felipe a. cisternas - university of toronto t-space...iv.2.3 northern blot analysis and...
TRANSCRIPT
THE FUNCTION OF ALTERNATIVELY SPLICED ISOFORMS OF DYSTROPHIN
Felipe A. Cisternas
A thesis submitted in conformity with the requirements for the Degree of Master of Science
Graduate Department of Molecular and Medical Genetics University of Toronto
O Copyright by Felipe A. Cisternas 2000
National Library Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Strset 395. rue Wdiingtm Onawa ON K l A W O(tawaON K I A W calnada canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, Ioan, distribute or seil copies of this thesis in microform, paper or electronic formats.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la foxme de microfiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or othewise de celle-ci ne doivent être imprimés reproduced without the author' s ou autrement reproduits sans son permission. autorisation.
" IF WE KNE W WHAT WE WERE DOING, IT WOULDN'T
BE CALLED RESEARCH, WOULD IT?"
Albert Einstein
THE FUNCTION OF ALTERNATIVELY SPLICED ISOFORMS
OF DYSTROPHIN
Master of Science, 2000
Felipe A. Cistemas
Graduate Department of Molecular and Medicai Genetics
University of Toronto
ABSTRACT
The Duchenne Muscular Dystrophy gene encodes multiple isoforms of dystrophin
generated by different promoters and by alternative splicing events at the 3' end of the
transcript. Alternative splicing of the penultimate exon 78 produces two structurally
different C-termini in the protein. Usage of the two dystrophin C-termini is tissue-
specific. developmentally regulated, and highly conserved across species. Work in this
thesis began to characterize the hinctional significance of the two C-termini of dystrophin
by creating targeted mice specifically mutated so as to constitutively use only one of the
two C-termini (Chapter II). in addition, the yeast-two hybrid system was used to identiQ
novel dystrophin interacting proteins that bind to the mainly hydrophobic exon-79
encoded C-terminus of dystrophin (Chapter III). Lastly, the full-length cDNA sequences
encoding the novel family of CAPS proteins (calcium-dependent activator protein for
secret ion), first identi fied in the two-hybrid screen, were obtained (C hapter IV). Human
expression profiles indicated that CAPS-1 is a neurdendocrine specific protein while
CAPS-2 is expressed ubiquitously.
i i i
ACKNOWLEDGEMENTS
1 am thankful to my supervisor, Dr. Peter N. Ray, for d l his help and support, and
for rnaking the last two and half years a great and entertaining learning experience.
1 would like to thank my supervisory cornit tee members, Dr. James Ellis and Dr.
Alan Cochrane, as they have been very helpful in guiding and supporting me throughout
my project.
1 am grateful to the members of the Ray lab, Paula Williams, Benjamin Isserlin,
Stephanie Ditta, Perry Howard, Dan Stevens, Jefiey Wong, Veronica Wong, and Ivan
Blasutig, for their help, fiiendship, and traveling Company.
1 would also like to thank al1 the people in the Genetics Department that have
helped me in the last two years including Dr. Enrico Arpaia, Brenda Muskat, Rahim
Ladak, David Ng, Dr. Johanna Romrnens, Jodi Momson, Sharan Goobie. Shanaz Al-
Rashid. and my room-mate Joel Rubin.
Finally, 1 am deeply thankfuI to my wonderfùl parents, Sonia and Julio, my sister
and brother-in-law, Sonia and Julio, and my nephew Cristian, for their love, support and
encouragement.
Table of Contents
... Thesis Abstract .....................................................................................................................III
Acknowledgements ....................................... ............... ........................................................... iv
Table of Contents ................................................................................................................. v
. . List of Figures .................... .......................... ..................................................................... VII
. . List of Tables ....................................................................................................................... VII
Chapter 1: Dystrophin and its Isoforms ............................................................................... 1 ......................................................... 1.1 Duchenne Muscular Dystrophy 2
1.2 Dystrophin ................................. ............................................................ 3 1.3 Dystrophin Isoforms ................... ............................................ . 6
1.3.1 Alternative Promoter Usage .................................................. 6 1.3.1.1 Dp427 ..................................................................... 6 1.3.1.2 Dp260 ......................................................................... 8 1.3.1.3 Dp140 ......................................................................... 9 1.3.1.4 Dpl16 ................. .............................................. 9
...................... 1.3.1.5 Dp71 .......................................... . . . 10 1.3.2 Alternatively Spliced Isoforms ............................................. 11
............ ....... 1.4 Dystrophin Interacting Proteins ...... ............... ............. 15 1.4.1 Dystroglycan ........................ ............................................. . 15 1.4.2 Sarcoglycan ............................................................................. 17 1.4.3 Dystrobrevin ............................................................................ 17 1.4.4 Syntrophin ........... .. .............................................................. 18 1.4.5 Other Partners ............ ....... ...................................................... 18
1.5 Mouse Models of DMI) ....................................................................... 19 1.5.1 Mouse Models with Point Mutations ..................... ... .......... 19 1.5.2 Knockout Mouse Models ................... ... ...... ..................... 2 1
1.6 Dystrophin in Neurotransmission ................... ........................... . 2 3
................ Chapter II: Mouse Models of Alternatively Spliced Isoforms of Dystrophin 25 II . 1 Introduction ....... ... ............. ........................................................... 2 6 11.2 Materials and Methods .................................................................... 2 7
11.2.1 Genomic Probe Isolation ....................................................... 27 11.2.2 Genomic Library Screening .................................................. 27 11.2.3 Phage DNA Restriction Mapping ............. .... ............... 2 9 11.2.4 PAC DNA Restriction Mapping ........................................... 30 11.2.5 Targeting of the Hydrophilic C-terminus .......... ... .......... 31 11.2.6 Targeting of the Hydrophobic C-terminus ......... .... ........ 32
11.3 Results ................... ............................................................ 34 .......... .................... 113.1 Physical Map of 3' End of Mouse DMD Gene 34
....... 11.3.2 Targeting the Hydrophilic C-terminus of Dystrophin 37
..... 11.3.3 Targeting the Hydrophobie C-terminus of Dystrophin 39 11.4 Discussion ........................................................................................ 41
..................................................... Chapter III: Isolation of New Dystrophin Interactors 44 III . 1 Introduction ........................................................................................ 45
....................................................................... 111.2 Materials and Methods 47 111.2.1 Yeast Two-Hybrid Plasmids ........... ................................ 47 111.2.2 Yeast Transformations ........................................................ 47
......... ........ 111.2.3 Yeast f3-gatactosidase Assay .. .................... 49 III.2.4 Yeast Two-Hybrid Library Screen .................................... 50
................... 111.2.5 Yeast Plasmid DNA Isolation ....... ............ . . . 50 ................ 111.2.6 Characterization and Specificity of Interaction 51
............................................................... U1.2.7 Expression Vecton 52 111.2.8 Western Blot Analysis ................ .......................................... 52
.................... 111.2.9 In Vitro Transcription/Translation .. .......... 53 111.2.10 In Vitro Affmity Pull-downs ................... ... .............. 5 4
1II.3 Results ................................................................................................ 55 .......................... 111.3.1 Novel Interacting Proteins of Dystrophin 55
.............. 111.3.2 Yeast and Non-Yeast Verification of Interaction 58 111.4 Discussion ........................................................................................ 65
............... Chapter IV: Cloning and Characterization of Human CAPS4 and CAPS-2 67 IV.1 Introduction .................................................................................... 68 IV.2 Materials and Methods ...................................................................... 71
IV.2.1 Yeast Two-Hybrid Screen ............................................. 7 1 IV.2.2 Cloning of Full-Length CAPS4 and CAPS-2 cDNA ....... 71
........ IV.2.3 Northern Blot Analysis and Semi-quantitative PCR 73 IV.2.4 Cornputer Analysis ....................................................... 73
IV.3 Results ................... ..................... ......................................... 7 4 ................. IV.3.1 Identification of CAPS-1 and CAPS-2 ............... 71
IV.3.2 Cloning Full-length human CAPS-1 and CAPS-2 cDNAs 75 .................... IV.3.3 Cloning of Full-length Mouse CAPS-2 cDNA 75
IV.3.4 Identification of Protein Motifs in CAPS-1 and CAPS.2 .. 79 IV.3.5 Chromosomal Location and structure of human CAPS-281
........................ IV.3.6 Tissue Expression of CAPS-1 and CAPS-2 81 IV.4 Discussion ........................................................................................... 85
.................................................................. Chapter V: Discussion and Future Directions 90 ............... V.1 Dystrophin Mutant Mice ...... ............................................... 91 ..................... V.2 Dystrophin Interacting Proteins ............................ ....... 93
V.3 Characterization of CAPS-1 and CAPS-2 ...................... .................. 95
................................................................................................. Chapter VI Reference List 98
List of Figures
Figure 1.1:
Figure 1.2:
Figure 1.3:
Figure 1.4:
Figure 1.5:
Figure 11.1:
Figure 11.2:
Figure 11.3:
Figure 11.4:
. . . Neurotransmission in the Retina .................................................................... 4
Dystrophin Isoforms Produced by Different Promoters .......................... 7
DMD Produces a Family of Isoforms Through Alternative Splicing ....... 13
Model of Dystrophin Function ................... .... ...... ........................................ 16
Dystrophin Promoters and Relative Position of Mouse DMD Mutations 20
Restriction Map of Phage 1.1 ................... ........................... . . . 3 5
Restriction Map of the 3' end of Mouse DMD Gene .................................. 36
......... Strategy for Targeting the Aydrophilic C-terminus of Dystrophin 38
....... Strategy for Targeting the Hydrophobic C-terminus of Dystrophin 40
Figure 111.1. Yeast Two-Hybrid "Bait" Constructs Development and Testing ............. 56
................... Figure 111.2. Steps Involved in the Yeast Two-Hybrid Approach ...... ...... ... 57
Figure 111.3. Pull-down Experiment with Bacterially Produced CAPS Proteins .......... 61
................. Figure 111.4. Pull-down Experiment with in vitro Produced CAPS Proteins 62
............... Figure IV . 1 : Stages of Exocytotic Pathway of Regulated Neurotransmission 69
Figure IV.2. Nucleotide and Amino Acid Sequence of CAPS-1 and CAPS-2 ................ 76
.......................... Figure IV.3. Amino Acid Alignment of CAPS.1. CAPS.2. and Une31 80
............. Figure IV.4. Genomic Structure and Location of Human CAPS-2 ....... ............ 82
................................. Figure IV.5. Expression Profiles of Human CAPS-1 and CAPS-2 81
List of Tables
....... Table 111.1. Yeast Two-Hybrid Transformations and Reporter Gene Activation 48
..... Table 111.2. Classification of Proteins Encoded by the Two-Hybrid cDNA Clones 59
...... Table 111.3. Verifkation of Interaction Between Target Clones and Bait Vectors 64
.................... Table IV.1. Humaa C A P S 3 gene structure information ................... 83
vii
CHAPTER 1: DYSTROPHIN AND ITS ISOFORMS
1.1 Duchenne Muscular Dystrophy
Duchenne muscular dystrophy (DMD) and its milder allelic variant Becker muscular
dystrophy (BMD) are X-linked disorders af5ecting over 1 in 3300 live bom males (Emery, 1993).
The primary pathology observed in DMD patients is a progressive skeletal muscle degeneration.
Disease is detected in infants as early as 2-3 years of age when they express signs of muscular
fatigue and weakening. As these children age, their skeletal muscles become increasingly weak,
leaving the affected children wheelchair b o n d by age 12 (Emery, 1993). Usually, DMD
patients die in their late teens or early twenties from respiratory complications or cardiac arrest.
It can be observed fiom muscle biopsies of DMD patients that their myofibers are
degenerating and cannot be adequately replaced. There is an infiltration of large fat ceils and
connective tissue in the muscle. Furthemore, the serurn level of muscle enzymes. including
creatine kinase, is significantly increased (Emery, 1993).
In addition to the progressive skeletal muscle degeneration, DMD patients have other
non-progressive defects. DMD affected boys have a cardiac phenotype in the form of altered
cardiac function. These patients have cardiac abnormalities such as arrhythmias, tachycardias.
rnurmurs, and abnormal electrocardiograms (Emery, 1993). DMD patients also have a central
nervous system (CNS) defect manifesting itself in the form of a Iower mean Intelligence
Quotient (IQ) level (Emery, 1993). As such, some patients may show no signs of mental
abnormalities, most patients have lower detectable IQ levels, and some have very pronounced
mental retardation.
DMD patients may also have abnormal retinal neurotransmission as detected by
electroretinograrns (ERG), a method of measuring the ion flux across the retina during light
stimulation to the eye (See Fig 1.1) (Pillers et al., 1993; Cibis et al., 1993; Sigesmund et al.,
1994; Pillers et al., 1999b). Following light stimulation, the photoreceptors in the retina becorne
hyperpolarized and send a signal to the adjacent neural ce11 layer which becomes depolarized.
During this process, potassium ions are released at the synapse and are taken up by the Müller
cells in the retina (Fig 1.1). These potassium ions travel the length of the Müller ce11 and are
finally secreted by the end feet of these cells at the imer limiting membrane and into the vitreous
humour. This ion flux can be detected by ERG recordings, thereby providing a means to
measure neurotransrnission occurring in the retina (Fig 1.1 ) (Fishman and Sokol, 1990).
1.2 Dystrophin
The gene responsible for DMD and BMD was cloned in 1987 (Burghes et al., 1987;
Koenig et al., 1987). It represented the first major disease gene identified soiely on the bais of
its genomic position, as the biochemical defects underlying its pathology were unknown. The
DMD gene was found to cover over 2.3 Mb on chromosome Xp2 1 (Roberts et al., 1993). The
gene is composed of 79 exons producing a transcript of 14 kb. This transcript encodes a protein
named dystrophin that is 3685 residues long and has a predicted molecular rnass of 427 kDa
(Koenig et al., 1987).
Based on sequence alignment, and partial proteolytic degradation, dystrophin is thought
to contain several distinct domains. It has an N-terminal domain with sequence similarity to the
actin-binding domain of a-actinin (Hemmings et al., 1992). Biochernical studies have shown
that filamentous actin can be bound by the dystrophin N-terminus at three locations. Following
the actin-binding domain, dystrophin contains a central a-helical coiled region that is composed
of 24 triple-helical spectrin-like repeats (Koenig and Kunkel, 1990). These repeated elements
separate the N-terminal and C-terminal domains of dystrophin. A cysteine rich domain follows
Scotopic ERG
Normal
bWaV. . -
Patient J.R.
a - w m
Figure 1.1: Neurotransmission in the retina. A) Diagram of the structure of the mammalian retina. The retinal ce11 types are designated as R, rods cells; C, cones cells; H, horizontal cells; B. bipolar cells; M, MülIer cells; 1, interplexifonn cells; Am, amicrine cells; G, ganglion cells. The retinal layers are indicated on the right: RPE, retinal pigment epitheliwn; OS, outer segment; IS, inner segment; OLM, outer limiting membrane; ONL, outer nuclear layer; OPL, outer plexiforrn layer; INL, inner nuclear layer; IPL, imer plexiform layer; GCL, ganglion ce11 layer; ILM, imer limiting membrane. Modified from Farber, D and Adler, R. 1986. B) A representation of an electroretinogram from an unaffected and an affected (J.R.) individual. The ERG is a record of the movement of ions across the membranes of the cells that make up the retina. In patient J.R. the ERG shows an absence of the B-wave, thus indicating abnormal retinal neurotransmission.
the spectrin repeats. This domain is involved in the binding of the transmembrane protein P-
dystroglycan to dystrophin. There is a WW motif partly formed by the 1 s t spectrin repeat and
by the cysteine rich region (Andre and Springael, 1994; Bork and Sudol, 1994). This WW motif
is involved in dystrophin binding to the proline-rich region of P-dystroglycan. The C-terminal
region of dystrophin is the most highly conserved domain across species and is involved in
dystrophin interactions with the syntrophin and the dystrobrevin families of proteins (Ahn and
Kunkel, 1 995; Suzuki et al.. 1995; Blake et al., 1995).
Although the precise fùnction of dystrophin is not yet fully understood. several postulated
functions have been proposed. Dystrophin has been s h o w to localize at the imer face of the
sarcolemrna where it is thought to act as a structural link between the actin cytoskeleton, the
plasma membrane, and the extracellular matrix (Ibraghimov-Beskrovnaya et al., 1992). Through
interactions with the proteins described below, dystrophin is thought to maintain the structural
intsgrity of the sarcolemma following the multiple rounds of muscle contraction (Ibraghimov-
Beskrovnaya et al., 1992). A second possible role for dystrophin is one of structural positioning
of specific channeIs and transmembrane receptor complexes, as well as peripherally membrane-
associated proteins, in a non-random manner on the plasma membrane (CampaneIli et al., 1994;
Sealock et al., 1991). Lastly, it has been postulated that dystrophin may be involved in ce11
signaling as it indirectly interacts with the signaling proteins nitric oxide synthase and the muscle
specific ion channels SkMI and SkM2 (Gee et al., 1998). All of these roles are accomplished
through multiple and diverse protein interactions, and although these varied functions may seem
very different, they are not mutually exclusive. It is currently believed that it is the large number
of different dystrophin isoforms which generate the functional specificity to accomplish each one
of these roles.
1.3 Dystrophin Isoforms
1.3.1 Alternative Promoter Usage
The DMD gene is a complex locus that encodes a large number of structurally diverse
isoforms through alternative promoter usage as well as alternative splicing at the 3' end. There
are at least 7 tissue specific promoters located within the gene. These promoters encode a
variety of isofoms that are identified by their respective molecular weights: Dp427, Dp260.
Dp 140, Dp 1 16, and Dp71 (see Fig 1.2).
I.3.l.l Dp427
Full-length dystrophin, or Dp427, contains al1 of the protein regions descnbed above. It
is encoded by three different tissue specific promoters (Fig 1.2), which include a muscle specific
promoter, a brain specific promoter, and a purkinje ce11 specific promoter (Gorecki et al., 1992;
Klamut et al., 1990; Chelly et al., 1990; Nudel et al., 1989). Dp427 has been shown to link the
actin cytoskeleton, through its N-terminal actin-binding domain, to the extracellular matrix, via
binding to the trammembrane P-dystroglycan protein. f3-dystroglycan binds a-dystroglycan on
the extracetlular side of the plasma membrane, and a-dystroglycan in turn binds the extracellular
protein laminin (Ibraghimov-Beskrovnaya et al., 1992; Ervasti and Campbell. 1993). These
interactions are thought to create a bridge that links the actin cytoskeleton to the extracellular
matrix providing a structural scaffold that supports the sarcolemrna during multiple rounds of
contraction (Ibraghimov-Beskrovnaya et al., 1992; Ervasti and CampbeII, 1993). It is thought
that the absence of Dp427 in muscle destabilizes the sarcolemrna, leaving this membrane more
susceptible to darnage and breakage which ultimately leads to the death of the muscle ce11 in
DMD patients.
NH2 Spectrin repeat WW Cys-rich COOH Dp427 111 1111111 1 1 1 l l 1 1 1 1 1 1 1 l -
,-• Brain
Figure 1.2: Dystrophin isoforms produced by different promoters. Top: the structure of the isofornis is schemat ically represented. Bottom: the ditrirent promoters, indicated by arrows, have a iiniqiie exon 1 spliced into spccific exons, shown by numbers, in the dystrophin transcript. (not drawn to scale)
1.3.1.2 Dp260
Dp260 was identified in our laboratory as a retinal specific dystrophin isoforrn (Dsouza et
al.. 1995). Further studies have s h o w that Dp260 is also expressed, at lower levels, in brain and
heart. The promoter for Dp260 is located in intron 29 of the dystrophin gene (Dsouza et al..
1995). Expression fiom this promoter leads to a transcript of 10 kb that contains a Dp260
specific first exon. This first exon splices into exon 30 of the full-length dystrophin transcript.
A translation initiation codon within the first exon of Dp260 leads to the generation of a unique
N-terminus composed of 13 new residues (Dsouza et al., 1995). This novel N-terminus is then
followed in frarne by the residues encoded by DMD exons 30 up to 79, ultimately generating a
protein of 260 kDa. Dp260 contains 15 of the 24 spectnn-like repeats, the WW motif, and the
cysteine-rich and C-terminal domains of dystrophin (Fig 1.2).
Retinal irnrnunohistochemistry studies done in Our laboratory, and others, have s h o w
that Dp260 expression is localized to the outer plexiform layer (OPL) (Dsouza et al., 1995;
Howard et al., 1998; Kameya et al., 1997). The OPL is a synaptic layer where the
photoreceptors transmit their message to bipolar cells, which in turn relay the information to
ganglion cells and finally to the visual cortex of the brain (Fig 1.1). Dp260 has been s h o w to be
espressed at the pre-synaptic face of photoreceptors (Schmitz and Drenckhahn, 1997). As
previously described, ERGs c m measure the transmission of the signal by measuring the ion flux
through the different layers of the retina. We, and others, have shown that there are
characteristic abnorrnalities in the ERGs of DMD patients and mouse models lacking Dp437 and
Op260 in the retina (Pillers et al., 1993; Pillers et al., 1995a; Pillers et al., 1999; Cibis et al.,
1993). These defects include a longer implicit time in b-wave generation, which indicates an
abnormality in the OPL neurotransmission (Fig 1.1). A recent mouse mode1 where expression of
Dp260 has been eliminated through targeted recornbination also generates an abnormal ERG
(Gaedick et al., 1999). This result m e r codïrms that Dp260 is essential for the effective
neurotransmission of signals produced by light stimuli. The fûnction of Dp26O in brain and h e m
is currently unknown, but it is likely to be similar to its role in retinal neurotransmission.
1.3.1.3 Dp140
A promoter located in intron 44 of the DMD gene gives rise to isoform Dp 140 (Lidov et
al.. 1995). This promoter expresses a transcript of 7.5 kb that contains a Dp140 specific exon 1
linked to exons 45-79 of the DMD gene. The 109 bp first exon of Dp140 lacks a translation
initiation start codon, thus translation of Dp140 commences at the first ATG site of the transcript
located in exon 51, which is in fiame with the rest of dystrophin, and generates a protein of 140
kDa (Lidov et al., 1995). Dp140 is the only known dystrophin isoforrn that does not contain a
unique N-terminus. Dp140 contains 5 of the spectrin-like repeats, the WW motif, and the
cysteine-rich and C-terminal domains of dystrophin (Fig 1.2). Its expression is restricted to the
peripheral membrane of glial cells in the central nervous systern as well as the developing
kidneys (Lidov and Kunkel, 1997; Lidov et al., 1995). It had been proposed that Dp140 rnight
be involved in the cognitive impairment of DMD patients, as gene mutations that disrupt Dp140
expression are ofien associated with mental retardation (Bardoni et al., 1 999). However, the
function of Dp140 is still unknown.
1.3.1.4 D p l l 6
A peripheral nervous system specific promoter encodes the Dp116 dystrophin isoform
(Byers et al., 1993). Expression of this isofonn starts in intron 55 of the DMD gene and the 5.2
kb transcript generated contains a unique exon 1 linked to exons 56-79 of the DMD gene. The
first exon of Dp 1 16 contains an ATG initiation codon and encodes a short and unique N-
terminus that is linked in frame to the rest of the dystrophin protein (Byers et al., 1993). The
overall protein has a molecular weight of 116 kDa and contains the last 2 repeats of the spectrin-
like rod domain, the WW motif, and the cysteine-rich and C-terminal domains of dystrophin (Fig
1.2). Dp116 has been shown to specifically localize to the myelin sheath that surrounds
peripheral nerves (Byers et al., 1993). The role of Dp116 in the peripheral nervous system is
u h o w n .
1.3.1.5 Dp71
A novel dystrophin promoter was identified in intron 62 of the DMD gene (Lederfein et
al.. 1993). This promoter transcribes a ubiquitously expressed isoform containing a unique N-
terminus composed of 7 amino acids linked to the dystrophin amino acids encoded by exons 63-
79 (Bar et al., 1990; Lederfein et al., 1992; Hugnot et al., 1992). Expression from this promoter
generates a protein of 71 kDa comprised of only the cysteine-rich and the C-terminal domains of
dystrophin (Fig 1.2). The WW motif, which is known to be involved in P-dystroglycan binding
to full-length dystrophin, is absent fiom this isoform, even though Dp71 has been reported to
bind P-dystroglycan (Cox et al., 1994; Greenberg et al., 1994).
