five gonadotrophin-releasing hormone receptors in a teleost

8/14/2019 Five Gonadotrophin-releasing Hormone Receptors in a Teleost

1/13

Five gonadotrophin-releasing hormone receptors in a teleostfish: isolation, tissue distribution and phylogeneticrelationships

Natalia Moncaut, Gustavo Somoza1, Deborah M Power and Adelino V M CanrioCentre of Marine Sciences, University of Algarve, Campus de Gambelas, 8005-139 Faro, Portugal

1Laboratorio de Ictiofisiologia y Acuicultura, Instituto de Investigaciones Biotecnologicas-Instituto Tecnologico de Chascomus (IIB-INTECH), Camino de Circunvalacion LagunaKm 6 (B7130IWA), Chascomus, Provincia de Buenos Aires, Argentina.

(Requests for offprints should be addressed to A V M Canrio; Email: [email protected] )

Abstract

Gonadotrophin-releasing hormone (GnRH) is the main neurohormone controlling gonadotrophin release in all

vertebrates, and in teleost fish also of growth hormone and possibly of other adenohypophyseal hormones. Over 20

GnRHs have been identified in vertebrates and protochoordates and shown to bind cognate G-protein couple

receptors (GnRHR). We have searched the puffer fish, Fugu rubripes, genome sequencing database, identified five

GnRHR genes and proceeded to isolate the corresponding complementary DNAs in European sea bass, Dicentrachus

labrax. Phylogenetic analysis clusters the European sea bass, puffer fish and all other vertebrate receptors into twomain lineages corresponding to the mammalian type I and II receptors. The fish receptors could be subdivided in two

GnRHR1 (A and B) and three GnRHR2 (A, B and C) subtypes. Amino acid sequence identity within receptor subtypes

varies between 70 and 90% but only 5055% among the two main lineages in fish. All European sea bass receptor

mRNAs are expressed in the anterior and mid brain, and all but one are expressed in the pituitary gland. There is

differential expression of the receptors in peripheral tissues related to reproduction (gonads), chemical senses (eye

and olfactory epithelium) and osmoregulation (kidney and gill). This is the first report showing five GnRH receptors in

a vertebrate species and the gene expression patterns support the concept that GnRH and GnRHRs play highly

diverse functional roles in the regulation of cellular functions, besides the classical role of pituitary function regulation.

Journal of Molecular Endocrinology(2005) 34, 767779

Introduction

Gonadotrophin-releasing hormone (GnRH) is a deca-peptide synthesized in the preoptic-hypothalamic areaand acts on the pituitary gland where it stimulates thesynthesis and release of gonadotrophic hormones in all

vertebrates (Millar et al. 2004), and growth hormone andprolactin in at least some fish species (Marchant et al.1989, Weber et al. 1997). In addition to the preoptic-hypothalamic GnRH, one or two additional GnRHforms are synthesized in extra preoptic-hypothalamicareas within the central nervous system (Lethimonieret al. 2004, Millar et al. 2004). The number of knownGnRH family members has now reached a total of 24,

usually named after the species where they were firstisolated (Adams et al. 2003, Millar et al. 2004, Somozaet al. 2002).

GnRHs exert their actions through GnRH receptors(GnRHRs) which are members of the rhodopsin-likeG-protein coupled receptor (GPCR) family. Thesereceptors show three main functional domains: 1) aN-terminal extracellular domain; 2) seven -helicaltransmembrane (TMs) domains connected by hydro-

philic intra- and extracellular loops and 3) a C-terminal

cytoplasmic domain. The extracellular domains andsuperficial regions of the TMs are usually involved inbinding. The TMs are believed to be involved inreceptor configuration. The C-terminal mediates effec-tors binding, propagation of signalling events, desensi-tization and internalization (McArdle et al., 2002, Millaret al., 2004). During the last decade several cDNAs forGnRHR have been cloned, often more than one in thesame species, e.g. three in bullfrog, Rana catesbiana(Wanget al. 2001) and medaka, Oryzias latipes(Okubo et al. 2001,2003) and two in primates (Millar et al. 2001, Neill et al.2001), goldfish, Carassius auratus (Illing et al. 1999) and

African catfish, Claria gariepinus (Bogerd et al. 2002). As

a result GnRH receptors have recently been groupedin three main subtypes designated GnRHR1, GnRHR2and GnRHR3, the latter only found in teleost fishes andamphibians (Millar et al. 2004). In addition, duplicatedgenes within these subtypes have been also describedin teleosts, e.g. Oncorhynchus masou (Jodo et al. 2003).The presence of multiple GnRH ligands for severalreceptors suggests complex regulatory mechanisms andraises the question of whether new functions, more

7

Journal of Molecular Endocrinology (2005) 34, 76777909525041/05/034767 2005 Society for Endocrinology Printed in Great Britain

DOI: 10.1677/jme.1.01757Online version via http://www.endocrinology-journals.org
http://www.endocrinology-journals.org/http://www.endocrinology-journals.org/http://www.endocrinology-journals.org/


2/13

specialization, or both, have been acquired by theduplicated genes.

Data mining of model fish genome sequences hasfacilitated the identification of novel genes and in thispaper we have used the GnRHRs DNA sequencesidentified in the Fugu rubripes genome database to isolatethe corresponding cDNAs in the European sea bass,

Dicentrarchus labrax. Like most perciform species, theEuropean sea bass synthesizes three GnRH ligands:sGnRH, sbGnRH and cGnRHII (Gonzlez-Martnezet al. 2001, 2002, Zmora et al., 2002). However, untilnow only a single GnRHR cDNA from European seabass has been cloned and its expression profile in thebrain and pituitary suggests it may mediate gonado-trophin release (Gonzlez-Martnez et al. 2004). Inthe current study we report the cloning of four addi-tional European sea bass cDNAs encoding GnRHRs(dlGnRHR), examine their tissue distribution andreassess their classification based on the phylogeneticanalysis of available sequences.

Materials and methods

Animals and tissue sampling

Sexually mature males and females from Europeansea bass were obtained from TIMAR Cultura de

guas (Livramento, Portugal) and maintained at theRamalhete Experimental Station (University of Algarve,Faro, Portugal) prior to sampling, in through-flowseawater tanks at 17 2 C under natural photoperiod.

Animal care was in accordance with the ethicalguidelines of the Animal Behaviour Society (ASAB 2003)

and national legislation. Fish were killed with anoverdose of 2-phenoxyethanol (1:10000, SigmaAldrich,Madrid, Spain), tissues were dissected and immediatelyfrozen in liquid nitrogen and stored at -80 C until used.

