foldable world

Transparent & Flexible Electronics

Massimo Marrazzo - biodomotica.com 1

NanotechnologyVOL. I2011

Transparent & flexible electronics

MASSIMO MARRAZZO - BIODOMOTICA®


2 Massimo Marrazzo - biodomotica.com

IIIIIIIInnnnnnnnddddddddeeeeeeeexxxxxxxx

Nanotechnology pag.3Graphene 7Nanotubes 8Printed electronics 13Ink for "printed electronics" 19Printer for "printed electronics" 21Transparent and Strong Plastic 24Transparent Electronics 25Flexible and trasparent displays 30Electronic paper / E-paper / E-ink 32Printed battery 33Charging batteries without wires 45WiTricity 46Solar Energy 48Seebeck effect - Thermoelectric 55Printed Memory 77Printed Antennas 79Wireless technologies 81Nanotube Radio 84Sound 87Lens 94Bio-Sensors 98Virtual Muscles 101Gecko 106Mems 113Ecology 115Link to transparent electronics 116Applications of transparent or flexible electronics 117Invisibility Cloak 125Acronyms 128Books 130Journal Papers 133Links 134Show/Convention/Exposition 136Blogs 136Toolbox 137iPad & iPhone applications for Nanotech 138Android applications for read RSS Nanotech 1392011 Update 140



NNNNNNNNaaaaaaaannnnnnnnooooooootttttttteeeeeeeecccccccchhhhhhhhnnnnnnnnoooooooollllllllooooooooggggggggyyyyyyyy

- http://www.nano.org.uk/whatis.htm

What is Nanotechnology?Nanotechnology originates from the Greek word “nanos” meaning “dwarf".A nanometre is one billionth (10-9) of a metre, which is tiny, only the length of ten hydrogen atoms,or about one hundred thousandth of the width of a hair! Although scientists have manipulatedmatter at the nanoscale for centuries, calling it physics or chemistry, it was not until a newgeneration of microscopes were invented in the nineteen eighties in IBM, Switzerland that theworld of atoms and molecules could be visualized and managed.

In simple terms, nanotechnology can be defined as 'engineering at a very small scale', and thisterm can be applied to many areas of research and development: from medicine to manufacturingto computing, and even to textiles and cosmetics. It can be difficult to imagine exactly how thisgreater understanding of the world of atoms and molecules has and will affect the everyday objectswe see around us, but some of the areas where nanotechnologies are set to make a difference aredescribed below.

From Micro to NanoNanotechnology, in one sense, is the natural continuation of the miniaturization revolution that wehave witnessed over the last decade, where millionth of a metre (10-6 m) tolerances(microengineering) became commonplace, for example, in the automotive and aerospaceindustries enabling the construction of higher quality and safer vehicles and planes. It was thecomputer industry that kept on pushing the limits of miniaturization, and many electronic deviceswe see today have nano features that owe their origins to the computer industry — such ascameras, CD and DVD players, car airbag pressure sensors and inkjet printers. ©2008 Institute of Nanotechnology

- http://www.crnano.org/whatis.htm

What is Nanotechnology?A basic definition: Nanotechnology is the engineering of functional systems at the molecular scale.This covers both current work and concepts that are more advanced.In its original sense, 'nanotechnology' refers to the projected ability to construct items from thebottom up, using techniques and tools being developed today to make complete, high performanceproducts.

The Meaning of NanotechnologyWhen K. Eric Drexler popularized the word 'nanotechnology' in the 1980's, he was talking aboutbuilding machines on the scale of molecules, a few nanometers wide motors, robot arms, and evenwhole computers, far smaller than a cell. Drexler spent the next ten years describing and analyzingthese incredible devices, and responding to accusations of science fiction. Meanwhile, mundanetechnology was developing the ability to build simple structures on a molecular scale. Asnanotechnology became an accepted concept, the meaning of the word shifted to encompass thesimpler kinds of nanometer-scale technology. The U.S. National Nanotechnology Initiative wascreated to fund this kind of nanotech: their definition includes anything smaller than 100nanometers with novel properties.



Four GenerationsMihail (Mike) Roco of the U.S. National Nanotechnology Initiative has described four generations ofnanotechnology development (see chart below). The current era, as Roco depicts it, is that ofpassive nanostructures, materials designed to perform one task. The second phase, which we arejust entering, introduces active nanostructures for multitasking; for example, actuators, drugdelivery devices, and sensors. The third generation is expected to begin emerging around 2010and will feature nanosystems with thousands of interacting components. A few years after that, thefirst integrated nanosystems, functioning (according to Roco) much like a mammalian cell withhierarchical systems within systems, are expected to be developed.© 2002-2008 Center for Responsible Nanotechnology TM CRN is an affiliate of World Care®, an international, non-profit,501(c)(3) organization.



- http://en.wikipedia.org/wiki/Nano-

Nano- (symbol n) is a prefix in the metric system denoting a factor of 10−9 or 0.000000001. It is frequentlyencountered in science and electronics for prefixing units of time and length, such as 30 nanoseconds(symbol ns), 100 nanometres (nm) or in the case of electrical capacitance, 100 nanofarads (nF).The prefix is derived from the Greek νάνος, meaning "dwarf", and was officially confirmed as standard in1960.In the United States, the use of the nano prefix for the farad unit of electrical capacitance is uncommon;capacitors of that size are more often expressed in terms of a small fraction of a microfarad or a largenumber of picofarads.When used as a prefix for something other than a unit of measure, as in "nanoscience", nano means relatingto nanotechnology, or on a scale of nanometres. See nanoscopic scale.

SI prefixesPrefix Symbol 10 n Decimal Short scale Long scaleyotta Y 1024 1000000000000000000000000 Septillion Quadrillionzetta Z 1021 1000000000000000000000 Sextillion Trilliardexa E 1018 1000000000000000000 Quintillion Trillionpeta P 1015 1000000000000000 Quadrillion Billiardtera T 1012 1000000000000 Trillion Billiongiga G 109 1000000000 Billion Milliardmega M 106 1000000 Millionkilo k 103 1000 Thousandhecto h 102 100 Hundreddeca da 101 10 Ten

100

1 Onedeci d 10-1 0.1 Tenthcenti c 10-2 0.01 Hundredthmilli m 10-3 0.001 Thousandthmicro ì 10-6 0.000001 Millionthnano n 10-9 0.000000001 Billionth Milliardthpico p 10-12 0.000000000001 Trillionth Billionthfemto f 10-15 0.000000000000001 Quadrillionth Billiardthatto a 10-18 0.000000000000000001 Quintillionth Trillionthzepto z 10-21 0.000000000000000000001 Sextillionth Trilliardthyocto y 10-24 0.000000000000000000000001 Septillionth Quadrillionth

The International System of Units (SI) specifies a set of unit prefixes known as SI prefixes or metric prefixes.An SI prefix is a name that precedes a basic unit of measure to indicate a decadic multiple or fraction of theunit. Each prefix has a unique symbol that is prepended to the unit symbol.

Name Abbrev. Decimal Representative objects with th is size scale

metre m 100 Height of a 7-year-old child.

deci- dm 10-1 Size of our palm.

centi- cm 10-2 Length of a bee.

milli- mm 10-3 Thickness of ordinary paperclip.

micro- ìm 10-6 Size of typical dust particles.

nano- nm 10-9 The diametre of a C60 molecule is about 1 nm.

pico- pm 10-12 Radius of a Hydrogen Atom is about 23 pm.

femto- fm 10-15 Size of a typical nucleus of an atom is 10 fm.

atto- am 10-18 Estimated size of an electron



http

://co

mm

ons.

wik

imed

ia.o

rg/w

iki/C

omm

ons:

Fea

ture

d_pi

ctur

e_ca

ndid

ates

/Imag

e:B

iolo

gica

l_an

d_te

chno

logi

cal_

scal

es_c

ompa

red-

en.s

vg



GGGGGGGGrrrrrrrraaaaaaaapppppppphhhhhhhheeeeeeeennnnnnnneeeeeeee

- http://en.wikipedia.org/wiki/Graphene

Graphene is a one-atom-thick planar sheet of sp2-bonded carbon atoms that are densely packedin a honeycomb crystal lattice. It can be viewed as an atomic-scale chicken wire made of carbonatoms and their bonds. The name comes from GRAPHITE + ENE; graphite itself consists of manygraphene sheets stacked together.

Graphene is an atomic-scale chicken wiremade of carbon atoms.

Integrated circuits

Graphene has the ideal properties to be an excellent component of integrated circuits. Graphene has a highcarrier mobility, as well as low noise allowing it to be utilized as the channel in a FET. The issue is that singlesheets of graphene are hard to produce, and even harder to make on top of an appropriate substrate.Researchers are looking into methods of transferring single graphene sheets from their source of origin(mechanical exfoliation on SiO2 / Si or thermal graphitization of a SiC surface) onto a target substrate ofinterest. In 2008, the smallest transistor so far, one atom thick, 10 atoms wide was made of graphene.

Transparent conducting electrodes

Graphene's high electrical conductivity and high optical transparency make it a candidate for transparentconducting electrodes, required for such applications as touchscreens, liquid crystal displays, organicphotovoltaic cells, and OLEDs. In particular, graphene's mechanical strength and flexibility are advantageouscompared to indium tin oxide, which is brittle, and graphene films may be deposited from solution over largeareas.



NNNNNNNNaaaaaaaannnnnnnnoooooooottttttttuuuuuuuubbbbbbbbeeeeeeeessssssss- http://en.wikipedia.org/wiki/Carbon_nanotube

3D model of three types of single-walled carbon nanotubes.

Carbon nanotubes (CNTs) are allotropes of carbon with a nanostructure that can have a length-to-diameterratio greater than 1,000,000. These cylindrical carbon molecules have novel properties that make thempotentially useful in many applications in nanotechnology, electronics, optics and other fields of materialsscience. They exhibit extraordinary strength and unique electrical properties, and are efficient conductors ofheat. Inorganic nanotubes have also been synthesized.Their name is derived from their size, since the diameter of a nanotube is in the order of a few nanometers(approximately 1/50,000th of the width of a human hair), while they can be up to several millimeters in length(as of 2008). Nanotubes are categorized as single-walled nanotubes (SWNTs) and multi-walled nanotubes(MWNTs).

- http://www.unidym.com/technology/about_carbon.htmlWhat are Carbon Nanotubes?Carbon nanotubes (CNTs) are tubular cylinders of carbon atoms that have extraordinary electrical,mechanical, optical, thermal, and chemical properties.



Individual carbon nanotubes can conduct electricity better than copper, possess higher tensile strength thansteel, and conduct heat better than diamond. In electronic applications, carbon nanotubes can possess highermobilities than single crystal silicon. All this in a material that is over 10,000 times thinner than a human hair.

There are multiple forms of carbon nanotubes, varying in diameter, length, and in the tendency of thenanotubes to form ropes and bundles of tubes. Some forms of carbon nanotubes are metallic and highlyconducting; other forms are semiconducting, and can form the basis of electronic switches.

- http://www.unidym.com/technology/about_carbon_more.htmlCARBON NANOTUBESCarbon nanotubes (fullerene nanotubes) are part of the fullerene family of carbon materials discovered by Dr.Richard E. Smalley and colleagues in 1985. They include single-wall carbon nanotubes (SWNTs), and nested(endohedral or endotopic) SWNTs, i.e., one, two or more tubular fullerenes nested inside another tubularfullerene. Each tubular fullerene is a huge carbon molecule, often having millions of carbon atoms bondedtogether to form a tiny tube. Carbon nanotube diameters range from about 0.5 to about 10 nanometers (onenanometer = 10-9 meter) and their lengths are typically between a few nanometers and tens of microns (onemicron = 10-6 meter).

Carbon is a truly remarkable atom. It readily bonds with itself into extended sheets of atoms comprising linkedhexagonal rings shown below. Each carbon atom is covalently bonded to its three nearest neighbors.



This unique sheet structure is called graphene. Solid graphite is made up of layers of graphene stacked asshown above. No other element in the periodic table bonds to itself in an extended network with the strength ofthe carbon-carbon bond, which is among the strongest of chemical bonds. Some of the electrons in thecarbon-carbon bonds are free to move about the entire graphene sheet, rather than stay home with their donoratoms, giving the structure good electrical conductivity. The tight coupling between atoms in the carbon-carbon bond provides an intrinsic thermal conductivity that exceeds almost all other materials. As suggestedby the carbon nanotube figure above, the structure of a fullerene nanotube is that of a sheet of graphene,wrapped into a tube and bonded seamlessly to itself. This is a true molecule with every atom in its place andvery few defects: an example of molecular perfection on a relatively large scale.

The special nature of the bonded carbon sheet, the molecular perfection of carbon nanotubes, and their longtubular shape endow them with physical and chemical properties that are unlike those of any other material.These properties include high surface area, excellent electrical and thermal conductivity, and tremendoustensile strength, stiffness, and toughness.

In a single tube, every atom is on two surfaces - the inside and the outside, and a single gram of nanotubeshas over 2400 m2 of surface area! The nature of the carbon bonding gives the tubes their great tensilestrength and electrical and thermal conductivity. The carbon nanotubes' stiffness and toughness derives fromtheir molecular perfection. In most materials the actual observed stiffness and toughness are degraded verysubstantially by the occurrence of defects in their structure. For example, high strength steel typically fails atabout 1% of its theoretical breaking strength. Carbon nanotubes, however, achieve values very close to theirtheoretical limits because of their perfection of structure - there are no structural defects where mechanicalfailures can begin! It is, however, the tubular geometry of carbon nanotubes that gives them their most exoticproperties. Depending on the orientation of the graphene sheet forming the tube's wall, the tube can be eithermetallic or semiconducting. The metallic tubes conduct electricity just as metals do and the semiconductingones have great promise as the basic elements of a new paradigm for electronic circuitry at the molecularlevel.

Basic StructureThere are literally hundreds of different carbon nanotube structures. One can identify these structures bythinking of the carbon nanotube as a sheet of graphene wrapped into a seamless cylinder. As one mightimagine, there are many ways to wrap a graphene cylinder, and the cylinder can have a wide range ofdimensions. Soon after fullerene nanotubes were discovered, a classification scheme was devised to describethe different conformations of graphene cylinders. This classification scheme uses an ordered pair of numbers,(n,m), and is based upon the diagram of graphene shown below. Each carbon atom in the graphene sheet isbonded to three other carbon atoms, forming a Y-shaped vertex of carbon-carbon bonds. In order to make aseamless graphene tube of a uniform diameter, one must wrap the graphene sheet in a way that permits everycarbon atom in the cylinder to be bonded to three other carbon atoms where the sheet joins to itself. Thenumber of ways this wrapping can be achieved is countable according to the numbering scheme given in thefigure below. The unit vectors of the 2-dimensional graphene lattice are shown as a1 and a2 below. Eachvertex that could possibly join to the origin during a wrapping operation is labeled with an ordered pair whereinthe first number of the pair is the distance (in lattice repeat units) of the vertex from the origin along a1, andthe second number is the distance of the vertex from the origin along a2.



- http://www.unidym.com/technology/cnt_application_electronics.htmlTransparent Conductive FilmsOne of the more amazing attributes of carbon nanotubes is that they can form films that are highly electricallyconductive, but almost completely transparent. The film is only about 50 nanometers thick, and very porous.Under an electron microscope, the film is seen to be a just a few layers of endless carbon nanotube ropes.The films have an ideal conductivity for multiple types of touch screens which have applications includingpoint-of-sale terminals, games, portable computers, cell phones, personal digital assistants and many others.The transparent films used initially for touch screens also reach any application that requires a large-areatransparent conductor, including LCD displays, plastic solar cells, and organic LED lighting, and transparentcarbon nanotube films have been demonstrated in the laboratory to be effective in all these areas.

Printable TransistorsThe semiconducting properties of carbon nanotubes can be exploited to create printable transistors withextremely high performance. Specifically, researchers have shown CNT-based transistors employing a sparsenanotube network to achieve mobilities of 1 cm2/V-s (Schindler et al., Physica E (2006), while those using analigned array of single-walled nanotubes can reach as high as 480 cm2/V-s [Kang et al., Nature Nanotech. 2,230 (2007)]. Nanotubes also prove to be useful additives to polymer-based TFTs and help to overcome someof the shortcomings of those devices. Beyond their performance, such devices are compatible with solution-based printing techniques, which enable dramatic cost savings in such devices as LCDs and OLED-baseddisplays.

