familial primary ovarian insufficiency associated with a ... · 3 31. abstract . 32 objective: to...

1

Familial primary ovarian insufficiency associated with 1

a SYCE1 point mutation: 2

Defective meiosis elucidated in humanized mice 3

4

Short title: SYCE1 point mutation causing POI 5

6

Diego Hernández-López,a Adriana Geisinger,a,b María Fernanda Trovero,c 7

Federico F. Santiñaque,d Mónica Brauer,e Gustavo A. Folle,c,d Ricardo 8

Benavente,f* and Rosana Rodríguez-Casuriaga.a,b* 9

10

a Department of Molecular Biology, Instituto de Investigaciones Biológicas 11

Clemente Estable, Montevideo, Uruguay. 12

b Biochemistry-Molecular Biology, Facultad de Ciencias, Universidad de la 13

República, Montevideo, Uruguay. 14

c Department of Genetics, Instituto de Investigaciones Biológicas Clemente 15

Estable, Montevideo, Uruguay. 16

d Flow Cytometry and Cell Sorting Core, Instituto de Investigaciones Biológicas 17

Clemente Estable, Montevideo, Uruguay. 18

e Department of Cell Biology, Instituto de Investigaciones Biológicas Clemente 19

Estable, Montevideo, Uruguay. 20

f Department of Cell and Developmental Biology, Biocenter, University of 21

Würzburg, Würzburg, Germany. 22

23

.CC-BY-NC-ND 4.0 International licensepreprint (which was not certified by peer review) is the author/funder. It is made available under aThe copyright holder for thisthis version posted February 7, 2020. . https://doi.org/10.1101/2020.02.07.938639doi: bioRxiv preprint

https://doi.org/10.1101/2020.02.07.938639

http://creativecommons.org/licenses/by-nc-nd/4.0/

2

*Corresponding authors: RRC, Department of Molecular Biology, Instituto de 24

Investigaciones Biológicas Clemente Estable, Av. Italia 3318, 11600 25

Montevideo, Uruguay; +59824872605; Email: [email protected] 26

RB, Department of Cell and Developmental Biology, Biocenter, University of 27

Würzburg, D-97074 Würzburg, Germany; Email: [email protected]

wuerzburg.de 29

30


mailto:[email protected]



https://doi.org/10.1101/2020.02.07.938639


3

Abstract 31

Objective: To investigate if nonsense mutation SYCE1 c.613C˃T -found in 32

women with familial primary ovarian insufficiency (POI)- is actually responsible 33

for infertility, and to elucidate the involved molecular mechanisms. 34

Design: As most fundamental mammalian oogenesis events occur during the 35

embryonic phase, thus hindering the study of POI’s etiology/pathogeny in 36

infertile women, we have used CRISPR/Cas9 technology to generate a mouse 37

model line with an equivalent genome alteration (humanized mice). 38

Setting: Academic research laboratories. 39

Interventions: We present the characterization of the biallelic mutant mice 40

phenotype, compared to wild type and monoallelic littermates. 41

Animals: Studies were conducted employing the generated humanized mice. 42

All studies were performed for both genders, except otherwise stated. 43

Main outcome measures: reproductive capability by fertility tests; gonadal 44

histological analysis; evaluation of chromosome synapsis and synaptonemal 45

complex (SC) assembly by immunolocalizations; protein studies by Western 46

blotting; transcript quantification by RT-qPCR. 47

Results: The studied mutation proved to be the actual cause of the infertile 48

phenotype, both in female and male mice homozygous for the change, 49

confirming infertility of genetic origin with a recessive mode of inheritance. The 50

mechanisms that lead to infertility are related to chromosome synapsis defects; 51

no putative truncated SYCE1 protein was observed, and Syce1 transcript was 52

hardly detected in biallelic mutants. 53

Conclusions: We present for the first time the generation of humanized mice to 54

study the actual consequences of a SC component mutation found in women 55


https://doi.org/10.1101/2020.02.07.938639


4

with familial POI. By this approach we could confirm the suspected etiology, and 56

shed light on the underlying molecular mechanism. 57

58

Key words 59

Idiopathic infertility; primary ovarian insufficiency; meiosis; synaptonemal 60

complex; humanized mice. 61

62

Capsule 63

Humanized mice were generated to study the effects on fertility of a mutation in 64

a synaptonemal complex-component-coding gene found in women with familial 65

POI, enabling etiology confirmation and mechanism elucidation. 66

67

68


https://doi.org/10.1101/2020.02.07.938639


5

Introduction 69

Primary ovarian insufficiency (POI) is a clinical syndrome characterized 70

by loss of ovarian activity before the age of 40. It is a heterogeneous condition 71

with a broad phenotypic spectrum, sharing the common feature of ovarian 72

follicle dysfunction or follicle depletion. It can have serious noxious effects upon 73

women's psychological and physical health. POI incidence increases with age, 74

affecting one in every 10,000 women at the age of 20, and 1 in 100 at the age 75

of 40 [1]. Most cases (50–90%) have unknown causes and, therefore, are 76

classified as idiopathic [2]. A significant contribution to idiopathic POI resides in 77

the genetic background of the diagnosed females [3], with 10%–15% of them 78

having an affected first-degree relative [4]. Among the already reported causes 79

of POI, there are alterations in chromosome number and structure (e.g. Turner’s 80

syndrome, 45,X), as well as genomic alterations in 46,XX non-syndromic 81

patients [5-7]. During the last two decades, an increasing number of POI-82

associated genes have been identified both on the X chromosome [e.g. 8-11] 83

and in autosomes [e.g. 8, 12-15], as well as in mitochondrial DNA [16], thus 84

confirming the heterogeneous nature of the genetic causal component. 85

Given the requirement of meiotic divisions for normal gamete formation, 86

it is expected that mutations in meiosis-related genes would account for at least 87

part of the idiopathic infertility cases. Specifically, as due to their importance for 88

recombination and proper chromosome segregation synaptonemal complexes 89

(SCs) are essential structures for gametogenesis progression, alterations in SC-90

coding genes are obvious candidates to be at the groundwork of infertility 91

[revised by 17], and particularly of POI. The SC is a meiosis-specific 92

proteinaceous, ladder-like structure that physically binds together homologous 93


https://doi.org/10.1101/2020.02.07.938639


6

chromosomes, and facilitates the resolution of recombination intermediates [18]. 94

SCs are composed of two lateral elements (LEs), a central element (CE), and 95

transverse filaments (TFs) linking both LEs with the CE. The CE together with 96

the TFs constitute the SC central region (CR). So far, eight different SC protein 97

components have been identified, including LE proteins SYCP3 [19,20] and 98

SYCP2 [21-23], TF constituent SYCP1 [24-26], and CE components SYCE1, 99

SYCE2, SYCE3, TEX12, and SIX6OS [27-30]. 100

The involvement of SC components in POI would be supported by loss-101

of-function studies for different SC genes employing KO mice, which have been 102

reported to disrupt SC structure, and lead to infertility [22,25,29-35]. Some 103

human mutations in SC-coding genes have been identified and linked to 104

infertility [revision by 17]. Concerning LE components, various mutations for 105

SYCP3 have been reported, and the first SYCP2 mutations have just been 106

identified [36]. For some of the SYCP3 mutations, a dominant negative effect 107

has been revealed in heterozygous individuals, in which the truncated SYCP3 108

interfered with polymerization of the normal protein [37,38]. 109

Regarding CE components of the SC, in the past years mutations 110

potentially associated to clinical conditions have started to be reported. In 111

particular, deletions in human 10q26.3 encompassing SYCE1 gene were found 112

in POI patients [39-41]. Besides, thus far three reports identifying mutations in 113

SYCE1 gene in infertile patients have been made [42-44]. In one of these 114

reports, a homozygous point mutation was identified in a 13-member-family in 115

which two sisters born to consanguineous parents suffered primary amenorrhea 116

[42]. This mutation, SYCE1 c.613C˃T, would lead to SYCE1 protein truncation. 117

By sequencing studies, the authors determined that of the 11 descendants (five 118


https://doi.org/10.1101/2020.02.07.938639


7

males and six females), only the two affected siblings were biallelic for SYCE1 119

c.613C˃T mutation, suggesting a genetic cause with a recessive mode of 120

inheritance [42]. Although the idea of a possible relation of SYCE1 mutation 121

with pathogenicity would be supported by the phenotype of Syce1 KO mice, 122

which are infertile [35], an unequivocal evaluation linking SYCE1 mutations to 123

the observed medical conditions is lacking so far. 124

As most fundamental mammalian oogenesis events (including SC 125

formation and recombination) occur during the embryonic phase, eventual 126

defects in this process are identified with many years of delay, leaving few 127

possibilities to intervene, and even to study the condition’s etiology and 128

pathogeny. A valid alternative to circumvent this difficulty is the employment of 129

suitable animal models, which has the highest physiological relevance after 130

human studies. However, thus far no transgenic humanized mice mimicking 131

mutations found in humans for any SC component-coding gene have been 132

reported. 133

In order to determine whether mutation SYCE1 c.613C˃T is the actual 134

cause of the observed infertile phenotype, and to study its pathogeny, we have 135

generated a humanized mouse model line containing an equivalent point 136

mutation via CRISPR/Cas9 mutagenesis system. Here, we present the 137

phenotypic characterization of the humanized mutant mice, helping to shed light 138

on the etiology and mechanisms of these infertility cases. We also discuss the 139

potential usefulness of these humanized mouse models as substrates for future 140

development of gene therapy approaches. 141

142

143


https://doi.org/10.1101/2020.02.07.938639


8

Materials and methods 144

145

Ethical approval 146

All animal procedures to generate the mutant line were performed at the SPF 147

animal facility of the Transgenic and Experimental Animal Unit of Institut 148

Pasteur de Montevideo. Experimental protocols were accordingly approved by 149

the institutional Animal Ethics Committee (protocol number 007-18), in 150

accordance with national law 18,611 and international animal care guidelines 151

(Guide for the Care and Use of Laboratory Animals) [45]. All subsequent 152

experimental animal procedures were performed at Instituto de Investigaciones 153

