activated metallothioneingene transcriptionRAVI KAMBADUR, VALERIA CULOTTA, AND DEAN HAMER

Laboratory of Biochemistry, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892

Communicated by Philip Leder, September 6, 1990

ABSTRACT Transcription factor 1ID (TFIID), the"TATA binding factor," is thought to play a key role in theregulation of eukaryotic transcriptional initiation. We havestudied the role of TFIID in the transcription of the yeastmetallothionein gene, which is regulated by the copper-dependent activator protein ACEL. Both basal and inducedtranscription of the metallothionein gene require TFIID and afunctional TATA binding site. Crude human and mouse TFIuDfractions, prepared from mammalian cells, respond to stimu-lation by ACEL. In contrast, human and yeast TFIID proteinsexpressed from the cloned genes do not respond to ACE1,except in the presence ofwheat germ or yeast total cell extracts.These results indicate that the cloned TFIHD gene products lacka component(s) or modification(s) that is required for regulatedas compared to basal transcription.

The regulated transcription of eukaryotic coding genes re-quires both gene-specific factors that recognize specific DNAsequence motifs and general initiation factors that interactwith common core promoter elements. The best character-ized of the general factors is transcription factor IID (TFIID;also known as BTF1 or DB), which binds to the "TATA box"sequences typically found between positions -60 to -120 foryeast genes and at about position -30 for higher eukaryoticgenes (1-5). The consensus binding sequence for TFIID isTATAAA/T (2, 6, 7), but a variety of other sequences arealso recognized with various affinities (8). The binding ofTFIID to the TATA sequence is an early step in the formationof an active transcription complex (9, 10).

Until recently, it was difficult to study the precise role ofTFIID in transcriptional regulation because of its low abun-dance and difficulty of purification. The discovery that theyeast Saccharomyces cerevisae contains an abundant activ-ity that can functionally substitute for mammalian TFIID inthe transcription of minimal promoter templates (11-13)allowed the purification and cloning of a gene encoding a27-kDa yeast polypeptide that possesses transcriptional com-plementation and specific TATA-binding activities (14-18).This polypeptide is encoded by the SPT15 locus, which isessential for normal yeast cell growth and is known to beinvolved in transcription by virtue of the suppression of Tyelement promoter insertions by certain alleles (15). The S.cerevisae gene has been used to clone homologous sequencesfrom fission yeast, Neurospora, Drosophila, and humans(19-22). The human gene encodes a 37.5-kDa polypeptidethat possesses TATA-binding activity and complements aTFIID-depleted human extract for transcription from theadenovirus E1B promoter. The yeast and human proteins are80% homologous in the carboxyl-terminal 181 amino acidsbut highly divergent in the amino-terminal region.

We have studied the role of TFIID in the transcription andregulation of the CUPI gene of S. cerevisae. The CUPI geneencodes a small Cu-binding metallothionein that protectscells against Cu toxicity (23). At low, physiological concen-trations of Cu, the CUPI gene is transcribed at a low basallevel, whereas at high potentially toxic concentrations of Cu,transcription is strongly induced. This response is mediatedby the ACEl protein (ref. 24; referred to as CUP2 in refs. 25and 26). ACEl consists of two domains: an amino-terminalCu-dependent DNA binding domain and a carboxyl-terminalacidic activation domain (27). At low Cu concentrations,ACEl is constitutively synthesized but cannot specificallybind DNA because it is unfolded. In the presence of excessCu, the amino-terminal domain undergoes a conformationalswitch that allows it to specifically bind to multiple sites in theupstream activation region (UAS) (27). Once bound to thepromoter, ACEl activates transcription by stimulating theformation of a committed transcription complex (28). Al-though the activation of CUPI gene transcription by ACElhas been studied both genetically and biochemically (23-31),no information is available on the role ofgeneral transcriptionfactors in this process. Here we show by genetic analysis, invitro transcription reactions, and DNase protection experi-ments that the transcription of the CUPI gene requiresTFIID. However, the cloned yeast and human TFIID geneproducts alone are incapable of activation by ACEl, sug-gesting that they lack a component(s) or modification(s)required for transcriptional regulation.

MATERIALS AND METHODSMutagenesis, Plasmid Constructions, and in Vivo Assays.