Dp71 is expressed in significant levels in brain, retina, h g , liver, kidney, smooth
muscle. testis, fetal muscle, but at very 10w levels in adult skeletal and cardiac muscle (Lederfein
et al., 1993; Rapaport et al., 1992; Austin et al., 1995; Hugnot et al., 1992). There appears to be
a switch in dystrophin expression from fetal to adult muscle tissues, as Dp71 is the sole isoform
in early muscle biogenesis and fetal development, with Dp427 gradually increasing its
expression during development and ultimately becoming the only dystrophin isoform produced
in newbom's muscle (Hugnot et al., 1993; Wertz and Fuchtbauer, 1998). Transgenic
experiments where expression of Dp71 was introduced in the muscles of the mdr mouse mode1
of DMD. whose Dp427 expression is abolished, revealed that Dp71 can reconstitute the
dystrophin glycoprotein complex on the sarcoiemma (Cox et al., 1994; Greenberg et al., 1994).
However, the muscle phenotype of these transgenic mice was not corrected, but was actually
worsened. The precise role of Dp71 in muscle and non-muscle tissues remains therefore
unknown.
1.3.2 Alternatively Spliced Isoforms
Alternative splicing is a common feature of a large nurnber of proteins involved in
diverse cellular functions that include cytoskeletal, extracellular. signaling. and transcriptional
regulation. Some examples of altematively spliced proteins include the cytoskeletal myosin.
troponin T, and P-tropomyosin proteins, the trammembrane integrins. as well as the e'rtracellular
agrin protein (Reiser et al., 1992; Cho and Hitchcock-DeGregori, 1991; Ferns et al., 1992;
Carnpanelli et al., 1996; Baudoin et al.? 1998). The precise role of the splice variants of each
protein is only begiming to be understood, but it is clear that regulated exon splicing confers an
additional level of protein modification, which is likely to be involved in altered protein folding
or differentid protein-protein interactions. For instance, alternative splicing of an exon in the
extracellular agrin protein can increase acetylcholine receptor clustering activity by 1000-fold
(Ferns et al., 1992; Campanelli et al., 1996; Gesemann et al., 1996).
The DMD gene has also generated greater diversity in its gene products through the use
of alternative splicing (Feener et al., 1989; Bies et al., 1992). There are two major sites in the
dystrophin transcript where aitemative splicing occurs (Fig 1.3.A). The first site includes
splicing of exons 71-74, either as individuai exons, or in combination (Ceccarini et al., 1997;
Feener et al., 1989; Lederfein et ai., 1992; Austin et al., 1995). This creates a senes of in-frame
deletions in full-length dystrophin and its shorter isofoms. Alternative splicing in this region
generates a multitude of slight variants of the original protein, possibly providing small
modifications to its overall role. For exarnple, exon 74 has been shown to contain the
syntrophin-binding site. Splicing of exon 74 therefore inhibits syntrophin binding to dystrophin
and may provide a means of regulation for these protein-protein interactions (Ceccarini et al..
1997).
A second region of alternative splicing in the dystrophin transcript ifivolves the
penultimate exon 78 (Feener et al., 1989; Lederfein et al., 1992; Bies et al., 1992; Austin et al..
1995). When exon 78 is present in the transcript, the translational machinery recognizes a stop
codon two amino acids into exon 79. This C-terminus is therefore composed of 1 1 residues from
exon 78 and 2 residues from exon 79 (Fig I.3.B). Analysis of the hydrophobicity of this C -
terminus shows that it is primarily hydrophilic. Removal of exon 78. by alternative splicing,
creates a translational fiame-shift in the transcript and generates a different C-terminus in
dystrophin. This alternative C-terminus is composed of 3 1 amino acids encoded by exon 79 (Fig
I.3.C), a d is primarily hydrophobic (Feener et al., 1989; Bies et al., 1992). While the functional
significance of the splicing of exon 78 remains unknown, the differences introduced into the
protein are significant, including a new potential leucine zipper domain (Fig I.3.C), and result in
an overall change in hydrophobicity that may influence protein folding or protein-protein
interactions (Roberts and Bobrow, 1998). In addition, exon 78 contains a potential
phosphorylation site for p34CdS' protein kinase which has been show to phosphorylate the
A. DMD gene
Exon 7 1-74 Exon 78 in-frame splice frame-shi fi splice
B. Hydrophilic C-terminus
. . . P S S R G N T P G K P M R E D T M
C. Hydrophobic C-terminus
Figure 1.3: The DMD gcne produces a fainily of isofornis through alternative splicing. A) Full-lcngth dystrophin transcript is shown with its 79 exons. Splicing of exons 71-74 produccs a series of in-fraiiie deleiions soiiic of which inhibit syntrophin binding. Splicing of exon 78 produces a translational franie-shift. B) The 3' end of a dystropliin transcript, çontaining exon 78, results in a 13 amino acid hydrophilic cxoii-78 encodcd C-terminus. C) Splicing of exon 78 results in a 31 amino acid hydrophobie exon-79 eticodcd C-terminus.
dystrophin C-terminus in vitro (Milner et al., 1993; Michalak et al., 1996). Splicing of exon 78
removes this potential phosphorylation site and may therefore regulate the phosphorylation status
of the dystrophin isoforms lacking exon 78.
While characterîzing the tissue expression of the different isoforms of dystrophin, we.
and others, have shown that al1 the isoforms originating fiom the multiple dystrophin promoters
are capable of using either the hydrophilic or the hydrophobic C-terminus (Austin et al.. 1995:
Howard et al.. 1998). Howeve- the level at which these two C- termini are used varies widely
depending on the isoform and the tissue studied (Gus Daily, manuscript in preparation). For
instance, when looking at dystrophin expression in the retina, Our lab, and others. have shown
that Dp477 and Dp260 are expressed in the outer plexiform layer, while Dp71 is expressed in the
inner limiting membrane of the retina (Dsouza et al., 1995; Kameya et al.. 1997; Howard et al.,
1998). More specifically, our lab has demonstrated that in the retina, Dp427 and Dp260 utilize
prima-ily the hydrophilic exon-78 encoded C-terminus, while Dp7 1 uses mainly the hydrophobic
exon-79 encoded C-terminus (Howard et al., 1998).
These results are comparable to other studies that show that while Dp71 can use both C-
termini. the predominant utilization is ha t of the hydrophobic C-terminus (Howard et al.. 1999).
Similarly, the larger isoforms, while capable of using either C-terminus, make use of the
hydrophilic C-terminus in greater proportions. The significance of this is unknown, but it rnay
be related to a specific function of Dp71 that necessitates the hydrophobic C-terminus to perhaps
interact with a unique set of proteins. Alternatively, it may affect the overall protein folding
conformation and affect the binding affinhies of dystrophin to its known protein partners.
It is important to note that the usage of alternatively spliced dystrophin isoforms, as well
as the primary amino acid sequence encoded by them, is very highly conserved between different
species, including human and mouse (Roberts and Bobrow. 1998). In addition, the
developmental regulation and tissue-specific variation of the usage of these altematively spliced
isoforms indicate that they are important in dystrophin function (Howard et al., 1999). Clearly.
fùrther research is necessary to elucidate the specific roles of the two C-tennini of dystrophin.
1.4 Dystrophin Interacting Proteins
Bioc hemical purification of dystrophin from muscle has identi fied a number of proteins
that comprise the dystrophin glycoprotein complex (DGC) (Ozawa et al., 1995). This complex
of dystrophin interactors consists of extracellular and transmembrane glycoproteins, as well as
intracellular membrane-associated and cytoskeletal proteins (Fig 1.4). These include B-
dystroglycan and a-dystroglycan, the a-, o-, 6-_ y-, and E-sarcoglycans. sarcospan. a-
dystrobrevin and B-dystrobrevin, and the al-, pl-, and P2-syntrophins. Aldiough the role of
these interactions remains unclear. some of these proteins are muscle specific and may be
required for muscle membrane integrity, while some are neuronal specific and may be important
for proper synaptic or neuromuscular junction activity.
1.4.1 Dystroglycan
P-dystroglycan is a 43 kDa transmembrane protein that interacts directly with dystrophin
via its proline-rich cytoplasmic tail (Ibraghimov-Beskrovnaya et al., 1992). The WW motif and
the cysteine-rich domain of dystrophin mediate this interaction. P-dystroglycan is CO-expressed
in tissues where dystrophin is present. In the retina, for example, it is expressed at the outer
plexiform layer, the inner limiting membrane, and the retinal blood vessels (Schmitz and
Drenckhahn, 1997). B-dystroglycan binds directly to the extracellular a-dystroglycan protein, a
Extracellular matrix
/ actin cytoskeleton
FIGURE 1.4: Maiel of Dystrophin Function. Dystrophin interacts with the actin cytoskeleton via its N-terminal actin binding domain and with B-dystroglycan via its cysteine-rich domain. 0-dystroglycan interacts with a- dystroglycan which in t m interacts with the extracellular matrix. These interactions create a bridge that links the intracellular cytoskeleton and the extracellular maîrix increasing the sarcolernma stability.
In addition, dystrophin is thought to interact directly, or through syntroph in and dystrobrevin, with specialized membrane pfdeins placing thern in non random locations, Lady, dystrophin is believed to participate in signal transduction via its multiple interactions.
156 kDa protein that interacts with the extracellular matrix proteins laminin and agrin (Ervasti
and Campbell, 1993). a-dystroglycan acts therefore as an agrin receptor and may initiate a
signal transduction cascade following agnn binding. Both a-dystroglycan and P-dystroglycan
are products of the same gene and become individual proteins following post-translational
modifications which divide the gene product in two (Ibraghimovbeskrovnaya et al., 1 993).
1.4.2 Sarcoglycan
The sarcoglycans are a fmi ly of proteins that have been shown to be biochemically
associated with dystrophin (EN& and Campbell, 1991). This family is composed of at least 5
members: a-, B-, 6-, y-, and E-sarcoglycan. Although the precise role of the sarcoglycans
rernains unknown, mutations in these genes are associated with various limb girdle autosomal
muscular dystrophies (Roberds et al., 1994; Lim et al., 1995; Noguchi et al., 1995; Nigro et al..
1996). The sarcoglycans must therefore be acting in a somehow related role to that of
dystrophin, possibly in membrane stabilization. The sarcoglycans are also associated with the
transmembrane protein sarcospan which also CO-purifies with dystrophin (Crosbie et al.. 1997).
It has been proposed that sarcospan rnay act as an ion channel as it is cornposed of four
transmembrane domains that could form a pore for specific ion transport (Crosbie et al., 1997).
1.4.3 Dystrobrevin
The dystrobrevins were initially identified as phosphorylated proteins involved in
acetylcholine receptor formation and maintenance in the electric organ of Torpedo californica
(Sadouletpuccio et al., 1996). It was later shown that the dystrobrevins, encoded by two genes
that produce multiple isoforms by alternative splicing, could directly interact with dystrophin via
their respective coiled-coi1 domains near their C-termini (Sadouletpuccio et al., 1997). In
addition to being dystrophin interactors, the dystro brevins where s h o w to be dystrophin
paralogues (Peters et al., 1997). a- and P-dystrobrevins resemble Dp71 in that they contain a
cysteine-rich domain and a C-terminal domain. However, contrary to Dp71, no alternative C-
terminus usage has yet been observed in the dystrobrevins.
1.4.4 Syntrophin
The syntrophins are a family of dystrophin binding proteins encoded by three genes. a-.
1 -, and PZ-syntrophin (Adams et al., 1 993; Ahn et al., 1 994). Transcription from each of these
genes is tissue specific and undergoes alternative splicing. The syntrophins contain two plekstrin
homology (PH) domains and a PDZ domain. PH domains are protein motifs involved in protein-
protein and protein-phospholipid interactions, and may help localize syntrophin to the plasma
membrane (Gibson et al., 1994). Syntrophin has been shown to bind directly to nitric oxide
synthase via their respective PDZ domains (Brenrnan et al., 1996). In addition, the PDZ domain
of syntrophin binds the transmembrane sodium channels SkMl and SkM2, and may position
them at specific locations along the membrane (Gee et al.. 1998).
1.4.5 Other Partners
A nurnber of other dystrophin interacting proteins have been identified through various
methods. Although these proteins do not CO-puri@ with the DGC complex, they may participate
in dystrophin isoform fùnctioning. For instance, the cytoskeletal protein troponin T was shown
to bind dystrophin in a two-hybrid system in yeast (Pearlman et al., 1994). It was demonstrated
that the C-terminal region of dystrophin interacts directly with troponin T via their respective
coiled-coi1 motifs (Pearlman et al., 1994). Additional yeast two-hybrid screens with the
dystrophin C-terminus have shown interaction with the cytoskeletal a-actinin protein (Hance et
al.. 1999). Other reports indicate that dystrophin may bind calmodulin and aciculin9 however.
none of these interacting proteins form part of the DGC complex, and may therefore represent
transient partners (Jarrett and Foster, 1995; Belkin and Burridge, 1995).
1.5 Mouse Models of DMD
Analysis of dystrophin expression, localization and fùnction has been aided by the
availability of dystrophin mutant mice. To date, nine different allelic variants of the mouse
DMD gene have been generated. These mice have mutations at different locations along the
DMD gene which affect the expression of specific dystrophin isoforms while leaving others
isoforms unaltered (See Fig 1.5).
1.5.1 Mouse Models with Point Mutations
The mu5 mouse was the first animal mode1 for human DMD identified (Bulfield et al..
1984). Similar to DMD individuals, mu5 mice show an absence of the dystrophin protein and
reduced dystrophin RNA levels (Chamberlain et al., 1988). However, in contrast to DMD
patients, these mice have successfùl muscle fiber regeneration and reduced c o ~ e c t i v e tissue
infiltration (Torres and Duchen, 1987). During the first months of life, damaged fibers are
replaced with new fibers, regenerated fiom satellite cells, which are resistant to b-ther
degeneration. An exception to the non-progressive muscle disease in these mice is the
progressive degeneration of the diaphragm, which is the only muscle with ongoing necrosis. It
has been shown that the rn& mouse has a single nucleotide substitution within exon 23 (Fig I.5),
Figure 1.5: Dystrophin promoters and relative positions of mouse DMD mutations. A) Schematic representation of the mouse DMD gene with the positions of the mutations in eight variants of the rn& mouse relative to the different promoters (not drawn to scale). B) Expression of the dystrophin isoforms in the eight mouse variants.
which causes premature termination of the polypeptide at 27 % of hill-length dystrophin
(Sicinski et al., 1989).
Four newer mdr mutants (mdrz-5cv) were recovered from male mice subjected to N-
ethylnitrosurea chemicai mutagenesis (Chapman et al., 1989). Al1 of these mutants display a
muscle pathology and elevated s e m creatine kinase levels that do not differ from the original
'-5Cv mdr mutant. Mutation detection studies have locaiized the respective mutations of the maY
series (Im et al., 1996). Similar to mdx mice, it has been dernonstrated that mdr'c' mice lack
soiely Dp127 expression (Fig 1.5). The allelic variant rndr''' is defective for both Dp427 and
Dp260. whereas mice are deficient in Dp427, Dp260, and Dp140 (Fig 1.5). Finally.
mdr3'' mice have a mutation in intron 65 where a T to A transversion creates a novel splice
acceptor in exon 66, thereby producing a translational frameshifi that leads to the absence of al1
dystrophin isoforms (Cox et al., 1993).
1.5.2 Knockout Mouse Models
To further characterize the h c t i o n of specific dystrophin isoforms, a total of four new
m d ~ alleles have been generated by homologous recornbination and by gene trapping (Araki et
al.. 1997; Wertz and Fuchtbauer, 1998; Sarig et al., 1999; Gaedick et al., 1999). First. a targeted
dismption within exon 52 of the DMD gene was used to eliminate Dp427, Dp260, and Dp140
expression in mice (Araki et al., 1997). These animals were shown to have a phenotype very
similar to the rndr'cv mice (Kameya et al., 1997). Secondly, a gene trap screen was used to
generate a DMD'&-~~O line where a B-galactosidase-neomycin reporter gene was inserted into
intron 63 of the mouse DMD gene (Wertz and Fuchtbauer, 1998). This allelic variant thereby
contains a mutation that affects ail known dystrophin isoforms, and c m be used to follow Dp7 1
expression by staining for P-galactosidase activity (Fig 1.5). Thirdly, Sarig et al. specifically
inactivated the expression of Dp71 by replacing its first and unique exon with a P-galactosidase
reporter gene in order to study the possible fùnction of Dp71 and its expression during
development (Sarig et ai., 1999). They found that Dp7l-nul1 mouse embryos and tissues
demonstrated a stage- and ce11 type-specific activity from the Dp71 promoter during
deveiopment and during the differentiation of the various tissues. Lastly. a Dp260 specific
targeted recombination study, where the unique first exon of Dp260 was mutated. was recently
used to show that this isoform is essential for normal retinal neurotransmission (Fig 1.5)
(Gaedick et al., 1999).
Al1 of the mouse variants described above have been very usefül in characterizing the
specific roles of particular isoforms of dystrophin. These mutant mice have revealed that the
short isoforms have no effect on muscle disease, and that muscle pathology is dependent on
Dp427 expression. Mice lacking Dp260 have demonstrated its essential role in retinal
neurotransmission, whereas no apparent phenotype has yet been described in the Dp71 knockout
variant. This indicates that it may be difficult to assess the non-muscle function of dystrophin
isoforms in mice. such as their role in cognitive impairments, and that their phenotype may be
masked by overexpression of the dystrophin paralogues utrophin and dystrobrevin.
In spite of this, the various mdr mouse alleles have been helplül in characterizing the
function of the dystrophin isoforms in the retina. The retina has been a usehl tissue to study
dystrophin isoform function in the nervous system since it displays a measurable phenotype in
the absence of specific isoforms. By analyzing the light stimulated ERGS of these mice, we, and
others, have demonstrated a correlation between the position of the mutation, and therefore the
specific isoforms affected, and the severity of the ERG abnormality (Pillers et al., 1995a; Pillers
et al.. 1999b). Mice with mutations in Dp427 (mdr and mdrscV) have normal ERGs. indicating
that full-length dystrophin is not required for proper neurotransmission in the retina, whereas
rnice with mutations afYecting both Dp427 and Dp260 (mdxzcv) have ERGs with increased
implicit times for the b-wave and oscillatory potentials. Finaily, the mdScv mouse, lacking al1
dystrophin isoforms, has an ERG with both an increased implicit time as well as an attenuation
of the amplitude of the b-wave response (Pillers et al., 1999b). These ERG profiles are very
similar to the situation in humans where it appears that the two smaller isoforms, Dp260 and
Dp7 1. are necessary and sufficient to generate a normal b-wave (Sigesmund et al.. 1994; Pillers
et al., 1999). This makes mouse mutants excellent models for the study of dystrophin isoforms
in the retina.
1.6 Dystrophin in Neurotransmission
A large proportion of DMD patients, as well as DMD mice, show defects in central
nervous system fùnction (Emery. 1993). The cognitive impairment and the abnormal retinal
ERGs from these subjects indicate that dystrophin andlor its shorter isoforms are involved in
neurotransmission. It has been demonstrated that al1 the dystrophin isoforms. i.e. Dp427. Dp260.
Dp 140. Dp116. and Dp7 1, are expressed in the nervous system (Lidov. 1996). Dp427 is
pnmarily expressed in the stellate and pyramidal neurons of the cerebral cortex and the
hippocarnpus (Lidov, 1996). Dp260 is present in the retina and in the cerebral cortex (Dsouza et
al., 1995). Dp140 is abundant in fetal brain where it has glial localization (Lidov et al., 1995).
Dpl16 is concentrated in the nerves of the peripheral nervous system (Byers et al., 1993). and
Dp71 is primarily expressed in the dentate gyms of the brain (Gorecki and Barnard. 1995).
Although the function of these isoforms in the nervous system remains unknown, it has been
postulated that they position specific membrane-associated proteins at non-random locations.
For example, we, and others, have s h o w that Dp427 and Dp260 are expressed at a presynaptic
region of the retina, the OPL (Dsouza et al., 1995). This suggests that dystrophin may function
to position specific elements on the pre-synaptic membrane which are necessary for synaptic
transmission. Some of the proteins involved in synaptic transmission have been identified in the
last few years, and their role is begiming to be understood (See Fig IV.1). Further identification
of these elements, and their possible direct or indirect association with dystrophin isoforms, is
critical in characterizing the role of dystrophin in the nervous system.
AIthough dystrophin was cloned twelve years ago. its specific function is still unknown.
Dystrophin was originaily though to be a muscle protein required for membrane stabilization
following the multiple rounds of contraction. However, it is now known to form a large family
of protein isoforms with tissue specific expression. Clearly, the diverse functions of dystrophin
in structural stability, membrane modeling, and signal transduction, appear to be achieved by
these tissue specific isoforms. Moreover, the functional diversity of dystrophin is probably due
to its large array of protein interactions. Therefore, a complete understanding of dystrophin
function will require a detailed examination of the proteins with which it interacts.
CHAPTER II: MOUSE MODELS OF ALTERNATIVELY SPLICED
ISOFORMS OF DYSTROPHIN
II. 1 Introduction
The different mdr models generated over the last few years, as well as rnouse knock out
models of some of the DGC members such as a-dystrobrevin. a-syntrophin, and the
sarcoglycans (Williamson et al., 1997; Karneya et al., 1999; Duclos et al., 1998), have yielded
important insights into the role of dystrophin isoforms and dystrophin protein complexes in
different tissues. However, some important questions remain as to the functional significance of
the altematively spliced isoforms of dystrophin. The alternative removal of exon 78 fiom the
dystrophin transcript creates a different C-terminus that differs in length, hydrophobic content.
and possibly protein-protein interaction or modulation. This splicing event is important as it is
developmentally regulated, shows tissue specificity, and is highly conserved across species
(Roberts and Bobrow, 1 998).
The dismption of dystrophin isoforms in the existing mouse models does not distinguish
between isoforms with the hydrophilic or the hydrophobic C-terminus. As a result, it is currentIy
impossible to distinguish between the fünctional contribution of each C-terminus. The answer to
some of these questions will require two mouse models each lacking one of the two C-termini of
dystrophin. To achieve this, we developed an experimentai scheme to knock in. or knock out.
the penultimate exon 78 of the dystrophin gene in mouse embryonic stem (ES) cells. This
method will generate mutant mice that utilize either the hydrophobic, or the hydrophilic. C-
terminus of dystrophin in a constitutive manner. This chapter describes work accomplished in
the generation of these mouse mutant lines.
11.2 Materials and Methods
11.2.1 Genomic Probe Isolation
Two genomic DNA probes were generated by PCR fiom the 3' end of the mouse DMD
gene. The first arnplified product contained the dystrophin sequence encoded by mouse exon 78
as well as part of its flanking introns. This 229 bp product was arnplified by PCR fiom mouse
liver DNA using Elongase DNA Polymerase (GibcoBRL) and the forward and reverse primers
KO-78-F2 5'-CTTTCTGATATCTCTGCCTCTTCC-3' and KO-78-R 5'-
AATGAGCTGCAAGTGGAGAGG-3'. The amplification conditions included a denaturation
step of 94OC for 30 sec, followed by 35 cycles of 94°C for 30 sec, 53°C for 30 sec. and 68OC for
60 sec. The PCR product was visualized on a 0.8 % agarose gel and purified with a QiaexII Gel
Purification Kit (Qiagen). This 229 bp exon 78 probe was blunt-end subcloned into vector
pBluescript-KS (Stratagene) and sequenced with the Sequenase Kit (Amersham) for verifkation.
The second probe, representing a non-coding portion of the mouse dystrophin exon 79, was
amplified with Elongase (GibcoBRL) and primers Exon-79-F2 5'-
CACATTGTTTTGCATTACTTTAGCGTGG-3' and Exon-79-R1 5'-
GTAAGTCCTGTGTATTCATTCGCATGTTCC-3'. The PCR conditions included a
denaturation step of 94OC for 30 sec, followed by 35 cycles of 94°C for 30 sec' 56'C for 30 sec,
and 6g°C for 60 sec. This reaction arnplified a 454 bp segment of exon 79, which was
subsequently subcloned into pBluescript-KS and sequenced.