Biológicas Clemente Estable (IIBCE, Montevideo, Uruguay), also in accordance 154

with the national law of animal experimentation 18,611 (Uruguay), and following 155

the recommendations of the Uruguayan National Commission of Animal 156

Experimentation (CNEA, approved experimental protocol 009/11/2016). 157

158

Design of molecules for mutagenesis and generation of humanized mice 159

CRISPR/Cas mutagenesis was employed aiming to obtain the desired 160

humanized mouse cell line [42]. Design and selection of molecules for directed 161

mutagenesis were carried out taking into account on-target ranking, off-target 162

ranking, and distance of single-guide RNA (sgRNA) to target site of 163

mutagenesis (http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-164

design). The selected sgRNA was acquired as CRISPRevolution Synthetic 165

sgRNA kit (Synthego, USA). The single-stranded oligonucleotide donor 166

(ssODN) employed as template for homology directed repair (HDR) was 167

designed making use of online tools for silent mutation scanning 168


http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design

http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design

https://doi.org/10.1101/2020.02.07.938639


9

(http://watcut.uwaterloo.ca/template.php) and restriction enzyme analysis 169

(nc2.neb.com/NEBcutter2/), and ordered from IDT as 4 nmole Ultramer DNA 170

Oligo (IDT, USA). Protospacer adjacent motif (PAM) was disrupted in the 171

ssODN in order to avoid repeated nuclease action after the desired edition. 172

Mice and zygote manipulation for genome editing was performed as previouly 173

described [46,47]. For details, see Expanded discussion of the Materials and 174

Methods. 175

176

Genotyping of transgenic mice 177

Offspring genotyping was performed via tail-tips. DNA was extracted by means 178

of GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific, USA). The 179

genomic region of interest (i.e. where the mutation was directed) was 180

specifically amplified by standard PCR. The primers employed were: Syce1-181

613-FOR: 5’ TCAAGGAAGGTGAGGTCAGG 3’; Syce1-613-REV: 5’ 182

ATGAAGAGACATACCGGCAG 3’. PCR products were run by electrophoresis, 183

recovered by GeneJET Gel Extraction and DNA Cleanup Micro Kit (Thermo 184

Fisher Scientific, USA), and sequenced. 185

186

Fertility tests 187

Fertility was assessed both for females and males by mating 2-month-old 188

mutant mice homozygous for the change with adult WT mice of opposite 189

gender. Heterozygous mutants and WT mice were used as control groups. 190

Assays were performed in triplicate for each gender in breeding pairs or trios 191

(two females and one male). After at least 3 months without offspring, the 192

analyzed individuals were considered infertile. 193


http://watcut.uwaterloo.ca/template.php

http://nc2.neb.com/NEBcutter2/






https://doi.org/10.1101/2020.02.07.938639


10

194

Histology 195

Whole adult testes and ovaries were primary fixed in 2.5% glutaraldehyde, 196

postfixed in 1% osmium tetroxide, dehydrated and resin-embedded (Durcupan, 197

Fluka) according to conventional procedures [48]. Thereafter, 250 nm sections 198

were cut using a Power Tome XL ultra-microtome (Boeckeler Instruments, 199

USA), stained with toluidine blue, and examined by bright field microscopy. 200

Photographs were taken by means of an Olympus FV300 microscope equipped 201

with a DP70 camera, and DPController v.1.1.1.65 software. 202

203

Analysis by flow cytometry (FCM) 204

Testicular cell suspensions were prepared using a mechanical method 205

previously described by our group [49,50]. The resulting cell suspensions were 206

stained with Vybrant DyeCycle Green (VDG, Invitrogen Life Technologies, USA) 207

at a final concentration of 10 μM for 1 h at 35 °C in the dark with gentle agitation 208

(80 rpm) as reported earlier [51]. FCM analyses were performed by means of a 209

flow cytometer and cell sorter MoFlo Astrios EQ (Beckman Coulter, USA), using 210

a 488 nm laser, a 100 μm nozzle (25 psi), and Summit software (Beckman 211

Coulter, USA). For details concerning flow cytometer calibration and analyzed 212

parameters, see Expanded discussion of the Materials and Methods. 213

214

Antibodies 215

Primary anti-rabbit antibody against SYCE1 amino-terminal region (i.e. capable 216

of detecting WT SYCE1 and its putative truncated form) was developed at 217

GenScript (GenScript USA Inc.), using peptides ATRPQPLGMEPEGSC and 218


https://doi.org/10.1101/2020.02.07.938639


11

CPEGARGQYGSTQKI from the amino-terminal region of the protein. This 219

affinity-purified antibody was employed both for fluorescence microscopy 220

(1:200) and for Western blots (0.3 µg/mL). 221

The other antibodies employed in this study were either commercial, or 222

described in detail elsewhere [26]. For more information, see Expanded 223

discussion of the Materials and Methods. 224

225

Immunocytochemistry 226

Immunolocalization assays were performed on gonadal spread cells obtained 227

through the dry-down technique [52] with minor modifications (see Expanded 228

discussion of the Materials and Methods). For oocyte spreading, fetal ovaries 229

(E18 embryos) were used, while for spermatocytes spreading we employed 230

mechanically disaggregated adult testes. Slides were afterwards used for 231

incubations with the indicated antibodies for immunofluorescence microscopy. 232

All incubations with primary antibodies were performed overnight at 4°C in the 233

presence of protease inhibitors (P2714, Sigma-Aldrich). Secondary antibody 234

incubations were done at room temperature for 1 h protected from light. 235

236

Microscopy and Imaging 237

All immunofluorescence microscopy acquisitions were performed employing a 238

Zeiss LSM 800 confocal microscope (Carl Zeiss Microscopy, Germany) 239

equipped with Airyscan processing module, a 63X/1.4 N.A. Plan Apochromat oil 240

objective, Axiocam 506 color digital camera, and ZEN Blue 2.3 software (Carl 241

Zeiss Microscopy, Germany). Airyscan image processing was done through the 242


https://doi.org/10.1101/2020.02.07.938639


12

software’s automatic deconvolution step. All images were analyzed by means of 243

FIJI ImageJ software [53]. 244

245

Statistical Analyses 246

Quantitative data of spread nuclei with synapsed chromosomes (zygotene and 247

pachytene stage) from biallelic and monoallelic mutants with WT littermate 248

controls were statistically compared using a chi-square test. Regarding RT-249

qPCR data, statistical significance and p-value were calculated in R 250

bioconductor (http://cran.r-project.org/). 251

252

Western blots 253

Testicular protein lysates corresponding to 7.5 x 105 cells in Laemmli sample 254

buffer were loaded per lane. SDS-polyacrylamide gel electrophoresis was 255

carried out on 12% polyacrylamide gels. Protein gels were transferred to 256

nitrocellulose membranes as instructed [54], and Western blots were performed 257

as previously described [55]. Membranes were incubated for 2 h at room 258

temperature in TBST with primary antibodies (anti-SYCE1-Nt and anti-β-259

tubulin), and for 1 h in blocking solution with anti-rabbit secondary antibody. 260

Bound antibodies were detected by using the Super Signal West Pico substrate 261

(Pierce). All assays were performed more than once, and using biological 262

replicates. 263

264

RT-qPCR assays 265

Total RNA from testicular cell suspensions was extracted with PureLink RNA 266

Mini Kit (Ambion, Life Technologies, Carlsbad, CA), following manufacturer’s 267


http://cran.r-project.org/

https://doi.org/10.1101/2020.02.07.938639


13

recommendations. RNA quantification was done by Nanodrop 1000 268

Spectrophotometer (Thermo Scientific). Retro-transcription and qPCR were 269

performed using Power SYBR Green Cells-to-Ct kit (Ambion), starting from 50 270

ng of RNA, following kit instructions, in a CFX96 Touch Real-Time PCR 271

Detection System 1 (BioRad, Hercules, CA). For qPCR step, 2 µL cDNA in 20 272

µL final volume reaction mix was used. 273

For RT-qPCR on embryonic ovaries, the same kit was directly employed after a 274

lysis reaction with no previous RNA extraction (due to the scarcity of the tissue). 275