Field EmissionCarbon nanotubes are the best field emitters of any known material. This is understandable, given their highelectrical conductivity, and the unbeatable sharpness of their tip. If the tip is placed close to another electrodeand a voltage is applied between the tube and electrode, a large electric field builds up near the tip of the tube.The magnitude of the electric field is inversely proportional to the radius of curvature of the tip. Thus thesharper the tip is, the larger the electric field. Even with only a few volts applied to an electrode a few micronsaway from the nanotube tip, electric fields in the range of a millions of Volts per centimeter will build up nearthe tip. These fields are large enough to pull a substantial number of electrons out of the tip. As "cold cathode"electron emitters, carbon nanotube films have been shown to be capable of emitting over 4 Amperes persquare centimeter. Furthermore, the current is extremely stable [B.Q. Wei, et al. Appl. Phys. Lett. 79 1172(2001)]. An immediate application of this behavior receiving considerable interest is in field-emission flat-paneldisplays. Instead of a single electron gun, as in a traditional cathode ray tube display, there is a separateelectron gun for each pixel in the display. The high current density, low turn-on and operating voltage, andsteady, long-lived behavior make carbon nanotubes ideal field emitters for this application. Other applicationsutilizing the field-emission characteristics of carbon nanotubes include: high-resolution x-ray sources, generalcold-cathode lighting sources, high-performance microwave tubes, lightning arrestors, and electronmicroscope cathodes.

Integrated CircuitsNanotubes might also represent a solution to thermal management problems plaguing the semiconductorindustry. As more and more transistors are packed on chips, microprocessors are getting hotter and noisier.The industry is searching for new types of heat sinks to control temperatures on chips. Nanotubes havetremendous thermal conductivity, and a number of firms are developing nanotube-based heat sinks. Due tothe unique conducting and semiconducting properties of nanotubes, devices based on individual carbonnanotubes may eventually replace existing silicon devices. For example, several prototypes for future memorydevices based on nanotubes have been demonstrated. In light of their high carrying capacity, nanotubes mightreplace copper interconnects in integrated circuits. Additionally, individual nanotubes have been shown to besuperior to existing silicon transistors and diodes.

- http://thefutureofthings.com/news/1106/high-speed-carbon-nanotube-based-chips.htmlHigh Speed Carbon Nanotube Based ChipsA team of electrical engineers from Stanford University and Toshiba have developed nanotube wires that canwithstand data transfer speeds comparable to those of commercially available chips. In a paper published inthe _Nano Letters" Journal, the researchers reported they had successfully used nanotubes to wire a siliconchip operating at the same speeds as today's processors.



PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss - http://en.wikipedia.org/wiki/Printed_electronics

Printed electronics is a set of printing methods used to create electrical devices. Paper's rough surface andhigh water absorption rate has focused attention on materials such as plastic, ceramics and silicon. Printingtypically uses common printing equipment, such as screen printing, flexography, gravure, offset lithographyand inkjet. Electrically functional electronic or optical inks are deposited on the substrate, creating active orpassive devices, such as thin film transistors or resistors. Printed electronics is expected to facilitatewidespread, very low-cost, low-performance electronics for applications such as flexible displays, smart labels,decorative and animated posters, and active clothing that do not require high performance.The term printed electronics is related to organic electronics or plastic electronics, in which one or more inksare composed of carbon-based compounds. These other terms refer to the ink material, which can bedeposited by solution-based, vacuum-based or some other method. Printed electronics, in contrast, specifiesthe process, and can utilize any solution-based material, including organic semiconductors, inorganicsemiconductors, metallic conductors, nanoparticles, nanotubes, etc.

- http://alislab.com/research/sub01.htmlPrinted electronics (also called electronic printing) is the term for a relatively new technology that defines theprinting of electronics on common media such as paper, plastic using standard printing processes. Thisprinting preferably utilizes common press equipment in the graphics arts industry, such as screen printing,flexography, gravure, contact printing and offset lithography. Instead of printing graphic arts inks, families ofelectrically functional electronic inks (conducting polymer, SWNT, insulator solution, etc) are used to printactive devices, such as thin film transistors, electronic paper, and flexible displays. Printed electronics isexpected to facilitate widespread and very low-cost electronics useful for applications not typically associatedwith conventional silicon based electronics, such as flexible displays, RF-ID tags, printing displays, andfunctional clothing.

- http://en.wikipedia.org/wiki/Conductive_polymerConductive polymers or more precisely intrinsically conducting polymers (ICPs) are organic polymersthat conduct electricity. Such compounds may have metallic conductivity or be semiconductors. The biggestadvantage of conductive polymers is their processability. Conductive polymers are also plastics, which areorganic polymers. Therefore, they can combine the mechanical properties (flexibility, toughness, malleability,elasticity, etc.) of plastics with high electrical conductivity.

- http://www.nanowerk.com/spotlight/spotid=1814.php



The fabrication of electronic devices on plastic substrates has attracted considerable recent attention owing tothe proliferation of handheld, portable consumer electronics. Plastic substrates possess many attractiveproperties including biocompatibility, flexibility, light weight, shock resistance, softness and transparency.Achieving high performance electronics or sensors on plastic substrates is difficult, because plastics melt attemperatures above 120 degrees C. Central to continued advances in high-performance plastic electronics isthe development of robust methods for overcoming this temperature restriction. Unfortunately, high qualitysemiconductors (such as silicon) require high growth temperatures, so their application to flexible plastics isprohibited. A group of researchers at the California Institute of Technology now showed that highly orderedfilms of silicon nanowires can be literally glued onto pieces of plastic to make flexible sensors with state-of-the-art sensitivity to a range of toxic chemicals. These nanowires are crystalline wires made out of doped silicon –the mainstay of the computer industry. By etching nanowires into a wafer of silicon, and then peeling them offand transferring them to plastic, they developed a general, parallel, and scalable strategy for achieving highperformance electronics on low cost plastic substrates.

Photograph of the flexible sensor chip (Image: Heath Group, Caltech)By Michael Berger, Copyright 2008 Nanowerk LLC

- http://www.gizmag.com/go/4749/picture/16223/By Mike Hanlon September 15, 2005First polymer electronic transistor produced completely by means of continuous mass printing technology. Thefinger structure of the source/drain electrodes can be seen, behind them lies the reddish semiconsuctor layer.The gate electrode lies invisibly behind the white insulator layer.

Source: [pmTUC] Institute for Print- und Media Technologyhttp://www.tu-chemnitz.de/mb/PrintMedienTech/pminstitut_en/download_en.php

- http://printedelectronics.idtechex.com/printedelectronicsworld/en/aboutus.asp



About Printed Electronics WorldPrinted Electronics World provides you with a daily update of the latest industry developments. Launched inMay 2007, this free portal covers the progress to printed electronics in all its forms - from transistor circuits topower, sensors, displays, materials and manufacturing.Hosted and written by IDTechEx, the leading printed electronics analyst and event organiser, articles providecommentary, analysis and give a balanced view of the issue.Copyright © 2008 IDTechEx Ltd.

- http://www.gizmag.com/biocompatible-flexible-led-array/16708/

Flexible, biocompatible LEDs could light the way fo r next gen biomedicineBy Ben Coxworth October 22, 2010Researchers from the University of Illinois at Urbana-Champaign have created bio-compatible LED arrays thatcan bend, stretch, and even be implanted under the skin. While this might cause some people to immediatelythink _glowing tattoos!", the arrays are actually intended for activating drugs, monitoring medical conditions, orperforming other biomedical tasks within the body. Down the road, however, they could also be incorporatedinto consumer goods, robotics, or military/industrial applications.Many groups have been trying to produce flexible electronic circuits, most of those incorporating new materialssuch as carbon nanotubes combined with silicon. The U Illinois arrays, by contrast, use the traditionalsemiconductor gallium arsenide (GaAs) and conventional metals for diodes and detectors.

An LED array, transfer printed onto the fingertip of a vinyl glove



Bending with a folded piece of paper

Last year, by stamping GaAs-based components onto a plastic film, Prof. John Rogers and his team were ableto create the array's underlying circuit. Recently, they added coiled interconnecting metal wires and electroniccomponents, to create a mesh-like grid of LEDs and photodetectors. That array was added to a pre-stretchedsheet of rubber, which was then itself encapsulated inside another piece of rubber, this one being bio-compatible and transparent.The resulting device can be twisted or stretched in any direction, with the electronics remaining unaffectedafter being repeatedly stretched by up to 75 percent. The coiled wires, which spring back and forth like atelephone cord, are the secret to its flexibility. The research was recently published in the journal NatureMaterials.



- http://blog.targethealth.com/?p=14473

Roll-to-roll Plastic DisplaysOct 22 2010A new company puts silicon transistors on plastic for flexible displays

This plastic material is used as the backing for Phicot’s amorphous silicon electronics. Credit: Phicot



Organic electronics (see also Printed electroni c)

- http://en.wikipedia.org/wiki/Organic_electronicsOrganic electronics , or plastic electronics , is a branch of electronics that deals with conductive polymers,plastics, or small molecules. It is called 'organic' electronics because the polymers and small molecules arecarbon-based, like the molecules of living things. This is as opposed to traditional electronics which relies oninorganic conductors such as copper or silicon.Conductive polymers are lighter, more flexible, and less expensive than inorganic conductors. This makesthem a desirable alternative in many applications. It also creates the possibility of new applications that wouldbe impossible using copper or silicon.

Organic electronics not only includes organic semiconductors, but also organic dielectrics, conductors andlight emitters.

New applications include smart windows and electronic paper. Conductive polymers are expected to play animportant role in the emerging science of molecular computers.

In general organic conductive polymers have a higher resistance and therefore conduct electricity poorly andinefficiently, as compared to inorganic conductors. Researchers currently are exploring ways of "doping"organic semiconductors, like melanin, with relatively small amounts of conductive metals to boost conductivity.However, for many applications, inorganic conductors will remain the only viable option.

Organic electronics can be printed.



IIIIIIIInnnnnnnnkkkkkkkk ffffffffoooooooorrrrrrrr ““““““““pppppppprrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss””””””””

- http://www.printelectronicnews.com/2820/epoxy-ink-for-printed-electronics/Fine-Line Epoxy Ink Recommended for Printed Electro nics ApplicationsDecember 2nd, 2010

Creative Materials, Inc., introduces 125-26, an exceptional conductive ink for screen- printing circuits with fine-line widths and spaces. Creative Materials is expanding its line of products for the printed electronics market.Our newest product, 125-26A/B119-44 is a flexible two-part epoxy ink that features superior adhesion to ITO-coated surfaces and other low surface-energy substrates. This product has been used successfully in printedelectronics applications and is recommended where high-performance on coated substrates is necessary.

- http://www.printelectronicnews.com/2732/new-film-technologies/New film technologies for printed polymer electroni cs developedOctober 22nd, 2010Conductive nano inks for flexible circuitsBayer MaterialScience develops conductive and formable nano inks for use in areas such as printed polymerelectronics under the BayInk® name. These can be applied digitally using Depending on the process, it ispossible to apply line widths with a resolution of less than 30 micrometers that are no longer visible to thehuman eye. This enables conductor tracks, contacts and electrodes to be applied much more easily andeffectively than with conventional methods, which are mostly more complicated and more energy- andmaterial-intensive.The inks ad here to a very wide range of plastic films such as Makrofol® and Bayfol® and other flexiblematerials, as well as to rigid substrates. The range of applications is wide – for example, as invisible conductortracks they can be used to simplify the complex design of touchscreens.Customized service along the entire process chain.

- http://www.nanotech-now.com/news.cgi?story_id=36811Conductive nano inks for printed electronicsLeverkusen | February 17th, 2010The two conductive inks BayInk® TP S and BayInk® TP CNT from Bayer MaterialScience have beendeveloped primarily for use in the growing “printed electronics” market. These new inks boast excellentadhesion to plastic films, other flexible substrates, glass, silicon and indium tin oxide.

- http://www.nanowerk.com/news/newsid=16884.phpMethode's Inkjet Printable Conductive Ink Allows Prin ting of Circuits on Polyester with No Secondary Curi ngJune 24, 2010(Nanowerk News) Methode Development Company, a business unit of Methode Electronics, Inc., announcesthat its conductive inkjet printable ink can now print circuits directly onto treated polyesters. The ink,formulated for thermal and piezo inkjet systems, makes it possible for engineers to print working electricalcircuits, right from their desktops – facilitating product development, prototyping, and manufacturingprocesses. With this technology, scale-up for high volume manufacturing can be easily achieved.



- http://www.inktec.com/english/product_info/electronic_tec.aspTransparent Electronic ConductiveTEC is the acronym of _Transparent Electronic Conductive," and one of the salient features of that TEC ink isits transparency at liquid phase. It means TEC is non-particle type ink before sintering and specially designedby InkTec, which is a world-class research and manufacturing company of inkjet applications.

- http://nanotechweb.org/cws/article/tech/33180Inkjet prints transparent CNT film.Transparent conductive film for use in displays is one of the headline applications for carbon nanotubes(CNTs). The interconnected material is seen as being more robust than today's ITO electrodes and couldprove a popular choice for flexible devices, but the challenge is to bring down production costs.

- http://www.epson.co.jp/e/newsroom/news_2004_11_01.htmEpson Inkjet Technology Used to Fabricate World's F irst Ultra-Thin Multilayer Circuit Board.Epson recently succeeded in producing a 20-layer circuit board sample by using an inkjet system to alternately"draw" patterns and form layers on the board using two types of ink: a conductive ink containing a dispersionof silver micro-particles measuring from several nanometers to several tens of nanometers in diameter, and anewly developed insulator ink.Copyright © 2008 SEIKO EPSON CORP

- https://buffy.eecs.berkeley.edu/PHP/resabs/resabs.php?f_year=2005&f_submit=one&f_absid=100770High-Performance All-Inkjet-Printed Transistors for Ultra-low-cost RFID ApplicationsDec 16, 2010Alejandro De La Fuente Vornbrock, Steven Edward Molesa, David Howard Redinger and Steven K. Volkman(Professors Ali Niknejad and Vivek Subramanian)Semiconductor Research Corporation, Defense Advanced Research Projects Agency and National Science Foundation

Printed electronics will enable the development of ultra-low-cost RFID circuits for use as electronic barcodes,since it eliminates the need for lithography, vacuum processing, and allows the use of low-cost webmanufacturing. Recently, there have been several demonstrations of printed transistors with mobilitiesapproaching or exceeding 1 cm2/V-s; however, all such devices have been fabricated using silicon substrateswith thermally grown oxides or using vacuum sublimated materials. In order to achieve ultra low cost,performance must be maintained without silicon substrates or vacuum processing.

- http://www.laserfocusworld.com/display_article/206960/12/none/none/Feat/Semiconductor-ink-advances-flexible-displaysSemiconductor ink advances flexible displaysThe technique being developed fabricates devices using high-volume inkjet printing to replace thephotolithographic techniques used to create the thin-film-transistor backplane circuits used in displays. Aliquid-based organic semiconductor material, developed by Xerox researchers, is used to print thesemiconductor channel layers for large-area transistor arrays.By Beng Ong - Research fellow and manager,Advanced Materials and Organic Electronics Group, Xerox Research Centre of Canada.Copyright © 2007: PennWell Corporation, Tulsa, OK



PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrr ffffffffoooooooorrrrrrrr ““““““““pppppppprrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss””””””””- http://www.ntera.com/technology/printing_processes.php

Web-Fed (Roll-to-Roll) Printed NCD Displays on Flex ible Substrate

Printing ProcessesNanoChromics Ink Systems are compatible with existing printing equipment and processes.Sheet or Web-fed Screen PrintingFlexographic PrintingInkjet PrintingLeveraging additive print processes, NanoChromics Ink Systems can be combined with other printedelectronic technologies (and traditional graphics inks) on the same substrate. Compatibility with existing,widely available printing equipment minimizes capital investment for traditional graphics printers looking toexpand into printed electronics and functional media.



- http://www.citala.com/index.php/flexible-display-technology/Roll-To-Roll-Manufacturing.htmlRoll To Roll ManufacturingCitala, US-based roll-to-roll (R2R) manufacturing is state-of-the art with a track record of reliability. Citala wasone of the first companies to offer genuine R2R manufacturing, enabling the production of large, cost-effectivequantities. R2R enables solutions for patterning, coating, cutting, and combining different layers ofcustomizable displays. Citala can manufacture flexible displays and optical shutters using the same line.

Citala's R2R-schematic diagram - © Copyright 2008 Citala. All Rights Reserved

- http://www.xenoncorp.com/print_mkt.htmlPHOTONIC SINTERING OF NANOPARTICLE INKS ON LOW- TEM PERATURE SUBSTRATES:PULSED LIGHT EXCELSThe world of printed electronics is moving out of R&D and into production, and new developments inmaterials—particularly nanoparticle inks and photonic curing from Xenon Corporation—are in the driver’s seat.