11.2.2 Genomic Library Screening
The exon 78 and exon 79 probes described above were used to screen a 129/Sv-D3
mouse genomic DNA library inserted into phage Lambda-Dash2 (gift from Dr. Michael A.
Rdnicki), as well as a 129/SvEvTac mouse PAC library (kindly screened by the Toronto Center
for Applied Genomics, TCAG, HSC, Toronto). Pnor to the library screens, the two probes were
radiolabeled by random pnming (High Pnme Labeling, Boeknger) with 3 2 ~ - d ~ ~ ~ (Mandel)
and tested on mouse genomic Southem Blots to veri@ their specificity for exons 78 and 79 of the
mouse DMD gene. The 129/SvD3 mouse genomic library was plated at 4x1 o5 p.f.u. and phage
were lifted ont0 N+ Hybond membrane filters, immobilized by denaturing with O.5N NaOH and
l.5M NaCl. and neutralized in 1 -5M NaCI, O.5M Tris pH 8.0. Filters were air dried. cross-linked
with 1 .2xl0~~joules in a UV Stratalinker 2400, and prehybridized for 4 hrs at 6j°C in 5xSSC.
1 M NaCI, 1 % SDS, and 100 &ml denatured salrnon sperm DNA. The two probes derived from
exons 78 and 79, labeled by random priming with 3 2 ~ - d ~ T P (Mandel), were allowed to hybridize
to the filters overnight at 65OC in SxSSC, 1M NaCl, 1% SDS, and 5% dextran sulfate. Filters
were washed with 2xSSC/O.l% SDS at 25OC for 5 min, 2xSSC/O.l% SDS at 55OC for 30 min,
and IxSSC/O.l% SDS at 55'C for 20 min. Membranes were exposed to X-ray film for 16 hrs
and 3 days. Two positive phages were picked and eluted from agarose plugs with TM (5OmM
Tris pH 8.0, lOmM MgS04) and chloroform for 16 hrs at 4OC. Host MRA(P2) E-coii cells.
grown in LB media with 1OmM MgSOj and 0.2% maltose. were separately inoculated with c.
multiple dilutions of phage DNA. Absorption of phage DNA into cells occurred at 37OC for 10
min. Prewarmed top agarose was added to the cells, and the mixture was plated and incubated
overnight at 37OC. The entire procedure was repeated twice until two pure phage clones were
isolated (clones 1.1 & 4.1) for M e r characterization. For DNA extraction, a pure phage plug
was isolated, plated, and incubated with host MRA(P2) cells ovemight at 37OC. The plates were
then flooded with 8 ml of TM buffer and shaken for 3 hrs at 25'C, after which the buffer was
collected and the cells removed by two centrifugation steps at 9000 rpm for 10 min. The high
titer phage supernatant was incubated with host cells in absorption buffer (1OmM MgCl? and
lOmM CaC12) for 10 min at 37'C, and grown in LB hroth supplemented with lOmM MgCl2 and
0.1% glucose for 7 hrs at 37OC until complete cell iysis occurred. The mixture was pelleted
twice at 9000 rpm, and the supernatant was collected and ultracentrifuged at 35000 rpm for 45
min at 15°C. The pellet was resuspended in lysis buffer (TM, lmg/ml proteinase K. 0.5% SDS)
and incubated at 37OC for 2 hrs. DNA was purified with phenol and chloroform extractions.
precipitated with 7.5M ammonium acetate and 100% ethanol, and resuspended in TE (1 0mM
Tris pH 8.0. 0.0 1 m M EDTA).
11.2.3 Phage DNA Restriction Mapping
Phage DNA was restriction digested separately with EcoRI, BamHI, XhoI, HindIII. SaII.
XbaI. KpnI, SmaI, Notl, Sad, as well as in combination with EcoRUXhoI, BamHVXhoI.
EcoRVHindIII, EcoRVBamHI, EcoRI/SalI, EcoRVXbaI, EcoWSacI, and HindIIVXhoI- The
restriction digestion products were separated on 0.8% agarose gels and visualized with ethidium
bromide staining. DNA was then transferred from the gels to N+ Hybond membrane filters by
Southern blotting with 1OxSSC. Blots were denatured with OSN NaOH. 1.5M NaCI .
neutralized in 1 .SM NaCl, 0.5M Tris pH 8.0. air dried, and UV cross-linked. Filters were then
prehybridized 1 hr at 42°C in 50% formamide, 5x Denhardt's Reagent, SxSSC, 0.1% SDS,
50mM NaP04 and 100 pg/ml denatured saimon sperm DNA, and hybridized 16 hrs at 42OC with
3 2 ~ - d ~ ~ ~ - l a b e l l e d exon 78 and 79 probes in 50% formamide, lx Denhardt's Reagent, SxSSC?
0.1 % SDS, 20mM NaPOj and 100 pg/ml denatured salmon sperm DNA. Restriction digestion
and Southern probing revealed that phage 1.1 and 4.1 were identical. Furthemore, the
restriction fragments containing exon 78 and 79 of the mouse DMD gene were organized into a
physical map (See Fig 11.1). Variclus restriction fragments from the 3' end of the mouse DMD
gene were subsequently gel purified, subcloned in pBluescript-KS (Stratagene), and sequenced
for further characterization.
11.2.4 PAC DNA Restriction Mapping
The 3' end of the mouse DMD gene was also obtained from a screening of a
I29/SvEvTac PAC library with a probe fiom exon 79. This screen was performed at the TCAG,
HSC, Toronto, and identified three positive PAC clones: 450-G15, 562-AI 0, and 657-F9. DNA
was isolated fiom these PAC clones by the alkaline lysis method. Briefly, the PAC clones were
inoculated in LB broth supplemented with kanarnycin and grown ovemight at 37OC. The
cultures were pelleted and resuspended in 0.3 ml P l solution (1 5mM Tris H 8.0. lOmM EDTA.
100pg/ml RNAse A). A volume of 0.3 ml of P2 solution (0.2N NaOH, 1% SDS) was added.
mixed slowly, and incubated for 5 min at 25OC before 0.3 ml of P3 solution (3M KOAc pH 5.5)
was added to the mixture and incubated on ice for 5 min. The DNA-containing supernatant was
recovered from two sequential 10 min centrifugations at 3000 and 14000 rpm. PAC DNA was
precipitated in ice-cold isopropanol, washed with 70% ethanol, and resuspended in distilled H20.
DNA from the three PAC clones was digested with various restriction enzymes, ran on
agarose gels, and Southem blotted as described above. These blots were hybridized with probes
from exon 78 and 79 of the DMD gene allowing for the generation of a physical map of the 3'
end of the DMD gene (See Fig 11.2).
11.2.5 Targeting of the Hydrophilic C-terminus
The restriction map generated from phage and PAC clones, as well as the partial
sequence obtained from the subcloning of particular restriction fragments in the 3' region of the
mouse DMD gene, were used to design and constnict a targeting vector, pKOACT- 1, to alter the
mouse DMD gene such that the hydrophobie C-terminus of dystrophin is constitutively used (Fig
11.3). This constnict, derived fonn the pPNTlloxP parental vector (Shalaby et al., 1995), contains
a neomycin resistance cassette flanked by two 10xP sites allowing for its future removal with Cre
recombinase, as well as a herpex simplex virus thymidine kinase (HSV-TK) negative marker for
selection against randomly integrated recombination events.
To ampli@ the short arm of pKOACT-1, Elongase DNA Polymerase (GibcoBRL) was
used with phage 1.1 DNA and pnmers Short-Arm-F 1 5'-CCCTACTCTAAAACACTTACC-3'
and Short-&-RI 5'-CCAAACAGATGTTGAGGTGAC-3'. These pnmers are located in
intron 77 of the mouse DMD gene at 2.8 kb and 120 bp 5' of exon 78 respectively. The
amplification cycling conditions included an initial denaturation step of 94OC for 30 sec.
followed by 30 cycles of 94OC for 30 sec, 55OC for 30 sec, and 68°C for 3.25 min. The 2.7 kb
PCR product was visualized on a 0.8 % agarose gel and purified with a QiaexII Gel Purification
Kit (Qiagen). This short arm was end-filled and blunt-end subcloned into vector pPNTlhP.
which had been previously digested with XhoI and end-filled with the Klenow subunit of the T4
DNA Polymerase (GibcoBRL). To arnplify the long a m of pKOACT-1, Elongase (GibcoBRL)
was used with phage 1.1 DNA and primers Long-Arm-KpnI-F2 5'-
CGGGGTACCTCATCATCCCTGCTCCACTTGC-3' and Long-Arm-KpnI-R2 5'-
CGGGGTACCACCAGGCTCACAATGTGATTGG-3'. The amplification conditions included a
denaturation step of 94OC for 30 sec, followed by 30 cycles of 94OC for 30 sec, 57'C for 30 sec,
and 68OC for 8.5 min. The 6.3 kb PCR product was separated on a 0.8 % agarose gel and
purified. This long arm was digested with KpnI and subcloned into vector pPNTlloxP/shortam-
1. which had been previously digested with KpnI, thereby generating pKOACT-1. Restriction
digestion and partial sequencing confirmed correct insert size and orientation for both anns of
pKOACT- 1.
11.2.6 Targeting of the Hydrophobie C-terminus
pPNTlloxP plasmid was used to generate a targeting vector, pKODCT-1. designed to
remove intron 78 from the mouse DMD gene, thereby creating a mutant that constitutively
utilizes the hydrophilic C-terminus of dystrophin. The replacement strategy involved generating
a shon arm consisting of intron 77 fused to exon 78 and part of exon 79, as well as a long arm
containing the rest of exon 79 as well as sequence located 3' to the DMD gene (Fig 11.4). Three
PCR amplifications were necessary for the short m. Ln the first, RT-PCR was used to amplifi
al1 32 bp of exon 78 and 164 bp of exon 79, which contain the C-terminal coding region and the
stop codons of dystrophin, using primers RT-PCR-Exon78F 51-
GAAGAAATGCCCCCGGAAAGC-3' and RT-PCR-Ex0n79R 5'-
CTGTCTAATCCTCTTTGTTGTACG-3'. The amplification conditions included a denaturation
step of 94°C for 30 sec, followed by 30 cycles of 94OC for 30 sec, 5S°C for 30 sec, and 6 8 ' ~ for
60 sec. The 196 bp PCR product was visualized on a 1.5% agarose gel and purified. The second
PCR amplified 2.8 kb of intron 77 fused to al1 32 bp of exon 78 using primers Short-Arm-F1 5'-
CCCTACTCTAAAACACTTACC-3' and Exon-78R2 5'-TCCTCTCTCATTGGCTTTCC-3', and
30 cycles of 94OC for 30 sec, 52OC for 30 sec, and 68°C for 4 min. In the third reaction. the
products fiom the first and second PCR were mixed and amplified with Short-Arm-F1 5'-
CCCTACTCTAAAACACTTACC-3' and RT-PCR-Exon79R 5'-
CTGTCTAATCCTCTTTGTTGTACG-3' for 30 cycles of 94°C for 30 sec, S O C for 30 sec, and
68°C for 4.5 min to obtain a 3.0 kb short arm product (Fig 11.4). This short a m was end-filled
and blunt-end subcloned into vector pPNTlfoxP, which had been previously digested with Xhol
and end- filled to make pPNTlloxPlshortann-2.
The long arm was created in three steps. First, a 454 bp PCR product was amplified fkom
nucleotides 165 to 618 of exon 79 with primers Long-Arm-EcoRV-BamHI-F2 5'-
GCGGGATATCGGATCCTAAGAGTTTACAAGAAATAAAATC-3' and Exon-79R 5'-
GTAAGTCCTGTGTATTCATTCGCATGTTCC-3' for 30 cycles of 94OC for 30 sec. 55°C for
30 sec. and 6g°C for 60 sec. This PCR product was subcloned into the EcoRV and EcoRl sites
of pBluescript-KS vector (Stratagene) to create pBS-KS-LAll2. Secondly. a 4.0 kb EcoRI
restriction fragment, containing the 3' end of exon 79 and sequence located 3' from the DMD
gene. was digested fiom PAC 562-A10 and subcloned into the EcoRI site of pBS-KS-LA112 to
generate pBS-KS-LA-Full. Lastly, a 4.5 kb BarnHI fragment was obtained fiom pBS-KS-LA-
Full, containing both halves of the long a m , and subcloned into the BamHI site of
pPNT/Zo.~Plshortarm-2 to generate pKODCT- 1 (Fig 11.4). Restriction digestion and partial
sequencing confirmed correct insert size and orientation for both a r m s of pKODCT-1.
11.3 Results
11.3.1 Physical Map of 3' End of Mouse DMD Gene
In order to construct targeting vectors that allow for the generation of mutant mice
lacking either the hydrophilic or the hydrophobic C-terminus of dystrophin, we first
charactenzed the genomic organization of the 3' end of the mouse DMD gene. Probes
corresponding to exons 78 and 79 of the mouse DMD gene were used to screen a I291Sv-D3
mouse genomic DNA phage library, as well as a 129/SvEvTac mouse PAC library. Two clones.
1.1 and 4.1. were obtained f?om the phage screens and found to contain identical inserts.
Enzymatic digestion and analysis by Southem blot, using exons 78 and 79 as probes. allowed the
complete mapping of the phage 1.1 genomic DNA insert (Fig II. 1 ).
The mouse PAC screen identified three clones containing the 3' end of the mouse DMD
gene: 450-G15, 562-A10, and 657-F9. Restriction digestion and Southem blotting of these PAC
clones were used to confirm the genomic organization obtained fiom cione 1.1, as well as to
further extend the physical map. It was found that the restriction map of phage 1.1 and the PAC
clones differed at the 5' end of the phage insen (Fig 11.2). indicating that there appears to be a
rearrangement in phage 1.1 such that the 5' end of the insert up to a region 2.8 kb 5' of exon 78
originates fiom a different genetic region. Al1 three PACs, and phage 1.1, are identical starting
near the first HindIII site in intron 77 (See Figs II. 1 and 11.2).
Intrûn 78 was found to be close to 5 kb in length in the mouse DMD gene (Fig 11.2).
Interestingly, there appears to be not only conservation in the exon 78 and 79 sizes and
sequences in humans and mice, but aiso in the size of the intronic sequence between these two
exons.
BRNLX I
DMD Exon
Lambda Phage Arm
Not drawn to scale
Figure 11.1: Restriction map of phage 1.1 . A mouse 129ISv-D3 library was screened with probes originating îiom exons 78 and 79 of the mouse DMD gene. Phage 1.1 was isolated, purified, and characterized to obtain u complete physical map. Exons 78 and 79 are indicated in blue boxes, the arms of lambda phage are shown by red boxes. Numbers below the map indicate distance between restriction sites. Restriction enzymes used are X-Xbal, L-Sall, N-Notl, R-EcoRI, K-Kpnl, H-Hindlll, O-Xhol, S-Smal, and B-BamHI. The two red lines indicate the region whcrc: divergence between phage 1. I und PACs 450-GIS, 562-A10, and 657- F9 occurs.
DMD Exon Not drawn to scale
Figure 11.2: Restriction mop of the 3' end of niouse DMD pne. A mousc 129/SvEvTac PAC library was screened with probes originating fiom exons 78 and 79 of the mouse DMD gene. PAC clones 450-G 15, 562-A1 0, and 657-F9 were isolated, purified, and characterized to obtain a complete physical map of the region. Exons 77, 78 and 79 are indicated in blue boxes. Numbers below the nwp indicate distance between restriction sites. Restriction enzymes used are X-Xbal, R-EcoRI, K-Kpnl, H-HindlIl, O- Xhol, S-Smal, and B-BamHI. The two red lines indicate the region where divergence between phage 1.1 and PACs 450-G 15, 562-A 10, and 65 7-F9 occurs.
11.3.2 Targeting of the Hydropbiiic C-terminus of Dystropbin
To develop mutant mice unable to generate the hydrophilic C-terminus of dystrophin. a
targeting vector was created dlowing for the permanent removal of exon 78 fkom the mouse
DMD gene. To achieve this, a 2.7 kb region of intron 77 was arnplified by PCR and subcloned
into plasmid pPNT/loxP to act as the short a m in this replacement vector. To generate a long
m. a 6.3 kb fragment composed of intron 78 and part of exon 79 was arnplified by PCR and
subcloned into pPNT/loxP-short-arm-1 thereby producing pKOACT- 1 (Fig 11.3). This targeting
vector is designed to effectively replace exon 78 of the DMD gene with a neomycin resistance
cassette (NEO). This selection cassette is flanked by two ioxP repeat elements which can be
used to subsequently remove NE0 by the introduction of Cre recombinase into the cells, or by
crossing the mutant mice with Cre transgenic mice.
This pKOACT-1 vector c m be used to target mouse embryonic stem cells (ES) by
homologous recombination so as to produce cells that constitutively use the hydrophobic C-
terminus of dystrophin. To identiG homologous targeting events versus randomly integrated
events in ES cells, we developed two screening approaches (Fig 11.3). In the first, recombinant
ES ce11 DNA is arnplified by PCR to produce a 5.4 kb product in the case of homologous
targeting or a 3.8 kb product in the case of random integration events. Secondly, recombinant
ES ce11 DNA is digested with KpnI, Southern blotted ont0 nylon filters, and hybridized with a
probe from exon 79. Homologous targeted cells can be identified by a 7.8 kb hybridized
product, whereas random integration events maintain the wild-type 12 kb product. This construct
will be electroporated into ES cells and homologous recombinant clones will be selected and
verified by f CR and Southern blotting analysis.
KH R X H B H H
Wild type \- x I I x \ \ \ \
I I \ \ I I \ 1 NR X I K HB H H 1
pKOACT- 1 I I 79 1 HSV-TK
loxP loxP
Homologous I I I I l 79
recombinant + œ
SCREENING Random: 3.8kb Random: 12kb
PCR Southern Homologous: 5Akb Homologous: 7.8kb
Figure (1.3: Strategy for targeting the hydrophilic C-terminus of dystrophin. A replacement veçtor was generated that removes exon 78 fiom the DMD gene and replaces it with a neomycin resistance cassette, which is flanked by two loxP elements. Two arms of hornology of 2.7 kb and 6.3 kb were ligated to vector pPNT/loxP to create pKOACT- 1. This targeting vector is designed to produce dystrophin isofonns that lack exon 78 and thereby use the hydrophobie C-terminus mstitutively. Arrows indicate the location of primas for the PCR smtegy, and the green box indicates the location of the probe used for the Southeni strategy for screening of homologous ES celf recombinants. K is Kpnl, H is Hindlll, R is EcoRI, X is Xhol, B is BamHI.
11.3.3 Targeting of the Hydropbobic C-terminus o f Dystrophin
To develop mutant mice unable to generate the hydrophobic C-terminus of dystrophin, a
targeting vector was created allowing for the removal of intron 78 from the rnouse DMD gene
(Fig 11.4). This vector, pKODCT-1, was composed of two arrns of homology ligated into
pPNTlloxP and was constnicted in various steps (see Materials & Methods). As an end result,
the short ami consists of 2.8 kb of intron 77 and al1 32 bp of exon 78 fused io 164 bp of exon 79.
This portion of exon 79 contains the entire C-terminal coding region of dystrophin encoded by
this last exon as well as its stop codons. The long arm is composed of al1 but the first 164 bp of
exon 79 (2.5 kb) as well as 2.0 kb of sequence 3' to the end of the mouse DMD gene (Fig 11.4).
The pKODCT-1 replacement vector is designed to remove intron 78 from the DMD gene so as to
eliminate the splicing of exon 78. Therefore, al1 dystrophin transcnpts should encode the
hydrophilic C-terminus of dystrophin, and the role of the hydrophobic C-terminus can be
elucidated from the phenotype of these mice.
To identi f i homologous recombination versus randomly integrated events in ES cells. we
designed two screening strategies (Fig 11.4). In the fint, recombinant ES ce11 DNA is ampiified
by PCR to produce a 6.5 kb product in the case of homologous targeting and a 4.6 kb product in
the case of random integration events. Secondly, recombinant ES ce11 DNA is digested with
KpnI and BarnHI, Southem blotted ont0 nylon filters, and hybridized with a probe from intron
77. Homologous targeted cells can be identified by a 6.1 kb hybridized product, whereas random
integration events maintain the wild-type 4.7 kb product. This constmct will be electroporated
into ES cells and homologous recombinant clones will be selected and verified by PCR and
Southern blotting analysis.
Wild Type
I I I I #
pKODCT-1 3.0 loxP loxP 4.5
K H X B R K R H K Homologous recombinant
I l 1 + f-
SCREENING Random: 4.6kb Random: 4.7kb
PCR Sorrfh ern Homologous: 6.5kb Hoinologous: 6.1 kb
Figure 11.4: Strategy for targeting the hydrophobie C-terminus of dystrophin. A replacement vector was constructed that removes intron 78 fiom the DMD gene. Two arms of homology of 3.0 kb and 4.5 kb were ligated to vector pPNTlloxP, containing a neomycin resistance selection cassette flanked by two loxP sites, to create pKODCT- 1. This targeting vector is designed to produce dystrophin isoforrns that amtain exon 78 fused to exm 79 and thereby use the hydrophilic C-taminus constitutively. Arrows indicate the location of primers for the PCR strategy, and the green box indicates the location of the probe used for the Southem spategy for screening of homologous ES cell recombinants. K is Kpnl, H is HindllI, X is XhoI, B is BarnHI, R is EcoRI.
11.4 Discussion
The study of animal models is an invaluable resource for genetic disease characterization
and treatment discovery. To date, Duchenne muscular dystrophy has a total of nine different
mouse models that have helped in the elucidation of the role of the different dystrophin isoforms
generated by alternative promoter usage (Cox et al., 1993; Araki et al., 1997; Sarig et al., 1999).
However, there is currently no animal mode1 available that c m depict the hinction of the
dystrophin isoforms created by alternative splicing at the 3' end of the dystrophin gene. The goal
of this project was to create mutant mice that were able to produce dystrophin isoforms with only
the hydrophilic or the hydrophobic C-terminus of dystrophin. Analysis of these mice would
contribute to the elucidation of the biological role of tiie different C-termini of dystrophin.
To generate these mutant mice, a targeting strategy was developed in which replacement
vectors would be able to knockin. or knockout, exon 78 of the DMD gene, thus creating
dystrophin isoforms that utilize the hydrophilic, or the hydrophobic C-terminus, in a constitutive
manner. A similar targeting experiment in which the exon D of B1 integin was knocked in. and
out, was used to characterize the f i c t ion of the alternatively spliced exon D (Baudoin et al..
1998). Similar to dystrophin, p l integrin regulates the usage of this particular exon so as ro
confer fùnctional specificity to its isoforms. Baudoin et ai. were the first to use the Cre-IoxP
system to generate exon-specific knockout and knockin animais. In the knockout animal, they
removed exon D fiom the mouse genome so as to get constitutive skipping of this exon and
production of P 1 A integrin. In the knockin animal, they designed their targeting vector so as to
obtain constitutive utilization of exon D by fusing it to its neighboring exons. As such, this
mouse line produced the P 1 D integrin isoform in a constitutive manner. Comparative analysis of
these two mouse mutants revealed a functional difference upon alternative exon usage (Baudoin
et al.. 1998). In a similar marner, we hope to show the fùnctional significance of the two C-
termini of dystrophin by the generation of mutant mice that constitutively use the hydrophobic or
the hydrophilic C-terminus.
We have successfully generated a physical map of the 3' end of the mouse DMD gene
using both phage and PAC clones. Knowledge of this physical organization was essential for the
construction of two replacement vectors designed to target either the hydrophilic or the
hydrophobic C-terminus of dystrophin. The targeting vector pKOACT-I was constmcted to
repIace exon 78 of the DMD gene with a neomycin resistance cassette, allowing for the
constitutive use of the hydrophobic C-terminus. On the other hand, replacement vector
pKODCT-1 was designed to remove intron 78 fiom the gene, thus fusing exon 78 to exon 79. so
as to obtain constitutive use of the hydrophilic C-terminus. These two vectors are ready to be
utilized to target ES cells and select for homologous recombinants.
Targeting vectors pKOACT-1 and pKODCT-1 contain a neomycin resistance cassette
that is flanked by two loxP sites. These loxP elements are recognizable by a Cre recombinase
which can remove al1 of the sequences between them. Our vectors were designed in such way
that following the homologous recornbination of ES cells, it will be possible to remove the
incorporated neomycin cassette from the genome so as to avoid any potentiai effects it may have
on the expression of the other dystrophin transcripts.