The primers used are listed in Supplemental Table 1. We made 3 biological 276

replicas, and chose Ppp1cc (protein phosphatase 1, catalytic subunit, gamma 277

isozyme) as normalizing gene, as it has been previously shown to be a good 278

normalizing gene for testicular RNA [56]. Amplification efficiency of all primers 279

was >93%. The 2-ΔΔCt method and WT mouse RNA as calibrator condition were 280

used [57]. 281

282


https://doi.org/10.1101/2020.02.07.938639


14

Results 283

Generation of model mouse line 284

Our first aim was to generate a model mouse line mimicking the SYCE1 285

c.613C>T point mutation observed in humans. To achieve this, we chose the 286

CRISPR/Cas9 technology, and proceeded as described in Materials and 287

Methods. Comparison of SYCE1-coding regions from human and mouse 288

genome evidenced high identity, thus facilitating the choice of the editing target 289

(Fig 1A). SYCE1 c.613C˃T is a nonsense mutation that would lead to a 290

truncated human SYCE1 protein of 240 residues, while its WT counterpart has 291

351 amino acids. In mouse, an equivalent mutation would lead to a truncated 292

protein of 242 amino acids, as compared to the WT 329-residue version. 293

Design of molecules to be used in the directed mutagenesis (sgRNA and 294

ssODN) was optimized to favor the HDR (homology directed repair) pathway 295

(Fig 1B) [58]. Specimens resulting from microinjected zygotes (F0) were 296

genotyped in search of the desired change, and then mated with WT individuals 297

to obtain F1 generation. Afterwards, heterozygous specimens from F1 were 298

intermated to generate F2 offspring. As expected, the latter included WT 299

specimens as well as others heterozygous and homozygous for the desired 300

point mutation, which in mouse corresponds to Syce1 c.727C>T (Fig 1C). 301

302

Syce1 c.727C>T biallelic mutation causes infertility both in female and 303

male mice 304

Fertility was assessed both for females and males by mating mutant 305

mice with WT specimens of opposite gender. Data from three experimental 306

groups was compared in these studies: WT, heterozygous and homozygous 307


https://doi.org/10.1101/2020.02.07.938639


15

mice. No differences were observed between WT and heterozygous mice, 308

which got as easily pregnant, and laid on average 7 pups with an equal ratio of 309

male and female offspring. After 3 months, only individuals homozygous for the 310

Syce1 c.727C>T mutation failed to have offspring. This result was consistently 311

reproduced in triplicates for each gender, and led us to conclude that the sole 312

presence of this mutation in both alleles should be enough to produce the 313

infertile phenotype observed in women [42]. Moreover, the same mutation in 314

men should be able to cause infertility as well. 315

316

Syce1 c.727C>T biallelic mutation affects gonadal development 317

When gonadal size and aspect were assessed, no evident differences 318

were found between adult WT and heterozygous mutant mice, neither for 319

females nor for males (Supplemental Fig 1A). However, adult homozygous 320

mutants showed striking differences in gonadal size and aspect as compared to 321

their WT littermates, and this proved to be true both for female and male adult 322

individuals (Fig 1D). 323

Concerning microscopic analysis of ovaries, growing oocytes and follicle 324

development were evident in adult WT and heterozygous female animals (Fig 325

1E and Supplemental Fig 1B), while in their biallelic Syce1 c.727C>T littermates 326

no follicles or oocytes were observed (Fig 1E). Regarding testicular 327

development, while both WT and heterozygous adult males showed normal 328

seminiferous tubules with complete spermatogenesis (Fig 1E and Supplemental 329

Fig 1C), the microscopic analysis of gonadal content from adult biallelic male 330

mutant mice evidenced a severely affected spermatogenesis process with 331

complete absence of post-meiotic stages (Fig 1E). The seminiferous tubules of 332


https://doi.org/10.1101/2020.02.07.938639


16

these mutants were also depleted from mid and advanced prophase I stages 333

(i.e. pachytene and diplotene), indicating an arrest in early meiotic prophase I 334

stages. Moreover, the seminiferous tubules were much smaller than those of 335

the WT and monoallelic mutants, and exhibited an unusual aspect (Fig 1E). 336

In order to have stronger quantitative comparative analyses, testicular 337

cell suspensions from adult mice were analyzed by flow cytometry (FCM), 338

mainly based on DNA content. Figure 1F shows representative FCM results. 339

While no significant differences were found between WT and heterozygous 340

mutants, this study confirmed for the biallelic mutant males complete absence 341

of post-meiotic C population (Fig 1F). Regarding the 4C population, the FCM 342

analyses hereby presented were obtained using the DNA-specific fluorochrome 343

VDG that -as we had previously reported- allows the discrimination of two 344

populations of spermatocytes: the early spermatocyte population (leptotene and 345

zygotene stages, L/Z), and the mid/late spermatocyte one (pachytene and 346

diplotene stages, P/D) [51]. Despite these populations are usually visualized in 347

the histograms as a 4C bimodal peak (Fig 1F), this latter could not be observed 348

in the FCM profiles from biallelic mutants (Fig 1F) that resembled those 349

expected for 13-14 dpp WT juvenile mice [59]. 350

351

Evaluation of chromosome synapsis and SC assembly by confocal laser 352

scanning microscopy 353

The dramatic effect of the point mutation on gonadal development, 354

prompted us to study its consequences on SC structure and homologous 355

chromosome synapsis. Immunocytochemical localizations were performed on 356


https://doi.org/10.1101/2020.02.07.938639


17

spread cells from both embryonic ovaries and adult testes, and analyzed by 357

confocal laser scanning microscopy. 358

A first set of studies was centered on SC lateral element component 359

SYCP3, in order to evaluate chromosome synapsis. As the pachytene stage 360

(completely synapsed homologs) is reached by day 13-14 post-partum in male 361

mice and by day 17.5-18 post-coitum in female mice embryos, the ages of the 362

specimens to be analyzed were chosen accordingly. Quantitative data of spread 363

meiocyte nuclei with synapsed chromosomes from Syce1 c.727C>T mutants 364

and WT littermate controls were statistically compared using a chi-square test 365

(X2). Once again, no evident differences were found between monoallelic 366

mutants and WT littermates (X2 [1, N = 84] = 0.26, p = 0.61), with both 367

presenting normally-looking spread chromosomes that had reached the 368

pachytene stage (Fig 2A). However, biallelic mutants consistently showed 369

impaired synapsis, presenting, at most, closely juxtaposed chromosomes that 370

resembled earlier meiotic prophase stages (Fig 2A). These findings proved to 371

be true for both genders (herein shown for females), and indicate that the sole 372

biallelic presence of the point mutation severely affects homologous 373

chromosome synapsis (X2 [1, N = 84] = 134.6, p < 0.00001), and would most 374

probably account for the observed gametogenesis failure. 375

As mentioned above, Syce1 c.727C˃T is a nonsense mutation that 376

would lead to a truncated protein of 242 amino acids, as compared to the WT 377

329-residue version. In order to evaluate the eventual presence of the putative 378

truncated SYCE1 protein in the SC of mutants, we addressed protein 379

immunolocalization employing an antibody specially developed against the 380

SYCE1 amino terminal (N-t) region (see Materials and Methods). We clearly 381


https://doi.org/10.1101/2020.02.07.938639


18

detected SYCE1 in spread meiocytes from WT and monoallelic mutant 382

individuals, but not in those of biallelic mutants. This result was observed for 383

either of both genders (herein shown for females; Fig 2B), and was consistently 384

obtained for all biological and technical replicates. 385

Afterwards, we evaluated the presence of other known protein 386

components of the SC central region (i.e. TFs and CE). Some of the 387

components have been reported to be loaded earlier than SYCE1 onto the SC 388

(i.e. TF SYCP1 and CE SYCE3), while others would be loaded later (e.g. CE 389

TEX12) [22,28-30,60-64]. Representative results are shown in Figure 3. Again, 390

no differences were found between WT and monoallelic mutants for any of the 391

analyzed components either in female (Fig 3A-C) or male meiocytes (e.g. Fig 392

3D). Regarding biallelic mutants, protein components SYCP1 and SYCE3 were 393

detected on spread meiocytes containing SCs in assembling process (Figs 394

3A,B), while TEX12 was not detected at all in the assembling structure (Figs 395

3C,D). 396

For spermatocytes, γH2AX was also immunolabeled along with SC 397

protein components. This histone variant renders a very typical staining on male 398

meiotic chromosomes: dispersed chromosome staining in early stages, then 399

restricted to the XY body in pachytene stage. No difference in this regard was 400

detected between WT and monoallelic male mutants (Fig 3D). However, as 401

expected for a pre-pachytene meiotic arrest, no restricted staining for the sexual 402

chromosome pair was found in biallelic male mutants, which presented a diffuse 403