Site-directed mutagenesis was performed by the method ofVandeyar et al. (32). For in vivo assays, the mutagenizedpromoters Were subcloned into the galK indicator plasmidYSK57 and transformed into yeast strain BR10 for galactoki-nase assays (27). For in vitro analyses, the mutagenizedpromoters were subcloned into p8CAT (28).The construction of ATATAA was similar to that of

5'A34CAT (33) except that the inserted oligonucleotide con-tained a Pst I site in place of the TATA sequence atnucleotides -24 to -29 and that the vector was UASc:mTATA:CAT (28). TATAA* and TAGGG* were con-structed by inserting the appropriate oligonucleotides into thePst I site of the ATATAA vector. In these latter constructs,the TATAA or TAGGG sequences are 7 base pairs (bp)upstream ofthe TATAA sequence in the wild-type promoter.

Preparation of Cloned TFIID and ACEl Proteins and Foot-printing Reactions. Yeast TFIID was prepared either by SP6polymerase transcription of pSH227 followed by translationin a reticulocyte lysate (16) or from Escherichia coli carryingthe yeast TFIID gene expression plasmid pASY2D (18). The

Abbreviations: TFIID, TFIIA, etc., transcription factor lID, tran-scription factor IIA, etc., respectively; UAS, upstream activationregion.

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

9168

Proc. Natl. Acad. Sci. USA 87 (1990) 9169

bacterial TFIID was purified by the method of Buratowski etal. (12) through the Mono S stage. Human TFIID wasprepared by bacteriophage T3 RNA polymerase transcriptionof pKB104 followed by translation in a reticulocyte lysate(19). ACE1 protein was prepared either by translation in awheat germ extract (27, 28) or by overproduction in bacteriausing a phage T7 vector (D.H. and S. Hu, unpublished data).The bacterial Cu-ACE1 was purified by heparin-Sepharose,CM-Sepharose, and Sephadex G-75 chromatography.DNase I footprinting reactions (50 ,ul) Contained 20 mM

Tris HCI (pH 8.0), 10% (vol/vol) glycerol, 0.01% NonidetP-40, 1 mM 2-mercaptoethanol, 5 mM MgSO4, 2.5 mM CaC12,1% polyvinyl alcohol, 20 pg of poly(dG-dC), 5 fmol (10,000cpm) of end-labeled DNA probe, and an amount of bacteri-ally produced yeast TFIID predetermined to give an optimalfootprint over the TATA box. The reaction mixtures wereprocessed as described (8).

In Vitro Transcription and Preparation of TFYI Fractions.In vitro transcription reactions using a mouse nuclear extractwere performed and assayed by primer extension as de-scribed (28). TFIID-depleted extracts were prepared bypassing the nuclear extract, adjusted to 475 mM KCI, over aphosphocellulose column and collecting the flow-throughfraction. A crude mouse TFIID fraction was obtained byelution of the phosphocellulose column with 800 mM KCl.The factor was further purified and concentrated by heparin-Sepharose chromatography (34). A crude human TFIIDfraction was similarly prepared from a HeLa cell transcrip-tion extract.

Micrococcal nuclease-treated wheat germ extract was pur-chased from Amersham. Yeast whole-cell extracts wereprepared by the method of Hahn and Guarente (35).

RESULTSCUP) Gene Transcription Requires a Functional TATA

Sequence. To begin our analysis of the role ofTFIID in yeastmetallothionein gene transcription, we determined whetheror not CUPI gene expression requires a TATA sequence.The CUPI sequence is as follows:

Table 1. Expression of TATA sequence mutants in vivo

GalK activityMutant Sequence - Cu + Cu

Wild type 11 ± 2 100 ± 8 (n = 3)-93/G -95/TAGGGA 12 ± 2 124 ± 9 (n = 3)-75/GG -77/TAGGAA 1 ± 0.4 7 ± 3 (n = 6)-43/GG -45/TAGGAA 7 ± 3 123 ± 15 (n = 5)-31/GG -33/TAGAT 10 ± 1 95 ± 9 (n = 2)-72/G -77/TATAAG 8 ± 2 108 ± 19 (n = 4)

Names and the sequences of the mutant derivatives are shown aswell as the relative galK expression levels for the mutants. Data arenormalized to a value of 100 for the wild-type promoter in thepresence of Cu. Values are the mean ± SD for n transformants.