Replacement vectors pKOACT-1 and pKODCT-I are currently being used to target
mouse 129/SvEv ES cells. Following electroporation of these linearized vectors into ES cells,
initial selection will be achieved by incubating in media containing G418, for neomycin
resistance selection, and gancyclovir, for thymidine kinase negative selection. Colonies obtained
afier this process will be screened for homologous recombination events by PCR and Southem
blotting. Correctly targeted ES cells can then be microinjected into blastocysts and inserted into
pseudo-pregnant mice for generation of chimeras. These chimeras will be tested for germ line
transmission of the recombination, and a mutant moue line will then be propagated.
These mutant mouse lines will be assayed for phenotypic abnormalities to gain an insight
into the function of the altematively spliced isoforms of dystrophin. An initial characterization
of the dystrophin transcripts will be perfonned to ven@ there are normal levels of transcnpt
produced and that there is no aberrant splicing due to the targeted mutations. Ln addition, we will
verify the protein products generated by the various DMD promoters to ensure that the proteins
are as stable as in wild type animals. The localization of the different dystrophin isoforms will
be investigated in various tissues, including muscle and retina, to determine if alternative C-
terminus usage affects the subcelllilar localization of dystrophin. Following this characterization
of dystrophin isoforms in mutant mice, we will analyze the localization of the dystrophin
interacting proteins to determine how the hydrophilic or hydrophobie C-terminus influences
protein binding. Furthemore, these mice will be analyzed for abnormal muscle and retinal
phenotypes that may give clues about the function of the different C-termini of dystrophin. We
expect these mice to be viable, as complete dystrophin knockout mice show normal lifespans
(Cox et al.. 1993, however, they may show signs of muscle degenerationlregeneration as in the
m d r mouse variants, and may have abnormal retinal neurotransrnission as detected by ERG
recordings. We expect that this analysis could provide insights into the biological role of the
different C-termini of dystrophin.
CHAPTER III: ISOLATION OF NEW DYSTROPHIN INTERACTING
PROTEINS
111.1 Introduction
The identification and characterization of dystrophin interacting proteins has been crucial
in the elucidation of dystrophin hinction. Cloning of the DMD gene and analysis of its sequence
organization suggested that dystrophin might have a cytoskeletal role similar to that of spectrin
and a-actinin (Koenig et al., 1988). However, biochemical purification studies revealed that
dystrophin strongly interacts with a complex of transmembrane glycoproteins and cytoplasmic
proteins that together form the dystrophin glycoprotein cornplex, DGC (Ervasti and Campbell.
199 1 ). Characterization of these proteins suggested that dystrophin might act as a link between
the actin cytoskeleton, the plasma membrane, and the extracellular rnatrix (Ibraghimov-
Beskrovnaya et al., 1 992). Altematively, dystrophin might be localizing specific transmembrane
and membrane-associated proteins at non-random locations along the membrane either through
direct interactions, or by indirect binding to the syntrophins and the dystrobrevins.
A number of dystrophin interacting proteins have been identified and characterized using
the yeast two-hybnd system. This approach involves a very sensitive assay that allows even
transient protein interactions to be readily recognized, and permits the imrnediate recovery of
cioned cDNAs encoding such proteins. Moreover, the assay is performed in vivo thus providing
a mode1 setting for protein interactions that most closely mimics the protein's native
conformation. This assay is based on the ability to separate the two functionally distinct domains
of the transcription activator GAL4 (Fields and Song, 1989). As such, a -'baitW vector can be
created where a fiil1 protein, or a protein domain of choice, can be fbsed to the DNA binding
domain (BD) of GAL4 and transformed into yeast cells. A second "target" vector can be
produced in which the transcription activation domain (AD) of GAL4 is fùsed to a tissue-specific
cDNA library. This library is transformed into a yeast strain containing the bait vector and can
be used to detect protein-protein interactions between the bait protein and specific target fusion
proteins. This "positive" interaction allows the BD:bait-target:AD cornplex to bind to GAL4
upstream activator sequences and activate transcription fiom HIS3 and lacZ reporter genes
located immediately downstrearn. The HIS3 reporter gene is used as an auxotrophic marker to
select for growth in media lacking histidine, whereas the lac2 gene is utilized as an enzymatic
marker to confirm protein-protein interactions in yeast.
To date, the yeast two-hybrid system has k e n used successfully at least four times in
trying to identie dystrophin interacting proteins. This assay demonstrated that syntrophins bind
directly to a dystrophin region encoded by the alternatively spliced exon 74 of the DMD gene
(Castel10 et al., 1996). In addition, this method identified the first and/or second coiled-coi1
leucine zipper domain of dystrophin as the dystrobrevin-binding site (Sadouletpuccio et al..
1997). The yeast two-hybrid system has also indicated that cytoskeletal troponin T can bind to
dystrophin near the C-terminus through interaction of their respective coiled-coils domains
(Pearlman et al., 1994). Lastly, the 1 s t 200 residues of dystrophin, including the hydrophilic C-
terminus. were s h o w to interact with a-actinin in a two-hybrid system (Hance et al.. 1999).
Although numerous two-hybnd screens have been done with the C-terminal domain of
dystrophin, none of these have included use of the hydrophobic C-terminus. This portion of
dystrophin, generated by the splicing of exon 78 from the transcript, contains a putative leucine
zipper that might fonn an additional coiled-coi1 domain involved in protein-protein interactions.
The tissue-specificity, developmental regulation, and high conservation of the usage of the
hydrophobic C-terminus of dystrophin strongly suggests an important cellular function. Here,
we attempt to characterize this role by screening for proteins that interact with the hydrophobic
C-terminus of dystrophin.
111.2 Materials and Methods
111.2.1 Yeast Two-Hybrid Plasmids
Al 1 yeast vectors originated fiom the MATCHMAKER Two-Hybrid S ystem (Clontech).
pGBT9 (TRPl, ampr) was used by a summer student in the laboratory, Jefiey Wong, to clone
the hydrophobic C-terminus of dystrophin, created by the splicing of exon 78, fused to the DNA
binding dornain of GAL4 (See Fig 111.1). Two "bait" constructs were created. pGBT9-ACT
contained the 31 hydrophobic residues encoded by exon 79 (aa, 3667-3698), whereas pGBT9-
LZACT was formed by a 640 nucleotide insert from the dystrophin C-terminus that includes the
coiled-coi1 domain and the hydrophobic C-terminus (a-a. 3486-3698). pACT2MBL (LEU2,
ampr) is a mouse brain cDNA library fùsed to the activation domain of GAL4 (Clontech).
Controls for the yeast two-hybrid system included pVA3 (TRPl, ampr), a plasmid encoding a
GAL4-BD-murine-p53 fusion protein in a pGBT9 backbone for use in association with pTDl as
a positive control (See Table III. 1). pTD 1 (LEUZ, ampr) encodes a GAL4-AD-large-T-antigen
fusion protein in pGAD3F. pLAM (TRPl, ampr) is a false positive detection plasmid encoding a
GAL4-BD-human-laminC fusion protein in pGBT9 (See Table III. 1).
-4dditional bait constructs were developed by another summer student. Ivan Blasutig. to
verify potential dystrophin interacting proteins (See Fig III. 1). pGBT9-ACT-RG contains the
same hydrophobic C-terminus as pGBT9-ACT but has arginine and glycine residues replacing a
leucine. pGBT9-ACT-H difliers fiom pGBT9-ACT-RG in that it lacks the arginine and glycine
residues (See Fig III. 1).
111.2.2 Yeast Transformations
Cells fiom yeast strain CG1945 were rendered transformation competent by the lithium
acetate method. Bnefly, CG1945 cells were grown in synthetic drop out (SD) medium,
Table III. 1 : Yeast Two-hybrid transformations and reporter gene activation
--
Bait Plasmid
pGBT9-ACT
pGBT9-LZACT
pCBT9-ACT
pGBT9-LZACT
pCBT9-ACT
none
pLAM (BD.lminC hybnd vecfor)
pVA3 (BD murinc p53 hybrid \cctori
pVA3
pLAM
Prey Plasmid
none
none
pTDl (AD-SV40 T hr igcn fusion vtcior)
pTD1
pACT2:library cDNA (GAL4 AD: l ib ra~ c m A vector)
pACT2:library cDNA
pACT2:library cDNA
pACT2:library cDNA
pTDI
pTDl
Expected result fora true positive P-gal: white HIS3: no growth on his- t3AT
P-gal: white HIS3: no growth on his- +3AT
P-gal: white HIS3: no growth on his- +3AT
P-gal: white HIS3: no growth on his- +3AT
P-gal: blue HI S3 : growth on bis- +3AT
P-gal: white HIS3: no growth on his- +3AT
P-gal: white HIS3: no growth on his- t 3 A T
P-gal: white HIS3: no growth on his- t3AT
P-gal: blue HIS3: growth on his- +3AT P-gal: white HIS3: no .e;rowth on his- +3AT
Purpose
To confinn that the BD fbsion does not autoactivate To confirrn that the BD füsion does not autoactivate To confirm that the BD tusion does not interact with non-specific proteins To confirm that the BD fusion does not interact with non-speci fic proteins To identie potential dystrophin interacting proteins To confinn that the AD fision does not autoactivate To eliminate false positives that bind to non- speci fic proteins To eiiminate false positives that bind to non- specific proteins A positive control
A negative control
supplemented with tryptophan, leucine and histidine, at 30°C until an ODsoo of 0.8 was obtained.
This culture was diluted to an OD6oo of 0.15 with YPD medium and grown until an ODsoo of 0.5-
0.8 was achieved, at which point the cells were pelleted at 5000 rprn and resuspended in
deionized water. After a new centrifugation round, cells were resuspended in 1 X LiAc (0.1M
lithium acetate), re-pelleted at 1500 rpm and resuspended in 1 ml l x LiAc for each 100 ml of
initial culture. These transformation competent cells were incubated at 4OC ovemight and then
transformed by addition of 0.1-1 .Opg plasmid DNA and 50pg denatured salmon sperm DNA to
1 OOpl of competent cells (See Table 111.1). This mix was incubated at 30°C for 30 min. then
supplemented with 6-7 volumes of 40% PEG solution (40% w/v polyethylglycol MW 3300.
0.1M lithium acetate) and re-incubated at 30°C for 60 min. These cells were heat-shocked at
42OC for 15 min, plated on selective SD media, and grown for 2-3 days at 30°C.
111.2.3 Yeast 9-galactosidase Assay
Yeast colonies grown on SD selection media were restreaked on Whatman paper (no. 3)
and placed on top of fresh selection plates. Afier overnight incubation at 30°C. these filters were
immersed in liquid nitrogen for a few seconds, layered colony side up on Whatman paper
(110.40): pre-wetted with 2.5 ml of Z bufferm-gal solution, and incubated at 30°C for P-
galactosidase reporter gene activation testing. Z bufferm-gal solution contained 6OmM
Na2HP04, 40mM NaHP02, lOmM KCI, ImM MgS04, 30mM P-mercaptoethanol, and 5-
bromo-4-chloroindolyl-p-D-galactoside (X-gal) at a final concentration of 0.2 mg/ml. Clones
tuming blue were considered positive and those remaining white were classified as negative.
111.2.1 Yeast Two-Hybrid Library Screen
A mouse brain cDNA library was screened in the yeast two-hybrid system using the
hydrophobic C-terminus of dystrophin as bait (See Fig 111.2). CG1945 yeast strain, initially
transformed with plasmid pGBT9-ACT, was transformed with 11Opg of DNA from a
commercial mouse brain matchrnaker cDNA library cloned into plasmid pACT2 (Clontech).
4x10~ yeast transformants were plated on SD selection plates lacking tryptophan, leucine and
histidine and supplemented with 15 mM 3-aminotriazole. Colonies which grew on this medium
after 6 days were streaked on similar SD selection plates supplemented with 25 m M 3-
ami no tnazole and restreaked for P-galactosidase reporter gene activation anal ysis.
111.2.5 Yeast Plasmid DNA Isolation
To extract plasmid DNA from positive yeast clones, the rapid yeast miniprep protocol
was utilized. Briefly. each clone was grown in SD selection broth at 30°C for 16-20 hrs and
pelleted at 2000 rpm for 5 min. Cells were resuspended in sterile water and transferred to
eppendorf tubes where lysis buffer and phenol solutions were added. Lysis buffer was composed
of 2% Triton X- 100, 1 % SDS. 1 OOmM NaCl. lOmM Tris pH 8.0, and 1 .OmiM EDTA whereas
phenol solution was made of 25 parts of phenol: 24 parts of chloroforms: 1 part of isoamyl
alcohol. Approximately 0.3g of acid washed g l a s beads were added to the tubes and the cells
were lysed on a vortex for 5-10 minutes. The mixture was pelleted at 14000 rpm for 10 min and
the supernatant collected in a new tube where it was precipitated with 2.5 volumes of 100%
ethanol and 1/10 volume 3M NaOAc. After a 70% ethanol wash, the DNA was resuspended in
Tris pH 8.0. Plasmid purification was completed using a Qiagex II Extraction Kit (Qiagen)
where plasmid DNA was eluted in lOmM Tris pH 8.5.
In order to separate the GAL4-AD-tibrary-cDNA "target" plasmid fiom "bait" vectors, E.
coli MH6 (LEU-) cells were transformed with the purified DNA and selected for growth in
media lacking leucine. MH6 cells were rendered transformation-competent by growing cells
until an ODboo of 0.2-0.4 was reached, followed by chilling on ice for 5 min, pelleting at 5000
rpm for 5 min at 4'C, resuspending in ice-cold 5OmM CaC12 for 45 min, pelleting for 5 min at
4OC, resuspending in ice-cold 50mM CaC12, and storing at 4°C for 2 days. These competent cells
were transformed by the addition of purified yeast plasmid DNA, followed by an incubation on
ice for 30 min, a heat-shock at 37°C for 45 sec. ice for 2 min, and plating on LB plates
supplemented with ampicillin. Colonies growing on these plates were streaked and selected on
M9 plates containing an amino acid drop out mixture minus leucine. Only transformants
containing the cDNA "target" plasmid were able to grow on this selection media.
111.2.6 Characterization and Specificity of Interaction of Target Vectors
Transformants isolated fiom M9 selection plates were incubated in LB broth
supplemented with ampicillin and grown at 37OC. Plasmid miniprep DNA isolation was
performed with the QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer.
Sequencing of cDNA insens was carried out with the ThennoSequenase Kit and radiolabelled
" P - ~ ~ N T P S (Amersharn) following the manufacturer3 protocols.
In order to test the specificity of interaction between the dystrophin hydrophobic C-
terminus and the target clones identified in the yeast two-hybrid screen, the cDNA target
plasmids were transformed into yeast CG 1945 by themselves, or in conjunction with bait vectors
pGBT9-ACT, pVA3, and pLAM (See Table III. 1). These yeast colonies were then streaked and
subjected to B-galactosidase assays to test for autoactivation and specificity of interaction with
dystrophin.
111.2.7 Expression Vectors
Expression vector pGST-ACT was made by digesting pGBT9-ACT with BamHI and
SalI, purimng the sequence encoding the 3 1 amino acid hydrophobic C-terminus of dystrophin,
and subcloning it into pGEX4T-1 (Amenharn Pharmacia Biotech) digested with BamHI and
SalI. pGST-LZACT was constnicted by subcloning the 640 bp LZACT fragment described
above into the EcoRI sites of pGEX2TK (Amersham Pharmacia Biotech). These vectors were
verified by restriction digestion and sequencing.
Expression vectors pET28-CAPS-1 and pET28-CAPS-2 were designed so as to produce
His6-T7 tagged CAPS-I and CAPS-2 proteins in E. coli. Briefly, yeast two-hybrid clones 9.9
(CAPS-1) and 10.2 (CAPS-2) were digested with EcoRI and XhoI, and the cDNAs subcloned
into plasmid pET28 (Novagen). Both constructs were verified by restriction analysis and
sequencing.
111.2.8 Western Blot Anaiysis
Yeast protein extracts were obtained by growing cultures on selective SD media until an
of 0.5-0.8 was reached, pelleting the cells at 3000 rpm for 10 min at 4°C. resuspending
them in sterile water, pelleting again at 14000 rpm for 5 min at 4OC, fieezing the cells at -20°C
for 15 min' and finally cracking the cells with vigorous vortexing in cracking buffer prewarmed
at 6OoC. Cracking buffer was composed of 1 % P-mercaptoethanol, 1 % SDS, 6M Urea. O. 1 mM
EDTA. 40mM Tris pH 6.8, 10% glycerol, and 1 x protease inhibitor solution mix (5mM PMSF.
lOpg/ml pepstatin A, 3pM leupeptin, 14mM benzamidine, and 37pg/ml aprotinin).
Bactenal ceIl extracts were obtained fiom pGEX-4T1, pGST-ACT and pGST-LZACT
transformed cultures, and GST fusion proteins purified with glutathione sepharosedB beads
according to the manufacturer's protocols (Amersham Pharmacia Biotech). Ce11 extracts were
also generated from cultures containing vectors pET28-CAPS-1 and pET28-CAPS-2, and the
His6-T7 tagged CAPS-1 and CAPS-:! proteins were punfied on His-Bind Resin Columns
according to the manufacturer (Novagen).
Yeast ce11 extracts and bacterially-purified proteins were electrophoresed on 4 4 2 %
poIyacrylarnide gradient geIs (Novex) in running buffer (20mM Tris, 192mM glycine, and O. 1 %
SDS) at 120 volts for 2 hrs and either stained with comrnassie blue dye or transferred ont0
nitrocellulose in transfer buffer (1 SmM Tris, 1 SSmM glycine. 0.0 1% SDS) at 400 mAmp at 4OC
for 2 hrs. Immunoblots were processed by blocking in 5% skim milk, IOmM Tris pH 8.0.
150mM NaCl, 0.05% Tween-20. with shaking at 4*C for 16 hrs. Blots were incubated with the
following primary antibodies for 2-4 hours at 4OC: polyclonal a-ACT-1 at 1500 dilution for
detection of GAL4-BD-ACT, GAL4-BD-LZACT, GST-ACT, and GST-LZACT; polyclonal a-
GST (Amersharn Pharrnacia Biotech) at 1:5000 dilution for detection of GST, GST-ACT, and
GST-LZACT; and monoclonal a-T7-tag (Novagen) at 1 : 10000 dilution for detection of His6-T7
tagged CAPS- 1 and CAPS-2 proteins. Following primary antibody incubations, blors were
washed three times for 10 min in TBST (1 OmM Tris pH 8.0. 150mM NaC1, 0.05% Tween-20).
and incubated for 1 hr with horseradish peroxidase secondary antirabbit or antimouse antibodies
at a 1 :5000 dilution (Amersham). Blots were washed 3X for 10 min with TBST. Signal was
detected with Enhanced Cherniluminescence (ECL, Amersharn).
111.2.9 In Vitro Transcription/Translation
PCR products TnT-CAPS-1 and TnT-CAPS-2 were amplified fiom yeast two-hybrid
clones 9.9 and 10.2 using Elongase DNA polymerase (GibcoBRL) and pnmers TnT-CAPS 1-F
5'GCTAATACGACTCACTATAGGAACAGACCACCATGGACATGAmGAGTCCTGCGTC
? I
-3 Y CAPS 1 -3'R 5'-GCTAATCTTGGTACCACGCAGC-Y, TnT-CAPS2-F j '-
GCTAATACGACTCACTATAGGAACAGACCACCATGGC~CTTTATATGAGTCC-3'.
pACT2-R 5'-GTGAACTTGCGGGGTTTTTC AGTATCTACGAT-3'. Amplification conditions
included an initial denaturation step of 94OC for 30 sec, followed by 35 cycles 3f 94OC for 30 sec.
55OC for 30 sec, and 68OC for 3.5 min. The final 0.9 kb and 1.6 kb products contained an open
reading fiame for the C-terminus of CAPS-1 and CAPS-2 respectively, and were preceded by a
T7 transcription recognition motif and a Kozak translation recognition sequence.
TnT-CAPS-1 and TnT-CAPS-2 PCR products, as well as a luciferase control. were used
to generate 35~-labelled protein in an in vitro Transcription/Translation Coupled Reticulocyte
Lysate System (Promega) according to the manufacturer. Proteins produced by the TnT system
were analyzed by SDS-PAGE and autoradiography.
111.2.10 In Vitro Affinity Pull-downs
To verifi the interaction of dystrophin with CAPS-1 and CAPS-2 using non-yeast
methods, the purified GST-tagged hydrophobic C-terminus was incubated with TnT-CAPS-1
and TnT-CAPS-2 proteins and "pulled-down" with glutathione sepharose beads. Briefly.
purified GST, GST-ACT, and GST-LZACT proteins were each incubated with radiolabelled
polypeptides of TnT-CAPS-1, TnT-CAPS-2, and TnT-luciferase for 1 hr at 4°C in TBST.
Subsequently, glutathione sepharose 4 8 beads (Amenharn Promega Biotech) were added to the
mixtures and incubatea for 1 hr at 4OC. The bound proteins were pelleted, washed 3X with
TBST, and analyzed by SDS-PAGE on 4-12% gradient gels (Novex).
111.3 Results
111.3.1 Novel lateracting Proteins of the Dystrophin Hydrophobic C-terminus
To identifi novel dystrophin hydrophobic C-terminus interacting proteins. we performed
a yeast two-hybrid screen. Two vectors, pGBT9-ACT and pGBT9-LZACT, consisting of the
DNA binding domain of GAL4 fused to the sequence encoding the hydrophobic, exon-79
encoded, C-terminus of dystrophin were created to be used as "baits" (Fig III.l.A). P-
galactosidase reporter gene assays performed on yeast celk transformed with these bait vectors
revealed that pGBT9-LZACT autoactivated the two-hybrid system (Fig III. 1 .B). Since a library
screen depends on activation of the reporter genes based on the presence of a protein interaction.
only pGBT9-ACT could be used as bait in the yeast two-hybrid setection.
Expression of GAL4-BD-Dystrophin hydrophobic C-terminus fusion protein was tested
on yeast cells transformed with plasmid pGBT9-ACT by western blot anaiysis. Using antibody
ACT-1, which is specific for the hydrophobic C-terminus of dystrophin, we showed that the
expected 26 kDa fusion protein product was obtained (Fig 111.1 .C). Yeast cells expressing this
fusion protein were transformed with approxirnately 106 mouse brain cDNA clones fused to the
GAL4-AD (Fig 111.2). Selection on SD media lacking the auxotrophic markers leucine.
tryptophan, and histidine, revealed that a total of 169 clones were able to activate the histidine
reporter gene and grow to form colonies. These clones were restreaked on similar SD media and
then subjected to a P-galactosidase assay to test their ability to activate transcription of a second
reporter gene. A total of 97 cDNA clones were considered P-galactosidase positive, and were
subsequently subdivided into 68 strong and 29 weak positives based on the level of P-
galactosidase activity (Fig 111.2).
Lcwiae Z i w e n 1 RCH WGSLFHMSDDLCRAMESLVSVMTDEECAE Exons 74-77 Exon 79
,. P ,. . ....%- W.*
GhE4iUd H WGSLFHMSDDLCRAMESLVSVMTDEEG AE 1
ACT -ve
B) r
Bait Vector
Figure iiI.1. Yeast twehybrid "bait" constnicts development and testing. A) pGST9-ACT contains the sequence for the DNA binding domain of GAL4 fused to the sequence encoding the 3 1 amino acid. hydrop hobic C-terminus of dystrophin. pGBT9-LZACT is similar to pGBT9-ACT, with the addit ion of the sequence encoding the coiled-coi1 domain fiom exons 74-77 of the DMD gene. pGBT9-ACT-RG and pGBT9-ACT-H differ fiom pGBT9-ACT by the addition and removal of 6 and 3 nucleotides respectively fiom the dystrophin exon 77. B) fkgalactosidase reporter gene activation tests perforrned on yeast transformed with either pGBT9-ACT or pGBT9-LZACT. * represents activation of the reporter gene, whereas +/- indicates low or no activation. C) Western blot analysis fiom yeast cells containing pGBT9-ACT. Yeast protein extracts were obtained and separated by SDS-PAGE. Proteins were transferred ont0 nitrocellulose filters and blotted with an antibody specific fot the hydrophobic C- terminus of dystrophin (ACT-]). -ve is a protein extract fiom untransformeci yeast cells, whereas ACT is a ce11 extract fiorn yeast cells transformeci with pGBT9-ACT.
