ICTBusiness Trends

Feature

Information and Communication Technology

▶ World Scope▶ Global Spotlight Mitsubishi HiTec Paper Europe GmbH Mitsubishi Heavy Industries-VST Diesel Engines Pvt. Ltd.

▶ Annual Events in Japan Sapporo Snow Festival

A Bimonthly Review of the Mitsubishi Companies and Their People Around the World

2018

February

–

MarchOfficial Website ■ http://www.mitsubishi.com/mpac/e/monitor/back/index.html

The Mitsubishi Monitor is published by the Mitsubishi Public Affairs CommitteeMarunouchi Nakadori Bldg., 2-3, Marunouchi 2-chome, Chiyoda-ku, Tokyo 100-0005, JapanPhone: 81-3-5218-8660 Fax: 81-3-5218-8661

©2018 Mitsubishi Public Affairs Committee

Volume 32 No.1

For more information about the Mitsubishi companies, see “Mitsubishi Profile” ■ http://www.mitsubishi.com/mpac/e/activity/profile.html

Printed in Japan on recycled paper

We want your feedback! ■ http://www.mitsubishi.com/mpac/e/talk/form.html

S apporo transforms the harsh conditions of the Hokkaido winter into

a mystical wonderland every February.

Hosted by Hokkaido’s leading city, the first Sapporo Snow Festival

was held in Odori Park in 1950, with six snow statues made by local

high school students. Featuring snowball fights, snow and ice statues and

carnivals, the festival attracted about fifty thousand people.

Sapporo hosted the Winter Olympic

Games in 1972 and to the theme of

“Welcome to Sapporo” the Snow Festival

became widely known around the world.

Today, some 2.65 million visitors

from around the world come to the

seven-day festival. The sheer size and

delicate intricacy of the ice sculptures

are overwhelming and present a beautiful

sight under neon street lights.

©Jiji Press Photo

©Jiji Press Photo

©123RF.COM

Started in 1990, the Mitsubishi Asian Children’s Enikki Festa is a program that seeks to promote literacy education and to stimulate cultural exchange among children by allowing them to learn about each other through “enikki” (illustrated diaries).

■ http://enikki.mitsubishi.or.jp/e/index_f.html

＊ The Enikki entries above, when necessary, have been translated into English from the language they were originally written in.

Kasone Festival 8th Jan. 2016My family takes part in Kasone, pouring water on bodhi tree festival, every year. I went to the pagoda with my family in the early morning and poured water on the bodhi tree in the pagoda compound. I was so surprised that I saw some people giving free food to the visitors. My father explained that pouring water on the bodhi tree is to be fresh in the summer heat of May.

Camel TrainingMy uncle trained a camel. I was worried that my uncle might fall off of the camel, but I ran around taking pictures of them. I got some good photos to show my family. My uncle is strong.

Chuu Thantha KyawAge 8, GirlRepublic of the Union of Myanmar

Ganbaatar BolormaAge 11, GirlMongolia

Sapporo Snow Festival Ice Sculptures Wow in Size and Detail

Gaisenmon (Triumphal Arch), 2017. The huge and intricately worked sculpture reproduces the beauty and dignity of the Arc de Triomphe in Paris

The Sapporo Snow Festival at night as seen from the Sapporo TV Tower

Recognition, logical deduction and execution. These are the three intelligent capabilities required to run a stable IT environment. ignio is an application that applies these intelligences by itself as it performs tasks. ignio also automates IT operation management and provides a unified system management platform.

ICT

AI-Powered Automation Solution for IT Operations Automated Design Deep Learning Algorithm – A World First

Automated, Autonomous, Mobile, Explosion-Proof RobotMitsubishi Heavy Industries (MHI ) is developing a robot that can carry out monitoring and inspection at plants, investigative work in hazardous environments, and even simple work using a robotic arm. What will make this robot unique will not only be its ability to operate autonomously using technologies such as automatic contactless charging and 3D-LiDAR to inform itself where it is in the facility, but also its explosion-proof capability, building on existing technology from Sakura No. 2, another robot originally developed with Chiba Institute of Technology as a tunnel accident first responder. The smart robot development program is partly funded by the Japanese government, but core technologies are proprietary MHI technology.

Tata Consultancy Services JapanMitsubishi Electric Corporation

Mitsubishi Heavy Industries

■ https://spectra.mhi.com/how_robots_will_change_ the_world

Digital Technologies Creating New Financial Services

Feature Information and Communication Technology

Business TrendsThis edition sees the start of a series of feature articles looking at ICT, food, mobility and other topics. We begin with ICT ( Information and communications technology) . ICT is indispensable in adapting to changes in business and in society today. The Mitsubishi group of companies employs ICT in creating new values in many fields, including finance, medicine and robotics.