In silico analysis and cloning of dlGnRHRs

The puffer fish (Fugu rubripes) Fugu Consortium GenomeDatabase (http://fugu.hgmp.mrc.ac.uk) was interro-gated with the amino acid sequences of available fishGnRH receptors via the tBLASTn programme using theBlosum62 matrix and an expected value of 10 (Altschulet al. 1997). Scaffolds identified to contain GnRHR

sequences were run on the HGMP Nix interface (GWilliams, P Woollard & P Hingamp, unpublished data;http://www.hgmp.mrc.ac.uk/NIX/) providing, as out-put, putative gene organization, coding sequence, aminoacid translation and neighbouring genes. Five differentloci were found with putative open reading frames(ORFs) for GnRHR located in scaffolds FS2243, FS553,FS686, FS3910 and FS1435. The putative codingsequences of Fugu genes together with other availablefish sequences were used to design five primer pairs to

amplify the corresponding cDNAs in European sea bass(Table 1) and the amino acid translations were used inthe phylogenetic analysis.

Total RNA was extracted from brain and pituitary ofEuropean sea bass using TRI Reagent (Sigma-Aldrich)according to the manufacturers protocol. Five micro-grams of total RNA was retro transcribed using Moloney

murine leukaemia virus (MMLV-RT; Invitrogen,Carlsbad, CA, USA) and oligo(dT)1218 in a final volumeof 30 l for 15 h at 37 C. Each PCR was carried outusing 12l cDNA, 25 U Taq polymerase (Promega,Biocontech, Lisbon, Portugal) and 1 pmol/l of eachdifferent pair of primers. Thermocycling parameterswere the same for all primer pairs, except for theannealing temperatures: 4 min at 94 C, 35 cycles of1 min at 94 C, 1 min 5056 C and 1 min at 72 C,with 5 min extension at 72 C. PCR products were

visualized in 1% agarose gel stained with ethidiumbromide and bands of expected size purified using GFXPCR and Gel Band Purification Kit (Amersham

Biosciences, Buckinghamshire, UK) and cloned usingthe pGEM-T easy Vector Systems (Promega). Thecloned inserts were used to transform E. coli XL1-Blueand positive colonies were isolated and plasmid DNAextracted using the alkaline lyses method and sequenced(Sistemas Genmicos, Valencia, Spain; Macrogen,Seoul, South Korea).

Construction and screening of cDNA libraries

cDNA libraries from European sea bass brain (pituitaryincluded) and testis were constructed using UNI-ZAPXR Vector (Strategene, Amsterdam, The Netherlands)

with reverse-transcribed cDNA obtained from 45 gof poly(A)+ RNA and using UNI-ZAP XR cDNAsynthesis kit (Stratagene) according to the suppliersinstructions. Library screening was carried out underhigh stringency conditions using the five specificdlGnRHR probes obtained by PCR amplification.Duplicate membranes (Hybond NX- Amersham Bio-sciences, Buckinghamshire, UK) were hybridized witheach of the [32P]dCTP-labelled dlGnRHR probes(Rediprime Random Labelling kit, Amersham Bio-sciences) overnight at 56 C in a solution containingEDTA 1 mM, SDS 7% and sodium phosphate 025 M(ChurchGilbert hybridization solution; Church &

Gilbert 1984). Stringency washes were carried out at56 C for 5 minutes with 2SSC, 1SSC (150 mMNaCl, 15 mM sodium citrate, pH 70) and 01SSCcontaining 01% SDS.

Tissue distribution of GnRHRs by RT-PCR andSouthern blotting

The distribution pattern of dlGnRHRs expression wasinvestigated by RT-PCR on anterior brain (olfactory

N MONCAUT and others Novel fish GnRH receptors768

www.endocrinology-journals.orgJournal of Molecular Endocrinology (2005) 34, 767779
http://www.endocrinology-journals.org/http://www.endocrinology-journals.org/


3/13

Table1Primerpairsusedfor

initialPCR

cloningofdlGnRHRsandforRT-P

CR

Initial

cloning

Product

size

RT-PCR

Product

size

Gene

dlGnRHR-1

A

dlgnrhR-F:58

CGTGATGCCTGTGGATGC38

342

dlgnrhR-F

342

dlgnrhR-R:58

TTGTAGGCCGTTTC(G/C)T(G/C)

CCA38

dlgnrhR-R

dlGnRHR-1

B

1gnrhF

2:58

CCGCTGGCAGGAAACTGT38

182

1gnrh

F2

182

1gnrhR

2:58

TCCGAGCCTTTGGGATGA38

1gnrh

R2

dlGnRHR-2

A

dlgnrhR-F:58

CGTGATGCCTGTGGATGCC38

411

dlgnrhR-F

586

dlgnrhR-R:58

TTGTAGGCCGTTTC(G/C)T(G/C)

CCA38

3gnrh

R-R:58

CCACAGTCCCAGCAGGTAG38

dlGnRHR-2

B

4gnrhR

-F2

:58

CCCGAGAACTTCACCCAG38

406

4gnrh

R-F2

490

3gnrhR

-R:58

CCACAGTCCCAGCAGGTAG38

sqR1Brev:58

TCTAATTCAGTCCGCGTGTTTG

38

dlGnRHR-2

C

2gnrhR

-F:58

TCACGGTACAGTGGTTGGC38

353

R1Cs

qfw3:58

GCTGTGCTGTGGGCAGCCAATG38

587

2gnrhR

-R:58

TGAGCGGCAGAAGGAAGAG38

R1Cs

qrev:58

TTGAGCAACGGAGATGTAG38

Novel fish GnRH receptors N MONCAUT and others 7

www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 767779


4/13

bulb and telencephalon), middle brain (optic tectum anddiencephalons), posterior brain (cerebellum, medullaoblongata and part of the spinal cord), pituitary gland,eye, olfactory epithelium, gonads, kidney, head kidney,spleen, liver, heart, midgut, gills and muscle. cDNA(40 l) was prepared from 5 g total RNA extracted withTRI Reagent and reverse transcribed with MMLV-RT

and random hexamers. PCR was performed on 1 l ofcDNA with specific primers (Table 1) designed to spantwo exonintron boundaries. Only single RTP-PCRproducts of the size of the expected cDNA wereobtained, indicating the absence of genomic DNAcontamination. Thermocycling conditions were opti-mized for each primer to be on the linear region ofamplification and were 4 min at 94 C, 2730 cycles of45 sec at 94 C, 45 sec at 5659 C and 45 sec extensionat 72 C, with a final 5 min extension at 72 C. A 540 bpfragment of European sea bass 18S was amplified usingoligonucleotides 18S-fw 5TCA AGA ACG AAA GTCGGA GG 3 and 18S-rev 5GGA CAT CTA AGG

GCA TCA CA 3 (3 min at 94 C, 16 cycles of 45 sec at94 C, 45 sec at 48 C and 45 sec at 72 C, followed by5 min extension at 72 C) and used as an internal controlfor the amount of cDNA per reaction. Each PCRproduct was transferred onto a nylon membrane(Hybond N; Amersham Biosciences) and hybridizedovernight at 64 C with ChurchGilbert hybridizationsolution with the corresponding probe labelled with[32P]dCTP by random priming (RediPrime RandomLabelling kit, Amersham Biosciences). Stringency washeswere carried out at 64 C with 2SSC, 1SSC and01SSC containing 01% SDS.