Here’s what’s happening:1.) Functionally conductive inks and coatings now contain nanoparticles that permit the use of low-costsubstrates such as paper, PET and polyethylene films.2.) New developments allow inkjets and screen printers to use silver, gold and most recently, lower-costcopper nanoparticle inks. 3.) It is now possible to print at room temperature on flexible substrates such asprinted circuit boards.

Here’s the photonic curing contribution: The challenge has long been heat. How do you sinter or annealnanoparticle inks at substrate temperatures, which are typically below 160C? Xenon’s photonic pulsed lightcuring answers this challenge. High energy peak pulses, delivered in milliseconds, quickly heat only the inksand not the substrates. The high energy removes the solvent, leaving only the metal flakes which are sinteredor annealed, while the substrate is unaffected. This speed allows copper inks to be sintered too quickly for asurface oxide layer to develop, so conductivity is improved.

- http://www.oled-display.net/oled-inkjet-printingCDT is sole supplier of the Litrex range of Ink Jet. Cambridge Display Technology have also partneredindustry leaders across the globe to offer a fully inclusive ink jet package.To support the Litrex printer range CDT can offer materials, print heads, know-how and skills developmentpackages. More about OLED Inkjet Printing and PLED at http://www.cdtltd.co.uk



- http://www.litrex.com/index.asp?sect=5&page=12The Litrex _ precision inkjet printer is a low-cost, compact system for research and development ofOLED/LEP, LCD, printed electronics, and biomaterial applications.

- http://www.dimatix.com/Dimatix is driving a revolution in micro-production technology that will deliver a new generation of applicationsin imaging, electronics and the biosciences.

- http://www.dea.brunel.ac.uk/cleaner/Electronics_Projects/Handbook_1.htmOver four years research work at Brunel University has demonstrated the feasibility of manufacturing electricalcircuit interconnect via the established printing technology of offset lithography. It has been shown that offset-lithography can be used as a process for manufacture of low specification electrical interconnect, leading toreduced production time and raw material use when compared to conventional thick film printing approaches.

- http://www.dea.brunel.ac.uk/cleaner/Electronics_Projects/Handbook_2.htm

© 2008 Cleaner Electronics Research Group

Conventional and Lithographically printed circuit boards for telephone assembly.This demonstrator surpassed all others in complexity and processor speed.

- http://www.engr.uiuc.edu/news/index.php?xId=074108960714'Nanonet' circuits closer to making flexible electr onics realityBy Emil Venere, Purdue UniversityTogether, researchers at Illinois and Purdue have overcome a major obstacle in producing transistors fromnetworks of carbon nanotubes, a technology that could make it possible to print circuits on plastic sheets forapplications including flexible displays and an electronic skin to cover an entire aircraft to monitor crackformation.



TTTTTTTTrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt aaaaaaaannnnnnnndddddddd SSSSSSSSttttttttrrrrrrrroooooooonnnnnnnngggggggg PPPPPPPPllllllllaaaaaaaassssssssttttttttiiiiiiiicccccccc

Strong, Light, Transparent Plastic- http://thefutureofthings.com/news/1060/strong-light-transparent-plastic.html

Researchers from the University of Michigan (UM) ha ve developed a composite plastic, which they sayis strong as steel, but much lighter and transparen t.The scientists name several possible applications for their invention. The composite plastic could be used inthe making of stronger and lighter armor for soldiers and police forces and for protecting their vehicles. Thematerial could also be used in micro-electromechanical devices, in micro-fluidics and biomedical sensors, invalves, and in unmanned aircrafts.Copyright © 2009 The Future of Things. All rights reserved

- http://www.trnmag.com/Photos/2008/033108/Flexible%20silicon%20circuits%20Image.htmlFlexible siliconStretchable and bendable computer circuits made from ordinarily brittle single-crystal silicon promise flexibleelectronic devices that perform at nearly the same level as today's rigid computer chips.© Copyright Technology Research News, LLC 2000-2008. All rights reserved.

- http://www.news.uiuc.edu/news/08/0327electronics.htmlFoldable and stretchable, silicon circuits conform to many shapes

- http://www.wisegeek.com/what-is-the-difference-between-silicon-and-silicone.htmDifference Between Silicon and Silicone



TTTTTTTTrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt EEEEEEEElllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss- http://www.indiastudychannel.com/resources/98936-Transparent-Electronics-or-Invisible-Electronics.aspxTransparent Electronics -- or Invisible ElectronicsDec 2009 By Pratima

Transparent electronics is a emerging technology, which is satisfying the requirements of everything invisibleor multi-purpose objects.

What is Transparent Electronics?Its just Technology for next generation of optoelectronic devices and employs wide band-gap semiconductorsfor the realization of invisible circuits. Oxide semiconductors are very interesting materials because theycombine simultaneously high/low conductivity with high visual transparency.

How it works?Transparent oxide semiconductor based transistors have recently been proposed using as active channelintrinsic zinc oxide (ZnO). The main advantage of using ZnO deals with the fact that it is possible to growthat/near room temperature high quality polycrystalline ZnO, which is a particular advantage for electronicdrivers, where the response speed is of major importance. Besides that, since ZnO is a wide band gapmaterial (3.4 eV), it is transparent in the visible region of the spectra and therefore, also less light sensitive.

Applications:They have been widely used in a variety of applications like:1.antistatic coatings2.touch display panels3.solar cells,4.flat panel displays5.heaters6.defrosters7.optical coatings etc

- http://kn.theiet.org/magazine/issues/1009/transparent-electronics-1009.cfmTransparent electronics look to use in smart object sJune 2010 By Chris Edwards

Transparent electronic materials will make it possible to build a new generation of smart objects.

After crash-landing on Mars in the 2000 movie 'Red Planet', Val Kilmer tries to work out where he and histeam have wound up on the surface. So, he unrolls a see-through computer that tries to match the locallandscape with the images collected by scores of unmanned Mars probes over the years.

It was a bomb at the box office. Ten years on, 'Red Planet' is not showing much sign of becoming a cultclassic and ultimately profitable like 'Blade Runner'. But it's still inspiring engineers to work out how to make aroll-up, see-through map.

Tolis Voutsas, director of the materials and devices applications lab at Sharp Laboratories of America, says:''Red Planet' was shown in 2000. And we still don't have technology to do this. But thanks to Hollywood we stillhave the vision.'

Director Antony Hoffman reckoned it might take a while to realise the transparent map. 'Red Planet' was set in2056. Engineers such as Chris Bower, principal scientist at Nokia's research centre in Cambridge, are hopingthat they can develop something similar much more quickly.

Working on morphA couple of years ago, Nokia unveiled what it called the Morph concept. A set of videos showed what the

portable computer and phone of the future might look like. Bower explained the idea at the PrintedElectronics conference in Dresden in April: 'You can take a standard candy-bar phone and transform it.You can wrap it around your wrist so that it becomes a wearable device.

'We are working hard to enable the Morph concept. We are trying to build a library of functional surfacematerials that provide the ability to change colour or haptic feedback. We also need compliancy to reshape



the device, with flexible and even stretchable displays. And transparency is something we require,' saysBower, showing a Photoshop-assisted mockup of Nokia's take on the transparent navigator.

The roll-up map is not the only applications for see-through electronics. Douglas Keszler of Oregon StateUniversity, a leading researcher into transparent metal oxides, reckons these materials will find uses in cardashboards and windows to provide extra real estate for computer circuits.

Carbon nanotubes and plastics are vying with metal oxides for a role in transparent electronics, but the metalshave a solid lead historically.

'We believe metal oxides can enable transparent electronics and they have been around for some time,' saysFlora Li, research associate at the University of Cambridge.

In the Second World War, aircraft makers used transparent conductive oxides to deliver heat to windshields tokeep them free of ice. Indium tin oxide (ITO) has become the one material that appears almost everywhereas a conductive coating for flat-screens and touchscreens. Unfortunately, the key component, indium, is avery rare and expensive metal, giving researchers a strong incentive to find other options.

Peter Harrop, chairman of analyst firm IDTechEx, says: 'It's a defeat that indium tin oxide is still used fortransparent electronics. There are replacements but they need to gain traction. That is a big opportunity fora lot of people.'

Li says ITO represents the first generation of transparent electronics, forming just passive conductors on thesurface of screens. 'The phase we are in now, we consider the second generation, allowing us to fabricatediscrete transparent components,' she claims. The coming third generation will put active transparentcomponents into many more devices.

Thin-film transistors made out of metal oxides date back to the the 1960s but it's only since the late 1990s thatresearch has shown that it is possible to create a library of standard components that you can see through.Keszler points to a paper on the creation of a p-type transistor by Hiroshi Kawazoe and colleagues at theTokyo Institute of Technology in 1997 as the birth of modern transparent electronics. Up to that point, allthe conductors were n-type. With the two types available, it became feasible to build thin-film diodes andtransistors.

There is a reason why transparent metal oxides are not more widely used in electronics. As with the organicpolymers used in printed electronics, electrons do not move easily through most of them. According toKeszler, the best materials have a conductivity more than ten times worse than the contact metals usedtoday in silicon chips.

Li says even with this lower performance, there is still a useful role for these devices. She compares metaloxides to lower-grade forms of silicon used in flat-panel displays, such as polycrystalline and amorphous,non-crystalline silicon, often called alpha-silicon.

'Polysilicon gives you great mobility. But you need to use really high temperatures to get this. Alpha-silicon youcan make at much lower temperatures but at the expense of lower mobility. This is where we believetransparent metal oxides fit in: filling a gap between organic materials and alpha-silicon in terms of cost andperformance,' says Li.

Whereas alpha-silicon generally has a mobility of around 1cm/Vs, researchers have managed to achievearound 30cm'/Vs for the widely available material zinc oxide, which is still five times lower than thepolysilicon used in high-end displays but is usable.

Mobility is only one of the concerns that researchers have with metal oxides. Sharp worked with startup Inpria,which Keszler co-founded, on indium gallium zinc oxide transistors. 'However, the current doesn't saturate,'says Voutsas, in the way that it should for a workable transistor. 'And the threshold voltage is high. That iswhy you don't see a product that uses amorphous-oxide TFTs.'

As with the the transistor, researchers are working with a range of metals in the hope of finding combinationsthat work. Li says many of these materials are binary oxides that are difficult to produce reliably usingsputtering - the balance between the two metals in the oxide varies, disrupting its ability to conductelectricity.



Like silicon-based processes, the metals can migrate into other layers, which Li found with indium zinc oxideand hafnium oxide gates. 'We found the indium migrated into the hafnium layer and destroyed the device.What we found really works with indium zinc is aluminium,' says Li. On the other hand, zinc oxides seem towork well with hafnium oxide.

With work continuing on indium-based oxides, materials scientists have yet to find a genuine low-cost, easilyavailable winner in transparent conductive oxides. 'But we think that this is one of the technologies that willemerge soon,' Voutsas concludes.

- http://www.technologyreview.com/computing/21964/?a=fHigh-quality, clear graphene films are a leap towar d bendable OLED displays.Korean researchers have found a way to make large graphene films that are both strong and stretchy andhave the best electrical properties yet.Prachi Patel-Predd - © 2009 - .technologyreview.com

© 2009 Ji Hye Hong

- http://www.sciencenews.org/view/access/id/39865/title/Graphene_from_gases_for_new,_bendable_electronics_Graphene from gases for new, bendable electronicsFlexible, translucent and ultrathin, layers of carbon atoms called graphene are also excellent electricalconductors that could find use in flexible computer displays, molecular electronics and new wirelesscommunications. Making high-quality graphene sheets is usually a slow, painstaking process, but now severalresearch groups have discovered ways to make patterned graphene circuits using techniques borrowed frommicrochip manufacturing, which can be scaled up for mass production.By Patrick Barry - ©2009 - .sciencenews.org

- http://chem.skku.edu/graphene/SKKU Graphene Research Laboratory

- http://www.nanowerk.com/spotlight/spotid=8787.phpNew work at the University of Southern California (USC) has now demonstrated the great potential ofmassively aligned single-walled carbon nanotubes for high-performance transparent electronics. "Wefabricated transparent thin-film transistors on both rigid and flexible substrates with transfer printed alignedcarbon nanotubes as the active channel and indium-tin oxide as the source, drain, and gate electrodes,"Chongwu Zhou, Jack Munushian Associate Professor in USC's Department of Electrical Engineering, tellsNanowerk. "We have fabricated these transistors through low-temperature processing, which allowed devicefabrication even on flexible substrates."By Michael Berger. Copyright 2008 Nanowerk LLC



- http://pubs.acs.org/doi/pdf/10.1021/nn800434d Transparent Electronics Based on Transfer Printed Aligned Carbon Nanotubes on Rigid and FlexibleSubstratesFumiaki N. Ishikawa, Hsiao-kang Chang, Koungmin Ryu, Po-chiang Chen, Alexander Badmaev, Lewis Gomez De Arco, Guozhen Shenand Chongwu Zhou*Department of Electrical Engineering, University of Southern California, Los Angeles, California 90089ACS Nano, Article ASAP DOI: 10.1021/nn800434d Publication Date (Web): December 10, 2008Report high-performance fully transparent thin-film transistors (TTFTs) on both rigid and flexible substrates.

- http://www.eurekalert.org/pub_releases/2008-12/uosc-urp121608.phpUSC researchers print dense lattice of transparent nanotube transistors on flexible baseIt's a clear, colorless disk about 5 inches in diameter that bends and twists like a playing card, with a lattice ofmore than 20,000 nanotube transistors capable of high-performance electronics printed upon it using apotentially inexpensive low-temperature process.Its University of Southern California creators believe the prototype points the way to such long sought afterapplications as affordable "head-up" car windshield displays. The lattices could also be used to create cheap,ultra thin, low-power "e-paper" displays.©2008 www.eurekalert.org

- http://www.nanowerk.com/spotlight/spotid=2062.phpTransparent and flexible electronics with nanowire transistorsThin-film transistors (TFTs) and associated circuits are of great interest for applications including displays,large-area electronics and printed electronics (e.g. radio-frequency identification tags - RFID). Well-established TFT technologies such as amorphous silicon and poly-silicon are well-suited for many currentapplications - almost all mobile phone color screens use them - but face challenges in extensions to flexibleand transparent applications. In addition, these TFTs have modest carrier mobilities, a measure of the velocityof electrons within the material at a given electric field. The modest mobility corresponds to a modestoperating speed for this class of TFTs. Organic TFTs are generally better suited for flexible applications, andcan be made transparent. However, mobilities in organic TFTs are generally quite low, restricting the speed ofoperation and requiring relatively large device sizes. Researchers at Purdue University, NorthwesternUniversity, and the University of Southern California now have reported nanowire TFTs that have significantlyhigher mobilities than other TFT technologies and therefore offer the potential to operate at much higherspeeds. Alternatively, they can be fabricated using much smaller device sizes, which allows higher levels ofintegration within a given chip area. They also provide compatibility with a variety of substrates, as well as thepotential for room-temperature processing, which would allow integration of the devices with a number of othertechnologies (e.g. for displays). "We have demonstrated fully-transparent thin-film transistors (TFTs) on bothglass and flexible plastic substrates" Dr. David B. Janes tells Nanowerk.

Image of NWTs on a plastic substrate, showing the optical clarity and mechanical flexibility. Arrows point to thetransistor array regions (Image: Dr. Janes)



http://www.innovations-report.com/html/reports/physics_astronomy/clear_future_electronics_transparent_memory_device_124145.htmlThe Clear Future of Electronics: Transparent Memory DeviceA group of scientists at Korea Advanced Institute of Science and Technology (KAIST) has fabricated a workingcomputer chip that is almost completely clear -- the first of its kind. The new technology, called transparentresistive random access memory (TRRAM), is described in this week's issue of the journal Applied PhysicsLetters, which is published by the American Institute of Physics. 11.12.2008

- http://www.nanowerk.com/spotlight/spotid=1858.phpElectronics can be so transparentOne of the newly emerging areas of semiconductor technology is the field of transparent electronics. Thesethin-film materials hold the promise of a new class of flexible and transparent electronic components thatwould be more environmentally benign than current electronics.However, the emerging transparent electronics technology is facing manufacturing problems: currentfabricating processes do not separate the device manufacturing from material synthesis. The transparentelectronic materials, which are largely inorganic oxides. are directly deposited on the device substrate underharsh conditions which may cause damage to the existing layer or flexible substrate. The etching of smalldimension oxide multilayer is also difficult due to the low selectivity of the etching recipe. New research resultsdemonstrate that nanofabrication techniques could solve these problems.A group of researchers from Clarkson University and Pacific Northwest National Laboratory report that clearnanocrystals can serve as the appropriate electronic materials in the transparent device. "The purpose of ourwork is to demonstrate the fabrication of transparent devices using nanofabrication and nanomaterials" Dr.Feng Hua tells to Nanowerk.By Michael Berger, Copyright 2008 Nanowerk LLC

- http://techon.nikkeibp.co.jp/article/HONSHI/20071024/141211/Transparent Electronic Products Soon a RealitySince the arrival of low-cost transparent transistors, R&D into transparent electronics has progressed rapidly.It will soon be possible, for instance, to embed transparent electronic circuits into large areas like windows,enabling the display of video imagery.Copyright © 1995-2008 Nikkei Business Publications, Inc.