Target Vector P-galactosidase reporter gene activation
Screened >106 mouse bra in c D N A : G U - A D clones
Obtained 169 His+ clones
B-gal assays
97 B-gaf Positive clones
68 Strong Positives
DNA isolation
Sequencing o f inserts Auto-activation test Specificity of interaction tests
Verif ication of t rue protein interactions
j. cDNA library screen
Cloning o f full lengtb cDNA
Affinity chromatography Co-immunoprecipitation
C o n f i m protein binding interaction w i th n o n yeast metbods
Assess tissue expression and subceilular l o c a b t i o n
Figure 111.2. Steps involved in the yeast two-hybrid approach for identi@ing new protein partners of the mainly hydrophobie. exon 79-encoded dystrophin C-terminus. Afier an initial screening o f a mouse brah cDNA library for clones encoding proteins that interact with dystrophh, the putative interactors are verified by specificity tests in yeast and by non-yeast methods.
Total plasmid DNA was isolated from the 68 strong P-galactosidase positive yeast clones
and transformed into E. coli MH6 cells for selection of the GAL4-AD-Target cDNA vectors.
Following isolation of the target plasmids, their cDNA insert was charactenzed by restriction
digestion and sequencing (Fig 111.2). The 68 clones were found to encode I l different genes.
Some genes were represented by a large number of clones. whereas others were identified in
only one or two clones.
To verify that the histidine and P-galactosidase reporter gene activation was due to a real
interaction between the dystrophin hydrophobic C-terminus and the proteins encoded by the
target cDNA clones, a series of tests that assess the specificity of interaction were performed in
yeast (Fig 111.2). GAL4-AD-Target cDNA plasmids were transformed individually into yeast
cells to verify that they were not capable of autoactivating the reporter genes by themselves (see
Table III. 1). In addition, these cDNA target vectors were CO-transformed with plasmids pGBT9-
ACT, pVA3, or pLAM, to determine if the reporter gene activation was specific to dystrophin or
if it was due to non-specific GAL4 interaction (Table III.1). These experiments resulted in the
isolation of 8 different protein groups that appeared to bind specifically to the hydrophobic C -
tenninus of dystrophin (Table 111.2).
111.3.2 Yeast and Non-Yeast Methods for Verification of Proteins Interactions
To confirm that the interactions between the hydrophobic C-terminus of dystrophin and
the newly identified proteins are biologically relevant, we attempted to show that these proteins
interact using an in vitro pull-down assay. In this assay, the hydrophobic C- terminus of
dystrophin was expressed as a GST fusion protein in E. coli and pwified with glutathione-bound
sepharose beads. SDS-PAGE and western blot analysis of purified GST-fusion proteins
1 Clone Number Descri'on CAPS- 1 : calcium-dependent activator protein for secretion- 1
Novel: CAPS-2 (CAPS- 1
ACRP: alpha-catenin-related protein FUSCNGps 1 : G-protein suppressor- 1
Ribosomal L3 8
Table 111.2 Classification of the proteins encoded by the yeast two-hybrid cDNA clones obtained after tests for the specificity of interaction with the hydrophobic C-terminus of dystrophin. CAPS- 1 is a neuraWendocnne protein involved in the ca2'-dependent triggering step of regulated secretion. CAPS-2 (see Chapter IV) is a novel CAPS- 1 orthologue that is expressed ubiquitously. RanBPM is an actin binding cytosketetal protein involved in actin filament remangement. TIP47 is a mannose-6-receptor-associated protein involved in intracellular trafficking. ACRP is a member of the vinculin superfarnily of proteins with cytoskeletal localization and unknown role. FuscaMjpsl is a G-protein suppressor involved in inhibition of signal transduction. FAP48 is a membrane-associated immunophilin binding protein of unknown role. L38 is a ribosomal protein that participates in the translational machines..
originating from constructs pGST-ACT and pGST-LZACT, which contain the same dystrophin
insert as their pGBT9 counterparts, identified the appropriate 33 kDa and 55 kDa products (Fig
III.3.A-C). Proteins CAPS4 and CAPS-2 were considered the best candidates for true
interaction with dystrophin, and as such were expressed as His6-T7-tag hision proteins in
plasmid pET28 in E. d i . Although purified His6-CAPS-l and His6-CAPS-2 were detectable by
western blot anaIysis with antibodies for the T7-tag (Fig III.3.D), the protein recovered was not
visible by commassie staining. in spite of the fact that the amount of protein generated was very
low, pull-down experiments were attempted to demonstrate interactions between the CAPS
proteins and dystrophin (Fig 111.3 .E). These experiments were unable to demonstrate an
interaction between these proteins, ihus it was decided that a new attempt would be performed
using a new expression system.
To generate enough CAPS-1 and CAPS-2 protein for a pull-down experiment with GST-
tagged dystrophin, an in vitro transcriptionltransiation system was utilized. PCR products were
generated containing the coding region of the yeast two-hybrid cDNA clones for CAPS-1 or
CAPS-2. as well as a T7 site for initiation of transcription and a Kozak sequence for initiation of
translation. This system produced 27 kDa CAPS-1 and 33 kDa CAPS-2 products (Fig III.4.A)
that were used in CO-sedimentation experiments. Two independent attempts ai pulling-down
CAPS-1 or CAPS-2 with GST-tagged dystrophin failed to show an in vitro interaction between
these proteins (Fig II1.4.B). This indicates that a dystrophin C-terminus segment identical to the
dystrophin region used in the two-hybrid screen is unable to interact with the CAPS proteins in
vitro at a detectable level.
Moreover, in the construction of the yeast "bait" plasmid pGBT9-ACT, an extra three
nucleotides were inserted at the junction of the GAL4-BD and the hydrophobic C-terminus of
CST GST- GST- GST GST- GST- CST GST- GST- ACT LZACT ACT LZACT ACT LZACT
GST- GST- GST ACT LZACT
HiscT7- HkT7- H&-T7- H*T?- HiscT7- HkT7- CAPS8 CAPS-2 CAPSI CAPS2 CAPSI CAPS2
U E U E U E U E U E U E
- 48 kDa - 9 0 0
* * 0 .r d..
9 d iwrl
Figure 111.3. Pull-down experiment with bacterially produced CAPS proteins. A) SDS-PAGE and commassie staining anal ysis of bacterially-produced glutathione sepharose-purified GST fusion proteins. GST represents glutathione-S-tramferase alone, GST-ACT contains the hydrophobic C-terminus of dystrophin fùsed to GST, GST-LZACT is sirnilar to GST-ACT with the addition of the peptides encoded by exons 74-77 of the DMD gene. Western blot analysis o f t hese bacterially produced GST-dystrophin fusion proteins was performed with ant ibod ies a- GST (B) that recognizes glutathione-S-transferase and a-ACT-l (C) specific for the hydrophobic C-terminus of dystrophin. In (D) the bacterially expressed and purified C-temiinal domains o f CAPS- 1 and CAPS-2 were analyzed with monoclonal antibody a-T7-tag. E) Puil-down experiment performed with GST alone, GST-ACT, or GST-LZACT, and CAPS-1 or CAPS-2. U represents the unbound fiaction and E indicates the bound and eluted hction. CAPS proteins were visualized by Western blot analysis u s h g a T7-tag antibody.
TOT- TOT- -ve TOT- CAPS-2 CAPS1 Lucif
Unbound GST-ACT GST-LZACT
Figure 1II.4: Pull-down experiment with in vitro produced CAPS proteins. A) The C-terminal domains of CAPS-1 and CAPS-2. generated in an in vitro transcriptionltranslation system, were analyzed by autoradiography. -ve is a negative control lacking DNA template, whereas TnT- luci ferase is a positive control for verification of protein production. B) Pull-down experiment performed with GST-ACT, or GST-LZACT, and in vitro transcribed/translated CAPS-I or CAPS-2. CAPS proteins were visualized by autoradiography. Neither GST-tagged bait was able to pull-down the CAPS proteins.
dystrophin to maintain the reading frame of the protein. This created an extra leucine in the
fusion protein that is not found in the native dystrophin protein (Fig 111.1). To determine if this
additional leucine is involved in the protein-protein interactions detected in the hvo-hybrid
screen, we created new "bait" vectors without this residue (Fig III. 1). pGBT9-ACT-RG contains
the last 33 residues of the hydrophobic C-terminus of dystrophin, while pGBT9-ACT-H is
formed by the last 31 hydrophobic arnino acids encoded by exon 79 (Fig 111.1). Co-
transformation of these bait vectoa with the GAL4-AD cDNA plasmids encoding CAPS-l and
CAPS-2. and examination of the reporter gene activation of these transfonned cells, failed to
show a protein-protein interaction (Table 111.3). This suggests that the extra leucine present in
the initial two-hybrid "bait" vector might be participating in the binding of dystrophin to the
CAPS proteins. However, the in vitro pull-down experiments included a GST-tagged portion of
the C-terminus of dystrophin that also contained this additional leucine, and still failed to detect a
protein-protein interaction between them. Clearly, an in vivo CO-immunoprecipitation assay will
be necessary to demonstrate a possible interaction between the CAPS proteins and dystrophin.
In addition to the GAL4-AD cDNA vectors encoding the CAPS proteins. we co-
transformed the other 6 genes identified in the two-hybrid screen with the new "bait3 vectors.
AnaIysis of P-galactosidase reporter gene activation fiom these yeast clones. revealed that the
additional leucine had a great effect on the protein-protein interactions as detected by a two-
hybrid system. More precisely, 6 out of the 8 proteins identified as potential dystrophin
interactors did not activate the reporter gene with pGBT9-ACT-RG or pGBT9-ACT-H (Table
111.3). However. clones 8.4 and 9.5, encoding ACRP and RanBPM respectively, did activate the
P-galactosidase gene in the presence of either ACT, ACT-RG, or ACT-H, indicating that these
proteins are likely candidates for û-ue interactors of dystrophin (Table 111.3).
1 CLONE PGBT9- PGBT9-ACT- PGBT9-ACT- ' DESCRIPTION ACT RG H CAPS- 1 +ttt ---
RanBPM
ACRP 1
Table 111.3: Verification of interaction between yeast two-hybrid "target" clones and hydrophobic C-terminus "bait" vectors. Reporter gene activation results fiom P-galactosidase assays of yeast cells CO-transformed with "target" plasmids and the different pGBT9 "bait" vectors. pGBT9-ACT contains an additional leucine residue located at the sixth position from the first leucine residue of the heptad repeat. Vectors pGBT9-ACT-RG and pGBT9-ACT-H encode the actual hydrophobic C-terminus of dystrophin without the artificialty created leucine residue (See Fig 111.1). ++++ indicates activation of reporter gene while --- indicates no activation.
111.4 Discussion
The yeast two-hybrid system has been recently used on a nurnber of occasions to identify
new protein partners of dystrophin (Sadouletpuccio et al., 1997; Hance et al.. 1999). However.
none of these assays has been carried out with the hydrophobic C-terminus generated from the
alternative splicing of exon 78 of the DMD gene. This C-terminus contains a leucine heptad
repeat that rnay be involved in protein-protein interactions via a coiled-coi1 motif.
To test this hypothesis, we conducted a two-hybrid screen to identiQ proteins interacting
specifically with the hydrophobic C-terminus of dystrophin. This assay recognized a total of 8
new potential dystrophin interactors that included proteins involved in vesicle secretion,
cytoskeleton rearrangements, signal transduction, as well as proteins of unknown function.
Among those proteins, CAPS-1 and CAPS-2 (see Chapter IV) were considered the best
candidates for tme interactors for three reasons: i) both of these proteins were obtained a large
number of times as multiple independent clones (see Table III.2), ii) CAPS-1 and CAPS-2 are
protein orthologues that share a high degree of identity (see Chapter IV) and were both recovered
in the screen, and iii) CAPS4 is involved in the regulated secretion of neurotransmitter-
containing vesicles, a process that may be affected in dystrophin deficient mice and DMD
patients. We attempted to confirm these interactions by perfonning in vitro CO-sedimentation
experiments using a bacterially expressed hydrophobic C-terminus of dystrophin, as well as
CAPS-1 and CAPS-2 made both in bacterial ce11 systems and in an in virro
transcriptionltranslation system. However, we were unable to demonstrate a direct binding
between the two proteins. It is still possible that CAPS-1 and CAPS-2 directly interact with
dystrophin, however this contact may be either too weak or transient to be detected by an in vitro
CO-sedimentation system. To verifi this hypothesis, we must perform in vivo CO-
immunoprecipitation assays fiom cells over-expressing both dystrophin and the CAPS proteins
so as to demonstrate a direct interaction between these proteins.
The yeast two-hybrid screen was conducted with the "bait" vector pGBT9-ACT. In the
construction of this plasmid an additional leucine residue was inserted at the junction of the
GAL4 binding domain and the hydrophobic C-terminus of dystrophin. We tested the effect of
this residue by assaying the P-galactosidase reporter gene activation of cells containing the target
vectors descnbed in Table HL2 and new "bait" constntcts lacking this residue. Results from
these experiments demonstrated that this additional leucine had a large effect in the two-hybrid
system. as the new "bait" vectors failed to activate the reporter gene in 6 out of 8 instances.
Only ACRP and RanBPM were still able to interact with the new bait vectors. indicating that
they might represent true dystrophin interactors. Additional in vivo CO-irnmunoprecipitation
experiments must be perfonned to further confirm and characterize these interactions.
The function of dystrophin has been largely deduced by the identification and analysis of
its interacting proteins. We, and others, have shown that the hydrophobic C-terminus is
fùnctionally significant and therefore the identification of novel interacting proteins is a key step
in the elucidation of its fùnction.
CHAPTER IV: CLONING AND CHARACTEIUZATION OF HUMAN
CAPS-1 AND CAPS-2
IV. 1 Introduction
Neurotransmitter release, hormone secretion and a variety of other secretory processes
are highly complex and include the release of secretory vesicles fiom reserve pools, targeting to
an active zone, docking, priming, and fusion (Fig IV. 1) (Calakos and Scheller. 1996). Although
considerable effort has been made in recent yean to identify the components involved in
regulated secretion, the precise molecular mechanisms implicated at the various steps of
secretion have yet to be elucidated. Semi-permeabilized secretory cells and celi-free systems
thar reconstitue the various aspects of regulated secretion in vitro have played a critical role in
the identification and fùnctional analysis of the components participating in the ca2'-dependent
triggering of fùsion (Avery et al., 1999).
The identification of the SNARE temary complex, comprised of the vesicle and plasma
membrane associated proteins VAMP, SNAP-25 and syntaxin, and the characterization of this
complex as a mediator for the docking and priming of secretory vesicles, provided a mechanism
for vesicle targeting to the active zone of exocytosis (Fig IV. 1) (Ro than , 1994; Sudhof, 1995).
In addition, it has been proposed that synthesis of phosphoinositide-(4.5)-bisphosphate (PIP2)
during priming at pre-synaptic regions acts as a localized signal for the recmitment of c)~osolic
proteins involved in the last steps of regulated secretion (Hay et al., 1995).
Afier priming, a rise in the intraceliular ca2' concentration foliowing an extemai
stimulus, triggers the fusion of the primed vesicies to the plasma membrane and the release of
vesicle contents to the extracelIular space (Fig IV.1). The requirement for ca2' in this last step
of regulated secretion suggests that at least one ca2' sensor participates in the triggenng of the
hsion event. The vesicle-associated protein synaptotagrnin has been proposed to be one of these
ca2' sensors (Sudhof and Rizo, 1996; Mikoshiba et al., 1999). Synaptotagmin
Figure IV.l: Multiple stages of the secretory pathway of regulated neurotransmision. Stages indicated are (1) ATP-dependent recruitment, (2) docking, (3) ATP-dependent pnming and (4) calcium-triggered fusion and release of vesicle content. Stage (1) involves proteins that disassemble F-actin and translocate vesicles to the active zones; Stage (2) involves SNARE proteins, including VAMP, syntaxin, and SNAP-25, which form complexes during or following docking of the vesicles, and that together with NSF and SNAP proteins, act during an ATP- dependent priming step (3) to disassemble complexes and promote conformational changes in the vicinity of the vesicle and plasma membranes. In (3), there is also a localized synthesis of phosphatidylinositol (4,5)-bisphosphate during ATP-dependent priming. Step (4) involves a calcium-triggered event that leads to tùsion of vesicle and plasma membranes and secretion of vesicle contents into synaptic zones. Adapted fiom Thomas, F. J. Martin. 1997
possesses two C2 domains, designated C2A and C2B, similar to the C2 domain of protein kinase
C. CZ domains are protein motifs involved in ~ a ' + binding and phosphoinositide interactions
(Sudhof and Rizo, 1996). It has been s h o w that ca2' binding to the C2A domain of
synaptotagmin produces a conformationaI change in the protein such that the C2A domain is
allowed to interact with syntaxin andjor phosphatidyl-senne on the plasma membrane (Chapman
et al., 1995). These interactions could represent essential precursor events prior to membrane
fusion of synaptic vesicles.
Another potential caZf sensor is the neurallendocrine ca2'-dependent activator protein
for secretion (CAPS) protein. CAPS, originally identified as a brain cytosolic protein. is
essential and sufficient to trïgger the ca2'-dependent release of norepinephnne fiom semi-
pemeabilized PC 12 cells (Walent et al. 1992). CAPS has been shown to be a caL' and PIP2
binding protein, m e r suggesting a role as a potential ca2' sensor (Ann et al., 1997). Although
identified as a cytosolic protein, CAPS is also peripherally associated with the membrane of
large dense core vesicles (LDCV), but not synaptic vesicles (SV) (Berwin et al., 1998; Tandon et
al.. 1998). It has been proposed that this membrane interaction is mediated by a plekstrin
homology (PH) domain present in CAPS (Elhamdani et al., 1999). PH domains are known
polyphosphoinositide binding motifs that show stereoselectivity in their association. Whereas
most PH domains exhibit specific binding to the D-3 class of polyphosphoinositides. the PH
domain of CAPS exhibits preferential binding to the D-4 class of polyphosphoinositides.
particularly PIP2 (Loyet et al., 1998). CAPS has been shown to be essential at a very late step in
the triggenng of neurotransmitter release, as specific anti-CAPS antibodies inhibit post-docked
and post-prïmed vesicle fusion to the plasma membrane (Martin and Kowalchyk, 1997).
A C. elegans orthologue of CAPS, WC-3 1, is expressed throughout the nervous system
(Livingstone, 1992). Unc-3 1 mutants have pleiotropic nervous system defects, and have been
show= to be resistant to inhibitors of acetylcholinesterase, a characteristic indicating impaired
neurosecretion regulation (Avery et al., 1993; Miller et al., 1996). This animal mode1 shows that
CAPS is an essentiai cornponent in the regulated secretory machinery. However, the precise role
of CAPS in the late steps of secretion remains to be elucidated.
In this chapter, we report the Ml-length cloning and characterization of the human
CAPS-1 gene, as well as a new human CAPS-1 paralogue we have named CAPS-2. We also
report the fùll-length cloning of the mouse CAPS-2 gene and show that it is also very well
conserved with its human paralogue.
IV.2 Materials and Methods
IV.2.1 Yeast Two-Hybrid Screen
The yeast two-hybrid identification of mouse brain cDNAs for CAPS-1 and the novel
gene CAPS-2 was described in detail in Chapter III.
IV.2.2 Cloning of Full-Length CAPS4 and CAPS-2 cDNA
RT-PCR was carried out on poly(A) mouse brain RNA (Clontech) to ampli@ a N-
terminal and a central region of the mouse CAPS- I gene. Primers used were CAPS-FI (bp 664-
684) 5'-GGCCGGCCTTCCAGCCCTAGC-3'; CAPS-RI (bp 1045- 1065) 5'-
GCTGAGGCCGTCAATCTCAGG-3'; CAPS-F2 (bp 1021-1041) 5'-
ATCGAGAAGAGGGTGCGCAGC-3'; CAPS-R2 (bp 2643-2667) 5'-
GTTACC ATGGACATGGGACGCGC AG-3'. The PCR products were radiolabeled with [a-
'"I~CTP (Amersham) by random priming (High Prime DNA Labeling Kit, Roche), and used to
screen a mouse brain cDNA library (Stratagene) and ri human pancreas cDNA iibrary (gift from
Dr. Johanna Rommens). Approximately 1.5 x 106 phage clones (5 x 104 PFU/plate) were
screened in each iibrary. Positive clones were pwified by secondary and tertiary screening and
the two largest (5.2 kb and 4.7 kb) human cDNA clones, 9.1 and 28.1, were sequenced on both
strands at the Sequencing Facility, Hospitd for Sick Children (HSC), Toronto, Canada. Blast
search identified cDNA clone 9.1 as the human orthologue of mouse CAPS-i, whereas clone
28.1 matched a large number of expressed sequence tags that have about 70 % hornology to
mouse CAPS-1. Complete double strand sequence for the largest (4.5 kb) mouse cDNA clone.
14.1, was also obtained fiom the Sequencing Facility (HSC). Blast search showed that clone
14.1 had 75 % homology to mouse CAPS-1 and was missing the 5' end. 5' RACE-PCR Version
2.0 (Clontech) was used to clone the 5' sequence of the mouse CAPS-1 homologue from poly(A)
mouse brain RNA (Clontech). Three gene specific prirners, CAPS-R3 5'-
GTTTGTTAAGCTTCTGCTGC-3' and CAPS- R4-aoI 5'-
AATACTCGAGGCCATGTCGGTGGGCTGCTTG-3', designed from the complementary
sequence of clone 14.1, and CAPS-F3-EcoRI 5'-
AATAGAATTCATGCTGGACCCGTCTTCCAGCGAAGAGG-3' designed fiom the start
codon of human CAPS-1, were used in this amplitication as recornmended by the manufacturer.
RACE PCR products were cloned into pBluescript-KS (Stratagene) and sequenced.
IV.2.3 Northern Blot Anaiysis and Semi-Quantitative PCR
Human CAPS-1 3'-UTR and CAPS-2 3'-UTR were amplified from cDNA clones 9.1 and
28.1 respectively, by PCR using Elongase DNA Polyrnerase (GibcoBRL) and the following
primers: CAPS 1 -F 1 -5'-CTTGTGTCGTTGTTAACCCATCCC~ ' , CAPS 1 -R 1-5'-
CTGAATAmATTGAGAAGCC-3', CAPS2-F 1 -5'-TCCTCTTTTGTGTAGTTTGACC-3'. and
CAPS2-R 1 -5'-TATACTGGTGCAGGAGAATATGG-3'. The two PCR products were
radiolabeled with [U--'~P]~CTP (Amenham) and used to probe human adult and fetal Multiple
Tissue Northern Blots (Clontech) according to the manufacturer. Hybridization was followed by
a high stringency wash (50°C, 0.1 x SSC) and autoradiography.
The gene expression profiles of CAPS-I and CAPS-2 were verified by semi-quantitative
PCR analysis of a normalized Multiple Tissue cDNA Panel fiom Clontech Inc. Briefly, the 3'
UTR primer sets described above: CAPS 1 -F 1 -CAPS 1 -RI, and CAPS2-F 1 -CAPS2-R 1. were
used with the AdvanTaq Plus PCR Kit (Clontech) under the conditions recommended by the
manufacturer to specifically ampli@ CAPS-1 and CAPS-:! transcripts. The cycling conditions
were as follows: an initial denaturation step of 94OC for 30 sec was followed by 22-3 8 cycles of
94°C for 30 sec, 63°C for 30 sec, and 68°C for 90 sec, with a final extension of 2 min at 68°C.
The PCR products were analyzed afier 22, 26, 30, 34, and 38 cycles by agarose gel
electrophoresis.
IV.2.4 Computer Analysis
Databases were accessed and searched using the BLAST algorithm at the National Center
for Biotechnology Information at www.ncbi.nlni.ni h.crou!BLAST and the Bioinformatics
Supercornputer Center at the Hospital for Sick Children, Toronto, Canada at
http://blast.bioinfo.sickkids.on.ca~indexhl. Sequences were analyzed using BestFit, PileUp.
and CoilScan €rom the GCG package of prograrns (Genetics Computer Group, Madison. WI)
available through the Bioinformatics Supercornputer Center at the Hospital for Sick Children.