Sequence comparison and phylogenetic analysis

The following sequences with accession numbers andabbreviations were used: buffalo, Bubalus bubalis (Bb,CAF21711), cow, Bos taurus, (Bt, NP803480), sheep, Ovisaries (Oa, CAA50978), human, Homo sapiens (R1,

AAA35917; R2, Q96P88), Rhesus macaque, Macacamulata (Mm2, AAK52745), Bonnet macaque, Macacaradiata (Mr, AAG43378), green monkey, Aethiops sabeus(As, AAK52746), marmoset, Callitrix jacchus (CjII,

AAK60927), horse, Equus caballus (Ec, O18821), dog,Canis canis (Cc, Q9 MZI6), Norwegian rat, Rattusnorvegicus (Rn, NP112300), mouse, Mus musculus (Mm,

Q01776), Guinea pig, Cavia porcellus (Cp, Q8CH60),Chicken, Gallus gallus (Gg, NP989984), leopard gecko,Eublepharis macularius (Em, BAD11150), bullfrog, Ranacatesbeiana (RcI AAG42575, RcII AAG42949, RcIII

AAG42574), frog, Rana ridibunda (Rr1 AAP15162, Rr2AAP15163, Rr3 AAP15164), brown frog, Rana dybowskii(Rd1 AAO50198, Rd2 AAO50196, Rd3 AAO50197),

African clawed frog, Xenopus laevis, (Xl1 AAF89754,Xl2 AAK49334), rubber eel, Typhlonectes natans (Tn,

AAD49750), stripped bass, Morone saxatilis (Ms,

AAF28464), amberjack, Seriola dumerilii (Sd, CAB65407),sea bream, Sparus auratus (Sa, AAS97968), Nile tilapia,Oreochromis niloticus (On1 BAC77241, On2 BAC77240,On3 BAD27389), medaka, Oryzias latipes (Ol1BAB70506, Ol2 BAB70505, Ol3 BAC97833), Africancatfish, Clarias gariepinus (Cg1, BAC97836, Cg2,

AAM95605), goldfish, Carassius auratus (CaA,

AAD20001, CaB AAD20002), masou salmon, Oncorhyn-chus masou (Oma1, BAC98943, Oma4, BAC98946),rainbow trout, Oncorhynchus mykiss (Om, CAB93351),

Japanese eel, Anguilla japonica (Aj, BAB11961).Multisequence alignments of the full-length proteins

were carried out using CLUSTAL X (Thompson et al.1997). Protein sequence similarities between differentforms of GnRHR and between species were calculatedwith GeneDoc (Nicholas et al. 1997) and protein motifswere identified using the Prosite database (Falquet et al.2002). The putative transmembrane domains (TMs)were determined with TMHMM 20 (Krogh et al. 2001).Phylogenetic data analysis was restricted to TMs which

were extracted from all identified genes (TMs 1, 2, 3, 4,5, 6 and 7) and aligned with Clustal X. Parsimoniousconsensus trees of the TMs of all available GnRHR weregenerated using PAUP software (version 40, Swofford2002) with the output of Clustal X alignments. Bootstrap

values were calculated with 1000 replicates to estimatethe robustness of internal branches.

Results

Molecular cloning of dlGnRHRs

Five different loci with putative open reading frames

(ORFs) for GnRHR were identified in scaffolds FS2243,FS553, FS686, FS3910 and FS1435 of the sequencedgenome of the tetraodontiform Fugu rubripes. Analysis ofthe putative GnRHR gene structure of FS2243 andFS553 showed that their coding regions encompassedfour exons and three introns while for FS686, FS3910and FS1435 there were three exons and two introns(Table 2).

RT-PCR using specific primers for each of the fiveGnRH identified in Fugu and the brain and pituitary ofEuropean sea bass led to the amplification of fivedifferent cDNAs showing high sequence homology to thecorresponding Fugu GnRHR sequences (Table 3). The

amplified GnRHRs have been classified as dlGnRHR-1A, -1B, -2A, -2B and -2C on the basis of phylogeneticanalysis (see below). The partial fragments of dlGnRHRisolated by RT-PCR were used as probes to screenbrain-pituitary and testis cDNA libraries in order toisolate the full length receptors. Screening of 4105

pituitary plus brain phages with the dlGnRHR-2B probeled to the isolation of clone 3121 corresponding todlGnRHR-2A (accession number AJ419594 alreadycharacterized, see Gonzlez-Martnez et al. 2004). From




5/13

a similar number of phages, but with the dlGnRHR-1Aprobe clone 4125 similar to dlGnRHR-1A (accessionnumber AJ606683) was isolated. It has a 5 untranslatedregion (UTR) of 264 bp, an ORF of 1155 bp and a3-UTR of 1788 bp, including a poly(A)+ tail. Thededuced amino acid sequence for dlGnRHR-1A was384 amino acids (aa). From screening 4105 phages ofthe testis library with the dlGnRHR-2C probe two

positive clones were isolated. Screening a similarnumber of phages from a testis library with thedlGnRHR-2C probe yielded two positive clones. Clone5711, is similar to dlGnRHR-2B (AJ606686), it is1240 bp long and by analogy to the (orthologous) Fuguand medaka sequences, this cDNA clone is presumed tobe truncated lacking the 5UTR. The ORF is 1185 bplong coding for a 394 aa protein and the 3-UTR is

Table 2 Number of exons and introns corresponding to the coding region of GnRH type I and type IIreceptors. Within parenthesis are indicated the number of introns or exons for those genes with an extraintron/exon in the 58 UTR. For species abbreviations and accession numbers see Materials and methods

Species No. of exons No. of introns Reference

GnRHR Type 1 Aj 3 2 (Okubo et al. 2000)O12 4 3 (Okubo et al. 2000)Om 3 (4) 2 (3) (Madigou et al. (2002)

FS553 (Fugu 1A) 4 3 This studyFS2243 (Fugu 1B) 4 3 This studyX11 3 (4) 2 (3) (Troskie et al. 2000)Gg 3 2 (Sun et al. 2001)Em 4 (5) 3 (4) (Ikemoto et al. 2004)Oa 3 2 (Campion et al. 1996)Human 1 3 2 (Kakar 1997)

GnRHR Type 2 O11 3 2 (Okubo et al. 2001)O13 3 (4) 2 (3) (Okubu et al. 2003)FS686 (Fugu 2A) 3 2 This studyFS3910 (Fugu 2B) 3 2 This studyFS1435 (Fugu 2C) 3 2 This studyMm2 3 2 (Neill et al. 2001)As 3 2 (Neill et al. 2001)Human 2 3 2 (Neill et al. 2001)

Table 3 Amino acid sequence identity (%) between dlGnRHRs, puffer fish (FS) and other vertebrateGnRHRs. dlGnRHRs were cloned from brain-pituitary and testis cDNA libraries of European sea bass. Inthe analysis only the segment encompassing the transmembrane domains was included. For speciesabbreviations and accession numbers see Materials and methods