initiation site at position +1. Fig. lA shows that the -77/TAGGAA mutant abolished this transcript whereas muta-tions in the -43 and -31 sequences had no effect. Mutationof the -93 sequence also had no effect (data not shown).Interestingly, the -77/TATAAG mutation had a 2- to 4-foldincreased level of transcription, both in this experiment andin assays using TFIID-depleted extract supplemented witheither yeast or mouse TFIID (see below). These results showthat the CUPI gene requires one specific TATA sequence,located at a typical distance from the initiation site for yeast,for efficient basal and Cu-induced transcription in vivo and invitro.The requirement for a TATA sequence was further studied

using hybrid promoters containing a functional yeast up-stream activation region, UASc, linked to TATA and initia-tion sequences derived from the mouse metallothionein Igene (28). Fig. 1B shows that a construct carrying thewild-type mouse sequences gave rise to a transcript with thesame initiation site as for the mouse metallothionein I gene invivo (33). Replacement of the TATA sequence by a Pst I site,

Ao

co C)Cb c) C:' C,

M ; / / t'Cu: -+-+-+-+-+

181 tt.P*Aw ....:: .:.......

-93 -75

TATGGATTGTCAGAATCATATAAAAGAGAAGCAAA-43 -31

TAACTCCTTGTCTTGTATCAATTGCATT&TAATAT

The CUPI gene promoter contains four potential TATAsequences between the UAS and the initiation site (boldtype). The initiation site in yeast is at position +1 and theUASc region is between positions -145 and -104. Each sitewas altered to TAGGXX, mobilized into a CUPJ:galK plas-mid containing the intact CUPI promoter, and assayed forgalK activity in cells grown in the presence or absence of Cu(27). Mutation of the sequence -77/TATAAA to the non-consensus sequence -77/TAGGAA greatly diminished tran-scription from the CUPI promoter. The levels of bothCu-induced and basal expression were reduced by >10-fold(Table 1). In contrast, mutation of this sequence toTATAAG, which has been shown to be functional in com-bination with certain UAS elements (36), had no significanteffect on expression in vivo. Mutations at the TATA-likesequences at positions -93, -43, and -31 also did notsignificantly affect expression.The importance of the -77/TATAAA sequence for CUP!

gene transcription was also tested in vitro using a nuclearextract from mouse. We have shown (28) that this heterolo-gous extract can specifically transcribe the CUPI gene in thepresence of the ACE1 regulatory factor and Cu ions, that thetemplate is transcribed only once, and that the major tran-script initiates at position -47 relative to the Yeast in vivo

Bvf. V

Cu: - + - + - + - + - + M

104-..4-1114-104

FIG. 1. Analysis of TATA mutants in vitro. (A) CUP1:CATconstruct (lanes wt) and its mutant derivatives, as indicated, weretranscribed in a complete mouse extract supplemented with invitro-synthesized apoACE1 in the presence (+) or absence (-) of 35,uM Cu-acetonitrile as described (28). The arrow marks the positionof the 181-nucleotide product of CUP1:CAT transcription. Thesequences of the mutants are shown in Table 1. (B) UASc:mTATA:CAT construct (lanes wt) and its mutant derivatives were transcribedin the presence (+) or absence (-) of Cu-acetonitrile as above. Thearrows mark the 104- and 111-nucleotide transcription products ofUASc:mTATA:CAT and UASc:TATAA*:CAT, respectively. M isMsp l-digested pBR322 fragments with sizes of 160, 147, 123, 110,and 90 bp.

Biochemistry: Kambadur et al.