γH2AX staining pattern, characteristic of earlier meiotic stages (Fig 3D). 404

405


https://doi.org/10.1101/2020.02.07.938639


19

The putative truncated SYCE1 protein is not detected in mutant mice 406

testes 407

Although no SYCE1 protein was detected on assembling SCs of biallelic 408

mutant mice, still, the putative SYCE1 truncated protein could be present in 409

meiocytes, although not incorporated into the SC. In order to shed some light on 410

the molecular mechanism leading to infertility, we assessed the presence of the 411

putative truncated protein in mutant mice through Western blot analysis on 412

testicular material. These protein studies cannot be performed in females due to 413

material requirements unable to be fulfilled with embryonic ovaries (< 0.0001 g). 414

A band with an apparent molecular mass of 38 KDa was detected both 415

for WT mice and monoallelic mutants, in accordance with the predicted 416

molecular weight for WT 329-residue version of murine SYCE1 protein (Fig 4A). 417

No truncated SYCE1 protein (theoretical expected size: 28 KDa) was detected 418

for monoallelic mutants. 419

Concerning biallelic mutants, no protein reactive to SYCE1 antibody was 420

detected at all (see Fig 4A). Protein gels were deliberately overloaded to 421

minimize the effects of detection sensitivity limits, but in all assays no band of 422

28 KDa was observed. 423

424

Syce1 transcript is fairly detected in mutant humanized mice 425

The results from the Western blot assays prompted us to analyze 426

transcript levels. As shown in Figure 4B, Syce1 transcript quantitation rendered 427

big differences between WT and biallelic mutants that exhibited minimum 428

mRNA levels, both for embryonic ovaries (p< 0.0001) and for adult testes (p< 429

0.005). 430


https://doi.org/10.1101/2020.02.07.938639


20

Less pronounced but still significant differences were obtained between 431

WT and monoallelic mutant males that showed intermediate transcript levels 432

(p< 0.01; Fig 4B). On the contrary and as expected, quantitation of Sycp2 433

transcript (coding for SC LE SYCP2) rendered no significant differences 434

between the three conditions. 435

436


https://doi.org/10.1101/2020.02.07.938639


21

Discussion 437

The present work deals with some primary ovarian insufficiency cases 438

presumably related to mutations in SC coding genes, but still classified as 439

idiopathic infertility. We have worked with nonsense mutation SYCE1 440

c.613C˃T, addressing the question on its actual responsibility for the infertility 441

observed in female patients homozygous for this mutation. We have also 442

intended to shed some light on the underlying mechanisms involved. Aiming 443

these, we have applied directed mutagenesis in mouse for genome editing, and 444

successfully generated a humanized mouse line (i.e. the edited murine genome 445

contains a mutation equivalent to the one found in humans). In this regard, the 446

high percentage of identity between human and mouse SYCE1 coding genes 447

allowed us to easily find a SYCE1 c.613C˃T murine equivalent mutation (Syce1 448

c.727C>T). Generation of this animal model has enabled us to study the 449

etiology and pathogeny of these infertility cases. 450

Concerning etiology, it could be established that the biallelic presence of 451

Syce1 c.727C>T mutation is enough to cause infertility in both females and 452

males. On the other hand, mice heterozygous for the mutation were as fertile as 453

WT individuals. Thus, infertility in these cases has now proven genetic origin 454

and recessive mode of inheritance. It is worth reminding that for humans, de 455

Vries and collaborators (i.e. the authors that reported the mutation) found no 456

clinical symptoms for heterozygous individuals of both genders examined in 457

their study [42]. However, the phenotype for males homozygous for the mutated 458

SYCE1 gene could not be known at that time because all the males examined 459

in that study were heterozygous for the mutation [42]. Thus, although the 460

identification of this nonsense mutation was initially connected to cases of 461


https://doi.org/10.1101/2020.02.07.938639


22

women infertility, we can now anticipate that the biallelic mutation would equally 462

cause infertility in men. 463

The fertility results herein reported evidence an absence of sexual 464

dimorphism for this CE-related mutation. This would be in accordance with 465

previous observations for mice with loss-of-function of CR components-coding 466

genes, which were equally infertile in both genders [25,29,30,33-35], as 467

opposed to LE-component mutants that showed sexual dimorphism [22,32]. 468

Regarding gonadal development, no differences were found between 469

monoallelic mutants and unaffected WT individuals of both genders. This is in 470

accordance with the fertile phenotype observed in heterozygous humans, and 471

also with our fertility tests results. However, analysis of gonads from adult 472

biallelic mutant mice did show striking differences both for females and males: 473

minute ovaries with absence of oocytes and follicles (indicative of POI), and 474

testes with incomplete spermatogenic process, and 3-4 times smaller than in 475

unaffected littermates. Female mutant mice bearing POI resemble the clinical 476

description of the human sisters with biallelic Syce1 c.613C˃T, ratifying the 477

validity of the experimental model. 478

In males, the seminiferous epithelium of biallelic mutants showed not 479

only absence of post-meiotic cells, but even of mid/late meiotic prophase 480

stages, thus indicating an early meiotic arrest. We also analyzed testicular cell 481

suspensions by FCM as this methodology represents a widely accepted means 482

to analyze testicular cellular content, bearing very high quantitative analytical 483

power and statistical weight. These analyses let us corroborate a severely 484

affected spermatogenic process in biallelic mutants, with testes completely 485

depleted from postmeiotic haploid cells with C DNA content (i.e. round and 486


https://doi.org/10.1101/2020.02.07.938639


23

elongating spermatids, and spermatozoa). Moreover, concerning the 4C 487

population (mainly composed of primary spermatocytes), FCM profiles obtained 488

for biallelic mutants resemble those of ≈13 dpp mice that have not reached the 489

pachytene stage yet [59]. This result is in agreement with the early meiotic 490

arrest observed by microscopic analysis. 491

Analysis of spread chromosomes immunolabeled against SC protein 492

components, coupled to the use of an Airyscan super-resolution module, 493

enabled a detailed study of chromosome synapsis. This study revealed that the 494

biallelic presence of Syce1 c.727C>T severely affects homologous synapsis. 495

Regarding interactions between SYCE1 and other SC proteins, previous 496

studies based on co-immunoprecipitation and yeast two-hybrid assays have 497

identified interactions with SYCE3 and SIX6OS1 [29,30,62]. Besides, SYCE1 498

recruitment to the SC has been proposed to be mediated by SYCE3 [65]. 499

Neither SYCE1 protein nor SYCE1-downstream-loading SC components (e.g. 500

TEX12) could be detected on meiotic chromosome axes of biallelic mutant 501

humanized mice. As the mutation under study is nonsense, two hypothesis 502

concerning the pathogeny of these infertility cases arose: a) the putative SYCE1 503

truncated protein, which would lack 87 residues from the carboxyl terminus (Ct), 504

would not be recruited and loaded to the SC as its interaction with SYCE3 505

would be impaired, thus affecting normal SC assembly after SYCE3 loading 506

step; b) impaired loading could be due to the absence of the putative truncated 507

SYCE1 protein. 508

In order to shed some light on this matter, SYCE1 protein was assessed 509

by Western blot assays. Even in overloaded protein gels, we have not been 510

able to detect the putative truncated protein in the biallelic mutant mice. 511


https://doi.org/10.1101/2020.02.07.938639


24

Similarly, in monoallelic mutant mice only the WT form of the protein could be 512

detected. Thus, the impaired synapsis phenotype observed in biallelic mutant 513

mice would result from the absence (or at least presence of undetectable levels) 514

of truncated SYCE1, supporting our second hypothesis. Of note, the absence of 515

an interfering shorter version of SYCE1 could explain the unaffected phenotype 516

of monoallelic mutants. This would be quite different from the case of some 517

SYCP3 mutations, where a dominant negative effect has been reported in 518

heterozygous patients [37,38]. The lack of a possibly interfering truncated 519

protein also has important implications concerning the development of eventual 520

therapeutic procedures in biallelic patients, as it would guarantee the 521

occurrence of no relevant interference with an eventually introduced exogenous 522

normal protein, thus facilitating the intervention. 523

As the mutation studied herein is a nonsense one, a possible explanation 524

for the lack of detectable mutant protein could rely on nonsense-mediated 525

mRNA decay (NMD). This regulatory pathway functions to degrade aberrant 526

transcripts containing premature termination codons (PTCs). Since mutations 527

that generate PTCs cause approximately one-third of all known human genetic 528

diseases [66], NMD has been proposed to have a potentially important role in 529

human disease. SYCE1 c.613C>T mutation could be one of these cases. In 530

order to have a primary evaluation of this possibility, we performed Syce1 531

transcript quantitation in humanized mice compared to WT littermates. The 532

results obtained were consistent and pointed to transcript degradation of 533

aberrant transcripts, with hardly detectable levels of transcript in biallelic mutant 534

gonads of both genders (Fig 4B). In addition, monoallelic mutant males showed 535

intermediate Syce1 levels, in accordance with NMD pathway involvement. 536


https://doi.org/10.1101/2020.02.07.938639


25

Thus, the biallelic presence of Syce1 c.727C>T mutation would lead - through a 537

different mechanism - to a similar phenotype to that reported for Syce1 KO 538

mice, in which complete absence of SYCE1 protein causes infertility [35]. 539

The findings herein reported represent a proof of principle, since there 540

are no previous reports on the employment of CRISPR/Cas technology to direct 541

a specific change to a SC component, and generate a humanized mouse model 542

line for its exhaustive study. Besides, the generated mouse model line can be 543

further employed in other studies, including those aiming to develop eventual 544

therapeutic procedures. 545

546


https://doi.org/10.1101/2020.02.07.938639


26

Acknowledgements 547

The authors thank the staff of Transgenic and Experimental Animal Unit core 548

facility from Institut Pasteur de Montevideo, Uruguay, for technical support in 549

the generation of the GM model. 550

551

552

Funding 553

Funding for this research was provided by Agencia Nacional de Investigación e 554