Sequence identity (%)

dlGnRHR-2A 53 dlGnRHR-2B 51 77 dlGnRHR-2C 49 82 76 FS553 (Fugu 1A) 86 52 51 49FS2243 (Fugu 1B) 73 52 49 49FS686 (Fugu 2A) 52 87 76 77FS3910 (Fugu 2B) 51 79 97 74FS1435 (Fugu 2C) 51 84 76 85

O11 51 82 77 86O12 74 51 49 48O13 51 76 94 73CaA 77 53 50 49CaB 82 52 51 48RcI 51 73 74 69RcII 61 53 52 49RcIII 53 65 65 62HumanI 41 44 40 41HumanII 38 44 42 43Sea bass GnRHRs dlGnRHR-1A dlGnRHR-2A dlGnRHR-2B dlGnRHR-2C




6/13

55 bp. Clone 3211 (dlGnRHR-2C) is 2677 bp longwith a 282 bp 5-UTR and an 1138 bp 3-UTR, andwith a translated protein of 418 amino acids. Until now,only a partial fragment of dlGnRHR-1B (AJ606685) hasbeen cloned (Fig. 1). Hybridization of sea bass genomicDNA in a Southern blot using probes specific for eachreceptor form resulted in a characteristic pattern of

bands, thus confirming that they are encoded bydifferent genes.

Comparison of the different dlGnRHRs and other

vertebrates/teleost

A multisequence alignment of the amino acid sequencesof dlGnRHRs with that of other vertebrates revealed thepresence of conserved features of the class A, rhodopsin-like family of G-protein coupled receptor superfamily,namely the seven transmembrane domains and the N-and C-terminal regions (Fig. 1). Amino acid sequenceidentity among the dlGnRHRs, including the trans-

membrane domains but excluding the highly variable N-and C-terminal tails, ranged between 49% and 82%(dlGnRHR-1B not included, see Table 3). Across the

vertebrates, sequence similarities between the Europeansea bass receptors ranged between 38% with humanGnRHR2 and 97% with Fugu.

A phylogenetic analysis of the GnRHR transmem-brane domains shows that there are two main receptorlineages encompassing all vertebrates (designated type Iand type II, Fig. 2). Within taxa, gene duplicationsappear to have occurred in the amphibians and inteleost fishes. Considering that each of the clades whichinclude a European sea bass and a Fugu GnRHR is

encoded by a separate gene, the lineage which includesthe human GnRHR type 1 appears to contain at leastone teleost specific gene duplication encompassing theCyprinidiformes, Salmoniformes and the modern teleostfishes (Perciformes, Atherinidiformes and Tetraodon-tiformes; Fig. 2). This results in two teleost subtypes.However, the Japanese eel receptor did not fallunambiguously in either of the two teleost subtypes. Inthe lineage which includes human GnRHR2, threeteleost clades can be identified and their tree topologysuggest two gene duplications, with one possibly specificto the modern teleosts. Two clades within this lineageare also present in the amphibians suggesting a

duplication event also occurred in this class. Analysis of the primary structure of the translated

proteins grouped according to the the phylogeneticanalysis showed, as main features, the presence of aC-terminal tail in all receptors except mammalian type I(Fig. 1). These have the shortest protein sequence with328 to 362 aa. In ascending order of size the protein is368375 aa long from amphibians to birds, 379390 aain fish subtype 1A, and 350375 aa in fish subtype 1B(considering only the second Met in rainbow trout), and

380 aa in Japanese eel. In type II receptors theC-terminal tail is longer in all cases in comparison totype I for the same class of animals. The mammalianreceptor ranges from 379380 aa (excluding humanwhich lacks the N-terminal region). One of theamphibian subtypes has 407 aa in all species studiedand the second 410424 aa. The fish subtype 2A ranges

from 412426 aa (Nile tilapia excluded because itprobably lacks part of the C-terminus). The fish subtype2B from 390394 aa and the fish subtype C from387418 aa.

A comparative analysis of conservation of amino acidsthat have been implicated in receptor function withreference to the human type I receptor (Millar et al.2004) show that not all are fully conserved. For thoseamino acids important for the structure of the receptoror of the binding pocket Cys114, Trp164, Cys196, Trp206,Trp280, Trp291 and Pro320 are fully conserved through-out the vertebrates. None of the amino acids implicatedin G-protein coupling in mammalian receptors are

conserved in the fish receptors. Amino acids Asp98

,Trp101, Asn102, Lys121 and Asn212 implicated in ligandbinding are fully conserved but not Tyr290 (modifiedonly in Nile tilapia) and Asp302 (conserved only in somemammals). Of the amino acids implicated in receptoractivation only Asn87 is not conserved.

Tissue mRNA expression of dlGnRHRs

All dlGnRHRs have a common pattern of medium tohigh abundance in the anterior and middle brain in thetwo females and two males that were analysed (Fig. 3).Of the two GnRHR types (1 and 2), type 1 has the

widest distribution among non reproductive tissues,while type 2 is more restricted to the central nervoussystem. dlGnRHR-1A transcripts are also relativelyabundant in the pituitary, olfactory epithelium, ovaryand eye. Lower levels of expression are detected in theposterior brain region, gills and kidney. Besides itsexpression in brain, olfactory epithelium and kidney,dlGnRHR-1B can be detected in the pituitary, eyes,gills, gut and liver. dlGnRHR-2A has higher expressionin the anterior and midbrain, pituitary and in both ovaryand testis (not shown). Faint expression is found in theolfactory epithelium, eyes and gills. dlGnRHR-2B ismainly expressed along the central nervous system and

gonads. Surprisingly, this receptor has no expression inthe pituitary gland. dlGnRHR-2C is also expressed inthe three brain regions, and in the pituitary, eyes andtestis (not shown). Faint expression is found in the ovaryand head kidney.

Discussion

In this study we have used sequence information fromthe model fish Fugu rubripes to isolate five cDNAs for




7/13

Figure 1 Multisequence alignment of deduced amino acid sequences of GnRHRs from Europeansea bass, Fugu (FS) and representatives from other fish orders and vertebrate classes. Theputative seven transmembrane domains are indicated. For species abbreviations and accessionnumbers see the Materials and methods section.




8/13

GnRHRs in the European sea bass and demonstratethat they are encoded by five separate genes. The phylo-genetic analysis of the translated amino acid sequencesindicates that two major clades, which include,mammalian receptor types I and II, encompass all

vertebrates. Within the type I clade a specific geneduplication appears to have occurred in teleosts, whilstin the type II clade, two rounds of gene duplication and

one round of gene duplication appear to have occurredin teleosts (three GnRHR1 genes) and amphibians (twoGnRHR2 genes). Among the teleosts the exceptionappears to be the eels in which at present only a singlereceptor GnRHR1 has been cloned.