- http://dx.doi.org/doi:10.1038/nnano.2007.151By Michael Berger, Copyright 2008 Nanowerk LLC

- http://nanoarchitecture.net/article/nanotubes-enable-flexible-transparent-electronicsNanotubes Enable Flexible, Transparent ElectronicsFlexible electronics have taken an important leap forward with the development of a new type of flexible,transparent electrode made using carbon nanotubes (CNTs). Jackson State University researchers made theelectrode by applying boron-doped CNTs to glass and polymer film surfaces. The devices are 89%transparent to visible light and are robust; they maintain their conducting properties even after being foldedand exposed to harsh environmental conditions.

- http://www.azom.com/News.asp?NewsID=7446Invisible ElectronicsNorthwestern University researchers report that by combining organic and inorganic materials they haveproduced transparent, high-performance transistors that can be assembled inexpensively on both glass andplastics.

- http://npl.postech.ac.kr/?mid=Trans_ElectronicAdvanced Display NanodeviceTransparent Thin film transistor(TFT)

- http://oregonstate.edu/dept/ncs/newsarch/2006/Feb06/license2.htmOSU Licenses New Transparent Electronics to HPScientists and engineers at Oregon State University have developed a new class of materials that can be usedto create safe, inexpensive and transparent electronic circuits, and licensed the exclusive rights to developand market products based on this technology to HP.



FFFFFFFFlllllllleeeeeeeexxxxxxxxiiiiiiiibbbbbbbblllllllleeeeeeee aaaaaaaannnnnnnndddddddd ttttttttrrrrrrrraaaaaaaassssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt ddddddddiiiiiiiissssssssppppppppllllllllaaaaaaaayyyyyyyyssssssss

For more info about this please see:Nanotechnology vol.2 Technology for E-books Readers (B/W & colors display)www.biodomotica.com/public/e-paper_e-book.pdf

Flexible Display

- http://www.crunchgear.com/2010/05/26/video-sonys-new-super-thin-oled-display-wraps-around-a-pencil/

- http://forum.dailymobile.se/index.php?topic=34521.0



Transparent TFT-LCD

- http://techpatio.com/2009/mobiles/sony-ericsson/sony-ericsson-xperia-pureness-600-euro-november-uk-price

Transparent OLED

- http://www.engadget.com/2010/01/07/samsungs-14-inch-transparent-oled-laptop-video/



EEEEEEEElllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiicccccccc ppppppppaaaaaaaappppppppeeeeeeeerrrrrrrr //////// EEEEEEEE--------ppppppppaaaaaaaappppppppeeeeeeeerrrrrrrr //////// EEEEEEEE--------iiiiiiiinnnnnnnnkkkkkkkk

For more info about this please see:Nanotechnology vol.2 Technology for E-books Readers (B/W & colors display)www.biodomotica.com/public/e-paper_e-book.pdf

by Emily Cooper - http://www.cooperhawk.com/contact.htm



PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd bbbbbbbbaaaaaaaatttttttttttttttteeeeeeeerrrrrrrryyyyyyyy- http://www.gizmag.com/worlds-smallest-battery-created/17237/World’s smallest battery createdBy Darren Quick December 2010

Nano Battery A tin oxide anode contorts in response to ions flowing in as the battery charges. Sandia Labshttp://www.popsci.com/science/article/2010-12/lithium-ion-batteries-swell-and-contort-while-charging-new-study-shows

Because battery technology hasn’t developed as quickly as the electronic devices they power, a greater andgreater percentage of the volume of these devices is taken up by the batteries needed to keep them running.Now a team of researchers working at the Center for Integrated Nanotechnologies (CINT) is claiming to havecreated the world’s smallest battery, and although the tiny battery won’t be powering next year’s mobilephones, it has already provided insights into how batteries work and should enable the development of smallerand more efficient batteries in the future.The tiny rechargeable, lithium-based battery was created by a team led by Sandia National Laboratoriesresearcher Jianyu Huang. It consists of a bulk lithium cobalt cathode three millimeters long, an ionic liquidelectrolyte, and has as its anode a single tin oxide (Sn02) nanowire 10 nanometers long and 100 nanometersin diameter – that’s one seven-thousandth the thickness of a human hair.Because nanowire-based materials in lithium-ion batteries offer the potential for significant improvements inpower and energy density over bulk electrodes the researchers wanted to gain an understanding of thefundamental mechanisms by which batteries work. They therefore formed the battery inside a transmissionelectron microscope (TEM) so they could study the charging and discharging of the battery in real time and atatomic scale resolution.By following the progression of the lithium ions as they travel along the nanowire, the researchers found thatduring charging the tin oxide nanowire rod nearly doubles in length. This is far more than its diameterincreases and could help avoid short circuits that may shorten battery life. This unexpected finding goesagainst the common belief of workers in the field that batteries swell across their diameter, not longitudinally.“Manufacturers should take account of this elongation in their battery design,” Huang said. “Theseobservations prove that nanowires can sustain large stress (>10 GPa) induced by lithiation without breaking,indicating that nanowires are very good candidates for battery electrodes,” he added.Atomic-scale examination of the charging and discharging process of a single nanowire had not been possiblebefore because the high vacuum in a TEM made it difficult to use a liquid electrolyte. Huang’s group overcamethis problem by demonstrating that a low-vapor-pressure ionic liquid – essentially molten salt – could functionin the vacuum environment.This means that although the work was carried out using tin oxide nanowires, Huang says the experimentscould be extended to other materials systems, either for cathode or anode studies.“The methodology that we developed should stimulate extensive real-time studies of the microscopicprocesses in batteries and lead to a more complete understanding of the mechanisms governing batteryperformance and reliability,” he said. “Our experiments also lay a foundation for in-situ studies ofelectrochemical reactions, and will have broad impact in energy storage, corrosion, electrodeposition andgeneral chemical synthesis research field.”The research team’s work is reported in the December 10 issue of the journal Science.



- http://www.energyharvestingjournal.com/articles/printed-lithium-reshaping-battery-00002104.aspEnergy Scavenging, Power Scavenging - Making small electronic and electric devices self-sufficientMar 2010 | Japan

Printed lithium reshaping battery

In February 2010, ITSUBO Advanced Materials Innovation Center and Hatanaka Electric in Japan announceda large area printed lithium polymer battery that can be reshaped as shown in the pictures. This is thestatement from Mie Prefecture Industrial Support Center for the Promotion of Education and Science, Ministryof Industry-Academia Collaboration Urban Areas (a development in the Mie Ise Bay area)."This development of advanced materials and innovation creates a new generation all-solid polymer lithiumsecondary battery. It is a world first because the all-solid polymer lithium secondary battery employs a printingprocess.This battery, involving new electrode material and electrode interface control technology and a new polymerelectrolyte, plus a separator, avoids the safety and reliability challenges of manufacturing polymer electrolytelithium ion secondary batteries. A safe, thin, bendable, large area battery has resulted, which offers ease ofstacking. Such batteries are welcome as the printed electronics sector is expected to grow rapidly.Development of this cell is continuing at the Principal Research and Development Center for Next Generation Batteries, Mie University,Mie Prefecture Industrial Research Institute (Kinseimatekku Co., Ltd., Kurehaerasutoma Co., Ltd., Shin-Co., Ltd., Toppan Printing Co.,Ltd., Myeongseong Chemical Co., Ltd.). It has been jointly conducted by the government and academia."

Photos prototype polymer lithium secondary batteries

Prototype battery performance"Cell size A6 (external dimension), cell thickness 450µm (external dimension)Initial charge and discharge efficiency of 99%Initial capacity of 45mAh (electrode material utilization efficiency of 80%)Operating voltage 1.8 V (voltage at 50% depth of discharge)Discharge rate of 0.02C ~ 1.0C of more than 100 cycle times (the current ongoing evaluation)Operating Temperature 0 ~ 25 C°

In future, we will dramatically improve the performance of the battery cell structure design and optimization ofpolymer electrolyte interface control electrode materials."Second generation lithium batteries that are safer and have better performance are incorporated in theLightning Car Company's Lightning sports car, the KleenSpeed Technologies 200mph Formula One car, theHawkes Ocean Technologies Deepflight submarines, the PC-Aero pure electric aircraft etc. but even morepowerful batteries will be welcome.For more read : Energy Harvesting and Storage for Electronic Devices 2009-2019

- http://newenergyandfuel.com/http:/newenergyandfuel/com/2010/01/08/printing-lithium-ion-batteries/Printing Lithium Ion BatteriesJanuary 2010

The Advanced Materials Innovation Center (AMIC) of MIE Industry and Enterprise Support Center, a Japan-based foundation, has developed a lithium polymer battery that can be manufactured by printing technology.



Printed Lithium Ion Sheet Battery.

The research group used a normal sheet-shaped flexible substrate but employed a printing technology thatcan be applied to roll-to-roll production. When a roll-to-roll production method is used, the thickness of theflexible substrate can be reduced, enabling the manufacturing of thin batteries.

Printed Lithium Ion Sheet Battery Side View. Quite thin.

There are two battery prototypes. One has an output voltage of about 4V at room temperature while the otherhas an output voltage of about 2V. The thickness of the battery is about 500µm, or 500 microns – that’s a half-millimeter. Its negative and positive electrodes were formed on a flexible substrate by using printingtechnology. The AMIC isn’t disclosing the battery capacity. That could be disappointing, but the point is to getsomething small and light for something small and light. Such things at this point in time aren’t going to havehuge power demands, yet.The AMIC says it did not use a printing technology to package the polymer electrolyte for the prototypes. Nordid they disclose the details of the polymer electrolyte or the negative or positive electrode materials.But the design and production by using printing technology offers reduced thickness, increased surface areasand laminated construction. Using a roll-to-roll production, costs can be reduced, and reducing costs forlithium technology is going to be a paramount concern.The sheet-shaped battery is being researched to be used with a flexible solar cell and be attached to a curvedsurface. If the battery is integrated with a solar cell formed on a flexible substrate, it is possible to build a sheetthat can be used both as a power generator and as power storage.The effort is a three-year project that will end in March 2011. During the coming year, the research groupplans to improve manufacturing technologies for commercial production, determine potential applications forthe battery and set out the targets such as battery capacity.Having the construction technology for simply sheets of batteries might open far larger fields of uses. Thecapacity issue is of some concern, but 4 volts, using simple printing to construct the battery internal parts hasto have a serious impact over time as the various anode and cathode materials are adapted to the assortedconstruction methods.The lithium polymer battery is being developed in a research project of MIE Industry and Enterprise SupportCenter with the partners of Toppan Printing Co Ltd., Shin-Kobe Electric Machinery Co. Ltd, Kureha ElastomerCo. Ltd., Kinsei Matec Co. Ltd., Meisei Chemical Works Ltd., MIE University, Suzuka National College ofTechnology and MIE Prefecture Industrial Research Institute.



One has to think now that seeing something much lower in cost and simpler to manufacture will push researchfor thinner and lighter substrates, innovations in the anode and cathode materials and some clever electrolyteapplication processes.This research bodes well for the future of lithium batteries. Still quite expensive, lithium needs to get themanufacturing costs down. Perhaps printing is the path, and at 4 volts per cell, a compelling one indeed.

- http://news.cnet.com/8301-11128_3-20004170-54.htmlby Martin LaMonica May 2010

CAMBRIDGE, Mass.--Scientists at the Massachusetts Institute of Technology have successfully coated paperwith a solar cell, part of a suite of research projects aimed at energy breakthroughs.Susan Hockfield, MIT's president, and Paolo Scaroni, CEO of Italian oil company Eni, on Tuesday officiallydedicated the Eni-MIT Solar Frontiers Research Center. Eni invested $5 million into the center, which is alsoreceiving a $2 million National Science Foundation grant, said Vladimir Bulovic, the center's director.The printed solar cells, which Bulovic showed at a press conference Tuesday, are still in the research phaseand are years from being commercialized.However, the technique, in which paper is coated with organic semiconductor material using a process similarto an inkjet printer, is a promising way to lower the weight of solar panels. "If you could use a staple gun toinstall a solar panel, there could be a lot of value," Bulovic said.

Vladimir Bulovic, director of the Eni-MIT Solar Frontiers Research Center, holds a solar cell printed ontoa piece of paper to spell MIT. This is the first paper solar cell, according to MIT and Eni.(Credit: Martin LaMonica/CNET)

The materials MIT researchers used are carbon-based dyes and the cells are about 1.5 percent to 2 percentefficient at converting sunlight to electricity. But any material could be used if it can be deposited at roomtemperature, Bulovic said. "Absolutely, the trick was coming up with ways to use paper," he said.MIT professor Karen Gleason headed the research and has submitted a paper for scientific review but it hasnot yet been published. MIT and Eni said this is the first time a solar cell has been printed on paper.During the press conference, Scaroni said that Eni is funding the center because the company understandsthat hydrocarbons will eventually run out and believes that solar can be a replacement. At the same time, hesaid, current technologies are not sufficient."We are not very active (in alternative energy) today because we don't believe today's technologies are theanswer of our problems," he said.

Quantum dotsThe paper solar cells are one of many avenues being pursued around nanoscale materials at the Eni-MITSolar Frontiers Center. Layers of these materials could essentially be sprayed using different manufacturingtechniques to make a thin-film solar cell on a plastic, paper, or metal foils.



Silicon, the predominant material for solar cells, is durable and is made from abundant materials. Manycompanies sell or are developing thin-film solar cells, which are less efficient but are cheaper to manufacture.

During a tour, Bulovic showed one of the center's labs, where researchers use a laser to blast light atnanomaterials for picoseconds. A picosecond is one trillionth of a second. The laser provides data on how thelight excites electrons in the material, which will provide clues as to whether it will make a good solar cellmaterial, he explained.MIT is focusing much of its effort on quantum dots, or tiny crystals that are only a few nanometers in size. Ahuman hair is about 50,000 to 100,000 nanometers thick.By using different materials and sizes, researchers can fine-tune the colors of light that quantum dots canabsorb, a way of isolating good candidates for quantum dot solar cells.Researchers at the center are also looking at different molecules or biological elements which can act as solarcell material. These cheap thin-film materials can be used on their own or added to silicon-based solar panelsto enhance the efficiency, Bulovic said.If 0.3 percent of the U.S. were covered with photovoltaics with 10 percent efficiency, solar power couldproduce three times the country's needs, including a transition to electric vehicles, Bulovic said. For example,the easement strip on highways could be coated with material that could capture energy from the sun.But don't expect a revolution in solar power tomorrow."I'm giving you a whole bunch of hype," Bulovic said while explaining solar's potential during the tour. "Itusually takes 10 years from the time between when you invent something and you commercialize it." Heestimated that many of the technologies in the labs were in the first three years of a five-to-seven-yeardevelopment cycle

- http://laptopreviewshop.com/flexible-li-ion-battery.htmlFlexible Li-Ion batteryMircea / September 2010

Stanford scientists created a new flexible Li-Ion battery that’s as slim as a piece of paper and can easily bend.

Researchers from Stanford invented a very slim rechargeable Lithium-Ion battery (it’s only 300 µm thick) thatcan easily bend.Scientists Liangbing Hu, Hui Wu and Yi Cui managed to transform a simple piece of paper into a functionalflexible battery . The piece of paper was covered on both sides with a layer of nano-tubes and a lithiumcompound. The lithium compound works as electrodes, while the nano-tubes collect and store electricalenergy. The piece of paper separates the electrodes and keeps the whole thing together.Following tests, these batteries endured 300 charges flawlessly. This technology can easily be applied inpaper-based electronics, an area that’s constantly evolving. Also, this technology can be used to storeelectrical energy, as Rice University professor Pulickel M. Ajayan states: “Such simple fabrication techniquescould prove useful for integrating other nanomaterials for building the next generation of energy-storagedevices.”