Innovación (ANII, Uruguay; https://www.anii.org.uy/), grant number FCE-3-555

2016-1-126285 awarded to R.R.C., and fellowship POS_NAC_2018_1_151425 556

to D.H.L. Complementary financial support through program aliquots to R.R.C. 557

and D.H.L. was provided by Programa de Desarrollo de las Ciencias Básicas 558

(PEDECIBA, Biología), Universidad de la República (UdelaR). The funders had 559

no role in study design, data collection and analysis, decision to publish, or 560

preparation of the manuscript. 561

562

563

Conflict of interest 564

The authors have declared that no competing interests exist. 565

566

567

568

569

570

571


https://www.anii.org.uy/

https://doi.org/10.1101/2020.02.07.938639


27

Reference list 572

1. Goswami D, Conway GS. Premature ovarian failure. Hum Reprod 573

Update 2005;11: 391-410. 574

2. Chapman C, Cree L, Shelling AN. The genetics of premature ovarian 575

failure: current perspectives. Int J Womens Health 2015;7: 799-810. 576

3. Coulam CB, Stringfellow S, Hoefnagel D. Evidence for a genetic factor in 577

the etiology of premature ovarian failure. Fertil Steril 1983; 40: 693-5. 578

4. Van Kasteren YM, Schoemaker J. Premature ovarian failure: a 579

systematic review on therapeutic interventions to restore ovarian function and 580

achieve pregnancy. Hum Reprod Update 1999;5: 483-92. 581

5. Fonseca J, Patino LC, Suarez Y, Rodríguez J, Mateus H, Jimenez K. 582

Next generation sequencing in women affected by nonsyndromic premature 583

ovarian failure displays new potential causative genes and mutations. Fertil 584

Steril 2015;104: 154-62 e2. 585

6. Laissue P. Aetiological coding sequence variants in non-syndromic 586

premature ovarian failure: from genetic linkage analysis to next generation 587

sequencing. Mol Cell Endocrinol 2015;411: 243-57. 588

7. Huhtaniemi I, Hovatta O, La Marca A, Livera G, Monniaux D, Persani L, 589

et al. Advances in the molecular pathophysiology, genetics, and treatment of 590

primary ovarian insufficiency. Trends Endocrinol Metab 2018;29: 400-19. 591

8. Laissue P, Christin-Maitre S, Touraine P, Kuttenn F, Ritvos O, Aittomaki 592

K, et al. Mutations and sequence variants in GDF9 and BMP15 in patients with 593

premature ovarian failure. Eur J Endocrinol 2006;154: 739-44. 594

9. Di Pasquale E, Rossetti R, Marozzi A, Bodega B, Borgato S, Cavallo L, , 595

et al. Identification of new variants of human BMP15 gene in a large cohort of 596


https://doi.org/10.1101/2020.02.07.938639


28

women with premature ovarian failure. J Clin Endocrinol & Metab 2006;91: 597

1976-9. 598

10. Ennis S, Ward D, Murray A. Nonlinear association between CGG repeat 599

number and age of menopause in FMR1 premutation carriers. Eur J Hum Genet 600

2006;14: 253-5. 601

11. Riva P, Magnani I, Fuhrmann Conti AM, Gelli D, Sala C, Toniolo D, et al. 602

FISH characterization of the Xq21 breakpoint in a translocation carrier with 603

premature ovarian failure. Clin Genet 2006;50: 267-9. 604

12. Doherty E, Pakarinen P, Tiitinen A, Kiilavuori A, Huhtaniemi I, Forrest S, 605

et al. A novel mutation in the FSH receptor inhibiting signal transduction and 606

causing primary ovarian failure. J Clin Endocrinol & Metab 2002;87: 1151–5. 607

13. Qin Y, Choi Y, Zhao H, Simpson JL, Chen ZJ, Rajkovic A. NOBOX 608

homeobox mutation causes premature ovarian failure. Am J Hum Genet 609

2007;81: 576-81. 610

14. Watkins WJ, Umbers AJ, Woad KJ, Harris SE, Winship IM, Gersak K, et 611

al. Mutational screening of FOXO3A and FOXO1A in women with premature 612

ovarian failure. Fertil Steril 2006;86: 1518-21. 613

15. Zhao H, Chen ZJ, Qin Y, Shi Y, Wang S, Choi Y, et al. Transcription 614

factor FIGLA is mutated in patients with premature ovarian failure. Am J Hum 615

Genet 2008;82: 1342-8. 616

16. Pagnamenta T, Taanman W, Wilson C, Anderson N, Marotta R, Duncan 617

A, et al. Dominant inheritance of premature ovarian failure associated with 618

mutant mitochondrial DNA polymerase gamma. Hum Reprod 2006;21: 2467-619

73. 620


https://doi.org/10.1101/2020.02.07.938639


29

17. Geisinger A, Benavente R. Mutations in genes coding for synaptonemal 621

complex proteins and their impact on human fertility. Cytogenet Genome Res 622

2016;150: 77-85. 623

18. Zickler D, Kleckner N. Recombination, Pairing, and Synapsis of 624

Homologs during Meiosis. Cold Spring Harb Perspect Biol 2015;7: 625

cshperspect.a016626. 626

19. Lammers JH, Offenberg HH, Van Aalderen M, Vink AC, Dietrich AJ, 627

Heyting C. The gene encoding a major component of the lateral elements of 628

synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated 629

genes. Mol Cell Biol 1994;14: 1137-46. 630

20. Alsheimer M, Baier A, Schramm S, Schutz W, Benavente R. 631

Synaptonemal complex protein SYCP3 exists in two isoforms showing different 632

conservation in mammalian evolution. Cytogenet Genome Res 2010;128: 162-633

8. 634

21. Offenberg HH, Schalk JA, Meuwissen RL, Van Aalderen M, Kester HA, 635

Dietrich AJ, et al. SCP2: a major protein component of the axial elements of 636

synaptonemal complexes of the rat. Nucleic Acids Res 1998;26: 2572-9. 637

22. Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ, Wang 638

PJ. Mouse SYCP2 is required for synaptonemal complex assembly and 639

chromosomal synapsis during male meiosis. J Cell Biol 2006;173: 497-507. 640

23. Winkel K, Alsheimer M, Ollinger R, Benavente R. Protein SYCP2 641

provides a link between transverse filaments and lateral elements of 642

mammalian synaptonemal complexes. Chromosoma 2009;118: 259-67. 643


https://doi.org/10.1101/2020.02.07.938639


30

24. Meuwissen RL, Offenberg HH, Dietrich AJ, Riesewijk A, Van Iersel M, 644

Heyting C. A coiled-coil related protein specific for synapsed regions of meiotic 645

prophase chromosomes. EMBO J 1992;11: 5091-100. 646

25. De Vries FA, de Boer E, van den Bosch M, Baarends WM, Ooms M, 647

Yuan L, et al. Mouse Sycp1 functions in synaptonemal complex assembly, 648

meiotic recombination, and XY body formation. Genes Dev 2005;19: 1376–89. 649

26. Schücker K, Holm T, Franke C, Sauer M, Benavente R. Elucidation of 650

synaptonemal complex organization by super-resolution imaging with isotropic 651

resolution. Proc Natl Acad Sci U S A 2015;112: 2029-33. 652

27. Costa Y, Speed R, Ollinger R, Alsheimer M, Semple CA, Gautier P, et 653

al. Two novel proteins recruited by synaptonemal complex protein 1 (SYCP1) 654

are at the centre of meiosis. J Cell Science 2005;118: 2755-62. 655

28. Hamer G, Gell K, Kouznetsova A, Novak I, Benavente R, Hoog C. 656

Characterization of a novel meiosis-specific protein within the central element of 657

the synaptonemal complex. J Cell Science 2006;119: 4025-32. 658

29. Schramm S, Fraune J, Naumann R, Hernandez-Hernandez A, Hoog C, 659

Cooke HJ, et al. A novel mouse synaptonemal complex protein is essential for 660

loading of central element proteins, recombination, and fertility. PLoS Genet 661