Traditional method

Request for DL design and implementation by an expert

RequestExamination for implementation

Expert user of application

It takes a lot of time for a DL expert to understand the problem and application because of poor knowledge of each individual field.

Implement DL directly by expert user of applicationSystems adapted to the specific environment can be constructed quickly because of direct implementation by expert users of the application.DL: Deep Learning A I: Artificial Intelligence

wealth of knowledge of applicationno expert knowledge of DL

Improved method

AI Experts no knowledge of applicationwealth of knowledge of DL

Expert user of application

wealth of knowledge of applicationno expert knowledge of DL

Automated DL designwithout expert knowledge of DL

Learning data

Automated design algorithm of DL

Quickerdeliveryand lowercost

Deduce and deriveworkable solutions

Logical deduction

Understand the entire IT environment accurately

Recognition

Execute complex tasks in a sequential manner without being instructed

Execution

Examination / Explanation of tests Clinical department

Division of Clinical Cancer Genomics

Diagnosis explanation / Medication / Treatment

Sampling /Sequencing

Team conference decides treatment protocol

Mitsubishi Space Software responsibility

Sequence dataTACGGACGTGGGATCCTTGGGATCCTGCACCCTC

Report

The cancer genome diagnostic process: MSS is responsible for the tasks in section 3 . Letters A, C, G, and T are abbreviations for the four nucleotide bases of a DNA strand: adenine, cytosine, guanine, and thymine.

■ http://www.mufg.jp/english/ir2016/v_c/fin/*From April 1, 2018 our company name will be changed to MUFG Bank, Ltd.

1

2

3 Data quality check / Data correctionMapping / RealignmentMutation detected

Cancer driver element searchPreparation of report

TACGGACGTGGGATCCTTGGGATCCTGCACCCTC

Min. 3 days from receipt of data to submission of report

ignio™ is a cognitive automation solution for IT operations using AI (artificial intelligence) that has been developed by Tata Consultancy Services. Already widely used by global companies in Europe and the US, Tata Consultancy Services Japan started serving Japanese companies in 2017. ignio autonomously acquires information, and learns about the IT environment in which it is deployed. It then takes over from humans in running and managing IT systems. ignio contributes to better operational quality and efficiency as well as to enhanced business reliability.

Mitsubishi Electric has become the first company anywhere to develop an algorithm which automatically designs deep learning structures. This allows the fast, low-cost development of artificial intelligence (AI) systems, without the input of specialized professionals, which can

be adapted to diverse user environments and devices. A paper describing the new system was published in the edition of Lecture Notes in Computer Science covering the International Conference on Neural Information Processing held at Kyoto University in 2016.

Data Analysis Technology Aids Cancer Genetic Testing

Mitsubishi Space Software The Bank of Tokyo-Mitsubishi UFJ

3 intelligent capabilities

Mitsubishi Space Software started working with Hokkaido University Hospital’s Division of Clinical Cancer Genomics in the sequencing of cancer gene data in April 2016. The company’s role is to perform deep sequencing analysis of genomic DNA samples and propose personalized treatment strategies to oncologists and others on the basis of the cancer-specific somatic gene mutations identified. The company has recently completed work on developing algorithms and software that are capable of analyzing combinations of molecular target drugs approved in Japan.

Mitsubishi UFJ Financial Group (MUFG) in May 2017 announced the MUFG Re-Imagining Strategy which, with business innovation using digital technologies one of its main strategies, is aimed at improving customer convenience and accelerating the development of new financial services. Through the MUFG Digital Accelerator, which uses digital technologies to support the creation of innovative financial businesses, and the recent establishment of Japan Digital Design, MUFG is also forging ahead with Open Innovation.

■ http://www.mitsubishielectric.com/news/2016/pdf/1014.pdf

2 3

World

GUINNESS WORLD RECORD® for Air ConditionersThe Kirigamine domestic air conditioner made by Mitsubishi Electric has been officially recognized as the “Longest running cross-flow-fan air conditioner brand” by Guinness World Records Ltd. after it set a new record of 49 years and 258 days on June 27, 2017. Mitsubishi Electric helped to boost the popularity of domestic air conditioners when it made them slimmer by using the world’s first cross-flow fan in the Kirigamine in 1967.