We did not find phylogenetic, structural or functionaljustification to name, as recently proposed (Okubo et al.2001, Millar et al. 2004), a third receptor type which

Figure 2 Unrooted tree showing the localization of the dlGnRHRs within the vertebrate lineage of GnRH receptors.The two larger Venn diagrams delimit type I and type II receptors; the included smaller diagrams delimit the fishclades. The tree was generated using PAUP software using the Parsimony criterion. Bootstrap values are indicated inthe nodes. Organism abbreviations: Japanese eel, Aj; green monkey, As; buffalo, Bb; cow, Bt; goldfish, CaA, CaB;dog, Cc; African catfish, Cg1, Cg2; marmoset, CjII; horse, Ec; Guinea pig, Cp; leopard gecko, Em; Chicken, Gg;mouse, Mm; Rhesus macaque, Mm2; Bonnet macaque, Mr; stripped bass, Ms; sheep, Oa; medaka, Ol1, Ol2, Ol3;rainbow trout, Om; masou salmon, Oma1, Oma4; Nile tilapia, On1, On, On3; bullfrog, RcI, RcII, RcIII; brown frog, Rd1,Rd2, Rd3; Norwegian rat, Rn; frog, Rr1, Rr2, Rr3; sea bream, Sa; amberjack, Sd; rubber eel, Tn; African clawed frog,Xl1, Xl2.




9/13

would split mammalian type II and the closestamphibian clade from the other amphibian and,following our designation, fish type II receptors. If athird receptor type were designated the resultingproposed clades would split through a phylogenetic

division separating higher from lower vertebrates. Analysis of gene organization corresponding to thecoding region of the cDNAs (Table 2) shows that in bothGnRHR1 and GnRHR2 types, genes with three exonsand two introns and genes with four exons and threeintrons (four and five, respectively in gecko) are present,the latter in some but not all fishes (Madigou et al. 2000,Okubo et al. 2000, 2001, 2003) and Xenopus(Troskie et al.2000). In the genes with more than three exons, the 1 st

exon appears to have acquired an intron (Okubo et al.2003). Overall, this indicates that gene organization

per seis not diagnostic to classify GnRH receptor types.The suggestion of three receptor types has been partly

fuelled by the fact that ligand evolution appears to haveled to three main clades, one of which consisting onlyof teleost fish (Millar et al. 2004). However, despiteextensive studies of different GPCR families and theirreceptors there is so far no clear evidence supportingthe notion that ligand evolution coincides with receptorevolution. Furthermore, similar observations of fishspecific duplications have occurred for other genes infish, including nuclear receptors, developmental genes,enzymes, etc. (Amores et al. 1998, Tchoudakova &

Callard 1998, Robinson-Rechavi et al. 2001). It appearsthat in fishes a specific round of genome duplication withgene loss has occurred (Jaillon et al. 2004) and it ispossible that segmentary genomic duplications may haveresulted in the larger number of GnRHRs, at least in

some fish species. Recent segmentary genome duplica-tions have also been proposed to have occurred inhuman (56% euchromatin; She et al. 2004) and mousegenomes (2%; Bailey et al. 2004). The most parsimoniousconclusion is therefore that in vertebrates the GnRHreceptor family is composed of two receptor types andthat specific duplications have occurred early in theevolution of amphibians and ray-finned fishes (possiblymore than once). In the following discussion GnRHRnomenclature in fish will be adapted to the Europeansea bass notation which is based on the topology of thephylogenetic tree (Fig. 2).

Amino acid sequence comparisons of the TMs of the

GnRHRs extracted from the Fugu rubripes genome andfrom the sea bass cDNAs had highest similarities ofbetween 77% and over 80% between receptorsbelonging to the same major clade (type I or type II)while across clades sequence similarity was low, between51 and 55%.

The analyses of amino acids that have beenimplicated in receptor function show that the highestconservation is present in those associated with ligandbinding. An exception is Asp302 (numbering in reference

Figure 3 Expression of dlGnRHRs in central and peripheral tissues detected by RT-PCR andSouthern blotting. Amplification of rRNA 18s was used to standardize the quantity of mRNA. M,muscle; G, gills; L, liver; Gt, gut; H, heart; S, spleen; K, kidney; HK, head kidney; O, ovary; AB,anterior brain; MB, middle brain; PB, post brain; P, pituitary; E, eye; OE, olfactory epithelium.




10/13

to human GnRHR1) which is often replaced by Gluanother negatively charged amino acid in GnRHR1receptors. The acidic residue in the mammalian receptoris proposed to induce a high affinity conformation ofmammalian GnRH that allows it to interact with a finalbinding pocket (Fromme et al. 2001). However, an acidicamino acid at position 302 does not appear to be

required for high affinity binding to GnRH II (Millaret al. 2004). This is consistent with the lack of conserva-tion of Asp302 in GnRHR2 receptors and being replacedby small or hydrophobic amino acids: Pro in mammalsand some amphibians, Gln in some amphibians or Hisin all fishes. Although GnRHR2 in different speciesgenerally bind GnRH II, but not mammalian GnRH,with high affinity (Millar et al. 2004), the results of ligandbinding studies do not show a clear pattern of associa-tion between putative GnRH ligands and GnRHRstypes and subtypes (e.g. Illing et al. 1999, Millar et al.2001, Neill et al. 2001, Okubo et al. 2001, Wang et al.2001, Bogerd et al. 2002).

For those amino acids important for the structure ofthe receptor or of the binding pocket, Cys114, Trp164,Cys196, Trp206, Trp280, Trp291 and Pro320, are fullyconserved throughout the vertebrates. Of interest isthe fact that of the two pairs of cysteines which wouldenable disulfide bond formation in the extracellulardomain (Millar et al. 2004), only Cys114Cys196 isconserved in all receptors, while Cys14Cys200 are onlypresent simultaneously in mammalian GnRH type Ireceptors. These differences will modify the receptorstertiary structure and add further complexity in trying todeduce the contribution of structural elements for ligandbinding.

Analysis of mRNA expression of the dlGnRHRsmakes it evident that the action of GnRHs is not limitedto the central nervous system and the pituitary gland.dlGnRHRs are also expressed in the peripheral tissuesrelated to the senses, reproduction and homeostasis: theeyes, olfactory epithelium, gonads, kidney, gut, liver, andgills. The role of GnRHs in peripheral tissues remains tobe established.

All the dlGnRHRs are expressed in the brain,especially in the anterior and mid brain which includethe olfactory bulb, telencephalon to diencephalon andthe optic tectum. An analysis of co-localization in thebrain of the three European sea bass GnRH forms

(Gonzlez-Martnez et al. 2002) and the five receptors,may provide an insight on ligand specificity andfunction. Binding sites have also been described indifferent pituitary cells in pejerrey, Odontesthes bonariensis(Stefano et al. 1999). Of the European sea bass receptors,dlGnRHR-2A appears to be expressed only in LH-gonadotrophs and the level correlates with thereproductive cycle (Gonzlez-Martnez et al. 2004).However, in teleost fishes, hypothalamic GnRHneurones innervate the adenohypophysis to control the

release not only of gonadotrophins (Somoza et al. 2002)but also of growth hormone (Marchant et al. 1989, Liet al. 2002), prolactin (Weber et al. 1997), somatolactin(Kakizawa et al. 1997) and thyroid stimulating hormone(Roy et al. 2000). In the goldfish GnRHR-1A and -1Bhave an overlapping expression and are present mainlyin gonadotropes and to a lesser extent in some

somatotrophs (Illing et al. 1999). With heterologousantisera in Nile tilapia immunoreactive GnRHR-1Alocalized to FSH and LH cells and GnRH-1B toprolactin FSH- and LH-containing cells and as smallclusters scattered along the periphery of the parsintermedia of the pituitary (Parhar et al. 2002). Alsoheterologous antisera to GnRHR-2A and -2C stainedGH-containing cells of the Nile tilapia pituitary (Parharet al. 2002). The fact that dlGnRHR-2B is not expressedin the pituitary supports the hypothesis of GnRHpeptides possibly having specialized functions not relatedto gonadotrophin release.

