Fig. S1. Hmx1 is expressed in craniofacial mesenchyme but not in the surface ectoderm. E14.5 control rat embryos were sectioned as described in Fig. 5. Ap2a is a transcription factor localized to the surface ectoderm in the region overlying the Hmx1-expressing CM (arrows), where it is not co-expressed with Hmx1. Ap2a expression is also noted in the hindbrain and in some cells of the trigeminal ganglion. (A) Expression of Hmx1 and Ap2a at the level of the retina. (B) Expression of Hmx1 and Ap2a at the level of the mandibular lobe of the trigeminal ganglion. Hb, hindbrain; L, lens; mnTG, mandibular lobe, trigeminal ganglion; R, retina. Scale bars: low power views, 200 mm; high power views, 100 mm.

Fig. S2. Haplotypes of key recombinants derived from a (BN/SsNSlc x KFRS4/Kyo)F1 x KFRS4/Kyo backcross. Fine mapping of the dmbo critical region was achieved with SNPs located in the Ablim, Sh3tc1, Acox3, Cpz and Hmx1 genes, and the markers D14Rat59 and D14Rat37. Haplotypes of two recombinants (#484 and #669) revealed recombination between Ablim and Sh3tc1 and between Cpz and Hmx1, respectively, defining the minimal dmbo critical region. Five recombination events were detected between the Hmx1 SNP and D14Rat37 (#383, 531, 394, 551, 708).

Fig. S3. Dumbo-eared rats with diverse genetic backgrounds show deletion of the Hmx1 distal conserved region. Dumbo-eared rats (SD1–4) were provided by an enthusiast breeder in San Diego California. The four animals shown are not known to be related, and have diverse genetic backgrounds, but are derived from dumbo rats, which have been recently distributed among breeders in the United States and intensively intercrossed with other strains. DNA samples were obtained by ear punch biopsy and examined for the 5,777-bp deletion identified in the KFRS4/Kyoto strain of dumbo rats using PCR primers immediately flanking the deleted region (supplementary material Table S2). All four San Diego animals exhibited the same deletion as KFRS4/Kyoto. The control strain PVG would hypothetically produce a ~6-kb product with the primers used but does not exhibit a band under the short PCR cycle times employed.

Chr14 position

gene symbol BN

KFRS4/Kyo location effect Ensembl database

80580613 Ablim2 C T exon3 silent novel 80584641 Ablim2 A G exon2 silent novel 80584652 Ablim2 G A exon2 H42Y novel 80673456 Sh3tc1 G A exon11 silent novel 80776797 Acox3 A G exon12 silent novel 80786958 Acox3 T G exon8 N287H novel 80795949 Acox3 G A exon5 silent rs64660639 SD

80815968 RGD1308380 T A exon1 silent rs64570676 SD

80857500 Cpz T C exon1 S23P rs64860291 SD 80865283 Cpz A G exon3 silent rs65644271 SD 80865295 Cpz G A exon3 silent rs65498549 SD 80865436 Cpz A G exon3 silent rs66058734 SD 80867659 Cpz C T exon4 silent rs66231841 SD 80867710 Cpz C T exon4 silent rs66082532 SD 80870248 Cpz C T exon5 silent rs66202575 SD 80870290 Cpz G A exon5 silent rs65637625 SD 80996158 Hmx1 C T exon2 silent novel 81316489 Dok7 G A exon6 silent novel 81348435 Hgfac T C exon14 silent novel 81349564 Hgfac T C exon12 silent novel

81351703 Hgfac A G exon9 silent ENSRNOSNP2854513

81352883 Hgfac A G exon5 silent novel 81353861 Hgfac C G exon3 E100D novel 81354098 Hgfac C T exon2 silent novel 81365035 Rgs12 T C exon16 silent novel 81365043 Rgs12 G A exon16 P1234S novel 81367040 Rgs12 C G exon14 E1114D novel 81367045 Rgs12 T C exon14 T1113A novel 81369834 Rgs12 C G exon11 silent novel 81370239 Rgs12 G A exon10 silent novel 81376873 Rgs12 C T exon4 V709I novel

Supplementary Table 1. Exonic single nucleotide polymorphisms detected by resequencing of the dmbo critical region. Resequencing was performed on the

interval of chromosome 14 from 80,500,000-81,500,000. SNPs were identified based

on comparison with the Brown Norway rat reference sequence. The dmbo allele was

then fine-mapped to the region from 80584652 to 80996158 between

Ablim2_SNP(H42Y) and Hmx1_SNP(L251L), as shown in bold.

   Product  size  (KB)  

Primer  set   Sequence   Control   Dumbo  

dumb-10k F gtttttggcagaatcccccttttaaattac R gacaaaacgtagtgagccaccctct 10   10  

dumb-20k F tatcctagttgtgtgcaccgaaaaataatc R gcgctgaatggttgattgttactaaattct 10   10  

dumb-30k F gaattttgttccaatcagcactcctagttt R ctagacatgagcatcaggggtaaaagatag 10   10  

dumb-40k F gttgtgtctgggcttttgagtaagttctct R gctccactttcttagtcccacttcatagat 10   10  

dumb-50k F cagaggacattagtataggagtctggccttt R gtgttgaggtcaaagctctgcaaaattaac 10   10  

dumb-60k F gaaaccaggcttagacatatccttcagcta R ggtggcattaccataagttgaactaaacaa 10   10  

dumb-70k F tatctgctcgctgaaaggattagattgtag R ctcactgcctgaatacttgcttgattg 10   10  

dumb-80k F ctcctgctgttctgttctctaaacattctg R aacaagtttcaagtttaagctgcaccacta 10   10  

dumb 82k-90k

F gtgtcctttgtgcccaagtt R cacagcccaacacttttgaa 8   2  

dumb-90k F gttgttagcacttatgggctacctgttacc R aacacttttgaataaaatgtctggcagga 10   4  

breakpoint F cctgatggaaatttggcagt R acgcctcagatttcaagagc

6  (None)   280bp  

dumb-100k F actttatagtcccacaccactttctgtcct R ctctctggatgcactgaatgtctcttactg 10   10  

dumb-110k F taagttagttccttgtctgtccctgctcac R aatgagagttgcaccttcttctttctgc 10   10  

dumb-120k F gaagtgaactgcagaagtgggaaatc R aattgtttctattctatttgaagcccctga 10   10  

Supplementary Table 2. Long-PCR resequencing of dumbo critical region. Long PCR screening of dumbo critical region. Primer sets 10k-120k were used to screen the dmbo critical region, and primer set 82k-90k was used to further refine the location of the dmbo deletion. The breakpoint genotyping oligonucleotide set flank the dumbo deletion region. They give a 280bp product in the presence of the dumbo deletion and are convenient for genotyping the deletion allele. In wild-type animals the breakpoint oligonucleotides give a 5.8Kb product under long PCR conditions, but no product with taq polymerase and one minute elongation time.