T 00"'T, 0

p /,T AT

9170 Biochemistry: Kambadur et al.

generating construct ATATAA, completely abolished thistranscript. In construct TATAA*, in which the TATAAsequence is restored in a position 7 bp upstream of its normalsite and with altered flanking sequences, transcription wasrestored to 10% of the wild-type level and the initiation sitewas shifted -7 bp upstream. In contrast, a construct with themutant sequence TAGGG inserted at this position did notrestore transcription. These results show that the yeastTATA sequence can be functionally replaced by a mouseTATA sequence in vitro and that the position of this sequencesets the initiation site in a mammalian extract.Binding of TFIID to the TATA Sequence. To determine if

the functional TATA sequences act as binding sites forTFIID, we performed DNase I footprinting experimentsusing yeast TFIID produced in bacteria. Fig. 2A shows thatyeast TFIID strongly protected the CUP] promoter over a16-bp region (positions -79 to -64) encompassing the func-tidnal TATA sequence -77/TATAAA. Protection was alsoobserved over -33/TATAAT and other A+T-rich sequencesin some experiments, but only at higher protein concentra-tions than were required to protect the -77/TATAAA se-quence. Altering the -77/TATAAA sequence to the non-functional sequence TAGGAT completely eliminated thefootprint.

Similar experiments using the UASc-mouse metallothio-nein I hybrid promoters are shown in Fig. 2B. TFIID, at anappropriate concentration, strongly protected the mousepromoter for =20 bp (positions - 36 to -17) centered over the-29/TATAAA sequence. Deletion of the TATAA sequenceeliminated the footprint whereas replacement with TATAA*resulted in a somewhat weaker footprint appropriatelyshifted upstream. The nonfunctional TAGGG* mutant gaveno footprint. These results show that TFIID binds to the

functional TATA sequences and that there is complete cor-relation between the TATA sequence requirements for tran-scription in vivo and in vitro and for TFIID binding activity.TFIID Requirement for in Vitro Transcription and Regula-

tion by ACEL. To further study the dependence ofCUPI genetranscription on the TFIID factor, in vitro transcriptionreactions were performed using a TFIID-depleted extract andvarious sources of TFIID. The mouse transcription extractwas passed over a phosphocellulose column to separate a0.475 M KCI fraction containing RNA polymerase II andfactors TFIIA, TFIIB, and TFIIE/F from a 0.8 M KCIfraction containing the TFIID factor and other polypeptides

ACu:.

apoACEl:TFIID:

B+ + l.

+ .- . LI

M M M)m) (m) (m)

CuACEl:

TFIID: Y Nr H H M M(r it)(r) (r) (m) inm

*MO P* * -

1 2 3 4 5

CCuACEl:

TFIID:

1 2 3 4 5 6 7 8

D Con WGX

+ - + CuACE1: 4

H H HHHM M TFIID: Y Y Y Y(r) (r) (h) (h) (m) (m) (b) (b) (b) t

YX Con,

y y y )b(b) (bi i5lb)b~

A

(3(3

TEIID

A. w MB± *-±

M -@ ,;; At Act

H1ar_HiIO

-W

VIG. 2. Binding of TFMID to the TATA box. (A) Binding to theCUP] promoter. Reaction mixtures contained (+) or lacked (-)

bacterially produced yeast TFIID as indicated. The probes were

prepared by cutting CUP1:CAT or the -75/GG mutant with HindIIIat position +52, end-labeling with [32P]ATP and T4 polynucleotidekinase, and recutting with Spe I at position -227. Lane M containsMsp I-digested pBR322 end-labeled fragments as markers. Theposition of the -77/TATAAA sequence is indicated. (B) Binding tohybrid 'promoters. The probes were prepared by cutting UASc:mTATA:CAT or its mutant derivatives with HindlII at position + 18,end-labeling with [32P]ATP and T4 polynucleotide kinase, and re-

cutting with EcoRI upstream of UASc. The positions of the -29/TATAA sequence and the -35/TATAA* sequences are shown.