- http://winarco.com/ultra-thin-flexible-secondary-lithium-ion-paper-batteries-by-standford-university-researchers/Ultra-thin Flexible Secondary Lithium-ion Paper Bat teries by Standford University Researchersby Kevin Xu on September 2010

First we saw Flexible e-ink display and at the middle of this month Sony also introduces Flexible ElectronicPaper display and recently the Department of Materials Science and engineering, Stanford Universityresearchers has showing their new Innovation of Ultra-thin Flexible Secondary Lithium-ion Paper Batteries.

The Standford University Researcher is using paper as separators and free-standing carbon nanotube thinfilms as both current collectors. The current collectors and Li-ion battery materials are integrated onto a singlesheet of paper through a lamination process.

This new prototypes have been tested to be able to recharge up to 300 times without any problems. If theresearcher able to bring their product to the surface, it will be a great contribution for our future batteries.

- http://pubs.acs.org/doi/abs/10.1021/nn1018158Thin, Flexible Secondary Li-Ion Paper BatteriesLiangbing Hu†, Hui Wu†, Fabio La Mantia, Yuan Yang, and Yi Cui*Department of Materials Science and Engineering, Stanford University, Stanford, California 94305ACS Nano, 2010, 4 (10), pp 5843–5848 DOI: 10.1021/nn1018158Publication Date (Web): September 13, 2010 Copyright © 2010 American Chemical Society

There is a strong interest in thin, flexible energy storage devices to meet modern society needs forapplications such as interactive packaging, radio frequency sensing, and consumer products. In this article, wereport a new structure of thin, flexible Li-ion batteries using paper as separators and free-standing carbonnanotube thin films as both current collectors. The current collectors and Li-ion battery materials are integratedonto a single sheet of paper through a lamination process. The paper functions as both a mechanicalsubstrate and separator membrane with lower impedance than commercial separators. The CNT film functionsas a current collector for both the anode and the cathode with a low sheet resistance (5 Ohm/sq), lightweight(0.2 mg/cm2), and excellent flexibility. After packaging, the rechargeable Li-ion paper battery, despite beingthin (300 µm), exhibits robust mechanical flexibility (capable of bending down to <6 mm) and a high energydensity (108 mWh/g).



- http://www.powerpaper.com/Power Paper's printable, environment-friendly batte ry technology.Power Paper pioneered the industry's first printable thin and flexible batteries over 10 years ago, and today itsbatteries and integration technologies enable a vast range of products for consumer, medical, and industrialapplications.©2008 Power Paper Ltd.

- http://www.powerpaper.com/?categoryId=33405Power Paper

SpecificationsPower Paper has developed a number of standard clean printed batteries for use in a variety of products andapplications. Currently, the company does not offer its thin batteries as stand-alone products, however,manufacturers interested in integrating Power Paper's thin printed batteries into their own products, orengaging in joint development projects, please see partnership opportunities or contact us.

The general specifications for Power Paper’s current generation of batteries are as follows:

Primary cell (multiple cell battery packs are possible) 1.5VTypical thickness (total) 0.7 mmBending radius 2.5cm (1 inch)Nominal continuous current density (per active area) 0.1 mA/cm 2Nominal capacity (per active area) 4.5 mAh/cm 2Nominal internal resistance (1kHz impedance) 50 Ohm maxShelf life 3 yearsTemperature operating range -20°C to +60°C

- http://www.bluesparktechnologies.com/index2.htmlBlue Spark UT (Ultra-Thin) SeriesThe UT Series is the industry’s thinnest printed battery currently in production, with a 30 percent slimmerlaminate profile (as thin as 500 microns ~ 0.020 in). The batteries are extremely flexible and durable, evenunder high duty levels, and offer the same “green” advantages as the ST Series.UT batteries are available in a variety of shapes and sizes. Typical standard form factors are 1.5V, capable ofdelivering approximately 12 mAh of energy, with peak drain currents of at least 1 mA. Overall voltage, storagecapacity and thickness can be adjusted according to each customer’s power requirements.©2010 Blue Spark Technologies.



- http://ozlab1.blogspot.com/2010_01_01_archive.htmlPower cells produced T-shirt fashionBy James Sherwood July 2009

Power boffins have developed a prototype battery that’s not only lighter and thinner than existing power cells,but is produced using a printing process.

Printed Batteries Provide Paper-Thin PowerAugust 2009A team of German scientists has invented the world's first printable batteries. Thin, flexible andenvironmentally friendly, the batteries can be produced in large quantities for a fraction of what it takes toproduce conventional batteries. The new battery is also different in other ways from conventional batteries.The printable version weighs less than one gram on the scales, is not even one millimeter thick and cantherefore be integrated into bank cash cards, for example.The battery contains no mercury and is in thisrespect environmentally friendly. Its voltage is 1.5 V, which lies within the normal range.

- http://www.elektor.com/news/a-printed-battery.860844.lynkxA printed batteryMarch 2009



The printed battery is an innovation developed by the department Printed Functionalities of the FraunhoferENAS in Germany. Series connections of printed batteries are possible for the first time, thus integer multiplesof the nominal voltage of 1.5 V are realized (3 V, 4.5 V, 6 V).The battery system is zinc manganese which might be regarded as environmentally friendly. Parts of thebatteries’ components may even be composed. By using high efficient printing technologies and theadaptation of the used materials, the production yield reaches almost 100 %.The printed batteries are especially suited for thin and flexible products. These might be e.g. intelligent chipand sensor cards, medical patches and plasters for transdermal medication and vital signs monitoring, as wellas lab on chip analyses. The combination with other flexible or thin modules, at least, has to be accentuated.Hereby flexible displays and solar cells may be manufactured in the same manner of preparation andcombined where required.More info Fraunhofer website

- http://gigaom.com/cleantech/mit-researchers-print-tiny-battery-using-viruses/MIT Researchers Print Tiny Battery Using VirusesBy Craig Rubens August 2008

Using nanorobots to build circuits is so last year’s fantasy. The latest technology of tomorrow uses viruses toconstruct everything from transistors to tiny batteries to solar cells. Researchers at MIT published a paper inthe Proceedings of the National Academy of Sciences this week describing how they’ve successfully createdtiny batteries, just four- to eight-millionths of a meter in diameter, using specially designed viruses. The hope isthat these tiny batteries — which could be used in embedded medical sensors — and eventually otherelectronics, could be printed easily and cheaply onto surfaces and woven into fabrics.

Viruses are very orderly little critters and in high concentrations organize themselves into patterns, withouthigh heat, toxic solvents or expensive equipment. By tweaking their DNA, the viruses, called M13, can beprogrammed to bind to inorganic materials, like metals and semiconductors. So far, the researchers havebeen able to use viruses to assemble the anode and electrolyte, two of the three main components of abattery. Eventually the work could also be used to make tiny electronics made up of silicon-covered viruses.Gross and cool.“It’s not really analogous to anything that’s done now,” lead researcher Angela Belcher told MIT TechnologyReview late last year when describing her work. “It’s about giving totally new kinds of functionalities to fibers.”The idea of thread-like electronics has gotten the interest of the Army, which has been funding Belcher’sresearch through the Army Research Office Institute of Collaborative Biotechnologies and the Army ResearchOffice Institute of Soldier Nanotechnologies. Theoretically, these fibers could be woven into soldiers’ uniformsallowing clothing to sense biological or chemical agents as well as collect and store energy from the sun topower any number of devices.The team still has to create a cathode for the battery, but so far, so good; the researchers note that when aplatinum cathode is attached, “the resulting electrode arrays exhibit full electrochemical functionality.” Belcherhas also successfully created fibers that glow under UV light, tiny cobalt oxide wires and has even developedviruses that bind to gold. We’re still waiting to see some viral bling.



- http://www.gizmag.com/go/7018/picture/32741/Flexible see-through battery powerBy Mike Hanlon February 2007

Flexible see-through battery power

All is no longer as it seems — the clear flexible plastic in the image is a battery — it is a polymer basedrechargeable battery made by Japanese scientists. Drs Hiroyuki Nishide, Hiroaki Konishi and Takeo Suga atWaseda University have designed the battery — which consists of a redox-active organic polymer film around200 nanometres thick. Nitroxide radical groups are attached, which act as charge carriers. Because of its highradical density, the battery has a high charge/discharge capacity. This is just one of many advantages the'organic radical' battery has over other organic based materials according to the researchers. The power rateperformance is strikingly high — it only takes one minute to fully charge the battery and it has a long cycle life,often exceeding 1,000 cycles.The team made the thin polymer film by a solution-processable method — a soluble polymer with the radicalgroups attached is _spin-coated" onto a surface. After UV irradiation, the polymer then becomes crosslinkedwith the help of a bisazide crosslinking agent.A drawback of some organic radical polymers is the fact they are soluble in the electrolyte solution whichresults in self-discharging of the battery — but the polymer must be soluble so it can be spin-coated.However, the photocrosslinking method used by the Japanese team overcomes the problem and makes thepolymer mechanically tough.Dr Nishide said: This has been a challenging step, since most crosslinking reactions are sensitive to thenitroxide radical."Professor Peter Skabara, an expert in electroactive materials at the University of Strathclyde , praised the highstability and fabrication strategy of the polymer-based battery. The plastic battery plays a part in ensuring thatorganic device technologies can function in thin film and flexible form as a complete package." The news isreported in the edition of The Royal Society of Chemistry journal Chemical Communications.

- http://www.ee-yorkshire.com/yf/services/enquire.asp?id=10%20ES%2027F3%203ISQ&EnquiryType=BBSTransparent lithium ion secondary batteryAn Andalusian University has developed a novel transparent lithium ion secondary battery comprising a firsttransparent support, a first transparent electronic conductor and transparent positive and negative electrodes,a solid lithium ion electrolyte between the negative and positive electrodes, a second transparent conductorand a second transparent support. Its transparency to sunlight enables the integration of this battery into glasssurfaces of buildings making it suitable for an energy saving and self-sustainable system, including lighting ifcombined with solar cells The invention also includes a method of manufacturing the battery.

- http://www.eu-service-bb.de/data/newsletter/1314/transparent_lithium_ion_secondary_battery.pdf?PHPSESSID=d0c174598bdecb3c53c795480705a8c4Enterprise Europe Pdf document: transparent_lithium_ion_secondary_battery.pdf



- http://www.oakridgemicro.com/tech/tfb.htmThin-film rechargeable lithium batteriesThin-film rechargeable lithium batteries were developed by Dr. John Bates and his team of scientists andengineers from more than a decade of research at the Oak Ridge National Laboratory (ORNL). Unlikeconventional batteries, thin film batteries can be deposited directly onto chips or chip packages in any shapeor size, and when fabricated on thin plastics, the batteries are quite flexible.

Miniature thin film lithium battery on a ceramic substrate for use in an implantable medical device.

Some of the unique properties of thin-film batteries that distinguish them from conventional batteries include:All solid state constructionCan be operated at high and low temperatures (tests have been conducted between -20°C and 140°C)Can be made in any shape or sizeCost does not increase with reduction in size (constant $/cm2)Completely safe under all operating conditions.Copyright © 2008 Oak Ridge Micro-Energy, Inc.

- http://www.excellatron.com/advantage.htmThin Film BatteriesA unique packaging technology has also been developed by Excellatron, enabling long-term shelf life of thinfilm batteries under harsh environmental conditions, such as high pressure, high temperature, and highhumidity.

Rechargeable thin film solid state batteries manufactured by Excellatron.The total thickness of the battery is only 0.31mm

©Copyright 2008 Excellatron



- http://www.geomatec.co.jp/eng/product/products_06.htmlThin-film rechargeable batteriesCooperation development with Iwate University

Film rechargeable battery

An achievement in unparalleled thinnessThin-film rechargeable batteries are possible with a thickness of a few µm. The thin film is comprised of thesupport substrate, collectors, and electrodes, and nevertheless is thinner and more lightweight than even thethinnest current polymer batteries (several hundred µm thick).

- http://news.rpi.edu/update.do?artcenterkey=2273&setappvar=page(1)Beyond Batteries: Storing Power in a Sheet of PaperTroy, N.Y. — Researchers at Rensselaer Polytechnic Institute have developed a new energy storage devicethat easily could be mistaken for a simple sheet of black paper.Copyright © 1996—2008 Rensselaer Polytechnic Institute

- http://www.frontedgetechnology.com/gen.htmNanoEnergy® is a miniature power source designed for highly space limited micro devices such as smartcard, portable sensors, and RFID tag.©2000-2008 Front Edge Technology, Inc.

Ultra thin As thin as 0.05 mm (0.002 inch) including package.Safe & environmentally friendly All solid-state, using ceramic electrolyte LiPON developed by Oak Ridge National Laboratories.

Contains no liquid or environmental hazardous material.Long cycle life More than 1, 000 cycles at 100% depth discharge.Flexible form factor Can be made into different shapes and sizes.Low self-discharge Less than 5% per year.Bendable Can be bent and twisted without damage.



CCCCCCCChhhhhhhhaaaaaaaarrrrrrrrggggggggiiiiiiiinnnnnnnngggggggg bbbbbbbbaaaaaaaatttttttttttttttteeeeeeeerrrrrrrriiiiiiiieeeeeeeessssssss wwwwwwwwiiiiiiiitttttttthhhhhhhhoooooooouuuuuuuutttttttt wwwwwwwwiiiiiiiirrrrrrrreeeeeeeessssssss- http://web.mit.edu/newsoffice/2007/wireless-0607.htmlMIT team experimentally demonstrates wireless power transfer, potentially useful for poweringlaptops, cell phones without cords.Franklin Hadley, Institute for Soldier Nanotechnologies Massachusetts Institute of Technologyhttp://web.mit.edu/newsoffice/techtalk-info.html PDF

- http://12degreesoffreedom.blogspot.com/2008/03/wireless-electricity.htmlNo strings (or wires) attachedResearchers at the Massachusetts Institute of Technology think that transmitting power without wires is notonly possible but within reach.

- http://www.dailymail.co.uk/sciencetech/article-460602/The-end-plug-Scientists-invent-wireless-device-beams-electricity-home.htmlScientists invent wireless device that beams electricity through your home

- http://news.cnet.com/Wireless-power-gets-recharged/2100-1041_3-6147684.htmlWireless power gets rechargedBy Erica Ogg Staff Writer, CNET News.com

At the Consumer Electronics Show next week, two companies--Arizona-based start-up WildCharge andMichigan-based Fulton Innovation--will demonstrate what are expected to be very different ways to givegadgets juice, sans wires.The process creates an electromagnetic field, but does not interfere with Wi-Fi or Bluetooth devices and won'tdemagnetize credit cards, Baarman said.© 2008 CBS Interactive Inc

- https://www.wildcharge.com/index.cfm/fuseaction/category.display/category_ID/255/How_It_Works.htmThe WildCharger pad is flat and thin with a conductive surface. Once a cell phone or other electronic devicethat is enabled with WildCharge technology is placed on the pad — anywhere on the pad and at anyorientation — it will instantaneously receive power from the pad. It is that simple. And charging speed is thesame as if the device is plugged to the wall!© 2008 WildCharge_

- http://ecoupled.com/technologyMain.htmleCoupled technology _ is intelligent wireless power. It changes the way that people and devices interact withpower and data.© 2008 Fulton Innovation , LLC



WWWWWWWWiiiiiiiiTTTTTTTTrrrrrrrriiiiiiiicccccccciiiiiiiittttttttyyyyyyyy- http://en.wikipedia.org/wiki/WiTricityWiTricity , a portmanteau for wireless electricity, is a term coined initially by Dave Gerding in 2005 and usedby an MIT research team led by Prof. Marin Soljaèiæ in 2007, to describe the ability to provide electricalenergy to remote objects without wires. WiTricity is based on strong coupling between electromagneticresonant objects to transfer energy wirelessly between them. The system consists of WiTricity transmittersand receivers that contain magnetic loop antennas critically tuned to the same frequency. As WiTricityoperates in the electromagnetic near-field, the receiving devices must be no more than about a quarterwavelength from the transmitter (which is a few meters at the frequency used by the example system). In theirfirst paper, the group also simulated GHz dielectric resonators.

- http://12degreesoffreedom.blogspot.com/2008/03/wireless-electricity.html

1 Wall outlet2 Resonant copper coil attached to frequency converter and plugged into outlet3 Electromagnetic field4 Resonant copper coil attached to light bulb

Wireless LightMarin Soljaèiæ and colleagues used magnetic resonance coupling to power a 60-watt light bulb. Tuned to thesame frequency, two 60-centimeter copper coils can transmit electricity over a distance of two meters, throughthe air and around an obstacle.