Nevertheless, all European sea bass receptors, apart

from dlGnRHR-1B, were strongly expressed in thegonads (i.e. testis and/or ovary). High levels ofGnRHRs expression have also been detected in thegonads of other teleosts (African catfish, Bogerd et al.2002; goldfish, Illing et al. 1999; rainbow trout, Madigouet al. 2000) and in mammals (Dong et al. 1996, Kakar& Jennes, 1995). This has also been confirmed bybinding studies (Pati & Habibi 1993), suggesting adirect effect of GnRH on sex steroid synthesis andgametogenesis.

dlGnRHR-2C and dlGnRHR-1A had relativelyhigher expression in the eye, an observation that has alsobeen made in rainbow trout (GnRHR-1B) and Japanese

eel, Anguilla japonica (GnRHR1) (Madigou et al. 2000,Okubo et al. 2000). Furthermore, GnRH immunoreac-tive fibers have been detected in the retina of platyfish,

Xyphophorus maculatus(Munz et al. 1981), goldfish (Kahet al. 1986) and pejerrey (Miranda et al. 2003) and in theolfactory systems of several teleost species, including the

American eel, Anguilla rostrata (Grober et al. 1987) andmasu salmon (Kudo et al. 1994). Fish olfactory receptorsare also highly sensitive to GnRH (Andersen & Doving1991). Immunoreactive GnRH somata have beenidentified along the rostro-caudal extent of the olfactorynerve, and clustered within the medial component of theolfactory nerve as it arises from the olfactory epithelium

(Nevitt et al. 1995). Since at least some cells in this clusterproject to the retina, possibly being part of a terminalnerve ganglion, it has been suggested that perhapsGnRH facilitates visual and olfactory perception duringsexual interactions (Nevitt et al. 1995). A role forolfactory stimuli in the regulation of GnRH secretionhas been suggested in sea lamprey, Petromyzon marinus,based on the overlap of olfactory- and GnRH-containing fibres from prolarval stages to metamorphosis(Tobet et al. 1996). It has been recently demonstrated




11/13

using GnRH-receptor antagonist that GnRH secreted bymammalian olfactory cells promotes the differentiationand migration of the olfactory sensory lineage cells thatare committed to become GnRH neurons (Romanelliet al. 2004). The expression of both dlGnRHR-2A anddlGnRHR-2B in the olfactory rosettes suggest that theyare likely mediators of these processes.

Of particular interest is the expression of GnRHRs intissues related to osmoregulation. We show for the firsttime GnRHR expression in the gills (dlGnRHR-1A, -1Band -2A) and kidney (dlGnRHR-2A and dlGnRHR-2B).Few species have been also shown to express GnRHpeptide. Teleost (Haplochromis burtoni ) kidney express atleast one form of GnRH (White & Fernald 1998) andhuman kidneys express two GnRH forms (Kakar &

Jennes 1995). Since GnRH has never been associatedwith osmoregulation, a possible explanation for thepresence of GnRH and its receptor in kidney is that thistissue contains a high concentration of mast cells whichexpress GnRH in high levels (Khalil et al. 2003,

Marchetti et al. 1996, Rissman 1996).In conclusion, the existence of five different GnRHreceptors to three GnRH forms in this model of

vertebrate species indicates a complex interplay occursbetween ligands and receptors in the regulation ofpituitary and hormone secretion. The fact that GnRHRsshow a wide and different pattern of tissue distribution,is suggestive that, in addition to regulating the secretionof gonadotrophins from the anterior pituitary, GnRHand its receptor also play a role in the regulation of arange of cellular functions in an autocrine or paracrinemanner (Millar 2003). However, when considering the

various species from different phylogenetic positions, in

which GnRHRs expression has been studied, it is notpossible as yet to identify a specific pattern of expressioncharacteristic of each receptor type or subtype. Gener-ally speaking the common feature is the expression of the

various receptors in the central nervous system, but thedistribution in other tissues is more variable. Thissuggests that in any one species (or higher taxonomicgroup) the GnRHRs receptors are generally involved insome ancestral functions, e.g. those related to reproduc-tion, but at a peripheral level specialization of functionshave also evolved independently.

Acknowledgements

This work received the support from a PortugalArgentina Science and Technology Cooperation Agree-ment, SECYT-GRICES 472 Program PO/PA02-BI/001. N P M was in receipt of a fellowship covered bythe European Social Fund and National funds underPortuguese National Science Foundation (FCT)POCTI/SFRH/BD/6083/2001.

References

Adams BA, Tello JA, Erchegyi J, Warby C, Hong DJ, AkinsanyaKO, Mackie GO, Vale W, Rivier JE & Sherwood NM 2003 Sixnovel gonadotropin-releasing hormones are encoded as triplets oneach of two genes in the protochordate, Ciona intestinalis.Endocrinology 144 19071919.

Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller

W & Lipman DJ 1997 Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. Nucleic AcidsResearch25 33893402.

Amores A, Force A, Yan YL, Joly L, Amemiya C, Fritz A, Ho RK,Langeland J, Prince V, Wang YL et al. 1998 Zebrafish hoxclusters and vertebrate genome evolution. Science282 17111714.

Andersen O & Doving KB 1991 Gonadotropin-releasing hormone(GnRH): A novel olfactory stimulant in fish. Neuroreport2 458460.

ASAB 2003 Guidelines for the treatment of animals in behaviouralresearch and teaching. Animal Behaviour65 249255.

Bailey JA, Church DM, Ventura M, Rocchi M & Eichler EE 2004Analysis of segmental duplications and genome assembly in themouse. Genome Research14 789801.

Bogerd J, Bas Diepenbroek W, Hund E, van Oosterhaut F, TevesAC, Leurs R & Blomenrhr M 2002 Two gonadotropin-realisinghormone receptor in the African catfish: No differences in ligand

selectivity, but differences in tissue distribution. Endocrinology 14346734682.

Campion CE, Turzillo AM & Clay CM 1996 The gene encodingthe ovine gonadotropin-releasing hormone (GnRH) receptor:cloning and initial characterization. Gene170 277280.

Church GM & Gilbert W 1984 Genomic sequencing. PNAS 8119911995.