1 2 3 4 5 6 l 2 3 4 5 6 11 8

FIG. 3. In vitro transcription using various sources of TFI1D. (A)TFIID is required for in vitro transcription. UASc:mTATA wastranscribed in a TFIID-depleted mouse extract containing (+) orlacking (-) apoACE1 translated in a wheat germ translation mixture(28), 35 ttM Cu-acetonitrile, and 5 ,ul of mammalian TFIID obtainedby phosphocellulose chromatography of a mouse nuclear extract.CON, transcription in the complete nuclear extract in the presenceof apoACE1 and Cu. (B) Transcription with cloned human and yeastTFIID gene products compared to a mouse TFIID fraction. Tran-scription of UASc:mTATA in the TFIID-depleted extracts wasconducted in the presence (+) or absence (-) of 1 ,ul of Cu-ACE1purified from an overproducing bacterial strain. Lanes 1-6 containreaction mixtures supplemented with 10 Al of reticulocyte lysatetranslation mixture programmed with yeast [Y(r)] or human [H(r)] orno (-) TFIID mRNA to give a final concentration of TFIID proteinof 5 fmol/Al, as estimated by SDS/gel electrophoresis and scintil-lation counting. Lanes 7 and 8 contain reaction mixtures supple-mented with 1 .lI of mouse TFIID [M(m)] obtained by phosphocel-lulose and heparin-Sepharose chromatography of a mouse L cellnuclear extract. (C) Transcription with cloned human TFIID versusa human TFIID fraction. Transcription reaction mixtures, as in Fig.2B, contained (+) or lacked (-) Cu-ACE1 and were supplementedas indicated with TFIID translated in a reticulocyte lysate [H(r)],human TFIID from HeLa cells [H(h)], or mouse TFIID from L cells[M(m)]. Lanes 1 and 2 contained 5 .lI of a reticulocyte lysateprogrammed with human TFIID mRNA, lanes 3 and 4 contained 5 IL1of human HeLa cell TFIID fraction, and lanes 5 and 6 contained 1 A.1of mouse L cell TFIID fraction. (D) Reconstitution of regulatedtranscription with the cloned TFIID gene product. The transcriptionreaction mixtures containing 0.5 ul of bacterially produced yeastTFIID and containing (+) or lacking (-) bacterially producedCu-ACE1 were further supplemented as indicated with 2 ul of awhole cell extract from either wheat germ (WGX) or yeast (YX) cellsor with extract buffer (Con).

Proc. Natl. Acad. Sci. USA 87 (1990)

Proc. Natl. Acad. Sci. USA 87 (1990) 9171

(34). Fig. 3A shows an experiment in which the TFIID-depleted 0.475 M KCI fraction was supplemented with var-ious combinations of the crude TFIID fraction, apoACE1protein (translated in a wheat germ extract), and Cu. Only inthe presence of all three components was efficient transcrip-tion observed, and the ratio of transcription with and withoutACEl protein was >10-fold. Similar results were obtainedusing bacterially produced highly purified Cu-ACE1 and themouse TFIID fraction further purified by heparin-Sepharosechromatography (Fig. 3B, lanes 7 and 8) or a human TFIIDfraction from HeLa cells (Fig. 3C, lanes 3 and 4). Again,efficient transcription was observed only in reaction mixturescontaining both TFIID and Cu-ACE1, and the stimulation oftranscription obtained with ACEl was >10-fold.

Quite different results were obtained when cloned humanor yeast TFIID gene products were used in place ofthe TFIIDfractions from mammalian cells. Fig. 3B shows that thehuman and yeast factors, translated in a reticulocyte lysate,gave rise to a basal level of transcription that was readilydetected compared to reaction mixtures supplemented with acontrol reticulocyte lysate (lanes 3-6 versus lanes 1 and 2).The basal level of transcription supported by the clonedTFIID proteins was 5-fold higher than that obtained with theconcentration of crude mouse TFIID fraction used in thisexperiment (lane 7); however, since the amount of TFIIDpolypeptide present in the mouse fraction was not determinedand since TFIID was limiting in these reactions (see below),the relative efficiencies for basal transcription cannot bequantitatively compared. The addition of Cu-ACE1 to reac-tion mixtures containing the cloned TFIID proteins did notaffect transcription, even though it strongly stimulated tran-scription in parallel reactions containing the mouse TFIIDfraction (lanes 7 and 8). This was not due to an ACEl inhibitorin the reticulocyte lysate, since reactions containing themouse TFIID fraction showed a good response to ACEl inthe presence of an equivalent amount of lysate (data notshown). The lack of response of the cloned TFIID proteins toACEl could in principle be due to a species difference sincethe cloned proteins were obtained from human or yeastwhereas the crude fraction was obtained from mouse. To testthis possibility, we compared cloned human TFIID to ahuman TFIID fraction from HeLa cells. Fig. 3C shows thatreaction mixtures containing the human TFIID fraction re-sponded well to ACEl whereas reaction mixtures containinghuman TFIID synthesized in vitro gave a high basal level oftranscription and failed to respond to ACEL.These results led us to consider the possibility that the