- http://www.jcwa.or.jp/eng/knowledge/tech/tech05.htmlNon-contact recharging system watchesWatches recharged by using a charger are called rechargeable watches.For wrist watches, the ordinary contact recharging method is not practical as it could lead to deterioration on awatch's quality characteristics such as water resistance. In this regard, however, a non-contact rechargingsystem can be employed, so that the watch can be recharged without opening the case back when it is simplyplaced on a charger.When a watch is placed on a charger, an alternating magnetic field is created, which induces an alternatingvoltage in the internal coil of the watch. This induced voltage is rectified and stored in the energy storage unitto power the quartz watch.The mechanism of non-contact recharging system watches is explained below.



1. Place the watch on the charger.2. An alternating current of approximately 20 Hz is applied to the primary coil inside the charger to produce analternating magnetic field.3. Across the secondary coil inside the watch, the induced voltage is generated based on Faraday's law ofelectromagnetic induction.4. The alternating voltage induced across the secondary coil is rectified and stored in the secondary battery.5. The secondary battery transmits the electrical energy to the driving circuit to run the quartz watch.



SSSSSSSSoooooooollllllllaaaaaaaarrrrrrrr EEEEEEEEnnnnnnnneeeeeeeerrrrrrrrggggggggyyyyyyyy

- http://media.caltech.edu/press_releases/13325Caltech Researchers Create Highly Absorbing, Flexib le Solar Cells with Silicon Wire ArraysPasadena, Calif.— Using arrays of long, thin silicon wires embedded in a polymer substrate, a team ofscientists from the California Institute of Technology (Caltech) has created a new type of flexible solar cell thatenhances the absorption of sunlight and efficiently converts its photons into electrons. The solar cell does allthis using only a fraction of the expensive semiconductor materials required by conventional solar cells."These solar cells have, for the first time, surpassed the conventional light-trapping limit for absorbingmaterials," says Harry Atwater, Howard Hughes Professor, professor of applied physics and materials science,and director of Caltech's Resnick Institute, which focuses on sustainability research.

This is a photomicrograph of a silicon wire array embedded within a transparent, flexible polymer film.[Credit: Caltech/Michael Kelzenberg]

The light-trapping limit of a material refers to how much sunlight it is able to absorb. The silicon-wire arraysabsorb up to 96 percent of incident sunlight at a single wavelength and 85 percent of total collectible sunlight."We've surpassed previous optical microstructures developed to trap light," he says.Atwater and his colleagues—including Nathan Lewis, the George L. Argyros Professor and professor ofchemistry at Caltech, and graduate student Michael Kelzenberg—assessed the performance of these arrays ina paper appearing in the February 14 advance online edition of the journal Nature Materials.Atwater notes that the solar cells' enhanced absorption is "useful absorption.""Many materials can absorb light quite well but not generate electricity—like, for instance, black paint," heexplains. "What's most important in a solar cell is whether that absorption leads to the creation of chargecarriers."The silicon wire arrays created by Atwater and his colleagues are able to convert between 90 and 100 percentof the photons they absorb into electrons—in technical terms, the wires have a near-perfect internal quantumefficiency. "High absorption plus good conversion makes for a high-quality solar cell," says Atwater. "It's animportant advance."The key to the success of these solar cells is their silicon wires, each of which, says Atwater, "is independentlya high-efficiency, high-quality solar cell." When brought together in an array, however, they're even moreeffective, because they interact to increase the cell's ability to absorb light."Light comes into each wire, and a portion is absorbed and another portion scatters. The collective scatteringinteractions between the wires make the array very absorbing," he says.



This is a schematic diagram of the light-trapping elements used to optimize absorption within a polymer-embedded silicon wire array.[Credit: Caltech/Michael Kelzenberg]

This effect occurs despite the sparseness of the wires in the array—they cover only between 2 and 10 percentof the cell's surface area."When we first considered silicon wire-array solar cells, we assumed that sunlight would be wasted on thespace between wires," explains Kelzenberg. "So our initial plan was to grow the wires as close together aspossible. But when we started quantifying their absorption, we realized that more light could be absorbed thanpredicted by the wire-packing fraction alone. By developing light-trapping techniques for relatively sparse wirearrays, not only did we achieve suitable absorption, we also demonstrated effective optical concentration—anexciting prospect for further enhancing the efficiency of silicon-wire-array solar cells."Each wire measures between 30 and 100 microns in length and only 1 micron in diameter. _The entirethickness of the array is the length of the wire," notes Atwater. _But in terms of area or volume, just 2 percentof it is silicon, and 98 percent is polymer."In other words, while these arrays have the thickness of a conventional crystalline solar cell, their volume isequivalent to that of a two-micron-thick film.Since the silicon material is an expensive component of a conventional solar cell, a cell that requires just one-fiftieth of the amount of this semiconductor will be much cheaper to produce.The composite nature of these solar cells, Atwater adds, means that they are also flexible. "Having these becomplete flexible sheets of material ends up being important," he says, "because flexible thin films can bemanufactured in a roll-to-roll process, an inherently lower-cost process than one that involves brittle wafers,like those used to make conventional solar cells."Atwater, Lewis, and their colleagues had earlier demonstrated that it was possible to create these innovativesolar cells. "They were visually striking," says Atwater. "But it wasn't until now that we could show that they areboth highly efficient at carrier collection and highly absorbing."The next steps, Atwater says, are to increase the operating voltage and the overall size of the solar cell. "Thestructures we've made are square centimeters in size," he explains. "We're now scaling up to make cells thatwill be hundreds of square centimeters—the size of a normal cell."Atwater says that the team is already "on its way" to showing that large-area cells work just as well as thesesmaller versions.In addition to Atwater, Lewis, and Kelzenberg, the all-Caltech coauthors on the Nature Materials paper,"Enhanced absorption and carrier collection in Si wire arrays for photovoltaic applications," are postdoctoralscholars Shannon Boettcher and Joshua Spurgeon; undergraduate student Jan Petykiewicz; and graduatestudents Daniel Turner-Evans, Morgan Putnam, Emily Warren, and Ryan Briggs.Their research was supported by BP and the Energy Frontier Research Center program of the Department ofEnergy, and made use of facilities supported by the Center for Science and Engineering of Materials, aNational Science Foundation Materials Research Science and Engineering Center at Caltech. In addition,Boettcher received fellowship support from the Kavli Nanoscience Institute at Caltech.Lori Oliwenstein (626) 395-3631 [email protected]



- http://www.solarisnano.com/coretechnologies.phpSolaris has proprietary and patented approaches for dramatically lowering the cost of solar panels andimproving the efficiency of photovoltaics.Our proven and validated process for recharging of low manufacturing cost dye sensitized solar cells (DSSC)eliminates the existing lifetime limitations of these photovoltaics, allowing them to function beyond the lifetimeof current silicon technology. When combined with government subsidies, these solar cells will cost theconsumer less than $3,000 with a five year payback period. This is in comparison to current silicon technologywhich requires cash outlays of $12,000 or more with payback periods in excess of twelve years in most USresidential markets.Furthermore, the Solaris’ non-toxic materials based process for recharging DSSCs allows for futureimprovements in the installed base of solar cells through recharging with newly developed, higher-efficiencydyes. This technology represents the world’s first and only rechargeable photovoltaic with the capability forpost-installation upgrades. Based on conservative market growth and penetration, we believe that this productcan exceed a billion dollars of annual revenue for Solaris within the next decade.

- http://www.solarisnano.com/solarenergy.php

Various colors in a series-connected dye solar cell modules, courtesy of Dr. Winfried Hofmann, RWE-Schott

Dye-sensitized electrochemical photovoltaic cells, also known as Graetzel Cells, offer significantly lowermanufacturing costs because of their simplicity and use of low-cost active materials such as TiO2.

Solaris Nanosciences has demonstrated a completely rechargeable dye sensitized solar cell (DSSC orGraetzel Cell) creating the lowest manufacturing cost, long-life photovoltaic system in the world. DSSCs whichare based on low cost materials and simple construction, have to date suffered from limited operating lifetimesdue to the degradation of the sensitizer dyes. Solaris' nontoxic chemical process allows the degraded dye inalready installed DSSCs to be removed and replaced with new dye, restoring the performance of the originalsolar cell.

DSSC or Graetzel Cell- http://en.wikipedia.org/wiki/Dye-sensitized_solar_cellA dye-sensitized solar cell (DSSC, DSC or DYSC[1]) is a class of low-cost solar cell belonging to the group ofthin film solar cells.[2] It is based on a semiconductor formed between a photo-sensitized anode and anelectrolyte; a photoelectrochemical system. This cell was invented by Michael Grätzel and Brian O'Regan atthe École Polytechnique Fédérale de Lausanne in 1991[3] and are also known as Grätzel cells. MichaelGrätzel won the 2010 Millennium Technology Prize for the invention of the Grätzel cell.[4]Grätzel's cell is composed of a porous layer of titanium dioxide nanoparticles, covered with a molecular dyethat absorbs sunlight, like the chlorophyll in green leaves. The titanium dioxide is immersed under an



electrolyte solution, above which is a platinum-based catalyst. As in a conventional alkaline battery, an anode(the titanium dioxide) and a cathode (the platinum) are placed on either side of a liquid conductor (theelectrolyte).

Sunlight passes through the transparent electrode into the dye layer where it can excite electrons that thenflow into the titanium dioxide. The electrons flow toward the transparent electrode where they are collected forpowering a load. After flowing through the external circuit, they are re-introduced into the cell on a metalelectrode on the back, flowing into the electrolyte. The electrolyte then transports the electrons back to the dyemolecules.

Dye-sensitized solar cells separate the two functions provided by silicon in a traditional cell design. Normallythe silicon acts as both the source of photoelectrons, as well as providing the electric field to separate thecharges and create a current. In the dye-sensitized solar cell, the bulk of the semiconductor is used solely forcharge transport, the photoelectrons are provided from a separate photosensitive dye. Charge separationoccurs at the surfaces between the dye, semiconductor and electrolyte.

The dye molecules are quite small (nanometer sized), so in order to capture a reasonable amount of theincoming light the layer of dye molecules needs to be made fairly thick, much thicker than the moleculesthemselves. To address this problem, a nanomaterial is used as a scaffold to hold large numbers of the dyemolecules in a 3-D matrix, increasing the number of molecules for any given surface area of cell. In existingdesigns, this scaffolding is provided by the semiconductor material, which serves double-duty.

- https://inlportal.inl.gov/portal/server.pt?open=514&objID=1269&mode=2&featurestory=DA_101047

Harvesting the sun's energy with antennas

INL researcher Steven Novack holds a plastic sheet of nanoantenna arrays, created by embossing theantenna structure and depositing a conductive metal in the pattern. Each square contains roughly 260 millionantennas. Nanotechnology R&D usually occurs on the centimeter scale, but this INL-patented manufacturingprocess demonstrates nano-scale features can be produced on a larger scale.(Credit: U.S. Department of Energy's Idaho National Laboratory)

Researchers at Idaho National Laboratory, along with partners at Microcontinuum Inc. (Cambridge, MA) andPatrick Pinhero of the University of Missouri, are developing a novel way to collect energy from the sun with atechnology that could potentially cost pennies a yard, be imprinted on flexible materials and still draw energyafter the sun has set.



The new approach, which garnered two 2007 Nano50 awards, uses a special manufacturing process to stamptiny loops of conducting metal onto a sheet of plastic. Each "nanoantenna" is as wide as 1/25 the diameter of ahuman hair.

Because of their size, the nanoantennas absorb energy in the infrared part of the spectrum, just outside therange of what is visible to the eye. The sun radiates a lot of infrared energy, some of which is soaked up bythe earth and later released as radiation for hours after sunset. Nanoantennas can take in energy from bothsunlight and the earth's heat, with higher efficiency than conventional solar cells.

An array of loop nanoantennas, imprinted on plastic and imaged with a scanning electron microscope. Thedeposited wire is roughly 200 nanometers thick. (Credit: U.S. Department of Energy's Idaho National Laboratory)



Commercial solar panels usually transform less that 20 percent of the usable energy that strikes them intoelectricity.The team estimates individual nanoantennas can absorb close to 80 percent of the available energy. Thecircuits themselves can be made of a number of different conducting metals, and the nanoantennas can beprinted on thin, flexible materials like polyethylene, a plastic that's commonly used in bags and plastic wrap. Infact, the team first printed antennas on plastic bags used to deliver the Wall Street Journal, because they hadjust the right thickness

- http://www.guardian.co.uk/environment/2007/dec/29/solarpower.renewableenergySolar energy 'revolution' brings green power closer .Power from light:Photovoltaic (PV) devices convert light into electrical energy. PV cells are made of semiconductor materialssuch as silicon. When light shines on a PV cell, the energy is transferred to electrons in the atoms of the PVcell. These electrons become part of the electrical flow, or current, in an electrical circuit. First wavephotovoltaic cell used thick silicon-wafer cells but were cumbersome and costly. The second generation ofphotovoltaic materials were developed about 10 years ago and use very thin silicon layers. These brought theprice down dramatically but still need expensive vacuum processes in their construction. The third wave of PV,now being developed by firms such as Nanosolar, can print directly on to other materials and does not usesilicon.

- http://www.sciencedaily.com/releases/2008/04/080410101210.htmFuture Of Solar-powered Houses Is Clear: New Window s Could Halve Carbon EmissionsProfessor John Bell said QUT had worked with a Canberra-based company Dyesol, which is developingtransparent solar cells that act as both windows and energy generators in houses or commercial buildings."The transparent solar cells have a faint reddish hue but are completely see-through," Professor Bell said."The solar cells contain titanium dioxide coated in a dye that increases light absorption."The glass captures solar energy which can be used to power the house but can also reduce overheating ofthe house, reducing the need for cooling."Copyright © 1995-2008 ScienceDaily LLC

- http://www.hp.com/hpinfo/newsroom/press/2008/080604a.htmlHP Licenses Technology to Xtreme Energetics for Cre ation of Super-efficient Solar Energy SystemHP and Xtreme Energetics (XE), a solar energy system developer based in Livermore, Calif., todayannounced they have entered into an agreement for the development of a solar energy system designed togenerate electricity at twice the efficiency and half the cost of traditional solar panels.Under the technology collaboration and licensing agreement, HP will license its transparent transistortechnology to XE in return for royalty payments.The transparent transistor technology that will be used in XE's solar energy device was co-developed by HPand Oregon State University. The technology includes thin film transparent transistors, which are made fromlow-cost, readily available materials such as zinc and tin. The materials raise no environmental concerns andallow for higher mobility, better chemical stability and easier manufacture.© 2008 Hewlett-Packard Development Company, L.P

- http://www.xyhd.tv/2007/09/technical/nanosolar-the-solar-cell-you-print-on-your-computer/Nano Solar uses an inkjet to create solar cells that are extremely thin, and cheap to manufacture. TheTechnology is interesting. Because it is printed the cells are amazingly thin, transparent even. So it can beapplied to windows, or other surfaces. Using copper indium gallium diselenide (CIGS) an inorganicphotovoltaic compound literally used as an ink a film, or sheet can be printed to what ever size and shape isneeded and then nanocomponents in the ink align themselves properly via molecular self-assembly.XYHD.TV © 2007

- http://www.nanosolar.com/products.htmNanosolar SolarPly_.Light-weight solar-electric cell foil which can be cut to any size. Non-fragile. No soldering required forelectrical contact.Copyright © 2002 - 2008, Nanosolar, Inc.



- http://www.octillioncorp.com/nano-power.phpNanoPower Windows (nanosilicon photovoltaic solar c ells )The technological potential of adapting existing glass windows into ones capable of generating electricity fromthe sun's solar energy has been made possible through a ground breaking discovery of an electrochemicaland ultrasound process that produces identically sized (1 to 4 nanometers in diameter) nanoparticles of siliconthat provide varying wavelengths of photoluminescence and high quantum efficiency (50% to 60%).Octillion Corp. © 2008

- http://www.nextenergynews.com/news1/next-energy-news1.7d.htmlScientists Invent Solar Cell Sheet That Collects En ergy at NightResearchers at Idaho National Laboratory, along with partners at Microcontinuum Inc. (Cambridge, MA) andPatrick Pinhero of the University of Missouri, are developing a novel way to collect energy from the sun with atechnology that could potentially cost pennies a yard, be imprinted on flexible materials and still draw energyafter the sun has set.Copyright © 2008, Next Energy News.