Toronto at h~~:~/web.bioinfo.sickkids.o~i.ca~rrso~~rces.litml. Protein domain predictions were
O btained using the SMART program (Simple Modular Architecture Research Tool) from the
European Molecular Biology Laboratory - EMBL at htto://coot.einbl-heidt.lbt.rn.dc!SM.~\R'f~'.
Intron-exon boundaries and chromosornai location were determined by direct cornparison of
cDNA sequences with genomic DNA from PAC clones available at
v u u .ncbi.iiinl.ni h.goviBL.AST.
IV.3 Results
IV.3.1 Identification of CAPS4 and CAPS-2 by the Yeast Two-hybrid Approach
To identifi novel dystrophin interacting proteins that could provide an explanation for the
abnormal neurotransmission in the retina and central nervous system of DMD patients, a mouse
brain cDNA library (4 x 10' clones) was screened by the yeast two-hybrid method. This screen
is fully described in Chapter III. Briefly, sequence analysis of 27 of the positive cDNA clones
showed 100 % homology to the 3' end of mouse CAPS-1 gene. In addition, 7 cDNA clones
showed 100 % homology to a mouse expressed sequence tag (EST) that had been named Cpd2
for cerebellurn postnatal development associated protein. Since these 7 cIones had 75%
similarity to the mouse CAPS-1 cDNA, we hypothesized that they represented a new CAPS-1
paralogue, which we proposed to cal1 CAPS-2. This provided the first indication that CAPS is a
h i l y of proteins of at least two pardogues.
IV.3.2 Cloning of Full-Length Human CAPS-1 and CAPS-2 cDNAs
To clone the hll-length cDNA of human CAPS-I and CAPS-2, we screened a human
pancreas cDNA library (1.5 x 106 clones) with probes fiom N-terminal and central portions of
the published mouse CAPS-1 cDNA sequence. The largest clone obtained fiom that screen was
sequenced and found to show 100 % identity to the partial human CAPS-1 sequence available in
GenBank. This clone (9.1) was 5 210 nucleotides long and was predicted to encode a 1274
arnino acid protein (Fig IV.2.A) sharing 98 % identity and 99 % similarity to mouse CAPS-1.
The second largest cDNA clone, 28.1, had 90 % identity to mouse EST Cpd2 and to the mouse
CAPS-2 clones isolated in the yeast two-hybnd selection described above. This clone (Hurnan
CAPS-2) was 4656 nucleotides long and was predicted to encode a 1254 arnino acid protein (Fig
IV.3.B). The human CAPS-2 protein shared 8 0 % identity and 85 % similarity to human CAPS-
1. A GenBank search revealed that both hurnan CAPS-1 and CAPS-2 had 54 % identity and
66% similarity to C. elegans UNC-31 protein (Fig. IV.3). Unc31 has been shown to be
necessary for neurotransmission, as unc-3 1 mutant worms have a pleiotropy of nervous system
defects and are resistant to inhibitors of acetylcholinesterase, a phenotype indicative of
neurotransmission abnormalities.
IV.3.3 Cloning of Full-Length Mouse CAPS-2 cDNA
Since the mouse CAPS-2 gene had not previousiy been cloned, we screened a mouse
brain cDNA library with the mouse CAPS- 1 probes mentioned above to obtain full-length mouse
CAPS-2. The largest cDNA clone obtained fiom these screens, 14.1, had 100 % identity to
mouse EST Cpd2 and to the mouse CAPS-2 clones isolated in the yeast two-hybrid selection.
Clone 14.1 (Mouse CAPS-2) was 4 329 nucleotides long and was predicted to encode a 1205
Figure IV.2.A: Nucleotide and predicted amino acid sequence o f hurnan CAPS-1. CAPS-1 open reading frame contains a C2 motif (bold) and a PH domain (bold and italic).
B) Human CAPS-2
: ' ~ ~ ~ C ~ G ~ A ~ ~ ~ C U ; C C C ~ C ~ - ~ - G ~ ~ G G C ~ C C ~ G C ~ ~ C C * ; V ; G D ; - * C U ; A C T ~ ~ G L C C U ; C U ; G U I C C ~ ~ ~ ~ G U ::3
:: : C = c ' C . C C C I C t - - P M L 2
c A T ~ ~ c ~ - ~ ~ U G C C c = ~ c ~ C U ; A :4a P J S S C C C S > L G L L C C S R D v L V A A C S S O U A P P A P ? P C G U P C
4 1 C G ( h C G G U ; E ~ G ( i < ; C ~ ~ C C - x . f ~ E U ; C r r c I C l G l ~ ~ ~ C C ~ ~ U T H G C C t G U ; C G G I L ; G C I ' F C C C 360 T P ~ A G C C ~ A A ~ ~ S ~ S P ~ P ~ ~ L S L ~ U D E P Q ~ Q L D D ~ ~ ~ ~ R ~ ~
3 6 1 C S G U G C T C T ~ G T ~ ~ C ~ C G ~ G * G G Z G U ~ C U G I A C ~ ~ U ~ C ~ T ~ ~ . + . -A- t a c L Q L Y ~ ~ V V R C : A ~ P ~ N A K ~ P T D M A R U ~ Q K L N K Q O L ~ L L K ~
4 9 : A C G G . r C W - ? I C C C * C i r ~ I t C t ~ - ~ [ ; C A C r r C ~ A I I A W .i. .r . -CWtGt-tCG:AU 60 0 P ~ C A ~ L N C C ~ ~ : ' J A > C A ~ C N A Y R S Y Y ~ ~ ~ L K S D R V A R ~ ~ C
6.1: ' A ~ S G A G r G ~ C ; G C I M T ~ ~ A ~ ~ T ~ c n ; C ~ C c ~ T ~ t ~ ~ U T G G * 1 7:: S G G C S A H D r U L V r K K M X C K R V R S L P C I D G L S K L T V L S S Y :
7 2 : A S ~ ~ V U ~ A ~ ~ T G ~ - ~ ~ * S ~ U . G G T ~ ~ U T A C I C ~ C * ~ C C C A M T ~ ~ ~ G ~ C I ~ A ~ A ~ ~ 4 c A K Y D A I Y R G L L D L C K Q P ~ U M A ~ S A ~ S ~ L I L S K C Q L Y ~ M ~ ~
e 4 : WGL~=SV~GTARP - - - C ~ A T M T ~ ~ C ~ U C C ~ ; C A ~ - ~ ~ U ~ ~ U ~ ~ G G C Z - Z V ~ C 960 ~ - L G : K K L K H ? L L Y N A C O L D N A D L O A A P ~ R I C L 3 G R L 9 L A
6 1 A U I - I ~ ~ m A T ~ T A T < ; G A G M T A 1 G : A T A T ~ C r t l C r r ~ ~ G C : ~ T V L ~ ~ . . . L : 3 8 C ~ U ~ A K ~ R K F P K ~ I A K D M L N M Y I C L L U S S ~ J H L L K A ~ L L S L P
:il 8 i A ~ C ~ G G T C C G C M m ~ I I ~ l i ~ ~ G C A S r r r r ~ T A C C A U T ~ T GIGI-cCGAI:G+CG:ACCC : Id0 V S K C G P C r K L O K L K R S O X J A ? L D I G D C N L ~ Q L 5 K S D ' J ' J L I
:: I : A O C X C ~ ~ ~ C T U ~ M ~ ~ ~ ~ C C ~ ~ ~ ~ T T G ~ ~ ~ - ~ ~ ~ U G L S A C L C ~ C ~ i x a F T L C t V I I C V P O L 1 # V A P W ~ L V ? C f I C Y C O ~ C L Q T O Q A L A
: 3 1 : c ~ ~ ~ ~ T v ~ u ~ G ~ * ~ w ~ W C I C C U ~ ~ C ~ ~ ~ ~ ~ T ~ L G : 4 4 Q
~ R P ~ ~ O T Q O D ~ + ~ T ~ ~ ~ ~ V V I : V I L ~ T C S ~ ~ V L A L L O K ~ L O : 4 4 : M ~ ~ ~ ' A ~ A ~ A T A C C C M C T : C T U f A ~ C = l i M ~ ~ ~ ~ T T A C L S C C A T ~ A ~ C ~ T ~ c u ; W ~ ~ ~ ~ f tkUC:GGCd52CZ~IUTt-CC<rM : ? 6 3
R V I L Y P T J H S S K S A L L ~ U ~ - ~ ~ J P K N S C ~ J ~ L K : K ~ A V P K ~ I ! . l 6 : A C ' 2 G C A U T A 7 ~ I L , C 1 C 1 & f A T C G T A T G C C e T ~ ? ~ ~ ~ ~ U ; . ; ~ U ; ~ ~ ~ A ~ X ~ A ~ A T A ~ G X A ~ G T U A ! 6 s c
~ ~ u r r m s ~ r ~ r ~ ~ ~ ~ r ~ w ~ m w r ~ m r r v ~ v p v s a r ~ r ~ œ ~ s : i. e : = T X r ~ ~ c G u c u ~ = M ~ ~ ~ T ~ ~ I : ~ ~ L s c t L . t c c c ~ ~ ~ c . ~ ~ m ~ ~ t ~ c ~ ~ ~ : e c O
..-. ~ ~ C K I I C I Q C L ~ Q L ~ O ~ T V O ~ T D P I ~ O L Q ~ ~ C U ~ ~ ~ A V K C . . - & j c ; n G A T L T S 1 M T - G C X W T W 5 ~ Z A T A 7 ~ ~ ~ Z G T A Z A c G < ; T ~ ~ ? A f ~ C G U I \ ~ ~ C ~ C T : 92 2
.<.. C D ~ V ~ ~ A S D D ~ O D ~ ~ L W V ~ A ~ ~ ~ A T O O S Y K P ~ ~ P ~ : ~ : ~ K I
. . - . r A X T T ~ ~ C I C C h f ~ ~ A T ~ ~ T C ~ ~ r 0 ; 1 A t W A T r ~ A ~ C . ~ c c ~ ~ ~ ~ ~ t ~ c - T r c ~ ~ i û 4 0 ~ P K G I ~ L ~ A D A ~ L Y A O R ~ O ~ ~ G M D ~ ~ I ~ A N P C K L D ~ A ~ L ~
2 3 4 : T A U A l A C I C ~ C U ~ ~ ~ ~ A ~ G G W C U 1 1 ; 5 A G C C t t r ; G C W ( . & c c i . I. ~ ~ ~ A C A ~ ; A ~ T A C ! V ~ C C C ' ; ~ ~ A T G C I G T ~ & i : 6 2 P : t Q R 0 T L D H R L H D S Y S C L G ~ ~ S P C O ' J ~ ' J L O C I C A 2 Y G G J P
2 : C : A C C ~ T ~ Z - I * ~ ~ ~ ~ C : C C S ~ C T ~ ~ ~ ~ C C ~ U U ~ T ~ G ~ ~ A ~ ~ ~ ~ ~ ~ C T C U ~ ~ G U ~ ~ G ~ V ~ ~ ~ Z U T ~ G C I C ~ ~ ~ 2 2 8 0 : C ~ R K L C Y L A C L ~ C ~ S C N C A V I D P ~ L L N ~ S F A ~ C A S K V N G
i 2 5 : C U C A ' Z C ' 4 T W P P - G U i G A W T - . L L . C C C r r r : ~ t - T M G C J ~ : X C Z . . . L C .' 4 c? 5 x R P D G I G T V S V C C K ~ R ~ C C : K C R L S ~ L L L ~ Q I J ~ ~ U Y C ~ ?
: 4 5 : - C C A C r & C T t M ~ ~ S ~ ~ I : A C r Z G l M G G C r m M T ~ 7 A ~ ~ C C U T A c ~ ~ - T G T C 2 52 S
.<. , F G i i P L G A L K A T L S L L C U Y L M K 3 : A T P : P A C C ' I K L V ' J P K C L . -. . : U G n M G c ? ~ ~ ~ ' A 7 ~ I : A U C - ~ C : ~ t A 5 1 ~ W T ~ T ~ C U i G U ~ ~ ~ G G U G U ; * , ~ Z S ~ k U W ~ ~ : 2 64 C C ~ A A L I H Y T U L T C Y A U I E L Z M N Q A 5 P h i i K L C C : ~ H L A L L C
2 c 4 : - ~ ~ A G M c ~ A u ~ u ~ ~ u ~ ~ T ~ ~ TTZCC-. - . .A. - . ~ ~ T ~ ~ ~ A ~ ~ ~ T A T - C T ~ X : :*O : f ~ J L Q C N C L H K A E A ~ A Y Y P D L L A L H A C K F U A L r ' ~ V D H D 7 A
' C : A C T ~ G < ; C T - A C C I ; C M G 1 C : C C Z G G C A f ~ f C C r r t f C V 3 r C T G C T T M T M ~ ~ ~ ~ G T C : M I " ~ T T : ~ C G C U G I M t 2 ¶ 1 0 L ~ A ~ P ~ ~ S Y O S ~ P L ~ Q L L N N ~ L ~ N D ~ L L C H G K ~ ~ K H : ~ ~ :
: 1 5 1 ~ ; T X t C T T G u ? T u T C C ; C T A 7 G T ~ ~ T W C T ~ C U X U C ~ r K M ~ ~ Y - G U C C ~ ~ ~ ~ 5 C A W 1 C O S ~ Y ~ ~ Y V U Y Y D L M C S S I A Q S : H ~ G ~ C ; C C ~ Y ~ P ~ N ~ G S A ~ S ~
? : I : ~ ~ ~ C ; . ; . ; ; ~ - ~ G I T ~ ~ T C ~ . ~ ~ ~ ~ ~ ~ C ~ - ~ ~ C ~ ~ S ~ ~ M M ~ U G ~ - ~ T A ~ C C S ~ ~ . , 1 : 2 0 ~ L ~ Y K L D A L Q ~ ~ ~ ~ ~ D L H U P L ~ C ~ A H ~ L L ~ ~ ~ L K L I I A S ~ H L C
3 : : : ' / ; ; C I S I G T C M M ~ ~ G C A ~ ~ ~ G C C U I l t U G C r r C C ~ ~ S A T ~ M ~ ~ A ~ ~ C S i i r T C C = M 3 2 113 A C Y K ~ : R T A ~ ~ L K L Q K A ~ K T ~ S L U I P A J ~ I C ~ ~ F Y ~ J L ~ J ~ L . K
12 4 : ~ ~ ~ c A c ~ c I ~ ~ c : c c I , ~ ~ ~ A C U ~ T ~ T - - A ~ ~ ~ A ~ ~ ~ T U - U ~ T 3 360 K : S : K L C A L D G G Q L ~ G S Q ~ ~ ~ Y H S U : D ~ L I D H ~ ~ I K ~ : : ~ L
1 36 : ~ ~ - ~ V ~ ~ T C U ; I G I ~ ~ C ~ ~ ~ ~ U G C ~ ~ C C A I G G T A T C ~ T ~ ~ U ~ C U ~ C T G T U ~ - ~ C ~ ~ ~ ~ : A ~ ~ 3 4 e o ~ ~ I S K F V S V L C C ~ J L S K L S U Y D ~ G ~ ~ ~ S S : L S ~ Z ~ ~ K A A A K Y ~ ~
! 4 C : ' ~ A T ~ c - c - T ~ T C ~ ~ A ~ A ~ A T ~ ~ ~ ~ I A ~ C + T ( : ~ .. .. . C M f G A G t % U T t S A 5 A T ~ A T r T C r A X A 3 6 C C d . ~ u ~ ~ n : ~ ~ ~ r ~ : n r v u ~ ~ ~ ~ : ~ ~ c ~ v ~ c ~ n ' r : r r ~ r ~ ~
3 t : : A T - - T A ; I ~ ~ C ~ I ~ C : U ~ . . K ~ C T ~ ; ~ ~ ~ ~ ~ ~ A T ~ T T ~ C : C ~ U T A T T T Z I C ~ G C T U T C U G A ~ : ~ C ~ ~ G G G I ~ ? : 3 7 2 2 ~ T S S S ~ K ~ J I C V ~ L ~ D P L D L ~ L ~ I Y Q L K T L : ~ : ~ ~ U ~ Y R ~ ~
1 -: : I C - A T T ~ ~ ' ~ G S C T Z ~ ~ U ~ ~ ~ C O A Z ~ ~ ~ G T ~ . ~ ~ ~ ~ ~ ~ ~ - ~ C ~ C Z ~ ~ ~ ~ ~ X ; W J B I C E L ~ C Y L E C T L N S K I Y 1 T Y M R U L ~ ~ ~ ~ C A ~ A S V S C C G G L 7 G : --- .A- . A T W ~ U G I G I C W S U C U ~ ~ T A T U ~ ~ L ' - T T W X G C L I T T i . A .A i . b.. . A U ~ C C I G I U T T ~ 7 X 3560
Figure IV.2.B: Nucleotide and predicted amino acid sequence of human CAPS-2. CAPS-2 open reading fiame contains a C2 motif (bold) and a PH domain (bold and italic).
Figure IV.2.C: Nucleotide and predicted amino acid sequence of mouse CAPS-2. Mouse CAPS-2 open reading fiame contains a C2 motif (bold) and a PH domain (bold and italic).
amino acid protein. Mouse CAPS-2 shared 79 % identity and 85 % similarity to mouse CAPS-1.
Clone 14.1 was missing the 5' end of mouse CAPS-2 as compared with full length human CAPS-
2. To obtain this 5' end, we used RACE-PCR on poly(A) mouse brain RNA. This amplification
identified a product of 2 10 nucleotides starting at the ATG of mouse CAPS-2 and ending in an
overlapping region of mouse clone 14.1. The hll-length mouse CAPS-2 protein was 1275
residues long (Fig IV.2.C) and shared 80 % identity to mouse CAPS-1 .
IV.3.1 Identification of Protein Motifs in CAPS-1 and CAPS-2
To obtain information on the role of the CAPS proteins in vertebrates, an analysis of the
predicted protein domains, using the SMART program, was perforrned for human and mouse
CAPS-1 and CAPS-2. This domain predictor revealed a previously unidentified C2 (protein
kinase C2) domain at residues 399-494 of CAPS-1 and 365-462 of CAPS-2 (Fig IV.3). C2
domains mediate ca2+ and phospholipid binding to a number of proteins involved in regulated
secretion, including the ca2' sensor synapiotagmin. The SMART program also identified a PH
domain at residues 522-626 of CAPS-1 and 487-591 of CAPS-2 (Fig IV.3). This domain has
been previously identified in mouse CAPS-1 and is thought to mediate CAPS-1-membrane
interactions. The CoilScan program fiom the GCG package was used to identiQ potential
coiled-coi1 motifs present in human CAPS-1 and CAPS-2 that might mediate their homo/
hetero/dimerization or their interactions with other proteins. We found that human CAPS-1
contained two putative coiled-coi1 motifs at residues 99-1 26 and 837-880. CAPS-2 also has two
predicted coiled-coils at residues 248-278 and 830-875.
Figure W.3: Amino acid alignment to compare the deduced amino acid sequences of hurnan CAPS- 1. human CAPS-2, and C. elegam unc3 1 proteins. Their C2 domain is shown by a dark shaded box with white letters, and their PH domain is indicated by a gray box with black letters.
IV.3.5 Chromosomal location and structure of buman CAPS-2
The full-lengtii nucleotide sequence of human CAPS-2 was used to search GenBank
databases using the BLAST algorithm to determine if any PAC clones that contain CAPS-2
cDNA sequences had been identified. Five PAC clones, DJ0589D08, NHO395G 17, DJ0850IO 1,
DJ 1 166A24, and DJ 1 10 1 C03, showed 100 % homology to different regions of CAPS-2 cDNA,
and were mapped to human chromosome 7q3 1. A partial PAC contig was assembled from these
five clones (Fig. IV.4). The genomic organization of human CAPS-2 indicates that the gene is
composed of over 26 exons covenng over 633 kb (Table IV. 1).
IV.3.6 Tissue expression of CAPS-1 and CAPS-2
Martin and colleagues have shown that CAPS-1 is selectively expressed in
neuravendocrine tissues (Walent et ai. 1992). To determine if hurnan CAPS-2 has a similar
profile of expression, we performed Northern Blot analysis on adult and fetal multi-tissue blots
using probes fiom nucleotides 4321 -4843 of CAPS-1 3WTR and 408 1-4603 of CAPS-2 3'-
UTR. These probes were specific for their respective gene as indicated by Southern Blot
analysis (data not shown). As reported previously, CAPS- 1 was found to be highly expressed as
a 5.6 kb band in adult brain and pancreas. as well as at Iower levels in adult heart (Fig. IV.5.A).
We found that CAPS-1 is also specifically expressed in fetal brain. In contrast to the CAPS-1
expression, a totally different profile of expression was seen with CAPS-2. This gene is
expressed as a 5.0 kb transcript in al1 adult and fetal tissues tested (Fig. IV.5.A). The level of
expression in adult tissue in decreasing order was kidney, pancreas, brain and h e m > lung and
liver >> skeletal muscle and placenta. Fetal kidney expresses CAPS-2 at higher levels than fetal
lung and liver, and at a much higher level than fetal brain.
Physical Map of Human CAPS-2 on 7q3 1
ATC STOP
Figure 1 V.4: Genomic structure and location of human CAPS-2. Diagram of the partial PAC clone con1 ig and localizat ion of exons 1-26 across a 600 kb region of human chromosome 7q3 I . Exons numbered fiom 1 to 26 are represented by solid boxes. PACs DJ0589D08, DJ 1 l66A24, NH0395G 17, DJ0850101, and DJ 1 101 CO3 are fioni GenBank accession numbers AC004838, AC004986, AC006463, AC006009, AC004594 respectively. (Not drawn to scale)
1 Exon 1 Exon 1 Position 1 Intron / Splice Splice / Intron 1 s i z e
1-433 150. O 434-547 73.4
Acceptor I l Phase I 5 ' UTR tgtagCTTAA ttcagGTTTT
1 1 0 1 1 0 9 11647-1755 1 1. O 1 agcagGTTAG 1 CCCAGgtaaa 1 O 1
4 5 6 7 8 9
AGAAGgtgag ATGAGgtaag GTCAGgtaaq
aacagAAACC 1 TTGATgtaag 1 2
1 1 1 1
8 1 237 1 1 9 1 2 2 1 4 0
67
11 1 2 1 3 1 4 1 5
---agCAATG 1 ---- 3' UTR 1 - 1
Table IV. 1 : Human CAPS-2 gene structure idonnation.
881-961 962-1198
1199-1317 1318-1439 1440-1579 1580-1646
2 0 1 1 3 7 1 8 8 1 0 2
64
7 . 5 > 4 . O >6.0 2 6.4 41.2 21.8
1756-1956 1957-2093 2094-2281 2282-2383 2384-2447
ttaagCTGGA tcaagGAAAG ---agATTGT tacagATGGG tacagGTGAT tccagATATC
1 5 . 6 2.8
19.9 9.9 3.0
CAAAGgtaaa TAGAGgtaag CCACAgt--- GAAGGgtgag AGTGGgtgag TTCAGgttag
cacagGCCTT tacagATGCA t gcagGGATG ttcagGCCTG taaagATACT
GCTTTgtaag GCTTGgtgag AACAGgta t t TTCAGgtata AAAGGgtatg
O 2 1 1 2
A) Adul t Tissues Fetal Tissues
CAPS2 (5.0 kb)
CAPS1 (5.5 kb)
Il-acîh (1.9 kb)
w
Figure IV.5: Expression profiles of human CAPS-1 and CAPS-2. (A) Northem blot analysis of CAPS-1 and CAPS-2 genes in eight adult (left) and four fetal (right) tissues. CAPS-1 is expressed as a 5.6 kb product while CAPS-2 is expressed as a 5.0 kb product. B-actin was used as a RNA loading control. (B) Semi-quantitative PCR expression analysis of CAPS-1 and CAPS-2 on a normalized multi-tissue cDNA panel. Shown are the results &er 30 cycles of amplification. Amplification of the house-keeping gene G3PDH is shown as a cDNA nonnalization control. (He) kart, (Br) brain, (Pl) placenta, (Lu) lung, (Li) liver, (SM) skeletal muscle, (Ki) kidney, (Pa) pancreas, (M) 100 bp DNA size marker, (C-1) CAPS-1 positive control, (C-2) CAPS-2 positive convol(+) G3PDH positive control, (-) negative control with no cDNA.