cloned TFIID gene products lack a component(s) or modifi-cation(s) that is necessary for activation by Cu-ACE1. Torestore regulation, we supplemented reaction mixtures con-taining bacterially produced yeast TFIID with whole cellwheat germ or yeast extracts (Fig. 3D). In both cases, theextracts strongly reduced the level of basal transcription andpartially restored regulation by Cu-ACE1. The levels ofCu-ACE1 stimulation in such reactions were typically 4- to7-fold, compared to 10- to 50-fold in reaction mixturescontaining the crude human or mouse TFIID fractions. Theactivity in the wheat germ extract appeared to be labile as itwas destroyed by a 1-hr incubation at room temperatureunder translation conditions (data not shown).A trivial explanation for the above results could be that the

cloned TFIID polypeptides were present in excess, therebyeliminating the need for ACEL. Table 2 shows that this wasnot the case. Even in reaction mixtures containing lowconcentrations of bacterially produced yeast TFIID or of invitro-synthesized human TFIID, such that basal transcriptionlevels were close to those observed with the mouse andhuman TFIID fractions, the addition of ACEl stimulatedtranscription no more than 1.8- to 2.5-fold. This shows thatthe lack of regulation in reactions programmed with the

Table 2. In vitro transcription with various concentrations ofcloned TFIID gene products

ACE+

Exp TFIID - + ratioA Mouse (m) (1.8 Al) 2 100 50

Yeast (b) (0.04 Al) 0.8 1.4 1.8Yeast (b) (0.5 Al) 61 79 1.3

B Human (h) (5 Al) 4 100 25Human (r) (1 ,ul) 6 15 2.5Human (r) (10 AI) 38 27 0.7

Transcription reactions, as in Fig. 3, contained or lacked Cu-ACE1 purified from bacteria and the indicated amount of mouseTFIID fraction from L cells (mouse), yeast TFIID from bacteria(yeast), human TFIID fraction from HeLa cells [human (h)], orhuman TFIID translated in a reticulocyte lysate [(human (r)]. Tran-scription levels were quantitated by laser densitometry of the auto-radiogram and normalized to a value of 100 for mouse TFIID in thepresence of ACEL. m, from mouse; b, from bacteria.

cloned TFIID polypeptides is not simply due to the presenceof excess transcription factor.

DISCUSSIONWe have shown that the transcription of the yeast metal-lothionein gene requires the general transcription factorTFIID and its TATA binding site. Evidence for the criticalrole of TFIID is 3-fold. (i) Mutations in the -77/TATAAAsequence of the CUPI promoter or in the -29/TATAAAsequence of a yeast-mouse hybrid promoter greatly reducetranscription. (ii) In vitro transcription of the yeast andhybrid metallothionein genes in a TFIID-depleted cell extractrequires the addition of TFIID, which can be supplied eitherfrom mammals or yeast. (iii) Yeast TFIID binds to thefunctional TATA sequences of the yeast and hybrid promot-ers but not to nonfunctional mutant derivatives.

In vitro transcription reaction mixtures containing crudehuman or mouse TFIID fractions showed a strong responseto ACEl whereas reaction mixtures containing cloned humanand yeast TFIID proteins did not. In addition, the clonedproteins gave higher basal levels of transcription than thecrude fractions under the reaction conditions typically used.The lack of responsiveness of the cloned TFIID was not duesolely to species differences since this effect was observedusing cloned and crude TFIID both derived from human. Itwas also not due to saturation of the reactions with TFIID,since equivalent results were obtained over a range of factorconcentrations. Rather, we propose that the cloned geneproducts lack a component(s) or modification(s) required forregulated as compared to basal transcription. Three specu-lations concerning the nature of this "missing link" areshown in Fig. 4 and discussed below.As shown in Fig. 4A, there could be a "bridge protein(s)"

or "coactivator(s)" that is present in the mammalian-cellTFIID fractions but not in the cloned gene products. Thefunction of the "bridge protein" would be to mediate inter-actions between ACEl and TFIID, whereas a "coactivator"might also contact additional transcription factors. This classof model would explain why transcription reaction mixturescontaining the cloned TFIID proteins do not respond tostimulation by ACEL.As shown in Fig. 4B, there could be an "anti-TFIID

protein(s)" whose negative effect on TFIID is alleviated byACEL. Such a protein could, for example, block the activa-tion function ofTFIID in the absence ofACE1, similar to theability of GAL80 to block GAL4 in the absence of galactose(37). Alternatively, the protein could specifically or nonspe-cifically bind to the TATA sequence, thereby restrictingaccess ofTFIID to the template unless ACEl is present. This

Biochemistry: Kambadur et al.