- http://www.sciencedaily.com/releases/2008/07/080731143345.htm'Major Discovery' Primed To Unleash Solar Revolutio n: Scientists Mimic Essence Of Plants' EnergyStorage SystemIn a revolutionary leap that could transform solar power from a marginal, boutique alternative into amainstream energy source, MIT researchers have overcome a major barrier to large-scale solar power: storingenergy for use when the sun doesn't shine.Copyright © 1995-2008 ScienceDaily LLC

- http://www.openecosource.org/energy-systems/promising-and-innovative-konarka-photovoltaicsKonarka builds Power Plastic® that converts light to energy — anywhere. The company develops andmanufactures light-activated Power Plastic® that is inexpensive, lightweight, flexible and versatile. Thismaterial makes it possible for devices, systems and structures to have their own low cost embedded sourcesof renewable power. By integrating energy generation functionality into everyday devices, Konarka allowsmanufacturers to offer truly wireless applications.

- http://www.konarka.com/index.php/site/tech_power_plastic/Konarka builds products that convert light to energ y anywhere.Download PDF file

- http://science.howstuffworks.com/solar-cell.htmIn this article, they will examine solar cells to learn how they convert the sun's energy directly into electricity.

- http://www.rug.nl/edrec/nieuws/nieuwsberichten/ontwikkelingDoorzichtigeZonnecellen?lang=enResearcher from Groningen developes transparent sol ar cells

- http://greenmonk.net/hp-teaming-with-xtreme-energetics-to-produce-cheaper-more-efficient-cheaper-solar/HP teaming with Xtreme Energetics to produce cheape r, more efficient cheaper solar

- http://venturebeat.com/2008/06/16/xtreme-energetics-ultra-efficient-pretty-solar-systems-catch-hps-eye/Xtreme Energetics' ultra-efficient, pretty solar sy stems catch HP's eye .



SSSSSSSSeeeeeeeeeeeeeeeebbbbbbbbeeeeeeeecccccccckkkkkkkk eeeeeeeeffffffffffffffffeeeeeeeecccccccctttttttt -------- TTTTTTTThhhhhhhheeeeeeeerrrrrrrrmmmmmmmmooooooooeeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrriiiiiiiiccccccccElectricity from the body heat

http://www.eetimes.com/design/smart-energy-design/4011571/Energy-harvesting-chips-and-the-quest-for-everlasting-lifeEnergy-harvesting chips and the quest for everlasti ng lifeErick O. Torres, Student Member, IEEE, and Gabriel A. Rincón-Mora, Senior Member, IEEE Georgia Tech Analog and Power IC DesignLab

Modern electronics continue to push past boundaries of integration and functional density, towards the elusivecompletely autonomous self-powered microchip. As systems continue to shrink, however, less energy isavailable on-board, leading to short device lifetime (runtime or battery life). Research continues to develophigher energy-density batteries but the amount of energy available is not only finite but also low, limiting thesystem's lifespan, which is paramount in portable electronics. Extended life is also particularly advantageousin systems with limited accessibility, such as biomedical implants and structure-embedded micro-sensors. Theultimate long-lasting solution should therefore be independent of the limited energy available during start-up,which is where a self-renewing energy source comes in, continually replenishing the energy consumed by themicro-system.State-of-the-art micro-electromechanical system (MEMS) generators and transducers can be such self-renewing sources, extracting energy from vibrations, thermal gradients, and light. The energy extracted fromthese sources is stored in chip-compatible, rechargeable batteries such as thin-film lithium ion, which powersthe loading application (e.g., sensor, etc.) via a regulator circuit. Since harvested energy manifests itself inirregular, random, low energy "bursts," a power-efficient, discontinuous, intermittent charger is required totransfer the energy from the sourcing devices to the battery. Energy that is typically lost or dissipated in theenvironment is therefore recovered and used to power the system, significantly extending the operationallifetime of the device.

Harvesting EnergyEnergy harvesting is defined as the conversion of ambient energy into usable electrical energy. Whencompared with the energy stored in common storage elements, like batteries and the like, the environmentrepresents a relatively inexhaustible source of energy. Consequently, energy harvesting (i.e., scavenging)methods must be characterized by their power density, rather than energy density. Table 1 compares theestimated power and challenges of various ambient energy sources. Light, for instance, can be a significantsource of energy, but it is highly dependant on the application and the exposure to which the device issubjected. Thermal energy, on the other hand, is limited because the temperature differentials across a chipare typically low. Vibration energy is a moderate source, but again dependent on the particular application.

Energy Source Challenge Estimated Power(in 1 cm3 or 1 cm2)

Light Conform to small surface area10 µW - 15 mW(Outdoors: 0.15 - 15 mW)(Indoors: <10 µW)

Vibrations Variability of vibration

1 - 200 µW(Piezoelectric: ~ 200 µW)(Electrostatic: 50 - 100 µW)(Electromagnetic: < 1µW)

Thermal Small thermal gradients15 µW(10°C gradient)

Comparison between different ambient energy sources

Vibration EnergyEnergy extraction from vibrations is based on the movement of a "spring-mounted" mass relative to its supportframe. Mechanical acceleration is produced by vibrations that in turn cause the mass component to move andoscillate (kinetic energy). This relative displacement causes opposing frictional and damping forces to beexerted against the mass, thereby reducing and eventually extinguishing the oscillations. The damping forcesliterally absorb the kinetic energy of the initial vibration. This energy can be converted into electrical energy viaan electric field (electrostatic), magnetic field (electromagnetic), or strain on a piezoelectric material. Theseenergy-conversion schemes amount to harvesting energy from vibrations.



Electromagnetic vibration energy harvester

Electromagnetic energy harvesting uses a magnetic field to convert mechanical energy to electrical. A coilattached to the oscillating mass traverses through a magnetic field that is established by a stationary magnet.The coil travels through a varying amount of magnetic flux, inducing a voltage according to Faraday's law. Theinduced voltage is inherently small and must therefore be increased to viably source energy. Methods toincrease the induced voltage include using a transformer, increasing the number of turns of the coil, and/orincreasing the permanent magnetic field. However, each is limited by the size constraints of a microchip.

Piezoelectric energy harvesting converts mechanical energy to electrical by straining a piezoelectric material.Strain, or deformation, in a piezoelectric material causes charge separation across the device, producing anelectric field and consequently a voltage drop proportional to the stress applied. The oscillating system istypically a cantilever beam structure with a mass at the unattached end of the lever, since it provides higherstrain for a given input force (a). The voltage produced varies with time and strain, effectively producing anirregular ac signal. Piezoelectric energy conversion produces relatively higher voltage and power densitylevels than the electromagnetic system.

(a) Piezoelectric energy harvesting beam and (b) MEMS varactors (c) in an energy-harvesting circuit

Electrostatic (capacitive) energy harvesting relies on the changing capacitance of vibration-dependantvaractors [3, 8-9]. A varactor, or variable capacitor, is initially charged and, as its plates separate because ofvibrations, mechanical energy is transformed into electrical energy (Figures 3b and 3c). The most attractivefeature of this method is its IC-compatible nature, given that MEMS variable capacitors are fabricated throughrelatively mature silicon micro-machining techniques. This scheme produces higher and more practical outputvoltage levels than the electromagnetic method, with moderate power density.

Thermal EnergyThermal gradients in the environment are directly converted to electrical energy through the Seebeck(thermoelectric) effect. Temperature differentials between opposite segments of a conducting material result inheat flow and consequently charge flow, since mobile, high-energy carriers diffuse from high to lowconcentration regions. Thermopiles consisting of n- and p-type materials electrically joined at the high-temperature junction are therefore constructed, allowing heat flow to carry the dominant charge carriers ofeach material to the low temperature end, establishing in the process a voltage difference across the baseelectrodes. The generated voltage and power is proportional to the temperature differential and the Seebeckcoefficient of the thermoelectric materials. Large thermal gradients are essential to produce practical voltageand power levels. Nevertheless, temperature differences greater than 10°C are rare in a micro-system,consequently producing low voltage and power levels.



Thermoelectrics

- http://en.wikipedia.org/wiki/Energy_harvestingEnergy harvesting (also known as power harvesting or energy scavenging ) is the process by whichenergy is derived from external sources (e.g., solar power, thermal energy, wind energy, salinity gradients,and kinetic energy), captured, and stored. Frequently, this term is applied when speaking about small, wirelessautonomous devices, like those used in wearable electronics and wireless sensor networks.

ThermoelectricsIn 1821, Thomas Johann Seebeck discovered that a thermal gradient formed between two dissimilarconductors produces a voltage. At the heart of the thermoelectric effect is the fact that a temperature gradientin a conducting material results in heat flow; this results in the diffusion of charge carriers. The flow of chargecarriers between the hot and cold regions in turn creates a voltage difference. In 1834, Jean Charles AthanasePeltier discovered that running an electric current through the junction of two dissimilar conductors could,depending on the direction of the current, cause it to act as a heater or cooler. The heat absorbed or producedis proportional to the current, and the proportionality constant is known as the Peltier coefficient. Today, due toknowledge of the Seebeck and Peltier effects, thermoelectric materials can be used as heaters, coolers andgenerators (TEGs).Ideal thermoelectric materials have a high Seebeck coefficient, high electrical conductivity, and low thermalconductivity. Low thermal conductivity is necessary to maintain a high thermal gradient at the junction.Standard thermoelectric modules manufactured today consist of P- and N-doped bismuth-telluridesemiconductors sandwiched between two metallized ceramic plates. The ceramic plates add rigidity andelectrical insulation to the system. The semiconductors are connected electrically in series and thermally inparallel.Miniature thermocouples have been developed that convert body heat into electricity and generate 40µW at3V with a 5 degree temperature gradient, while on the other end of the scale, large thermocouples are used innuclear RTG batteries.Practical examples are the finger-heartratemeter by the Holst Centre and the thermogenerators by theFraunhofer Gesellschaft. Advantages to thermoelectrics:No moving parts allow continuous operation for many years. Tellurex Corporation (a thermoelectric productioncompany) claims that thermoelectrics are capable of over 100,000 hours of steady state operation.Thermoelectrics contain no materials that must be replenished.Heating and cooling can be reversed.One downside to thermoelectric energy conversion is low efficiency (currently less than 10%). Thedevelopment of materials that are able to operate in higher temperature gradients, and that can conductelectricity well without also conducting heat (something that was until recently thought impossible), will result inincreased efficiency.Future work in thermoelectrics could be to convert wasted heat, such as in automobile engine combustion, intoelectricity.

- http://en.wikipedia.org/wiki/Thermoelectric_effectThermoelectric effectThe thermoelectric effect is the direct conversion of temperature differences to electric voltage and viceversa. A thermoelectric device creates a voltage when there is a different temperature on each side.Conversely when a voltage is applied to it, it creates a temperature difference (known as the Peltier effect). Atatomic scale (specifically, charge carriers), an applied temperature gradient causes charged carriers in thematerial, whether they are electrons or electron holes, to diffuse from the hot side to the cold side, similar to aclassical gas that expands when heated; hence, the thermally induced current.This effect can be used to generate electricity, to measure temperature, to cool objects, or to heat them orcook them. Because the direction of heating and cooling is determined by the polarity of the applied voltage,thermoelectric devices make very convenient temperature controllers.Traditionally, the term thermoelectric effect or thermoelectricity encompasses three separately identifiedeffects, the Seebeck effect , the Peltier effect , and the Thomson effect . In many textbooks, thermoelectriceffect may also be called the Peltier–Seebeck effect . This separation derives from the independentdiscoveries of French physicist Jean Charles Athanase Peltier and Estonian-German physicist ThomasJohann Seebeck. Joule heating, the heat that is generated whenever a voltage is applied across a resistivematerial, is somewhat related, though it is not generally termed a thermoelectric effect (and it is usuallyregarded as being a loss mechanism due to non-ideality in thermoelectric devices). The Peltier–Seebeck andThomson effects can in principle be thermodynamically reversible, whereas Joule heating is not.



Seebeck discovered that a compass needle would be deflected when a closed loop was formed of two metalsjoined in two places with a temperature difference between the junctions. This is because the metals responddifferently to the temperature difference, which creates a current loop, which produces a magnetic field.Seebeck, however, at this time did not recognize there was an electric current involved, so he called thephenomenon the thermomagnetic effect, thinking that the two metals became magnetically polarized by thetemperature gradient. The Danish physicist Hans Christian Ørsted played a vital role in explaining andconceiving the term "thermoelectricity".The effect is that a voltage, the thermoelectric EMF, is created in the presence of a temperature differencebetween two different metals or semiconductors. This causes a continuous current in the conductors if theyform a complete loop. The voltage created is of the order of several microvolts per kelvin difference. One suchcombination, copper-constantan, has a Seebeck coefficient of 41 microvolts per kelvin at room temperature.

- http://www.ecofan.co.uk/technical-information.htmlThe Seebeck EffectThe generator module is a unique semiconductor device that relies upon the Seebeck effect to generateelectricity. When two dissimilar semiconductors (p-type and n-type) at the same temperature are connectedtogether they establish a static electric potential difference. With the introduction of a temperature differenceheat flows across the joined semiconductors which in turn permits electrons to flow. With the electron flow orcurrent comes the ability to power electrical devices such as the fan's motor.



Seebeck-Thermoelectric- http://www.artechhouse.com/GetBlob.aspx?strName=Beeby-718_CH05.pdfThermoelectric Energy HarvestingGao Min - Cardiff University, United Kingdom

Thermoelectric module. (a) Schematic diagram of a thermoelectric module. (b) Crosssectionalview of a thermoelectric module which consists of a number of n- and p-type thermocouplesconnected electrically in series but thermally in parallel and sandwiched between two ceramicplates.

Low Power SystemsAdvance in modern microelectronics has led to a significant reduction in the power level requirement.Modern-day remote wireless sensors can operate at a power level of about 130 µW. A quartz digitalwristwatch requires merely 20 to 40 µW.At such a power level, it is possible to use thermoelectric devices to harvest ambient heat for poweringremote sensor networks or mobile devices. This eliminates the needs for replacing batteries or forlengthy cabling from central power sources. A particularly attractive feature of thermoelectric devices istheir ability to generate electricity from body heat that could power medical implants, personal wirelessdevices, or other consumer electronics. A successful example in this attempt is the thermoelectricwristwatch developed by Seiko and Citizen.Figure below shows a schematic cross-section of a thermoelectric watch. A miniature thermoelectricconverter that consists of 2,268 pairs of Bi2Te3 thermocouples is mounted on the bottom case of thewatch. It produces on average 25 µW of electricity from a temperature difference of 2–3K generated bybody heat. The conversion efficiency is about 0.1% (compared with the corresponding Carnot efficiencyof 0.66%).Although it is technologically successful, its commercialization has been restricted mainly due to the costof the thermoelectric converter employed. In a normal environment, the temperature difference betweenhuman body and ambient is around 5–10K. The rate of heat generation for an average human body istypically around 100W. Using such data, the power output that can be harvested using a thermoelectricdevice is estimated to be 20–50 µW/cm2.This indicates that the power of about 2–5 mW may be obtained with a realistic surface area of 0.1 m2

(equivalent to an area of 40 cm × 25 cm) that enables heat extraction from a body without causingsignificant inconvenience or discomfort. Such a power level is sufficient for some low-power applications.



A schematic diagram of thermoelectric wristwatch. A miniature thermoelectric converteris placed on the bottom case of the watch.

- http://www.jcwa.or.jp/eng/knowledge/tech/tech04.htmlThermal generating system watches

- http://www.media.mit.edu/resenv/pubs/books/Starner-Paradiso-CRC.1.452.pdfHuman Generated Power for Mobile ElectronicsThad Starner Joseph A. ParadisoGVU Center, College of Computing Responsive Environments Group, Media LaboratoryGeorgia Tech MITAtlanta, GA 30332-0280 Cambridge, MA 02139

Power from Body Heat

Activity Kilocal/hr Wattssleeping 70 81lying quietly 80 93sitting 100 116standing at ease 110 128conversation 110 128eating meal 110 128strolling 140 163driving car 140 163playing violin or piano 140 163housekeeping 150 175carpentry 230 268hiking, 4 mph 350 407swimming 500 582mountain climbing 600 698long distance run 900 1,048sprinting 1,400 1,630

Human energy expenditures for selected activities.Derived from: D. Morton. Human Locomotion and Body Form. The Williams & Wilkins Co., Baltimore, MD, 1952.