2011;7: e1002088. 662

30. Gómez-H L, Felipe-Medina N, Sánchez-Martín M, Davies OR, Ramos I, 663

García-Tuñón I, et al. C14ORF39/SIX6OS1 is a constituent of the 664

synaptonemal complex and is essential for mouse fertility. Nat Commun 665

2016;7: 13298. 666


https://www.ncbi.nlm.nih.gov/pubmed/27796301


https://doi.org/10.1101/2020.02.07.938639


31

31. Fraune J, Schramm S, Alsheimer M, Benavente R. The mammalian 667

synaptonemal complex: protein components, assembly and role in meiotic 668

recombination. Exp Cell Res 2012;318: 1340-6. 669

32. Yuan L, Liu JG, Hoja MR, Wilbertz J, Nordqvist K, Hoog C. Female germ 670

cell aneuploidy and embryo death in mice lacking the meiosis-specific protein 671

SCP3. Science 2002;296: 1115-8. 672

33. Hamer G, Wang H, Bolcun-Filas E, Cooke H. J, Benavente R, Hoog C. 673

Progression of meiotic recombination requires structural maturation of the 674

central element of the synaptonemal complex. J Cell Science 2008;121: 2445-675

51. 676

34. Bolcun-Filas E, Costa Y, Speed R,Taggart M, Benavente R, De Rooij 677

DG, et al. SYCE2 is required for synaptonemal complex assembly, double 678

strand break repair, and homologous recombination. J Cell Biol 2007;176: 741-679

7. 680

35. Bolcun-Filas E, Speed R, Taggart M, Grey C, de Massy B, Benavente R, 681

et al. Mutation of the Mouse Syce1 Gene Disrupts Synapsis and Suggests a 682

Link between Synaptonemal Complex Structural Components and DNA Repair. 683

PLoS Genet 2009;5: e1000393. 684

36. Schilit SLP, Menon S, Friedrich C, Kammin T, Wilch E, Hanscom C, et al. 685

SYCP2 Translocation-Mediated Dysregulation and Frameshift Variants Cause 686

Human Male Infertility. Am J Hum Genet 2020;106: 41-57. 687

37. Miyamoto T, Hasuike S, Yogev L, Maduro MR, Ishikawa M, Westphal H, 688

et al. Azoospermia in patients heterozygous for a mutation in SYCP3. Lancet 689

2003;362: 1714-49. 690


https://www.ncbi.nlm.nih.gov/pubmed/?term=Schilit%20SLP%5BAuthor%5D&cauthor=true&cauthor_uid=31866047

https://www.ncbi.nlm.nih.gov/pubmed/?term=Menon%20S%5BAuthor%5D&cauthor=true&cauthor_uid=31866047

https://www.ncbi.nlm.nih.gov/pubmed/?term=Friedrich%20C%5BAuthor%5D&cauthor=true&cauthor_uid=31866047

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kammin%20T%5BAuthor%5D&cauthor=true&cauthor_uid=31866047

https://www.ncbi.nlm.nih.gov/pubmed/?term=Wilch%20E%5BAuthor%5D&cauthor=true&cauthor_uid=31866047

https://www.ncbi.nlm.nih.gov/pubmed/?term=Hanscom%20C%5BAuthor%5D&cauthor=true&cauthor_uid=31866047


https://www.ncbi.nlm.nih.gov/pubmed/?term=Westphal%20H%5BAuthor%5D&cauthor=true&cauthor_uid=14643120

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lamb%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=14643120

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lamb%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=14643120

https://doi.org/10.1101/2020.02.07.938639


32

38. Bolor H, Mori T, Nishiyama S, Ito Y, Hosoba E, Inagaki H, et al. 691

Mutations of the SYCP3 gene in women with recurrent pregnancy loss. Am J 692

Hum Genet 2009;84: 14-20. 693

39. McGuire MM, Bowden W, Engel NJ, Ahn HW, Kovanci E, Rajkovic A. 694

Genomic analysis using high-resolution single-nucleotide polymorphism arrays 695

reveals novel microdeletions associated with premature ovarian failure. Fertil 696

Steril 2011;95: 1595-600. 697

40. Zhen XM, Sun YM, Qiao J, Li R, Wang LN, Liu P. Genome-wide copy 698

number scan in Chinese patients with premature ovarian failure. Beijing Da Xue 699

Xue Bao 2013;45: 841-7. 700

41. Bestetti I, Castronovo C, Sironi A, Caslini C, Sala C, Rossetti R, , et al. 701

High-resolution array-CGH analysis on 46,XX patients affected by early onset 702

primary ovarian insufficiency discloses new genes involved in ovarian function. 703

Hum Reprod 2019;34: 1-10. 704

42. De Vries L, Behar DM, Smirin-Yosef P, Lagovsky I, Tzur S, Basel-705

Vanagaite L. Exome sequencing reveals SYCE1 mutation associated with 706

autosomal recessive primary ovarian insufficiency. J Clin Endocrinol & Metab 707

2014;99: 2129-32. 708

43. Maor-Sagie E, Cinnamon Y, Yaacov B, Shaag A, Goldsmidt H, Zenvirt S, 709

et al. Deleterious mutation in SYCE1 is associated with non-obstructive 710

azoospermia. J Assist Reprod Genet 2015;32: 887-91. 711

44. Pashaei M, Rahimi Bidgoli MM, Zare-Abdollahi D, Najmabadi H, Haji-712

Seyed-Javadi R, Fatehi F, et al. The second mutation of SYCE1 gene 713

associated with autosomal recessive nonobstructive azoospermia. J Assist 714

Reprod Genet 2020; doi: 10.1007/s10815-019-01660-1. 715


https://www.ncbi.nlm.nih.gov/pubmed/?term=Inagaki%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19110213

https://www.ncbi.nlm.nih.gov/pubmed/?term=Zenvirt%20S%5BAuthor%5D&cauthor=true&cauthor_uid=25899990

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pashaei%20M%5BAuthor%5D&cauthor=true&cauthor_uid=31916078

https://www.ncbi.nlm.nih.gov/pubmed/?term=Rahimi%20Bidgoli%20MM%5BAuthor%5D&cauthor=true&cauthor_uid=31916078

https://www.ncbi.nlm.nih.gov/pubmed/?term=Zare-Abdollahi%20D%5BAuthor%5D&cauthor=true&cauthor_uid=31916078

https://www.ncbi.nlm.nih.gov/pubmed/?term=Najmabadi%20H%5BAuthor%5D&cauthor=true&cauthor_uid=31916078

https://www.ncbi.nlm.nih.gov/pubmed/?term=Haji-Seyed-Javadi%20R%5BAuthor%5D&cauthor=true&cauthor_uid=31916078

https://www.ncbi.nlm.nih.gov/pubmed/?term=Haji-Seyed-Javadi%20R%5BAuthor%5D&cauthor=true&cauthor_uid=31916078

https://www.ncbi.nlm.nih.gov/pubmed/?term=Fatehi%20F%5BAuthor%5D&cauthor=true&cauthor_uid=31916078



https://doi.org/10.1101/2020.02.07.938639


33

45. National Research Council (NRC). Guide for the care and use of 716

laboratory animals. 7th ed. Washington: National Academies Press; 1996. 717

46. Crispo M, Schlapp G, Cárdenas-Rodríguez M, González-Maciel D, 718

Rumbo M. Optimization of transgenesis conditions for the generation of CXCL2-719

luciferase reporter mice line. Electron J Biotechnol 2013;16: 14. 720

47. Schlapp G, Goyeneche L, Fernandez G, Menchaca A, Crispo M. 721

Administration of the nonsteroidal anti-inflammatory drug tolfenamic acid at 722

embryo transfer improves maintenance of pregnancy and embryo survival in 723

recipient mice. J Assisted Reprod Genet 2015;32: 271-5. 724

48. Glauert AM, Lewis PR. Biological Specimen Preparation for 725

Transmission Electron Microscopy. Practical Methods in Electron Microscopy, 726

vol. 17. New Jersey: Princeton Legacy Library; 1998. 727

49. Rodríguez-Casuriaga R, Geisinger A, López-Carro B, Porro V, Wettstein 728

R, Folle GA. Ultra-fast and optimized method for the preparation of rodent 729

testicular cells for flow cytometric analysis. Biol Proced Online 2009;11: 184-5. 730

50. Rodríguez-Casuriaga R, Folle GA, Santiñaque F, López-Carro B, 731

Geisinger A. Simple and Efficient Technique for the Preparation of Testicular 732