9172 Biochemistry: Kambadur et al.

A

Bridge or Coactivator

AC'E IE IF UASc 1 TATA

BAnut' i/Anti

VTFIIDe lTEIIDj

ACEI1i AEftUASc

c

ACE _

UASc

FIG. 4. (A-C) Three speculative models (described in text) fortranscription regulation by ACE1 and TFIID.

model would explain why the cloned TFIID proteins givehigher basal transcription levels than the mammalian cellfractions and why yeast and wheat germ whole cell extractsrepress basal transcription and partially restore ACEl regu-

lation.As shown in Fig. 4C, TFIID might undergo a modifica-

tion(s) that is necessary for regulation by ACEL. For exam-

ple, TFIID might undergo a critical phosphorylation or

glycosylation that does not occur in bacteria or in thereticulocyte lysate. Alternatively, TFIID might undergo a

modification, such as multimerization, which allows it to bindto promoter sites other than the TATA sequence; in this case,

the function ofACEl might be to displace or transport TFIIDto the functional TATA sequence.

Our results clearly show that TFIID can support basaltranscription independently of its ability to respond to ACEL.The availability of pure TFIID and ACEl proteins may

facilitate the search for additional TFIID cofactors, subunits,or modifying activities that mediate interaction with this typeof acidic activator protein. After this paper was submitted, itwas reported that transcriptional activation by the Spl, CTF,and USF factors also requires "coactivator" or "adaptor"proteins and that different cofactors may be involved fordifferent classes of activator protein (38-41). It was alsoshown that a GAL4-VP16 hybrid protein can repress acti-vated transcription from an unrelated UAS sequence, pre-

sumably by titrating a positively acting TFIID cofactor as

proposed in Fig. 4A (42, 43). Our results do not rule out thepossibility that TFIID can interact with acidic activatorproteins directly (44), since transcription might require an-

other factor to activate or different activators might havedifferent factors. Rather, they suggest that different types ofinteractions between TFIID and activator proteins contributeto the diversity of eukaryotic transcriptional regulation.

R.K. and V.C. contributed equally to this paper. We thank C. Kao,M. Schmidt, and A. Berk for providing the human TFIID clone priorto publication and for the yeast TF1ID clone, S. Hahn for the yeast

TF1ID in vitro transcription plasmid, and M. Falzon for HeLa cell

transcription extract. We thank C. Klee, Carl Wu, members of theHamer lab, and the reviewers for comments on the manuscript.

1. Breathnach, R. & Chambon, P. (1981) Annu. Rev. Biochem. 50,349-383.

2. Chen, W. & Struhl, K. (1985) EMBO J. 4, 3273-3280.3. Hahn, S., Hoar, E. & Guarente, L. (1985) Proc. Natl. Acad. Sci.

USA 82, 8562-8566.4. Nagawa, F. & Fink, G. (1985) Proc. Natl. Acad. Sci. USA 82,

8557-8561.5. McNeil, J. B. & Smith, M. (1986) J. Mol. Biol. 187, 363-378.6. Myers, R., Tilly, K. & Maniatis, T. (1986) Science 232, 613-618.7. Chen, W. & Struhl, K. (1988) Proc. Natl. Acad. Sci. USA 85,

2691-2695.8. Hahn, S., Buratowski, S., Sharp, P. & Guarente, L. (1989) Proc.