Inclusion in DJSI for ESG InvestmentThe Dow Jones Sustainability Indices (DJSI), a family of stock price indices for environmental, social and governance (ESG) investment, is made up of eight different benchmarks including DJSI World, which covers developed and emerging nations, and DJSI Asia Pacific, which covers nations in the Asia/Pacific region. In 2017, the following Japanese companies were selected for inclusion in the DJSI family: Mitsubishi Chemical Holdings (first inclusion in DJSI World and DJSI Asia Pacific), Tokio Marine Holdings (DJSI World), NYK, Mitsubishi Heavy Industries, and Mitsubishi UFJ Financial Group (MUFG) (all in DJSI Asia Pacific).

LNG Bunkering Supply for Statoil Shuttle TankersGas4Sea – a commercial brand jointly launched by Engie, Mitsubishi Corporation, and NYK to supply LNG marine fuel – has been selected by Norwegian multinational energy group Statoil as its LNG supplier in the port of Rotterdam. Gas4Sea is due to start supplying four Statoil shuttle tankers to be operated with LNG fuel in early 2020.

Naoshima Smelter and Refinery & Central Research Institute Celebrate Centennials Mitsubishi Material’s central smelter, Naoshima Smelter and Refinery, as well as the core research base, Central Research Institute, both celebrated their centennials in 2017. Naoshima Smelter and Refinery’s commercial production uses the patented “Mitsubishi Process” technology; it is proud to be the number one producer of gold in Japan and to employ the best E-Scrap processing capabilities in the world. The Central Research Institute was established in 1917 as a private research institution, a rarity in Japan at the time, and is still, after a century, recognized as one of Japan’s leading research institutions.

Japan

Japan Norway France

Japan

The Central Research Institute founded in Shinagawa in 1917

President Aikyo fires up a new reverberatory furnace at the Second Smelter in 1969

Building an 11th- Generation TFT-LCD Glass Substrate Furnace in ChinaThere has been a large increase in the production of thin-film transistor LCD panels in China in recent years and this has resulted in a sharp rise in glass substrate demand. AGC Asahi Glass has decided to build a furnace to produce 11th -generation TFT-LCD glass substrates at its subsidiary AGC Display Glass (Huizhou) Co., Ltd. in the Huizhou Zhongkai High-Tech Industrial Development Zone, Guangdong Province, China. This decision to relocate a cutting-edge glass substrate production facility from within the AGC Group will significantly reduce the need for capital investment while maintaining the group's total production capacity.

Boro Tower: First Major Project in the Washington, DC, Area

Rockefeller Group International, Inc. has agreed to form a joint venture to co-develop Boro Tower, a 20-story, 437,000-square-foot office building at The Boro in Tysons, Virginia, a close-in suburb of Washington, DC. This will be the Mitsubishi Estate group’s first office building development project in the area.

China

Faster Overseas Claims Settlement with Remote Video Streaming SystemTokio Marine & Nichido Fire Insurance in November 2017 introduced a system that allows real-time streaming of HD video content from remote locations to enhance the capabilities of its overseas insurance claim investigations. In the event of a major accident or disaster outside Japan, this will allow the company to pay claims more quickly and thereby help to restore operations at an earlier date.

USA

■

http://www.agc.com/en/news/detail/1195711_2814.html

■

http://www.mitsubishicorp.com/jp/en/pr/archive/2017/ html/0000033434.html■

http://www.nyk.com/english/news/2017/1188956_1553.html

Manufacture of MultiStem® Stroke Medication in JapanNikon Cell innovation has entered an agreement with US company Athersys, Inc. for the commercialization in Japan of MultiStem®, a stem cell product for the treatment

of ischemic stroke. MultiStem may extend the ischemic stroke treatment window from the current 4.5 hours, with existing standard care, out to 36 hours, and may also meaningfully enhance patient recovery after such an attack.

USA

■

www.nikon.com/news/2017/1011_01.htm

Mitsubishi Monitor introduces some of the latest news about Mitsubishi companies as they play an active role on the world stage.World Scope

*MultiStem® is a registered trademark or trade name of Athersys, Inc. in the US and other countries.

World

4 5

The forest “Teutoburger Wald” is in a low mountain range

in the center of Germany. In the year 9 AD, the “Teuto”

became historically significant due to the so-called Varus battle in this region, where the Romans

suffered a disastrous defeat against the Germanic hordes. Today, the Teutoburger Wald is very

popular for holiday and leisure activities. Picturesque landscapes with idyllic lakes and bizarre rock

formations invite visitors to enjoy extended trekking and mountain bike trips. The world’s biggest

gliding airfield is located on the southern slope of the Teuto. A combination of forest and sandy

soil offers perfect conditions for gliding – enthusiastic pilots come from abroad. Bielefeld, with its

330.000 inhabitants, is located on the edge of the forest.