Cell Suspensions. J Vis Exp 2013;78: e50102. 733

51. Rodríguez-Casuriaga R, Santiñaque F, Folle GA López-Carro B, 734

Geisinger A. Rapid preparation of rodent testicular cell suspensions and 735

spermatogenic stages purification by flow cytometry using a novel blue-laser-736

excitable vital dye. MethodsX 2014;1: 239-43. 737

52. Peters AH , Plug AW, van Vugt MJ, de Boer P. A drying-down technique 738

for the spreading of mammalian meiocytes from the male and female germline. 739

Chromosome Res 1997;5: 66-8. 740


https://www.ncbi.nlm.nih.gov/pubmed/?term=Rodr%C3%ADguez-Casuriaga%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Geisinger%20A%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=L%C3%B3pez-Carro%20B%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Porro%20V%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Wettstein%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Wettstein%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Folle%20GA%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Rodr%C3%ADguez-Casuriaga%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Folle%20GA%5BAuthor%5D&cauthor=true&cauthor_uid=19495915

http://europepmc.org/search?query=AUTH:%22A%20W%20Plug%22&page=1

http://europepmc.org/search?query=AUTH:%22M%20J%20van%20Vugt%22&page=1

http://europepmc.org/search?query=AUTH:%22P%20de%20Boer%22&page=1

https://doi.org/10.1101/2020.02.07.938639


34

53. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch 741

T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 742

2012;9: 676-82. 743

54. Matsudaira P. Sequence from picomole quantities of proteins electro-744

blotted onto polyvinylidene difluoride membranes. J Biol Chem 1987;262: 745

10035-8. 746

55. Goldman A, Rodríguez-Casuriaga R, González-López E, Capoano A, 747

Santiñaque F, Geisinger A. Mtch2 is differentially expressed in rat testis and 748

mainly related to apoptosis of spermatocytes. Cell Tissue Res 2015 361:869-749

83. 750

56. da Cruz I, Rodríguez-Casuriaga R, Santiñaque FF, Farías J, Curti G, 751

Capoano CA,, et al.Transcriptome analysis of highly purified mouse 752

spermatogenic cell populations: gene expression signatures switch from 753

meiotic-to postmeiotic-related processes at pachytene stage. BMC Genomics 754

2016;17: 294-312. 755

57. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using 756

real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 757

2001;25: 402-8. 758

58. Yang L, Guell M, Byrne S, Yang JL, De Los Angeles A, Mali P, , et al. 759

Optimization of scarless human stem cell genome editing. Nucleic Acids Res 760

2013;41: 9049-61. 761

59. Geisinger A, Rodríguez- Casuriaga R. Flow cytometry for the isolation 762

and characterization of rodent meiocytes. Methods Mol Biol 2017;1471: 217-30. 763


https://www.ncbi.nlm.nih.gov/pubmed/?term=Frise%20E%5BAuthor%5D&cauthor=true&cauthor_uid=22743772

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kaynig%20V%5BAuthor%5D&cauthor=true&cauthor_uid=22743772

https://www.ncbi.nlm.nih.gov/pubmed/?term=Longair%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22743772

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pietzsch%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22743772

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pietzsch%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22743772

http://www.nature.com/nmeth/journal/v9/n7/full/nmeth.2019.html

https://www.ncbi.nlm.nih.gov/pubmed/?term=Matsudaira%20P%5BAuthor%5D&cauthor=true&cauthor_uid=3611052


https://www.ncbi.nlm.nih.gov/pubmed/?term=da%20Cruz%20I%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Rodr%26%23x000ed%3Bguez-Casuriaga%20R%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Santi%26%23x000f1%3Baque%20FF%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Far%26%23x000ed%3Bas%20J%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Curti%20G%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Capoano%20CA%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Capoano%20CA%5BAuthor%5D&cauthor=true&cauthor_uid=27094866

https://www.ncbi.nlm.nih.gov/pubmed/?term=Livak%20KJ%5BAuthor%5D&cauthor=true&cauthor_uid=11846609

https://www.ncbi.nlm.nih.gov/pubmed/?term=Schmittgen%20TD%5BAuthor%5D&cauthor=true&cauthor_uid=11846609

https://www.sciencedirect.com/science/journal/10462023

https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20L%5BAuthor%5D&cauthor=true&cauthor_uid=23907390

https://www.ncbi.nlm.nih.gov/pubmed/?term=Guell%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23907390

https://www.ncbi.nlm.nih.gov/pubmed/?term=Byrne%20S%5BAuthor%5D&cauthor=true&cauthor_uid=23907390

https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20JL%5BAuthor%5D&cauthor=true&cauthor_uid=23907390

https://www.ncbi.nlm.nih.gov/pubmed/?term=De%20Los%20Angeles%20A%5BAuthor%5D&cauthor=true&cauthor_uid=23907390

https://www.ncbi.nlm.nih.gov/pubmed/?term=Mali%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23907390



https://doi.org/10.1101/2020.02.07.938639


35

60. Yuan L, Liu JG, Zhao J, Brundell E, Daneholt B, Höög C. The murine 764

SCP3 gene is required for synaptonemal complex assembly, chromosome 765

synapsis, and male fertility. Mol Cell 2000;5: 73-83. 766

61. Pelttari J, Hoja MR, Yuan L, Liu JG, Brundell E, Moens P, , et al. A 767

meiotic chromosomal core consisting of cohesin complex proteins recruits DNA 768

recombination proteins and promotes synapsis in the absence of an axial 769

element in mammalian meiotic cells. Mol Cell Biol 2001;21: 5667-77. 770

62. Lu J, Gu Y, Feng J, Zhou W, Yang X, Shen Y. Structural insight into the 771

central element assembly of the synaptonemal complex. Sci Rep 2014;4: 7059. 772

63. Davies OR, Maman JD, Pellegrini L. Structural analysis of the human 773

SYCE2-TEX12 complex provides molecular insights into synaptonemal complex 774

assembly. Open Biol 2012;2: 120099. 775

64. Dunce JM, Dunne OM, Ratcliff M, Millán C, Madgwick S, Usón I, et al. 776

Structural basis of meiotic chromosome synapsis through SYCP1 self-777

assembly. Nat Struct & Mol Biol 2018; 25: 557-69. 778

65. Hernández-Hernández A, Masich S, Fukuda T, Kouznetsova A, Sandin 779

S, Daneholt B, et al. The central element of the synaptonemal complex in mice 780

is organized as a bilayered junction structure. J Cell Science 2016; 129: 2239-781

49. 782

66. Miller JN and Pearce DA. Nonsense-Mediated Decay in Genetic 783

Disease: Friend or Foe? Mutat Res Rev Mutat Res 2014;762: 52-64. 784

785

786


https://www.ncbi.nlm.nih.gov/pubmed/?term=Yuan%20L%5BAuthor%5D&cauthor=true&cauthor_uid=10678170

https://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20JG%5BAuthor%5D&cauthor=true&cauthor_uid=10678170

https://www.ncbi.nlm.nih.gov/pubmed/?term=Zhao%20J%5BAuthor%5D&cauthor=true&cauthor_uid=10678170

https://www.ncbi.nlm.nih.gov/pubmed/?term=Brundell%20E%5BAuthor%5D&cauthor=true&cauthor_uid=10678170

https://www.ncbi.nlm.nih.gov/pubmed/?term=Daneholt%20B%5BAuthor%5D&cauthor=true&cauthor_uid=10678170

https://www.ncbi.nlm.nih.gov/pubmed/?term=H%C3%B6%C3%B6g%20C%5BAuthor%5D&cauthor=true&cauthor_uid=10678170

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pelttari%20J%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=Hoja%20MR%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=Yuan%20L%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20JG%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=Brundell%20E%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=Moens%20P%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=H%C3%B6%C3%B6g%20C%5BAuthor%5D&cauthor=true&cauthor_uid=11463847

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=25394919

https://www.ncbi.nlm.nih.gov/pubmed/?term=Gu%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=25394919

https://www.ncbi.nlm.nih.gov/pubmed/?term=Feng%20J%5BAuthor%5D&cauthor=true&cauthor_uid=25394919

https://www.ncbi.nlm.nih.gov/pubmed/?term=Zhou%20W%5BAuthor%5D&cauthor=true&cauthor_uid=25394919

https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20X%5BAuthor%5D&cauthor=true&cauthor_uid=25394919

https://www.ncbi.nlm.nih.gov/pubmed/?term=Shen%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=25394919

https://www.ncbi.nlm.nih.gov/pubmed/?term=%22Davies%20OR%22%5BAuthor%5D&cauthor=true&cauthor_uid=22870393

https://www.ncbi.nlm.nih.gov/pubmed/?term=Maman%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=22870393

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pellegrini%20L%5BAuthor%5D&cauthor=true&cauthor_uid=22870393

https://doi.org/10.1101/2020.02.07.938639


36

Expanded discussion of the Materials and Methods 787

Mice manipulation for genome editing 788

Mice were housed in individually ventilated cages (Tecniplast, Milan, Italy), in a 789

controlled environment at 20 ± 1ºC with a relative humidity of 40-60%, in a 790

14/10 h light-dark cycle. Autoclaved food (Labdiet 5K67, PMI Nutrition, IN, USA) 791

and water were administered ad libitum. 792

Cytoplasmic microinjection was performed in C57BL/6J zygotes using a mix of 793

20 ng/µL sgRNA, 30 ng/µL Cas9 mRNA, and 20 ng/µL ssDNA oligo. The same 794

day, surviving zygotes were transferred to B6D2F1 0.5 dpc pseudopregnant 795

females (25 embryos/female in average), following surgery procedures 796

established in the animal facility [46]. Previously, recipient females were 797

anesthetized with a mixture of ketamine (100 mg/kg, Pharmaservice, Ripoll Vet, 798