Natl. Acad. Sci. USA 86, 5718-5722.9. Buratowski, S., Hahn, S., Guarente, L. & Sharp, P. (1989) Cell 56,

549-561.10. Workman, J., Roeder, R. & Kingston, R. (1990) EMBO J. 9,

1299-1308.11. Cavallini, B., Huet, J., Plassat, J., Sentenac, A., Elgy, J. &

Chambon, P. (1988) Nature (London) 334, 77-80.12. Buratowski, S., Hahn, S., Sharp, P. & Guarente, L. (1988) Nature

(London) 334, 37-42.13. Horikoshi, M., Wang, C., Fujii, H., Cromlish, J., Wei, P. & Roeder,

R. (1989) Proc. NatI. Acad. Sci. USA 86, 4843-4847.14. Cavallini, B., Faus, I., Matthes, H., Chipoulet, J., Winsor, B., Elgy,

J. & Chambon, P. (1989) Proc. Natl. Acad. Sci. USA 86,9803-9807.15. Eisenmann, D. M., Dollard, C. & Winston, F. (1989) Cell 58,

1183-1191.16. Hahn, S., Buratowski, S., Sharp, P. & Guarente, L. (1989) Cell 58,

1173-1181.17. Horikoshi, M., Wang, C., Fujii, H., Cromlish, J., Weil, P. &

Roeder, R. (1989) Nature (London) 341, 299-303.18. Schmidt, M., Kao, C., Pei, R. & Berk, A. (1989) Proc. Natl. Acad.

Sci. USA 86, 7785-7789.19. Kao, C., Lieberman, P., Schmidt, M., Zhou, Q., Pei, R. & Berk, A.

(1990) Science 248, 1646-1650.20. Lewin, B. (1990) Cell 61, 1161-1164.21. Fikes, J., Becker, D., Winston, F. & Guarente, L. (1990) Nature

(London) 346, 291-294.22. Hoffmann, A., Horikoshi, M., Wang, C., Schroeder, S., Weil, P. &

Roeder, R. (1990) Genes Dev. 4, 1141-1148.23. Hamer, D., Thiele, D. & Lemont, J. (1985) Science 228, 685-690.24. Thiele, D. (1988) Mol. Cell. Biol. 8, 2745-2752.25. Welch, J., Fogel, S., Buchman, C. & Karin, M. (1989) EMBO J. 8,

255-260.26. Buchman, C., Skroch, P., Welch, J., Fogel, S. & Karin, M. (1989)

Mol. Cell. Biol. 9, 4091-4095.27. Furst, P., Hu, S., Hackett, R. & Hamer, D. (1988) Cell 55,705-717.28. Culotta, V. C., Hsu, T., Hu, S., Furst, P. & Hamer, D. (1989) Proc.

Natl. Acad. Sci. USA 86, 8377-8381.29. Furst, P. & Hamer, D. (1989) Proc. Natl. Acad. Sci. USA 86,

5267-5271.30. Huibregtse, J. M., Engelke, D. & Thiele, D. (1989) Proc. NatI.

Acad. Sci. USA 85, 65-69.31. Szczypka, M. & Thiele, D. (1989) Mol. Cell. Biol. 9, 421-429.32. Vandeyar, M. A., Werner, M., Hutton, C. & Batt, C. (1988) Gene

65, 129-123.33. Culotta, V. C. & Hamer, D. (1989) Mol. Cell. Biol. 9, 1376-1380.34. Dignam, J., Martin, P., Shastry, B. & Roeder, R. (1983) Methods

Enzymol. 101, 582-598.35. Hahn, S. & Guarente, L. (1988) Science 240, 317-319.36. Harbury, P. A. & Struhl, K. (1989) Mol. Cell. Biol. 9, 5298-5304.37. Ptashne, M. (1988) Nature (London) 335, 683-689.38. Peterson, M., Tanese, N., Pugh, B. & Tjian, R. (1990) Science 248,

1625-1630.39. Hoey, T., Dynlacht, B., Peterson, M., Pugh, B. & Tjian, R. (1990)

Cell 61, 1179-1186.40. Pugh, B. & Tjian, R. (1990) Cell 61, 1187-1197.41. Hoffmann, A., Sinn, E., Yamamoto, T., Wang, J., Roy, A.,

Horikoshi, M. & Roeder, R. G. (1990) Nature (London) 346, 387-390.

42. Berger, S., Cress, W., Cress, A., Trizenberg, S. & Guarente, L.(1990) Cell 61, 1199-1208.

43. Kelleher, R., Flanagan, P. & Kornberg, R. (1990) Cell 61, 1209-1215.

44. Stringer, K., Ingles, C. & Greenblatt, J. (1990) Nature (London)345, 783-786.

Proc. Natl. Acad Sci. USA 87 (1990)