Dong KW, Duval P, Zeng Z, Gordon K, Williams RF, Hodgen GD,Jones G, Kerdelhue B & Roberts JL 1996 Multiple transcriptionstart sites for the GnRH gene in rhesus and cynomolgus monkeys:a non-human primate model for studying GnRH gene regulation.

Molecular and Cellular Endocrinology 117 121130.Falquet L, Pagni M, Bucher P, Hulo N, Sigrist CJ, Hofmann K &

Bairoch A 2002 The PROSITE database, its status in 2002. Nucleic Acids Research30 235238.

Fromme BJ, Katz AA, Roeske RW, Millar RP & Flanagan CA 2001Role of aspartate732(302) of the human gonadotropin-releasinghormone receptor in stabilizing a high-affinity ligandconformation. Molecular Pharmacology 60 12801287.

Gonzlez-Martnez D, Madigou T, Zmora N, Anglade I, Zanuy S,Zohar Y, Elizur A, Muoz-Cueto A & Kah O 2001 Differentialexpression of three different prepro-GnRH (gonadotrophin-releasing hormone) messengers in the brain of the European seabass (Dicentrarchus labrax). Journal of Comparative Neurology 429144155.

Gonzlez-Martnez D, Zmora N, Maanos E, Saligaut D, Zanuy S,Zohar J, Elizur A, Kah O & Muoz-Cueto JA 2002Immunohistochemical localization of three different prepro-GnRHs in the brain and pituitary of the European sea bass(Dicentrarchus labrax ) using antibodies to the corresponding GnRH-associated peptides. Journal of Comparative Neurology 446 95113.

Gonzlez-Martnez D, Madigou T, Mananos-Sanchez E,Cerd-Reverter JM, Zanuy S, Kah O & Muoz-Cueto JA 2004Cloning and expression of gonadotrophin-releasing hormonereceptor in the brain and pituitary of the European sea bass: an insitu hybridization study. Biology of Reproduction 70 13801391.

Grober MS, Bass AH, Burd G, Marchaterre MA, Segil N, Scholz K& Hodgson T 1987 The nervus terminalis ganglion in Anguillarostrata: an immunocytochemical and HRP histochemical analysis.

Brain Research436 148152.Ikemoto T, Enomoto M & Park MK 2004 Identification and

characterization of a reptilian GnRH receptor from the leopardgecko. Molecular and Cellular Endocrinology 214 137147.




12/13

Illing N, Troskie BE, Nahorniak C, Hapgood JP, Peter R & MillarRP 1999 Two gonadotropin-releasing hormone receptor subtypeswith distinct ligand selectivity and differential distribution in brainand pituitary in the Goldfish (Carassius auratus). PNAS9625262531.

Jaillon O, Aury JM, Brunet F, Petit JL, Stange-Thomann N,Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot A etal. 2004 Genome duplication in the teleost fish Tetraodon nigroviridisreveals the early vertebrate proto-karyotype. Nature431 946957.

Jodo A, Ando H & Urano A 2003 Five different types of GnRHreceptor gene are expressed in the brain of masu salmon(Oncorhynchus masou). Zoological Science20 11171125.

Kah O, Breton B, Dulka JG, Nunez-Rodriguez J, Peter RE,Corrigan A, Rivier JE & Vale WW 1986 A reinvestigation of theGn-RH (gonadotrophin-releasing hormone) systems in the goldfishbrain using antibodies to salmon Gn-RH. Cell and Tissue Research244 327337.

Kakar SS 1997 Molecular structure of the human gonadotropin-releasing hormone receptor gene. European Journal of Endocrinology137 183192.

Kakar SS & Jennes L 1995 Expression of gonadotropin-releasinghormone and gonadotropin-releasing hormone receptor mRNAsin various non-reproductive human tissues. Cancer Letters98 5762.

Kakizawa S, Kaneko T & Hirano T 1997 Effects of hypothalamicfactors on somatolactin secretion from the organ-cultured pituitaryof rainbow trout. General and Comparative Endocrinology 105 7178.

Khalil MH, Silverman AJ & Silver R 2003 Mast cells in the ratbrain synthesize gonadotropin-releasing hormone. Journal of

Neurobiology 56 113124.Krogh A, Larsson B, von Heijne G & Sonnhammer ELL 2001

Predicting transmembrane protein topology with a hidden Markovmodel: Application to complete genomes. Journal of Molecular

Biology 305 567580.Kudo H, Ueda H, Kawamura H, Aida K & Yamauchi K 1994

Ultrastructural demonstration of salmon-type gonadotropin-releasing hormone (sGnRH) in the olfactory system of masusalmon (Oncorhynchus masou). Neuroscience Letters166 187190.

Lethimonier C, Madigou T, Muoz-Cueto JA, Lareyre JJ & Kah O2004 Evolutionary aspects of GnRHs, GnRH neuronal systemsand GnRH receptors in teleost fish. General and Comparative

Endocrinology135

116.Li WS, Lin HR & Wong AOL 2002 Effects of gonadotropin-releasing hormone on growth hormone secretion and geneexpression in common carp pituitary. Comparative Biochemistry andPhysiology B-Biochemistry and Molecular Biology 132 335341.

Madigou T, Mananos-Sanchez E, Hulshof S, Anglade I, Zanuy S &Kah O 2000 Cloning, tissue distribution, and central expression ofthe gonadotropin-releasing hormone receptor in the rainbow trout(Oncorhynchus mykiss). Biology of Reproduction 63 18571866.

Madigou T, Uzbekova S, Lareyre JJ & Kah O 2002 Two messengerRNA isoforms of the gonadotrophin-releasing hormone receptor,generated by alternative splicing and/or promoter usage, aredifferentially expressed in rainbow trout gonads duringgametogenesis. Molecular Reproduction and Development 63 151160.

Marchant TA, Chang JP, Nahorniak CS & Peter RE 1989 Evidencethat gonadotropin-releasing hormone also functions as a growth

hormone-releasing factor in the goldfish. Endocrinology 12425092518.Marchetti B, Gallo F, Farinella Z, Romeo C & Morale MC 1996

Luteinizing hormone-releasing hormone (LHRH) receptors in theneuroendocrine-immune network - Biochemical bases andimplications for reproductive physiopathology. Basis for Cancer

Management784 209236.McArdle CA, Franklin J, Green L & Hislop JN 2002 Signalling,

cycling and desensitisation of gonadotroping releasing hormonereceptors. Journal of Endocrinology 173 111.

Millar RP 2003 GnRH II and type II GnRH receptors. Trends inEndocrinology and Metabolism 14 3543.

Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B,Ott T, Millar M, Lincoln G, Sellar R et al. 2001 A novelmammalian receptor for the evolutionarily conserved type IIGnRH. PNAS 98 96369641.

Millar RP, Lu ZL, Pawson AJ, Flanagan CA, Morgan K &Maudsley SR 2004 Gonadotropin-releasing hormone receptors.Endocrine Reviews25 235275.