To confirm the tissue expression of CAPS-1 and CAPS-2, we perfonned semi-
quantitative PCR on a normalized multi-tissue cDNA panel. Using primers that specifically
amplifi the 3'-UTR, CAPS-1 was shown to be expressed in heart, brain, and pancreas (Fig
IV.5.B). Primers specific for the 3'-UTR of CAPS-2 amplified, at varying levels, a 503 bp band
in al1 tissues tested. Pancreas and kidney express CAPS-2 at higher levels than hem, brain, lung,
and liver, and at much higher levels than placenta and skeletal muscle, thereby confirming the
Northern Blot results (Fig IV.5.B).
IV.4 Discussion
A large number of the proteins and lipids involved in regulated secretion of vesicles have
been identified in the Iast few years (Sudhof, 1995; Rothman, 1994). However, the precise
molecular mechanisms underlying the multiple steps of vesicle docking and fusion remain
elusive. Evidence provided by experiments on semi-intact PCl2 cells deprived of cytosol has
shown that regulated exocytosis of LDCVs, involved in the secretion of norepinephrine and
peptide hormones, consists of separate ATP-dependent priming and ca2'-dependent triggering
steps (Martin and Kowalchyk, 1997). The ATP dependence in vesicle priming can be accounted
for by the requirement for ATP in the synthesis of PlPZ on the synaptic membrane, as well as for
the dissociation of the SNARE temary complex (Avery et al., 1999). It is thought that the
regulated synthesis of PIP2 on membrane surfaces could act as a localized signal that hct ions
to recruit specific proteins involved in secretion as evidenced by PIP2 binding to proteins with
PH motifs (Cockcroft, 1999). These recruited proteins might participate either in the triggering
process or in the direct fiision of vesicle membranes.
The requirement for ca2' in the post-priming niggering step of regulated secretion
indicates that at least one ca2+ sensor is involved in the late fusion steps. It has been proposed
that the ca2'-binding protein synaptotagmin might act as one of these sensors (Sudhof and Rizo,
1996). Similarly, CAPS-1 has been shown to be a ca2+-binding protein involved in a post-
docked, post-primed secretory stage (Elhamdani et al., 1999). Although CAPS- 1 was identified
as a cytosolic protein capable of reconstituting the post-priming, caz'-dependent secretion of
norepinephrine in semi-intact PC12 ceIls (Walent et al., I992), significant amounts of CAPS-1
were shown to be vesicle membrane- and plasma membrane-associated (Benvin et al., 1998).
In this study, we have cloned the full-length cDNA of human CAPS-1 and characterized
its protein structure and tissue expression. Human CAPS-1 protein was s h o w to possess over
98% identity to mouse CAPS-1 indicating a strict conservation of sequence across species.
Human and mouse CAPS-1 proteins were found to contain a PH domain near their center
(Elhamdani et al., 1999). PH domains are composed of about 120 residues and occur in a wide
range of proteins involved in intracellular signaling or as constituents of the cytoskeleton.
Martin and colleagues demonstrated that rat CAPS-1 is capable of binding specifically to
liposomes containing PIP2 but not to liposomes containing PIP3, and proposed that this
interaction was rnediated by the PH domain of CAPS-1 (Loyet et al., 1998). As mentioned
above, PIP2 is synthesized at the active zones of secretion and Loyet et al. suggested that CAPS-
1 is recmited to these active zones by PIP2.
We found that human CAPS-1 protein contains a single C2 domain next to the PH
domain. C2 domains are ca2"and phospholipid binding motifs originally identified in protein
kinase C. The secretory protein synaptotagmin contains two C2 domains designated C2A and
C2B (Schiavo et al., 1996). C2A is capable of binding PIP2, as well as the SNARE protein
syntaxin, in a ca2'-dependent manner (Chapman et al., 1995). C2B binds ca2', polyphosphate-
inositols, and the endocytotic factor AP-2 (Mikoshiba et al., 1999). It has been s h o w that below
the ~ a " concentration threshold for exocytosis, synaptotagnin is bound to PIP3, and following
an increase in ca2' concentration above the threshold, synaptotagmin changes its binding affinity
and binds to PIP2 in a ca2'-dependent manner (Schiavo et ai., 1996). These molecular events
are thought to participate in the fusion of the vesicle membrane to the plasma membrane. CAPS-
1 is also a ca2'-binding protein ( A m et al., 1997) but until this report, no caz'-binding protein
domain had been recognized. It is possible that CAPS-1 functions in a manner similar to
synaptotagmin such that under low ca2' concentrations, it is bound to PIP2 by either its C2
domain, its PH domain, or both. Following a raise in intracellular ca2' concentration. its
specificity for PIP2 might decrease and it might then be able to bind other phospholipids to
trigger the fusion of exocytotic membranes.
It is known that proteins important for endocytosis and exocytosis of SVs and LDCVs
have homologues in non-neuronaVendocrine cells which are essential for constitutive membrane
trafficking (Ralston et al., 1994; Calakos and Scheller, 1996). For instance, the synaptotagmin
family of proteins is composed of at least 1 1 paralogues with differential tissue and subcellular
expression (Mikoshiba et al., 1999). In this paper, we have described the cloning of a human and
mouse CAPS-1 homologue, CAPS-2, which shares over 80% identity with CAPS-1. CAPS-2 is
very well conserved as human and mouse CAPS-2 orthologues share over 98% identity. CAPS-
2 also possesses a CS and a PH domain thereby allowing CAPS-2 to have a potentiaily similar
type of interaction with caZ' and phosphoinositides as CAPS-1. Interestingly, unlike CAPS-1,
CAPS-2 expression is not restricted to n e d e n d o c r i n e tissues, but has a more widespread
expression profile. Its ubiquitous expression suggests that CAPS-2 may not be strictly involved
in regulated secretion but might be involved in constitutive membrane trafficking.
Regulated neurotransmitter secretion utilizes a machinery that is fùndamentally similar to
vesicle trafficking in al1 ce11 types (Mayer, 1999). As such, a number of ubiquitous intracellular
trafficking reactions require ca2': endoplasmic reticulurn (ER) to Golgi transport, vacuole
fusion. and endosorne fusion (Rexach et al., 1991). In the case of ER to Golgi transport, ~ a "
acts on vesicles at a late stage similar to the regulated secretion of LDCVs (Mayer. 1999)
(Beckers et al., 1989). However, contrary to regulated secretion where an extemal signal triggers
a ca2' influx to the site of exocytosis, ca2' operating in vacuole fusion is released from the
lumen of vacuoles in response to docking (Mayer, 1999). Calmodulin associated with the
vacuole membrane binds this ca2' and may present it to a ~ a " sensor (Peters and Mayer, 1998).
We suggest that CAPS-2 might act as this ca2+ sensor in the late stages of vacuole membrane
fusion and that it might be capable of triggering the bilayer mixing of membranes in a sirnilar
manner to the fiision of secretory vesicles.
We found that hurnan CAPS-1 and CAPS-2 share over 50% identity and 65% similarity
to C. elegans UNC-3 1 protein. Unc-3 1 mutants have a pleiotropy of nervous system defects that
include a locomotive defect (unc), a iarva stage defect (dar), an egg laying defect (egl), a feeding
defect (puc), and a marked increase in life span (Avery et al., 1 993; Ailion et al.. 1 999). UNC-3 1
is expressed throughout the nervous system (Livingstone, 1991) and is invoived in
neurotransmitter secretion. Mutants of unc-31 show defective serotonin secretion and are
resistant to inhibitors of acetylcholinesterase, a phenotype characteristic of impaired
neurosecretion (Miller et al., 1996). It must be noted that unc-31 mutants are stiil able to
perform nomdly the majority of functions controlled by the nervous system. Therefore, the
effect of unc -3 1 mutations does not result in a complete loss of neurotransrnission, but rather in a
defect in the fine modulation of specific hc t ions by the nervous system (Avery et al., 1993).
The conservation of sequence and function of unc-3 1 with CAPS-1 and CAPS-2, indicates the
importance of this family of proteins in the control of regulated and possibly constitutive
secretion.
Martin and colleagues found that cytosol fiom neuraVendocrine tissues could fùlly
restore ca2' regulated secretion in semi-intact PCl2 cells (Waient et al., 1992). They
demonstrated that CAPS-1 isolated fiom such tissues was sufficient to provide the cytosolic
component necessary for ~ a ~ ' - d e ~ e n d e n t secretion. While they concluded that non-secretory
tissues such as muscle and lung were not able to fully reconstitute CAPS-1 (Walent et al. 1992).
it can be seen fiom their results that a fraction of the ca2'-dependent secretion from PC12 cells
was reconstituted by cytosols from non-secretory tissues. We suggest that CAPS-2 might be
able to partially compensate for the loss of CAPS-1. In the absence of CAPS-1, CAPS-2 might
hinction as a ca2+ sensor in the late steps of regulated secretion.
We have mapped the human CAPS-2 gene to chromosome 7q3 1 by identifying a number
of PAC clones containing portions of the CAPS-2 cDNA sequence. CAPS-2 is a rather large
gene spanning over 633 kb. It is composed of over 26 exons and contains large introns in the 5'
end of the gene. The CAPS-2 gene is localized within a disease locus for autism, a polygenic
disease associated with abnormal cognitive brain function (Barrett et al. 1999). It is possible that
mutations in CAPS-2 may lead to autism through an alteration of the reguiation of secretory
pathways or vesicle trficking. Further studies are necessary to determine if CAPS-2 is one of
the autism causing genes, and to characterize the molecular mechanisms underlying this disease.
CHAPTER V: DISCUSSION AND FUTURE DIRECTIONS
The goal of this project was to elucidate the role of the altematively spliced variants of
dystrophin. The DMD gene is able to generate a large number of isoforms through multiple
tissue-specific promoters and alternative splicing. The alternative splicing of the penultimate
exon 78, which creates a totally different C-terminus, is a tissue-specific and developmentally
regulated process. This splicing event produces a highly conserved mainly hydrophobic C-
terminus that may be involved in protein-protein interactions.
V. 1 Dystrophin mutant mice
To characterize the role of the spliced isoforms created in the presence or absence of
exon 78, we initiated the creation of mutant mouse variants that lack one of the two C-termini of
dystrophin (Chapter II). For this purpose, we characterized the genomic structure of the 3' end of
the mouse DMD gene and used that information to generate two replacement constructs designed
to target the C-terminus of dystrophin. We first created vector pKOACT-1, which by
homologous recombination in ES cells, should remove exon 78 and its flanking sequences from
the gene and thereby encode a dystrophin isoform that constitutively uses the hydrophobic C-
terminus. We also generated vector pKODCT-I, designed to remove intron 78 from the DMD
gene and produce dystrophin isoforms having the hydrophilic C-terminus used in a constitutive
manner. Dan Stevens, a graduate student in the lab, is currentiy targeting mouse 1291Sv ES cells
with these replacement vectors, as well as selecting for homologous recombinants by the PCR
and Southern blotting strategies that we designed. Following mutant ES ce11 production, these
Iines will be microinjected into blastocysts and inserted into pseudopregnant female mice to
generate chimenc mice. These chimeras will be crossed and analyzed for germline transmission
of the targeted recombination.
An assessment of the muscle, cardiac, and CNS phenotype of these mice will determine if
the hydrophobic or hydrophilic C-termini are essential for dystrophin hinction. In addition, ERG
measurements of neurotransmission across the retina w ï I I be conducted in collaboration with Dr.
De-Ann Pillers (Oregon Health Sciences University, Oregon). If the hydrophobic C-terminus of
dystrophin is involved in localizing specific transmembrane proteins in the ILM of the retina, we
expect to obtain abnormal ERGS similar to the measurements obtained in Dp71 nuIl mice (Pillers
et al., 1999b). Furthemore, we and others, have shown that Dp7 I is expressed early in fetal
muscle development and that irs subcellular locaiization differs from that of Dp427 (Howard et
al.. 1999). As Dp71 contains primarily the hydrophobic C-terminus in developing muscle
whereas Dp427 utilizes predominantly the hydrophilic C-terminus, we predict an abnormal
muscle development if these differences are essential for protein function.
We will anaiyze the expression and subcellular localization of the components of the
DGC in mice with targeted disruptions in their dystrophin C-termini. It has been shown that
dystrophin binds P-dystroglycan via its WW and cysteine-rich domains, the syntrophins by the
peptides encoded by exon 74, and the dystrobrevins through a coiled-coi1 domain in exons 74-76.
Although these regions are not directly targeted by Our replacement strategies, it is possible that
the hydrophilic or hydrophobic C-terminus of dystrophin may modulate some of these
interactions by altering the overall protein tertiary folding. As such, we rnay be able to
determine the extent to which some of the components of the DGC are altered in our mutant
mice by performing immunohistochemistry with antibodies specific to these proteins. In
addition, our mutant mice may be lacking direct binding sites for proteins that have not yet been
identified.
It is possible that mouse variants lacking one of the two C-termini of dystrophin may not
show a measurable phenotype. This might be due to a potential functional overlap between
dystrophin and its orthologues utrophin and dystrobrevin which may mask the effects of the
dystrophin mutations. To test this, our mutant mice will be crossed to utrophin null and
dystrobrevin null mice and tested for abnormal phenotypes or incorrect expression and
localization of the DGC components.
V.2 Dystrophin interacting proteins
To characterize the function of the mainly hydrophobic C-terminus of dystrophin we
looked for novel interacting proteins that may bind to it through this domain (Chapter III). We
used the yeast two-hybrid system to screen a mouse brain cDNA library with a "bait"
corresponding to the last 3 1 hydrophobic residues of dystrophin generated in the absence of exon
78. This screen identified 8 new proteins that potentially interact with dystrophin. However.
only 2 of these 8 proteins, ACRP and RanBPM, were able to activate the two-hybrid reporter
gene in conjunction with "bait" vectors that lack an additional leucine present in the original
"bait". This suggests that the other 6 proteins may represent false positives of the two-hybrid
system. Assays performed using a larger region of dystrophin, while maintaining the
hydrophobic C-terminus to be tested, would allow a correction of this single residue issue and
would also increase the probability of obtaining the imate tertiary folding of the protein. We
have tested longer dystrophin "baits" but they have al1 autoactivated the two-hybrid system and
thereby have prevented their usage on a screen, a problem that is often encountered while
designing appropriate domains to be tested. As such, we are limited in the type of two-hybrid
screens that we c m perform with the hydrophobic C-terminus of dystrophin.
An alternative and complementary approach to characterize protein-protein interactions
consists of in vitro and in vivo CO-sedimentation experiments. We attempted this approach with
the best two-hybrid candidates, CAPS-1 and CAPS-2. These proteins were obtained numerous
times in the screen. and represent orthologues of a new farnily of proteins involved in
neurotransrnitter release via regulated exocytosis of secretory vesic1es. However, in vitro
attempts at performing pull-down experiments with GST-tagged dystrophin and in vitro
transcribedtranslated CAPS-1 and CAPS-2 failed to demonstrate a direct interaction between
these proteins. Three possibilities may explain these results: i) dystrophin and CAPS-1 and
CAPS-2 do interact, as observed by the two-hybrid system, but are low affinity binding partners
unable to CO-sediment in vitro; ii) the hydrophobic C-terminus of dystrophin requires an adaptor
molecule, which is expressed in yeast but absent fiom the in vitro pull-downs, in order to interact
with the CAPS proteins; iii) CAPS-1 and CAPS-2 may represent false positives of the two-
hybrid system. To demonstrate that i) or ii) are true, we must perfonn CO-immunoprecipitation
studies in mammalian cells over-expressing dystrophin and the CAPS proteins. This in vivo
analysis will provide an effective means to determine whether there is a real interaction between
these partners or if they represent false positives.
The other six proteins obtained in the yeast two-hybrid screen are still candidates for real
interactors of dystrophin. To confirm binding of these proteins with the hydrophobic C-terminus
of dystrophin, a similar approach as described above will be taken. Towards that goal. Paula
Williams, a graduate student in the lab, has used the GST-tagged dystrophin baits to show that in
vitro transcribed/translated ACRP does CO-sediment with the hydrophobic C-terminus.
Currently, she is attempting to reveal an in vivo interaction by over-expressing both proteins in
mammalian cells and testing for binding by CO-immunoprecipitation studies.
To M e r confirm that the proteins identified in the two-hybrid system interact with the
hydrophobic C-terminus of dystrophin, we will raise antibodies specific to our candidates. and
perform CO-localization studies with these and with antibodies specific for the hydrophobic C-
terminus of dystrophin. These tests should demonstrate that both proteins are CO-expressed in
the same tissues and more importantly, that their sub-cellular localization overlap. As Our initial
screen used a brain cDNA library, it will be important to assess the overall tissue expression
pattern of the candidates by multi-tissue Northem blot anaiysis and semi-quantitative RT-PCR.
If some of these proteins are expressed in the retina, we may be able to use our lab expertise in
immunohistochemical preparations to m e r define which retinal layers express them. and
assess their CO-localization with the different dystrophin isoforms of the retina.
It will be interesting to determine whether the new potential interactors of dystrophin
have altered expression a d o r localization in its absence. Various dystrophin interacting
proteins, such as P-dystroglycan and P-dystrobrevin, have been shown to be absent from the
retinas of mdx3cv and DMD patients. This could also occur with the newly identitied protein
partners of dystrophin and could potentially explain some of the retinal phenotypes observed in
the dystrophie mouse variants and in DMD patients.
V.3 Characterization of CAPS-1 and CAPS-2
In the course of analyzing potential dystrophin interactors, we identified a novel protein
that shared a high degree of similarity to mouse CAPS-1, a neurdendocrine specific protein
known to be essential for neurotransmitter release from secretory vesicles (Chapter IV). We
decided to look more closely at CAPS-1 and this newly identified protein, which we named
CAPS-2, by cloning and characterizhg the hurnan and mouse genes encoding them. We were
successful in obtaining the hill-length cDNA of human CAPS-1 and CAPS-2, as well as mouse
CAPS-2. This, together with the known mouse CAPS-1 gene sequence, revealed a new famiiy
of proteins that shares a high degree of homology, from human and mouse down to C. elegans.
There is a high conservation at the amino acid level between paralogues and orthologues. For
instance, human CAPS-1 and CAPS-2 are 98% identical, while human and mouse CAPS-2 are
close to 80% identical. This conservation of the overall primary arnino acid sequence in this
family of proteins, as well as in the individual protein domains, indicates the importance of these
proteins.
In addition to the two coiled-coi1 motifs present in this family of proteins. which are
likely the mediators of protein-protein interactions, we identified two well-characterized protein
domains: a PH and a C2 motifs. The PH domain is a phospholipid binding motif that is likely
the mediator of the known association of CAPS-1 to the membrane of secretory vesicles. By
analogy, we predict that CAPS-2 is also capable of binding vesicle or plasma membranes via its
PH dornain. The C 2 domain is a ca2' and phospholipid binding motif that has been shown to act
as the ca2' sensor in other exocytotic proteins such as the synaptotagmins. It has been
previously demonstrated that CAPS-1 binds ca2' and triggers the release of vesicle contents
from rat adrenal medulla derived PC12 cells. We have now identified the protein motif. a C2
dornain, which most likely mediates this ca2' binding.
We analyzed the expression patterns of CAPS- 1 and CAPS2 and showed that they differ
significantly. CAPS-1 is restncted to neurdendocrine tissues while CAPS-2 is ubiquitously
expressed in al1 the tissues tested. While these results confirm the proposed role of CAPS-1 as
an essential component in the regulated secretion of neurotransmitter-containing vesicles. it
creates a paradox in defining the role of CAPS-2. Since regulated secretion of vesicles only
occurs in neuroendocrine and exocrine tissues, a role for CAPS-2 analogous to CAPS-1 in this
process is unlikely. However, CAPS-2 does contain a C2 domain that is thought to provide
CAPS-1 its ca2+ sensitivity for regulated secretion. Therefore, CAPS-2 might be involved in a
similar role to CAPS-1, but in a system that occurs ubiquitously. This system rnay be the
constitutive vesicle trafficking occurring in al1 mammalian cells. As such, CAPS-2 rnay act as
~ a " sensor in the vesicle-vesicle membrane fusion events of normal cellular traficking. Here,
an intemal ca2' signal appears to originate fiom the intenor o f the vesicles directly following
docking of their membranes, which differs from the requirement of an external signal in
regulated secretion. This hypothesis will need to be tested by in vitro systems that reproduce the
vesicle-vesicle interactions.
To date, no direct protein interactions have been detected fcr the CAPS family of
proteins. An interesting area of future research will be the identification of protein partners of
CAPS4 and CAPS-2. as well as the localization of this binding to the coiled-coi1 motifs or their
PH and C2 domains. One possible approach is the utilization of the yeast two-hybrid system to
screen brain and other cDNA Iibraries using the full-length or specific domains of CAPS-1 and
CAPS-2 as "baits". In addition to the search for CAPS4 and CAPS5 interacting proteins, we
will raise specific antibodies for each of the two proteins, which will allow us to identiw their
tissue and subcellular localization in brain and other tissues. These studies should provide a
better understanding of the function of the CAPS family of proteins as well as characterize the
functional specificity of each of its rnembers.
Chapter VI: Reference List
Adams. M.E., Butler, M.H., Dwyer, T.M., Peters, M.F., Murnane, A.A. and Froehner, S.C. 2 Fonns of mouse syntrophin, a 58-kd dystrophin-associated protein, differ in primary structure and tissue distribution. Neuron 1 1 :53 1-540, 1993.
Ahn, A.H. and Kunkel, L.M. Syntrophin binds to an alternatively spliced exon of dystrophin. Journal of Cell Biology I28:363-371, 1995.
Ahn, A.H., Yoshida, M., Anderson, M.S., et al. Cloning of human basic al , a distinct 59-kda dystrophin-associated protein encoded on chromosome 8q23-24. Proc.Natl.Acad.Sci.USA 9 1 :4446-4450, 1994.
Ailion, M., houe, T., Weaver, C.I., Holdcrafi, R. W. and Thomas, J.H. Neurosecretory control of aging in Caenorhabditis elegans. Proc.Natl.Acad.Sci.USA 96:7394-7397, 1999.
Andre. B. and Springael, J.Y. Wwp, a new amino acid motif present in single or multiple copies in various proteins including dystrophin and the sh3-binding yes-associated protein yap65. Biochem. 205: 1201- 1205. 1994.
Ann. K., Kowalchyk, J.A., Loyet, K.M. and Martin, T.F.J. Novei cd+-binding protein (Caps) Related to unc-3 1 required for ce+-activated exocytosis. Journal of Biological Chemistry 272: 19637-1 9MO, 1997.
Araki, E.. Nakamura, K., Nakao, K., et al. Targeted dismption of exon 52 in the mouse dystrophin gene induced muscle degeneration similar to that observed in duchenne rnuscular dystrophy. Biochem. 238:492497, 1997.
Austin, R.C., Howard, P.L., Dsouza, V.N., Klamut, H.J. and Ray, P.N. Cloning and characterization of altematively spliced isoforms of dp7 1. Hurn.Molec.Genet. 4: 1475- 1483, 1995.
Avery, J., Jahn, R. and Edwardson, J.M. Reconstitution of regulated exocytosis in cell-fiee systems: A critical appraisai [Review]. Annual Review of Physiology 6 1 :777-807, 1999.
Avery, L., Bargmann, C.I. and Howitz, H.R. The caenorhabditis-elegans unc-3 1 gene affects multiple nervous system-controlled functions. Genetics 134:454-464, 1993.
Bar. S., Barnea, E., Levy, Z., Neuman, S., Yaffe, D. and Nudel, U. A novel product of the Duchenne muscular dystrophy gene which greatly differs fiom the known isofoms in its structure and tissue distribution. Biochem-J. 272557-560, 1990.
Bardoni, A., Sironi. M., Felisari, Ci., Comi, G.P. and Bresolin, N. Absence of brain Dp140 isofonn and cognitive impainnent in Becker muscular dystrophy. Lancet 353397-898, 1999.
Barret, S., Beck, J., Bernier, R., Bisson, E., et al. An autosomal genomic screen for autism. American Journal of Medicai Genetics 88:609-6 15, 1999.