Mitsubishi HiTec Paper Retains Old Papermaking Traditions

In the past Bielefeld was well known for the production of linen

so it’s no wonder that the paper industry settled there. The paper

mill in Bielefeld was established in 1799 and is nowadays one of

the leading manufacturers of specialty papers worldwide. Today our product portfolio consists of

thermal papers, carbonless papers, inkjet papers, cast-coated label papers and barrier papers. I

started my training as a papermaker at Mitsubishi HiTec Paper in Bielefeld in 1989. Now I am jointly

responsible for occupational health & safety and industrial education.

To introduce the profession of paper technologist and to get young people interested in the

job, we participated in a medieval market in Bielefeld for the first time. Some of our trainees

presented the craft of papermaking as practiced centuries ago. All devices, the tent and even the

clothes were in the traditional medieval style and were made mostly by our trainees themselves.

The medieval market takes place every year at Bielefeld’s

landmark Sparrenburg, an old castle constructed in the 13th

century. With its high tower, stone walls and underground

basement vaults, the Sparrenburg is a perfect place to bring

the past back to life. Every year the medieval festival is a

great event – and with about 35.000 visitors it is one of the

biggest events in the region. So, we are very proud that

our presentation was so attractive and interesting that we

received inquiries from other markets in our area, as well, to

show the old craft of papermaking.

Compared to other festivals a medieval market has a very

special atmosphere. Not only the exhibitors but also the

visitors are often dressed in the traditional style, speak an

old German language and eat traditional food – so organizing

and attending the markets is a real pleasure for me and I am

looking forward to them again next year.

Bielefeld, Germany: Big City Near the Teuto

Sparrenburg Castle

The medieval festival

Center of Bielefeld

Mr. Markus Kerker Human Resource DepartmentAssistant to head of industrial training & specialist for occupational health & safety

Mitsubishi HiTec Paper Europe GmbHA group company of Mitsubishi Paper Mills

Global Spotlight focuses on employees from the Mitsubishi companies who are excelling in their respective fields around the world. In each issue we will get to know different employees, who will tell us about their hometowns, businesses, culture, and pastimes.

GlobalSpotlight

Germany

from

from IndiaSituated in a land of history and rich culture, with a plethora of

historical monuments, is the city of Mysore – the home of MVDE!

Cosmopolitan yet rich in heritage, the city celebrates its cultural

unity, pomp and grandeur during the Dasara Festival every year,

drawing lots of tourists from all over the world. The fortnight-long

festival commemorates the victory of good over evil, with the entire

city decorated in colourful lights, with traditional dance and folk

arts with music performances, culminating with a procession of

elephants carrying “Goddess Chamundi” seated in a golden canopy.

The city has also gained a reputation for its unique handwoven

silk garments and sandalwood artifacts. Not far away, in the

Nilgiri Forest Reserve surrounding Mysore, sightings of Bengal

tigers, Asiatic elephants, Indian bisons and many species of

birds are common and so it offers a real treasure trove for wildlife

enthusiasts.

My Association with MVDE

My company “Mitsubishi Heavy Industries - VST Diesel

Engines Private Ltd.” (MVDE) is a joint venture conceived

from the visions of our parent companies, to marry evergreen

Japanese technology with Indian manufacturing capability. I

joined MVDE at its inception in 2007 and being a greenfield

project it proved the most challenging part of my career, to

have set up and established this company brick by brick.

My 30 years of rich experience in operations and the world famous Japanese manufacturing system

have both helped me to carve out some of the best shop floor practices at MVDE, to make it a world-

class manufacturing base within Mitsubishi Heavy Industries Group today.

MVDE’s growth was slow initially, with our products struggling to gain a foothold in the highly

competitive domestic market. But it soon turned around as we started exports to MHI’s worldwide

customer base, supplying diesel engines made in India and assured with Mitsubishi quality. As MVDE

celebrates its 10th anniversary, I am indeed proud and happy to see the transformation of the company

over the years and I further look forward to mentoring my team members to stride ahead and taking

MVDE to greater heights in the future.

“Namma Mysore” (My Mysore)

Dasara procession

The rare Bengal tiger

Celebrating MVDE’s 10th Anniversary

Sandalwood handicraft

Mr. Mahesh Seshadrinath Vice PresidentMarketing and Supply Chain Management

Mitsubishi Heavy Industries-VST Diesel Engines Pvt. Ltd.A part of Mitsubishi Heavy Industries Group

6 7