Miranda LA, Strobl-Mazzulla PH, Strussmann CA, Parhar I &Somoza GM 2003 Gonadotropin-releasing hormone neuronal

development during the sensitive period of temperature sexdetermination in the pejerrey fish, Odontesthes bonariensis. General andComparative Endocrinology 132 444453.

Munz H, Stumpf WE & Jennes L 1981 LHRH systems in brain ofplatyfish. Brain Research221 113.

Neill JD, Duck LW, Sellers JC & Musgrove LC 2001 Agonadotropin-releasing hormone (GnRH) receptor specific forGnRH II in primates. Biochemical and Biophysical ResearchCommunications282 10121018.

Nevitt GA, Grober MS, Marchaterre MA & Bass AH 1995GnRH-like immunoreactivity in the peripheral olfactory systemand forebrain of Atlantic salmon (Salmo salar): A reassessmentat multiple life-history stages. Brain Behavior and Evolution 45350358.

Nicholas KB, Nicholas HB Jr & Deerfield II DW 1997 GeneDoc:Analysis and visualization of genetic variation. Embnet News4 14.

Okubo K, Suetake H, Usami T & Aida K 2000 Molecular cloningand tissue-specific expression of a gonadotropin-releasing hormonereceptor in the Japanese eel. General and Comparative Endocrinology119 181192.

Okubo K, Nagata S, Ko R, Kataoka H, Yoshiura Y, Mitani H,Kondo M, Naruse K, Shima A & Aida K 2001 Identification andcharacterization of two distinct GnRH receptor subtypes in ateleost, the Medaka Oryzias latipes. Endocrinology 142 47294739.

Okubo K, Ishii S, Ishida J, Mitani H, Naruse K, Kondo M, ShimaA, Tanaka M, Asakawa S, Shimizu N et al. 2003 A novel thirdgonadotropin-releasing hormone receptor in the medaka Oryziaslatipes: evolutionary and functional implications. Gene314121131.

Parhar IS, Soga T, Sakuma Y & Millar RP 2002 Spatiotemporalexpression of gonadotropin releasing hormone receptor subtypes

in gonadotropes, somatotropes and lactotropes in the cichlid fish. Journal of Neuroendocrinology 14 657665.Pati D & Habibi H 1993 Characterization of gonadotropin-releasing

hormone receptors in goldfish ovary: variation during folliculardevelopment. American Journal of Physiology 264 R227R234.

Rissman EF 1996 Behavioral regulation of gonadotropin-releasinghormone. Biology of Reproduction 54 413419.

Robinson-Rechavi M, Marchand O, Escriva H, Bardet PL, Zelus D,Hughes S & Laudet V 2001 Euteleost fish genomes arecharacterized by expansion of gene families. Genome Research11781788.

Romanelli RG, Barni T, Maggi M, Luconi M, Failli P, Pezzatini A,Pelo E, Torricelli F, Crescioli C, Ferruzzi P et al. 2004 Expressionand function of gonadotropin-releasing hormone (GnRH) receptorin human olfactory GnRH-secreting neurons: an autocrine GnRHloop underlies neuronal migration. Journal of Biological Chemistry

279 117126.Roy P, Datta M, Dasgupta S & Bhattacharya S 2000 Gonadotropin-

releasing hormone stimulates thyroid ativity in a feshwater murrel,Channa gachua (Ham.), and carps, Catla catla (Ham.) and Cirrhinusmrigala (Ham.). General and Comparative Endocrinology 117 456463.

She X, Jiang Z, Clark RA, Liu G, Cheng Z, Tuzun E, Church DM,Sutton G, Halpern AL & Eichler EE 2004 Shotgun sequenceassembly and recent segmental duplications within the humangenome. Nature431 927930.

Somoza GM, Miranda LA, Strobl-Mazzulla P & Guilgur LG 2002Gonadotropin-releasing hormone (GnRH): From fish tomammalian brains. Cellular and Molecular Neurobiology 22 589609.




13/13

Stefano AV, Vissio PG, Paz DA, Somoza GM, Maggese MC &Barrantes GE 1999 Co-localization of GnRH binding sites withgonadotropin-, somatotropin-, somatolactin-, and prolactin-expressing pituitary cells of the pejerrey, Odontesthes bonariensis, invitro. General and Comparative Endocrinology 116 133139.

Sun Y-M, Flanagan CA, Illing N, Ott TR, Sellar R, Fromme BJ,Hapgood J, Sharp P, Sealfon SC & Millar RP 2001 A chickengonadotropin-releasing hormone receptor that confers agonistactivity to mammalian antagonists. Identification of D-Lys6 in the

ligand and extracellular loop two of the receptor as determinants. Journal of Biological Chemistry 276 77547761.

Swofford DL 2002 PAUP*. Phylogenetic Analysis Using Parsimony(*and other methods), CD-ROM. Sunderland, Massachusetts:Sinauer Associates.

Tchoudakova A & Callard GV 1998 Identification of multipleCYP19 genes encoding different cytochrome P450 aromataseisozymes in brain and ovary. Endocrinology 139 21792189.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG1997 The CLUSTAL X windows interface: flexible strategies formultiple sequence alignment aided by quality analysis tools. Nucleic

Acids Research25 48764882.Tobet SA, Chickering TW & Sower SA 1996 Relationship of

gonadotropin-releasing hormone (GnRH) neurons to the olfactorysystem in developing lamprey (Petromyzon marinus). Journal of

Comparative Neurology 376 97111.

Troskie BE, Hapgood JP, Millar RP & Illing N 2000Complementary deoxyribonucleic acid cloning, gene expression,and ligand selectivity of a novel gonadotropin-releasing hormonereceptor expressed in the pituitary and midbrain of Xenopus laevis.Endocrinology 141 17641771.

Wang L, Bogerd J, Choi HS, Seong JY, Soh JM, Chun SY,Blomenrhr M, Troskie BE, Millar RP, Yu WH et al. 2001 Threedistinct types of GnRH receptor characterized in the bullfrog.PNAS 98 361366.

Weber GM, Powell JFF, Park M, Fischer WH, Craig AG, Rivier JE,Nanakorn U, Parhar IS, Ngamvongchon S, Grau EG et al. 1997Evidence that gonadotropin-releasing hormone (GnRH) functionsas a prolactin-releasing factor in a teleost fish (Oreochromismossambicus ) and primary structures for three native GnRHmolecules. Journal of Endocrinology 155 121132.

White RB & Fernald RD 1998 Ontogeny of gonadotropin-releasinghormone (GnRH) gene expression reveals a distinct origin forGnRH-containing neurons in the midbrain. General and ComparativeEndocrinology 112 322329.

Zmora N, Gonzlez-Martinez D, Muoz-Cueto JA, Madigou T,Maanos-Sanchez E, Zanuy-Doste S, Zohar Y, Kah O & ElizurA 2002 The GnRH system in the European sea bass (Dicentrarchuslabrax). Journal of Endocrinology 172 105116.

Received 11 February 2005

Accepted 15 February 2005



five gonadotrophin-releasing hormone receptors in a teleost

Documents