Baudoin, C., Goumans, M.J., Mummery, C. and Sonnenberg, A. Knockout and knockin of the beta 1 exon D deflne distinct roles for integrin splice variants in heart hnction and embryonic development. Genes & Deveiopment 12: 1202- 12 16, 1998.
Beckers, C.J.M. and BaIch W.E., Calcium and GTP: essential components in vesicular traficking between the endoplasmic reticulum and Golgi apparatus. Journal of Ce11 Biology 108: 1245- 1256, 1989.
Belkin, A.M. and Burridge, K. Association of aciculin with dystrophin and utrophin. Journal of Biological Chemistry 270:6328-6337, 1995.
Benvin, B., Floor, E. and Martin, T.F.J. CAPS (mammalian UNC-3 1) protein Iocalizes to membranes invoIved in dense-core vesicle exocytosis. Neuron 2 1 : 137- 145, 1998.
Bies, R.D., Phelps. S.F., Cortez, M.D., Roberts, R., Caskey, C.T. and Chamberlain, J.S. Human and murine dystrophin mRNA transcripts are differentially expressed during skeletal muscle, heart, and brain developrnent. Nucleic Acids Res. 20: 1725- 173 1, 1992.
Blake, D.J., Tinsley, I.M., Davies, K.E., Knight. A.E., Winder, S.J. and Kendrickjones. Coiled-coi1 regions in the carboxyterminal domains of dystrophin and related proteins - potentials for protein-protein interactions. Trends in Biochemical Sciences 20: 133- 135, 1995.
Bork, P. and Sudoi, M. The ww domain - a signalling site in dystrophin. Trends in Biochemical Sciences 1953 1 - 533, 1994.
Brenrnan, J.E., Chao, D.S., Gee, S.H., et al. Interaction of nitric oxide synthase with the postsynaptic density protein psd-95 and alpha- 1 -syntrophin mediated by pdz domains. Ce11 84:757-767, 1996.
Bulfie Id. G.. Si l ler, W.G., Wight, P.A.L. and Moore, K.J. X chromosome-linked muscular dystrophy (mdx) in the rnouse. Proc.Natl.Acad.Sci.USA 8 1 : 1 189- 1 i 92, 1984.
Burghes, A.H.M.. Logan, C., Hu, X., Belfall, B., Worton, R.G. and Ray, P.N. A cDNA clone from the DuchenneBecker muscular dystrophy gene. Nature 328:434-437, 1987.
Byers, T.J., Lidov, H.G.W. and Kunkel, L.M. An alternative dystrophin transcript specific to peripheral nerve. Nature Genet. 4:77-8 1, 1993.
Calakos, N. and Scheller, R.H. Synaptic vesicle biogenesis, docking, and fusion - a molecular description [Review]. Physiol. 76: 1-29, 1996.
Campanelli, J.T., Gayer, G.G. and Scheller, R.H. Alternative ma splicing that determines agin activity regulates binding to heparin and alphadystroglycan. Development 122: 1663- 1672, 1996.
Campanelli, J.T.. Roberds, S.L., Campbell, K.P. and Scheller, R.H. Role for dystrophin-associated giycoproteins and utrophin in agrin-induced achr clustering. Cell 77:663-674. 1994.
Castelio, A., Brocheriou, V., Chafey, P., Kahn, A. and Gilgenkrantz, H. Characterization of the dystrophin- syntrophin interaction using the two-hybrid system in yeast. FEBS Leners 3 83: 124- 128, 1996.
Ceccarini, M., Riuo, G., Rosa, G., Chelucci, C.. Macioce, P. and Petnicci, T.C. A splice variant of dp7l lacking the syntrophin binding site is expressed in early stages of human neural development. Dev. Developmental Brain Research. 103:77-82, 1997.
Chamberlain, J.S., Pearlman, J.A., Muzny, D.M., et al. Expression of the murine Duchenne muscular dystrophy gene in muscle and brain. Science 239: 14 l6- 14 18, 1988.
Chapman, E.R., Hanson, P.I., An, S. and Jahn, R. Ca2+ regulates the interaction between synaptotagmin and syntaxin 1. Journal of Biological Chemistry 270:23667-2367 1, 1995.
Chaprnan, V.M., Miller, D.R., Armstrong, D. and Caskey, C.T. Recovery of induced mutations for X chromosome- linked muscular dystrophy in mice. Proc.Natl.Acad.Sci.USA 86: 1292-1 296, 1989.
Chelly, J., Hamard, Ci., Koulakoff, A., Kaplan, J.C., Kahn, A. and Berwald Netter, Y. Dystrophin gene transcribed from different promoters in neuronal and glial cells. Nature 344:64-65, 1990.
Cho. Y.J. and Hitchcock-DeGregori, S.E. Relationship between alternatively spliced exons and functional domains in tropomyosin. Proc.Natl.Acad.Sci.USA 88: 10 153- 10 157. 1991.
Cibis, G.W., Fitzgerald, K.M., Harris, D.J., Rothberg, P.G. and Rupani, M. The effects of dystrophin gene mutations on the erg in mice and humans. Invest.Ophthalmol.& Vis.Sci 34:3646-3652, 1993.
Cockcroft, S. Mammalian phosphatidylinositol transfer proteins: emerging roles in signal transduction and vesicular trafic. Chem. 98:23-33, 1999.
Cos, G.A.. Phelps, S.F., Chapman, V.M. and Chamberlain, J.S. New mdx mutation disrupts expression of muscle and nonmuscle isoforms of dystrophin. Nature Genet. 4:87-93, 1993.
Cox. G.A., Sunada, Y., Campbell, K.P. and Chamberlain, J.S. Dp71 can restore the dystrophin associated glycoprotein complex in muscle but fails to prevent dystrophy. Nature Genet. 8:333-339, 1994.
Crosbie, R.H., Heighway, J., Venzke, D.P., Lee, J.C. and Campbell, K.P. Sarcospan, the 25-kDa transrnembrane component of the dystrophin-glycoprotein complex. Journal of Biological Chemistry 2723 122 1-3 1224, 1997.
Dsouza, V.N., Man, N.T., Morris, G.E., Karges, W., Pillers, D.A.M. and Ray, P.N. A novel dystrophin isoform is required for normal retinal electrophysiology. Hum.Molec.Genet. 4:837-842, 1995.
Duclos. F., Straub, V., Moore, S.A., et al. Progressive muscular dystrophy in alpha-sarcoglycan-deficient mice. Journal of Cel! Biology 142: 1461-1471, 1998.
Elhamdani, A., Martin, T.F.J., Kowalchyk, I.A. and Artalejo, C.R. Cd+-dependent activator protein for secretion is critical for the fusion of dense-core vesicles with the membrane in calf adrenal chromaftin. Journal o f Neuroscience l9:7375-7383, 1999.
Emery, A.E.H. Duchenne ~Muscular dystrophy. Second Edition. In: Oxford Monographs on Molecukar Genetics. no.24.. 0xford:Oxford University Press, 1993.
Ervasti, J.M. and Campbell, K.P. Membrane organization of the dystrophin-glycoprotein complex. Cell66: 1 12 1- 1131. 1991.
Ervasti, J.M. and Campbell, K.P. A role for the dystrophin-glycoprotein comples as a transmembrane linker between laminin and actin. Journal of Ce11 Biology l22:809-823, 1993.
Feener, C.A., Koenig, M. and Kunkel, L.M. Alternative splicing of human dystrophin mRNA generates isoforms at the carboxy terminus. Nature 338509-5 1 1, 1989.
Ferns, M., Hoch, W., Campanelli, J.T., Rupp, F., HaIl, Z.W. and Scheller, R.H. RNA splicing regulates agrin- mediated acetylcholine receptor clustering activity on cultured myotubes. Neuron 8: 1079- 1086, 1992.
Fields. S. and Song, O. A novel genetic system to detect protein-protein interactions. Nature 340245-246, 1989.
Fis hman, G . and Soko 1, S. Eiectrophysioiogic Tesring in Disorders of the Retina, Optic Nerve and fisual Pathway, San Francisco: American Academy of Ophthalmology, 1990. pp. 1 - 164.
Gee, S.H., Madhavan, R., Levinson, S.R., Caldwell, J.H., Sealock, R. and Froehner, S.C. Interaction of muscle and brain sodium channels with multiple members of the syntrophin farnily of dystrophin-associated proteins. Journal of Neuroscience 18: 128-1 37, 1998.
Gesemann, M., Cavalli, V., Denzer, A.J., et al. Alternative splicing of agrin alters its binding to heparin, dystroglycan, and the putative agrin receptor. Neuron 16:755-767, 1996.
Gibson, T.J., Hyvonen, M., Musacchio, A., Saraste, M. and Birney, E. Ph domain - the first anniversary. Trends in Biochemical Sciences 19:349-353, 1994.
Gorecki, D., Monaco, A., Deny, J., Walker, A., Barnard, E. and Barnard, P. Expression of four alternative dystrophin transcripts in brain regions regulated by different promoters. Hurn.Molec.Genet. 1505-5 10, 1992.
Gorecki, D.C. and Barnard, E.A. Specific expression of g-dystrophin (Dp7 1) In the brain. Neuroreport 62393-896. 1995.
Greenberg, D.S., Sunada, Y., Campbell, K.P., Yaffe, D. and Nudel, U. Exogenous dp71 restores the levels of dystrophin associated proteins but does not alleviate muscle darnage in mdx mice. Nature Genet. 8:340- 344, 1994.
Hance, J.E., Fu, S.Y., Watkins, S C , Beggs, A.H. and Michaiak, M. alpha-actinin-2 is a new cornponent of the dystrophin-glycoprotein cornplex. Archives of Biochem isuy & Biophysics 365:2 1 6-222, 1999.
Hay. I.C., Fisette, P.L., Jenkins, G.H., et ai. Atp-dependent inositide phosphorylation required for CS+-activated secretion. Nature 374: 173- 177, 1995.
Hemmings, L., Kuhlman, P.A. and Critchley, D.R. Analysis of the actin-binding dornain of alpha-actinin by mutagenesis and demonstration that dystrophin contains a functionally homologous dornain. J.Cell Biol. 1 1 6: I 369- 1 3 80, 1992.
Howard, P.L., Dally, GY., Ditta, S.D., et al. Dystrophin isoforms Dp7 1 and Dp427 have distinct roles in myogenic cells. Muscle & Nerve 22: 16-27, 1999.
Howard, P.L., Dally, G.Y., Wong, M.H., et al. Localization of dystrophin isoform Dp7 1 to the inner lirniting membrane of the retina suggests a unique fiinctional contribution of Dp7 1 in the retina. Hum.Molec.Genet. 7:1385-1391, 1998.
Hugnot, I.P., Gilgenkrantz, H., Chafey, P., et al. Expression of the dystrophin gene in cultured fibroblasts. Biochem. 19269-74, 1993.
Hugnot, I.P., Gilgenkrantz, H., Vincent, N., et al. Distal transcript of the dystrophin gene initiated tiorn an alternative first exon and encoding a 75 kDa protein wideIy distributed in nonmuscle tissues. Proc.Natl.Acad.Sci.USA 8917506-75 10, 1992.
Ibraghirnov-Beskrovnaya, O., Ervasti, J.M., Leveille, C.J., Slaughter, C.A. and Campbell, K.P. Prirnary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 355:696-702, 1 992.
Ibraghimovbeskrovnaya, O., Milatovich, A., Ozcelik, T., et al. Human dystroglycan - skeletal muscle cdna, genomic structure, origin of tissue specific isoforms and chromosomal localization. Hurn.Molec.Genet. 2: 165 1 - 1657. 1993.
Irn, W.B., Phelps, S.F., Copen, E.H., Adams, E.G., Slightom, J.L. and Chamberlain, J.S. Differential expression of dystrophin isoforms in strains of mdx mice with different mutations. Hurn.Molec.Genet. 5: 1 149- 1 153, 1996.
Jarrett, H.W. and Foster, J.L. Altemate binding of actin and calmodulin to multiple sites on dystrophin. Journal of Biological Chemistry 2705578-5586, 1995.
Kameya, S., Araki, E., Katsuki, M., et al. Dp260 dismpted mice revealed prolonged implicit time of the b-wave in erg and loss of accumulation of beta-dystroglycan in the outer plexiforni layer of the retina. Hum.Molec.Genet. 6:2 195-2203, 1997.
Kameya, S., Miyagoe, Y., Nonaka, I., et al. alpha 1-syntrophin gene disruption results in the absence of neuronal- type nitric-oxide synthase at the sarcolemma but does not induce muscle degeneration. Journal of Biological Chemistry 274:2 l93-2îOû, 5999.
Klamut, H. J., Gangopadhyay, S.B., Worton, R.G. and Ray, P.N. Molecular and fbnctional analysis of the muscle- specific promoter region of the Duchenne muscular dystrophy gene. Mol-Cell Biol. 10: 193-205, IWO.
Koenig, M., H o h a n , E.P., Benelson, CJ., Monaco, A.P., Feener, C. and Kunkel, L.M. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. CeIl 50509-5 17, 1987.
Koenig, M. and Kunkel, L.M. Detailed analysis of the repeat domain of dystrophin reveals four potential hinge segments that may confer flexibility. J.BioI.Chem. 265:4560-4566, 1990.
Koenig, M.. Monaco, A.P. and Kunkel, L.M. The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. CeIl 5 3 2 19-226, 1988.
Lederfein, D., Levy, Z., Augier, N., et al. A 7 1 -kilodaIton protein is a major product of the Duchenne muscular dystrophy gene in brain and other nonmuscle tissues. Proc.Natl.Acad.Sci. USA 895346-5350, 1992.
Lederfein. D., Yaffe, D. and Nudel, U. A housekeeping type promoter, located in the 3' region of the duchenne muscular dystrophy gene, controls the expression of dp7 1, a major product of the gene. Hum.Molec.Genet. 2: 1 883- 1 888, 1993.
Lidov, H.G.W. Dystrophin in the nervous system [Review]. Brain Pathology 6:63-77, 1996.
Lidov, H.G.W. and Kunkel, L.M. Dp140 - alternatively spliced isoforms in brain and kidney. Genomics 45: 132- 139, 1997.
Lidov, H.G.W., Selig, S. and Kunkel, L.M. DpI40 - a novel 140 kda cns transcript fiom the dystrophin locus. Hurn.Molec.Genet. 4:329-335, 1995.
Lim. L.E., Duclos, F., Broux, O., et al. Beta-sarcoglycan - characterization and role in limb-girdle muscular dystrophy linked to 4q 12. Nature Genet. 1 1257-265, 1995.
Livingstone, D. Studies on the Unc-3 1 gene of Caenorhabditis elegans. Ph.D Thesis, Cambridge University, U.K. 1991.
Loyet, KM., Kowalchyk, J.A., Chaudhary, A., et al. Specific binding of phosphatidylinositol4,5-bisphosphate to calcium-dependent activator protein for secretion (CAPS), a potentiai phosphoinositide effector protein for regulated exocytosis. Journal of B iological C hemistry 273:8337-8343, 1 998.
Martin, T.F.J. and Kowalchyk, J.A. Docked secretory vesicies undergo cd+-activated exocytosis in a cefl-fiee system. Journal of Biological Chemistry 272: 14447- 14453, 1997.
Mayer, A. Intracellular membrane fusion: SN ARES only? CUIT. 1 1 :447-452, 1999.
Michalak, M., Fu, S.Y., Milner, R.E., Busaan, J.L. and Hance, J.E. Phosphorylation of the carboxyl-terminal region of dystrophin. Biochemistry & Cell Biology-Biochimie & Biologie Cellulaire 74:43 1-437, 1996.
Mikoshiba, K., Fukuda, M., Ibata, K., Kabayama, H. and Minitani, A. Role of synaptotagmin, a Ca2+ and inositol polyphosphate binding protein, in neurotransmitter release and neurite outgrowth. Chem. 9859-67. 1999.
Miller, KG., Alfonso, A., Nguyen, M., Crowell, J.A., Johnson, C.D. and Rand, J.B. A genetic selection for caenorhabditis elegans synaptic transmission mutants. Proc.Natl.Acad.Sci.USA 93: 12593- 12598, 1996.
Milner, R.E., Busaan, I.L., Holmes, C.F.B., Wang, J.H. and Michalak, M. Phosphorylation of dystrophin - the carboxyl-terminal region of dystrophin is a substrate for invitro phosphorylation by p34(Cdc2) Protein kinase. Journal of Biological Chemistry 268:2 190 1-2 1905, 1993.
Nigro, V., Moreira, E.D., Piluso, Ci.. et al. Autosomal recessive limb-girdle muscular dystrophy, Igmd2C is caused by a mutation in the delta-sarcoglycan gene. Nature Genet. 14: 195- 198, 1996.
Noguchi, S., McNalIy, E.M., Benothmane, K., et al. Mutations in the dystrophin-associated protein gamma- sarcoglycan in chromosome 13 muscular dystrophy. Science 2 7 0 3 19-822, 1995.
Nudel. U., Zuk, D., Einat, P.. et al. Duchenne muscular dystrophy gene product is not identical in muscle and brain. Nature 337:76-78, 1989.
Ozawa. E.. Yoshida, M., Suzuki, A., Mizuno, Y., Hagiwara, Y. and Noguchi, S. Dystrophin-associated proteins in muscular dystrophy [Review]. Hum.Mo1ec.Genet. 4: 17 1 f -1 7 16, 1995.
Pearlman, J.A., Powaser, P.A., Elledge, S.J. and Caskey, C.T. Troponin t is capable of binding dystrophin via a leucine zipper. FEBS Letters 354: 183- 186, 1994.
f eters, C. and Mayer, A. Ca2+/calmodulin signals the completion docking and triggers a late step of vacuole fusion. Nature 396575-580, 1998.
Peters, M.F., O'Brien, K.F., Sadoulet-Puccio, H.M., Kunkel, L.M., Adams, M.E. and Froehner, S.C. beta- dystrobrevin, a new member of the dystrophin family - Identification, cloning, and protein associations. Journal of Biological Chemistry 2723 156 f -3 1569, 1997.
Piliers, D.A.H., Fitzgerald, K.M., Duncan, N.M., et al. Duchennemecker muscular dystrophy: correlation of phenotype by electroretinography with sites of dystrophin mutations. Hum. 105:2-9, 1999.
Pillers, D.A.M., Bulman, D.E.. Weleber, R.G., et al. Dystrophin expression in the human retina is required for normal function as defined by electroretinography. Nature Genet. 4:82-86, 1993.
Pillers, D.A.M., Weleber, R.G., Green, DG., et al. Effects of dystrophin isoforms on signal transduction through neural retina: Genotype-phenotype analysis of Duchenne muscular dystrophy mouse mutants. Molecular Genetics & Metabolism 66: 100- 1 10, 1999b.
PiIlers, D.A.M., Weleber, R.G., Woodward, W.R., Green, DG.. Chapman, V.M. and Ray, P.N. Mdx(Cv3) Mouse is a mode1 for electroretinography of duchenne becker muscular dystrophy. Invest.OphthalmoI.& Vis.Sci 36:462-466, 1995a.
Ralston, E., Beushausen, S. and Ploug, T. Expression of the synaptic vesicle proteins vamps/synaptobrevins 1 and 2 in non-neural tissues. Journal of Biological Chemistry 269: 15403- 15406, 1994.
Rapaport, D., Lederfein, D., den Dumen, J.T., et al. Characterization and ceIl type distribution of a novel, major transcript of the Duchenne muscular dystrophy gene. Differentiation 49: 187- 193, 1992.
Rexach M.F. and Schekman R.W. Distinct biochemical requirements for the budding, targeting, and fusion or ER- derived transport vesicles. Joumal of Ceil Biology 1 l4:2 19-229, 199 1.
Reiser. P.J., Greaser, M.L. and Moss, R.L. Developmental changes in troponinT isoform expression and tension production in chicken single skeletal muscle fibres. Journal of Physiology 573-588, 1992.
Roberds, S.L., Leturcq, F., Allamand, V., et al. Missense mutations in the adhalin gene Iinked to autosornal recessive muscular dystrophy. Cell 78:625-633, 1994.
Roberts, R.G. and Bobrow, M. Dystrophins in vertebrates and invertebrates. Hum.Molec.Genet. 7:589-595. 1998.
Roberts, R.G., Coffey, A.J., Bobrow, M. and Bentley, D.R. Exon structure of the human dystrophin gene. Genomics l6:536-538, 1993.
Rothman, J.E. Mechanism of intracellular protein transport [Review]. Nature 37255-63, 1994.
Sadouletpuccio, H.M., Khurana, T.S., Cohen, J.B. and Kunkel, L.M. Cloning and characterization of the hurnan homologue of a dystrophin related phosphoprotein found at the torpedo electric organ post-synaptic membrane. Hurn.Molec.Genet. 5:489-496, 1996.
Sadouletpuccio, H.M.. Rajala, M. and Kunkel, L.M. Dystrobrevin and dystrophin - an interaction through coiled-coi1 motifs. Proc.Nat1.Acad.Sci.USA 94: 124 13- 124 18, 1997.
Sarig. R.. Mezger-Lallemand, V., Gitelman, I., et al. Targeted inactivation of Dp7 1, the major non-muscle product of the DMD gene: differential activity of the Dp7 1 promoter during development. Hum.Molec.Genet. 8: 1 - IO. 1999.
Schiavo, G., Gu, Q.M., Prestwich, G.D., Sollner, T.H. and Rothman, I.E. Calcium-dependent switching of the specificity of phosphoinositide binding to synaptotagmin. Proc.Nat1.Acad.Sci.USA 93: 1 3327- 13332. 1996.
Schmitz, F. and Drenckhahn, D. Localization of dystrophin and beta-dystroglycan in bovine retinal photoreceptor processes extending into the postsynaptic dendritic complex. Histochemistry & Cell Biology 108:249-255, 1997.
Sealock. R., Butler, M.H., Kramarcy, N.R., et al. Localization of dystrophin relative to acetylcholine receptor dornains in elecaic tissue and adult and cultured skeletal muscle. J.Cel1 Biol. 1 13: 1 133- 1 144, 199 1.
Shalaby, F., Rossant, J., Yamaguchi, T.P., et al. Failure of blood-island formation and vasculogenesis in flk- 1 - deficient mice. Nature 376:62-66. 1995.
Sicinski, P., Geng, Y., Ryder Cook, A.S., Barnard, E.A., Darlison, M.G. and Barnard. P.J. The moIecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 244: 1578- i 580, 1989.
Sigesmund, D.A., Weleber, R.G., Pillers, D.A.M., et al. Characterimion of the ocular phenotype of duchenne and becker muscular dystrophy. Ophthalmol. 10 1 :856-865, 1994.
Sudhof, T.C. The synaptic vesicle cycle - a cascade of protein-protein interactions [Review]. Nature 375:645-653, 1995.
Sudhof, T.C. and Rizo, J. Synaptotagmins - c-2-domain proteins that regulate membrane trafic [Review]. Neuron 1 7:379-388, 1996.
Suzuki, A., Yoshida, M. and Ozawa, E. Mammalian alpha- 1 - and beta-1-syntrophin bind to the alternative spiice- prone region of the dystrophin cooh terminus. Journal of Cell Biology 128:373-38 1, 1995.
Tandon, A., Bannykh, S., Kowalchyk, J.A., Bane rjee, A., Martin, T.F.J. and Balch, W.E. Differential regulation of exocytosis by calcium and CAPS in semi-intact synaptosornes. Neuron 2 1 : 147- 154, 1998.
Torres, L.F. and Duchen, L.W. The mutant mdx: inherited myopathy in the mouse. Morphological studies of nerves. muscles and end-plates. Brain 1 10:269-299, 1987.
Walent, J.H., Porter, B. and Martin, T.F.J. A novel 145 kd brain cytosolic protein reconstitutes calcium-regulated secretion in permeable neuroendocrine cells. Ce1 l70:765-775, 1992.
Wertz, K. and Fuchtbauer, €.M. Dmd(mdx-beta geo): A new allele for the mouse dystrophin gene. Developrnental Dynamics 2 I2:229-24 1, 1998.
Williamson, R.A., Henry, MD., Daniels, K.J., et al. Dystroglycan is essential for early embryonic development - disruption of reicherts-membrane in dagl -nuIl mice. Hum.Molec.Genet. 6:83 1-841, 1997.