Montevideo, Uruguay) and xylazine (10 mg/kg, Seton 2%; Calier, Montevideo, 799

Uruguay). Tolfenamic acid was administered subcutaneously (1 mg/kg, 800

Tolfedine, Vetoquinol, Madrid, Spain) to provide analgesic and anti-801

inflammatory effects [47]. Pregnancy diagnosis was determined by visual 802

inspection by an experienced animal caretaker two weeks after embryo transfer, 803

and litter size was recorded on day 21 after birth. 804

805

Flow cytometry analysis 806

Flow cytometer calibration and quality control were carried out using 3.0 µm 807

Ultra Rainbow Fluorescent Particles (Spherotech, USA). Fluorescence emitted 808

from VDG was detected with a 513/26 bandpass filter. The following parameters 809

were analyzed: forward scatter (FSC-Height with P1 Mask), side scatter (SSC-810

Height), 513/26-Area (VDG fluorescence intensity), and 513/26-Width. Doublets 811


https://doi.org/10.1101/2020.02.07.938639


37

were excluded using dot plots of 513/26 pulse-area vs 513/26 pulse-width. FCM 812

data was analyzed with Kaluza software (Beckman Coulter, USA). 813

814

Cell spreading 815

Fetal ovaries were dissected, incubated in hypotonic buffer (30 mM Tris-HCl pH 816

8.2, 17 mM sodium citrate, 5mM EDTA, 50 mM sucrose, 5mM DTT) for 30 817

minutes, mechanically disaggregated on clean slides containing 100 mM 818

sucrose, fixed in 1%-paraformaldehyde/0.15%-TritonX100, and allowed to dry 819

slowly (overnight in closed humidity chamber, then open). Once completely dry, 820

slides were wrapped in aluminum foil, and stored at -80°C until use. For 821

spermatocytes spreading, the same procedure was applied on mechanically 822

disaggregated adult mice testes. 823

824

Antibodies 825

Guinea pig anti-SYCP3 (1:200), guinea pig anti-TEX12 (1:200), rabbit anti-826

SYCP1(1:200) and rabbit anti-SYCE3 (1:200) primary antibodies were used as 827

affinity purified immunoglobulins and described in detail elsewhere [26]. Mouse 828

anti-γH2AX was purchased at Millipore (1:500, 05-636; Millipore, Germany). 829

Primary anti-β-tubulin antibody employed in Western blots as loading control- 830

was acquired from Abcam (ab6046, 1:8,000, Abcam Antibodies), and revealed 831

using an anti-rabbit secondary antibody coupled to horseradish peroxidase 832

(1:30,000, Pierce). 833

Suitable secondary antibodies coupled to AlexaFluor dyes were acquired from 834

Invitrogen Life Technologies, USA: AlexaFluor488 goat anti-rabbit (A11034, 835


https://doi.org/10.1101/2020.02.07.938639


38

1:1,000), AlexaFluor633 goat anti-guinea pig (A21105, 1:1,000), AlexaFluor546 836

goat anti-guinea pig (A11074, 1:1,000). 837

838

839

840

841

842

843

844

845

846

847

848

849

850

851

852

853


https://doi.org/10.1101/2020.02.07.938639


39

854

Figure 1 – Mouse genome editing strategy and initial characterization of edited 855

mice. (A) Graphical representation of SYCE1/Syce1 transcripts from human 856

and mouse. Boxes represent the 13 exons separated by intronic sequences 857

(lines); arrowheads indicate exon #11 where the mutation was found in humans, 858

and to which mutagenesis was directed in mouse genome. The alignment of 859

mouse and human genomic sequence for exon #11, showing high sequence 860

similarity, is also presented. Red boxes indicate the codon affected by mutation 861


https://doi.org/10.1101/2020.02.07.938639


40

c.613C>T in humans that would generate a premature TAG stop codon. (B) 862

Mouse Syce1 genomic sequence corresponding to exon #10 + intron #10 + 863

exon #11. The 20 nt sequence complementary to the sgRNA is shown in grey, 864

protospacer adjacent motif (PAM) in green, and cytosine to be edited in red. 865

Sequences of the sgRNA and single stranded oligonucleotide (ssODN) are 866

indicated. Note in the latter the C>T substitution at the beginning of exon #11, 867

as well as the disrupted PAM sequence. (C) Representative genotyping results 868

obtained through standard sequencing of PCR products amplified from mouse 869

tail-tips. (D) Comparative size of gonads in Syce1 c.727C>T biallelic mutant and 870

control mice. (E) Microscopic analysis of gonads in semi-thin sections of Epon-871

embedded ovaries and testes from adult WT and biallelic mutants. Panoramic 872

view (left) and higher magnification images (right) are shown. Bars correspond 873

to 100 and 20 µm (left and right images, respectively). (F) Flow cytometric 874

analysis of testicular cell suspensions from adult WT and mutant mice. 875

Representative FCM profiles obtained for testis from mutant mice and WT 876

littermates are shown. Relative percentages of C, 2C and 4C cell populations 877

are indicated in each case. 878

879

880

881

882

883

884

885

886


https://doi.org/10.1101/2020.02.07.938639


41

887

Figure 2 – Evaluation of chromosome synapsis and SYCE1 loading to SC in 888

WT and humanized mice. (A) Immunolabelling of LE component SYCP3 on 889

spread meiotic chromosomes from WT (above) and biallelic mutant mice 890

(below). Fluorescence acquisition was performed by means of an Airyscan 891

module that enabled the resolution of LEs, even in completely assembled SCs 892

(see inset above). Closely aligned but unsynapsed LEs are observed for 893

biallelic mice (below). (B) Immunolocalization of SYCE1 protein in female 18 894

dpc WT and mutant mouse embryos. SYCE1 is shown in green, and SYCP3 in 895

magenta. Merged channels and DNA staining with DAPI are also shown 896

below. 897


https://doi.org/10.1101/2020.02.07.938639


42

898

Figure 3 – Immunolocalization of other CR SC components in WT and mutant 899

mice. (A) Immunolabelling of TF SYCP1 in female 18 dpc mouse embryos. 900

SYCP3 is shown in magenta, and SYCP1 in green. (B) Immunolocalization of 901


https://doi.org/10.1101/2020.02.07.938639


43

CE SYCE3 in female 18 dpc mouse embryos. SYCE3 is shown in green, and 902

SYCP3 in magenta. (C) Immunolabelling of CE TEX12 in female 18 dpc mouse 903

embryos. SYCP1 is shown in green, and TEX12 in red. (D) Immunolocalization 904

of TEX12, SYCP1 and γH2AX in male adult WT and mutant mice. SYCP1 is 905

shown in green, TEX12 in red and γH2AX in magenta. Merged channels and 906

DNA staining with DAPI are shown below in each case. 907

908

909

910

911

912

Figure 4 - Analysis of SYCE1 protein by Western blot, and transcript 913

quantitation by RT-qPCR. (A) Western blot analysis of SYCE1 protein and its 914

putative truncated mutant variant. The blotted bands were immunodetected with 915

a specific rabbit antibody against mouse SYCE1 Nt-region. β-tubulin was 916

employed as loading control. (B) RT-qPCR results obtained for gonads from 917

WT and mutant mice. Statistical levels of significance are indicated in each 918

case. **P value < 0.005; ***P value < 0.0001. 919

920


https://doi.org/10.1101/2020.02.07.938639


44

Supplemental material 921

922

Supplemental Figure 1 - Macroscopic and microscopic analysis of gonads in 923

WT and Syce1 c.727C>T monoallelic mutant mice. (A) Comparative size of 924

gonads. (B) Semi-thin sections of Epon-embedded ovaries from adult WT and 925

monoallelic mutants. Note the presence of normal developing follicles both in 926

WT and heterozygous mutant females. (C) Cross sections of seminiferous 927

tubules from adult WT and monoallelic mutant mice. Normal spermatogenesis is 928

evident in both cases. Bars correspond to 20 µm. 929

930


https://doi.org/10.1101/2020.02.07.938639


45

Supplemental Table 1: Primers used for qPCR experiments. 931

Primer name Transcript detected Sequence 5'-3'

Syce1-FOR Syce1 GGGTTCTTCCAGCCTCATTG

Syce1-REV Syce1 CCCATGCTTTTCCAGTTCTTC

Ppp1cc-FOR Ppp1cc CATATCTTGAGTGGTGCTTCA

Ppp1cc-REV Ppp1cc GACAGCATCATCCAACGGCT

Sycp2-FOR Sycp2 TCACTTCCGGCTGACCCATC

Sycp2-REV Sycp2 GAAGACAAACACCCGCAGAC

932

933


https://doi.org/10.1101/2020.02.07.938639


familial primary ovarian insufficiency associated with a ... · 3 31. abstract . 32 objective: to...

Documents