Table indicates that while sitting, a total of 116W of power is available. Using a Carnot engine to model therecoverable energy yields 3.7-6.4Wof power. In more extreme temperature differences, higher efficienciesmay be achieved, but robbing the user of heat in adverse environmental temperatures is not practical.Evaporative heat loss from humans account for 25% of their total heat dissipation (basal, non-sweating) evenunder the best of conditions. This “insensible perspiration” consists of water diffusing through the skin, sweatglands keeping the skin of the palms and soles pliable, and the expulsion of water-saturated air from the



lungs. Thus, the maximum power available without trying to reclaim heat expended by the latent heat ofvaporization drops to 2.8-4.8W.The above efficiencies assume that all of the heat radiated by the body is captured and perfectly transformedinto power.However, such a system would encapsulate the user in something similar to a wetsuit. The reducedtemperature at the location of the heat exchanger would cause the body to restrict blood flow to that area.When the skin surface encounters cold air, a rapid constriction of the blood vessels in the skin allows the skintemperature to approach the temperature of the interface so that heat exchange is reduced. This self-regulation causes the location of the heat pump to become the coolest part of the body, further diminishing thereturns of the Carnot engine unless a wetsuit is employed as part of the design.While a full wetsuit or even a torso body suit is unsuitable for many applications, the neck offers a goodlocation for a tight seal, access to major centers of blood flow, and easy removal by the user. The neck isapproximately 1/15 of the surface area of the “core” region (those parts that the body tries to keep warm at alltimes). As a rough estimate, assuming even heat dissipation over the body, a maximum of 0.20-0.32W couldbe recovered conveniently by such a neck brace. The head may also be a convenient heat source for someapplications where protective hoods are already in place - the head is also a very convenient spot for couplingsensory input to the user. The surface area of the head is approximately three times that of the neck and couldprovide 0.60-0.96W of power given optimal conversion. Even so, the practicality, comfort, and efficacy of sucha system are relatively limited.Even given all the limitations mentioned above, practical body-worn, thermally-powered systems have beencreated.The Seiko Thermic wristwatch uses 10 thermoelectric modules to generate sufficient simbolo mu microW torun its mechanical clock movement from the small thermal gradient provided by body heat over ambienttemperature.

Possible power recovery from body-centered sources.Total power for each action is included in parentheses.



Fraunhofer Institute

- http://www.fraunhofer.de/EN/press/pi/2007/08/Researchnews82007Topic1.jspElectricity from body heatIn collaboration with colleagues from the Fraunhofer Institute for Physical Measurement Techniques IPM andthe Fraunhofer Institute for Manufacturing Engineering and Applied Materials Research IFAM, researchscientists at the Fraunhofer Institute for Integrated Circuits IIS in Erlangen have developed a way ofharnessing natural body heat to generate electricity. It works on the principle of thermoelectric generators,TEG for short, made from semiconductor elements.© 4/2008 Fraunhofer-Gesellschaft

- http://bme240.eng.uci.edu/students/08s/rogers/Heat.htmlThermoelectricsIntroduction:Scientists of the Fraunhofer Society, as well as the company Biophan, are exploring devices andsemiconductor materials for the generation of electricity from small temperature gradients in the body. Up to5°C of difference can be found across certain parts of the body, such as between the skin and theenvironment. As far back as 1998, the feasibility of scavenging power from this source was proven for non-biomedical applications by Japanese watch company Seiko, which introduced a "Thermic" wristwatch that ranon heat from the skin.

Device Design:In the medical field, Biophan hopes to extend the operating life of small implants by continuously rechargingthem with a bismuth telluride semiconductor-based thermoelectric energy-scavenger. Pacemakers, forexample, might have their lives extended from one decade to three by this method once the device isperfected, and lower-power devices might even run indefinitely. The company's goal is to produce a devicethat will be able to generate 100 µW at 4 V in a slim package about 1 inch squared, comparable in size tocurrent Li-ion pacemaker batteries.



Fujitsu

- http://www.fujitsu.com/global/news/pr/archives/month/2010/20101209-01.htmlFujitsu Develops Hybrid Energy Harvesting Device fo r Generating Electricity from Heat and LightKawasaki, Japan, December 9, 2010 — Fujitsu Laboratories Ltd. today announced that it has developed a new hybridenergy harvesting device that generates electricity from either heat or light. With this single device, it ispossible to derive energy from two separate sources, which previously could only be handled by combiningindividual devices. Furthermore, because the cost of the hybrid device is economical, this technology pavesthe way to the widespread use of highly efficient energy harvesting devices. The new technology has greatpotential in the area of energy harvesting, which converts energy from the surrounding environment toelectricity. Since there is no need for electrical wiring or battery replacements, this development could enablethe use of sensors in previously unserved applications and regions. It also has great potential for powering avariety of sensor networks and medical-sensing technologies.

About Energy HarvestingEnergy harvesting is the process for collecting energy from the surrounding environment and converting it toelectricity, and is gaining interest as a future next-generation energy source. Conventionally, electricity issupplied by either a power plant or a battery, requiring electrical wiring and replacement batteries. In recentyears, the idea of using ambient energy in the forms of light, vibration, heat, radio waves, etc. has becomeincreasingly attractive, and a number of methods to produce electricity from these different kinds of energysources have been developed. Energy harvesting technology would eliminate the need for replacing batteriesand power cords.



Overview of energy harvesting

Technological ChallengesSince the amount of power available by energy harvesting is quite limited, there has been interest in utilizingmultiple forms of external energy simultaneously - such as light and heat, or light and vibrations - in order tocollect a sufficient amount for practical use. In the past, this has been achieved by combining different kinds ofdevices, which leads to higher costs.Newly-developed TechnologyFujitsu Laboratories has developed a new hybrid harvesting device that captures energy from either light orheat, which are the most typical forms of ambient energy available for wide-scope application. This makes itpossible for a single device to capture energy from either heat or light without combining two harvestingdevices. In addition, as it can be manufactured from inexpensive organic materials, device production costscan remain low

Details of the new technology are as follows.1. New structure for hybrid generating devicesBy changing the electrical circuits connecting two types of semiconductor materials - P-type and N-typesemiconductors - the device can function as a photovoltaic cell or thermoelectric generator (Figure below).2. Development of an organic material for hybrid generating devicesFujitsu Laboratories successfully developed an organic material that is suitable for a generator in bothphotovoltaic and thermoelectric modes. The organic material features a high generating efficiency that canproduce power from even indoor lighting in photovoltaic mode, and it can also generate power from heat inthermoelectric mode. Since the organic material and its process cost are inexpensive, production costs can begreatly reduced.

Single device featuring operation in both photovoltaic mode (left) and thermoelectric mode (right)



ResultsUntil now, photovoltaic cells - which generate electricity from light, and thermoelectric devices - whichgenerate electricity from temperature differentials, have only been available as separate devices. This newtechnology from Fujitsu Laboratories doubles the energy-capture potential through the use of both ambientheat and light in a single device. In medical fields, for example, the technology could be used in sensors thatmonitor conditions such as body temperature, blood pressure, and heartbeats - without batteries and electricalwiring. If either the ambient light or heat is not sufficient to power the sensor, this technology can supply powerwith both sources, by augmenting one source with the other. In addition, the technology can also be used forenvironmental sensing in remote areas for weather forecasting, where it would be problematic to replacebatteries or run electric lines.

Prototype hybrid generating device manufactured on flexible substrate

- http://www.forbes.com/2010/06/07/nanotech-body-heat-technology-breakthroughs-devices.htmlTurning Body Heat Into ElectricityOsman Can Ozcanli, August 2010

Developments in nano-engineering could unleash new body-powered devices.The idea of converting the human body's energy into electricity has tantalized scientists for years. A restingmale can put out between 100 and 120 watts of energy, in theory enough to power many of the electronicsyou use, such as your Nintendo Wii (14 watts), your cellphone (about 1 watt) and your laptop (45 watts).Eighty percent of body power is given off as excess heat. But only in sci-fi fantasies such as the Matrix filmseries do you see complete capture of this reliable power source.Current technology for converting body heat into electricity is capable of producing only a few milliwatts (onethousandth of a Watt), which is enough for small things such as heart rate monitors and watches. Somepeople fondly remember Seiko's Thermic watch, which runs continuously off body heat on 1 microwatt (one-millionth of a watt). It debuted in 1998 to rave reviews, but Seiko produced only 500 units before discontinuingit. If you own a Seiko Thermic, you never have to worry about changing batteries as long as your environmentis cooler than your body.

Recent developments in nanotechnology engineering promise to usher in lots more body-powered devices.The basic technology behind the concept of turning body heat into electricity is a thermoelectric device. It isusually a thin conductive material that exploits the temperature difference between its two sides to generateelectricity, known as the Seebeck effect. Such devices can work in reverse, meaning if you were to applyelectricity to the device, one side would get extremely cold and the other extremely hot. If you own a USB-powered drink chiller, you probably own a thermoelectric generator--only working in reverse. The same idea isalso used in cooling some computers.



A thermoelectric device placed on skin will generate power as long as the ambient air is at a lowertemperature than the body. A patch of material one square centimeter in area can produce up to 30microwatts. Place these generators side by side to multiply the amount of power being harvested.

In 2006 Vladimir Leonov and Ruud J.M. Vullers from Belgium built a working prototype of a blood oxygensensor, or pulse oxymeter, powered with body heat. It was about the size of a watch and was successfullytested on patients. It generated about 100 microwatts while the patient was asleep and up to 600 microwattswhen awake and active. The group had to design the device so it could work with a record low power of 62microwatts vs. commercially available 10-milliwatt pulse oxymeters.In 2007 the duo built a body-heat powered electroencephalograph device that monitored brain activity. Leonovand Vullers started by redesigning the EEG device so it consumed less power. The EEG had to wirelesslytransmit real-time data to a computer, too, so it had to consume a lot more power than their first prototype.The 50-square-centimeter prototype was placed on the forehead of a person and harvested 3,500 microwatts,which was great, but came with a side effect: With so much area covered with thermoelectric devices suckingthe heat, the sensation of cold became overwhelming to the patient.

The following year, the duo added photovoltaic cells to the top of the device to harvest solar power to offsetsome of the thermoelectric generation and make the device less chilly for the patient.

Next, they built a body-heat powered electrocardiograph device (EKG) that monitored heart activity. This time,they built the system as a washable shirt. In previous prototypes they used a super capacitor, which workedwell. But when the capacitor was charged, it would waste any extra energy available from the thermoelectricdevice. In the shirt prototype they used a secondary battery as a storage device that constantly rechargedusing body heat. That cut out the waste and enabled them to shrink the device even more. Combining otherforms of generation with smart storage systems will likely be the ways that body-heat- powered devicesbecome practical.

At MIT, researchers are working on improving the efficiency of the circuitry that harnesses the minute amountsof power generated by standard thermoelectric generators. Scientists Anantha Chandrakasan, director ofMIT's Microsystems Technology Laboratories, and his colleague Yogesh Ramadass have created extremelyefficient circuitry in an EKG sensor with a built-in processor and wireless radio.



There's even greater potential in improving the efficiency of thermoelectric generators. Currently, athermoelectric generator currently can only convert 0.4% of the heat energy into usable electrical power. Withthis efficiency, if you were to cover all of your body with thermoelectric generators you could produce 0.5Watts of energy. This would feel extremely cold and would hardly be enough to power a cellphone. There isresearch being done by the U.S. Department of Energy and the University of California-Berkeley ondeveloping more efficient thermoelectric generators.MIT Professor Peter Hagelstein published a paper in November that showed a way to improve the efficiency ofthermoelectric generators by up to 4 times in practice and up to 9 times in theory. Devices with that kind ofefficiency could be used anywhere there is wasted heat--on the walls of power plants or lining the hoods ofautomobiles. A company that is closely related to MIT, MTPV, is starting to work on commercializingHagelstein's ideas.

- http://medgadget.com/archives/2007/10/wireless_eeg_powered_by_body_heat.htmlOctober 2007

Wireless EEG Powered by Body Heat

This autonomous electroencephalogram system, powered by body heat, is another interesting devicedeveloped by the IMEC, a Belgium/Netherlands nanotechnologies research center.

Here's more about this prototype's technology:



The entire system is wearable and integrated into a headband. The small size, low power consumption ofonly 0.8mW and autonomous operation increase the patient's autonomy and quality of life. Potentialapplications are detection of imbalance between the two halves of the brain, detection of certain kinds ofbrain trauma and monitoring of brain activity.

The EEG system uses IMEC's proprietary ultra-low power biopotential readout ASIC to extract high-qualityEEG signals with micro-power consumption. A low-power digital signal-processing block encodes theextracted EEG data which is sent to a PC via a 2.4GHz wireless radio. The whole system consumes only0.8mW.

The thermoelectric generator is mounted on the forehead and converts the heat flow between the skin andair into electrical power. The generator is composed of 10 thermoelectric units interconnected in a flexibleway. At room temperature, the generated power is about 2-2.5mW or 0.03mW/cm2 which is the theoreticallimit of power generation on human skin. Higher power generation would cause an uncomfortable sense ofcold. The EEG system is operational in less than one minute after switching on the device.

Future research targets further reduction of the power consumption of the different system componentsincluding the radio and processor. Also, a semiconductor process for manufacturing thermopiles is underdevelopment. This will allow a significant reduction of the production cost.

- http://www.research.a-star.edu.sg/research/6218Microfabrication: The power of heatPublished online September 2010



- http://technicalstudies.youngester.com/2010/06/paper-electricity-generated-by-human.html

Electricity Generated by Human Body

A resting male can put out between 100 and 120 watts of energy, in theory enough to power many of theelectronics you use, such as your Nintendo Wii (14 watts), your cellphone (about 1 watt) and your laptop (45watts). Eighty percent of body power is given off as excess heat.

…. A thermoelectric device placed on skin will generate power as long as the ambient air is at a lowertemperature than the body. A patch of material one square centimeter in area can produce up to 30microwatts. Place these generators side by side to multiply the amount of power being harvested.…. A human body constantly generates heat as a useful side effect of metabolism. However, only a part of thisheat is dissipated into the ambient as a heat flow and infrared radiation, the rest of it is rejected in a form ofwater vapor. Furthermore, only a small fraction of the heat flow can be used in a wearer’s friendly andunobtrusive energy scavenger. (For example, nobody would accept a large device on his/her face. Therefore,the heat flow from it practically cannot be used.) At last, due to the laws of thermodynamics, the heat flowcannot be effectively converted it into electricity. However, a human being generates more than 100 W of heat;therefore, a quite useful electrical power still can be obtained using a person as a heat generator. The tool forconverting heat flow into electricity is a thermoelectric generator (TEG), the heart of which is a thermopile.Typically, only a few watts of heat flow can be harvested unobtrusively on a person and thermoelectricallyconverted into several milliwatts in a form of electricity. If we recall that watches consume 1000 times less, it isfairly good power. Moreover, PV cells of the same area typically generate much less power because not muchlight is available indoors, where the authors and the reader of this paper are resting now.

The human body is not a perfect heat generator as a heat supply for a wearable TEG. The body has highthermal resistance; therefore, the heat flow is quite limited. This is explained by the fact that warm-bloodedanimals have received in the process of evolution a very effective thermal management. This includes a veryhigh thermal resistance of the body at ambient temperatures below 20–25 °C if the skin temperaturedecreases below thermal comfort.1,2 As a result, not much heat is dissipated from the skin and only about 3–5mW/cm2 is available indoors, on average.



- http://www.sciencedaily.com/releases/2008/04/080412172006.htmWireless EEG System Self-Powered By Body Heat And L ightScienceDaily (April 2008)

- http://www.ecofriend.org/entry/texas-instruments-to-manufacture-chips-powered-by-body-heatTexas Instruments to manufacture chips powered by b ody heatArpita Mukherjee | Feb 2008

Imagine the day that will come when in order to recharge the batteries of your mobile phone you only have tohold it in your grasp for a few minutes saving a bit of your electricity bill. This is exactly what will be achievedby a new concept chip designed by Texas Instruments. The energy efficient chip is capable of functioning at0.3 volts of energy that can be provided by any small heat source; even by body heat. This chip is expected tolengthen the life span of batteries in mobile phones, implantable medical devices and sensors.The energy efficient chip is the handiwork of Joyce Kwong, a graduate student of MIT and Professor AnanthaChandrakasan of MIT, will be ready for commercial application within the next five years. To enable the chip towork at 0.3V energy the memory and logic circuits currently prevalent with the existing 1V chips need to beredesigned. Instead of using a separate converter, there will be an inbuilt DC-to-DC converter that would helpto reduce the voltage. It is a challenge to researchers to develop chips capable of functioning at low power asat very low power levels the imperfections in the silicon become more apparent.

- http://www.gizmowatch.com/entry/electricity-from-body-heat-ultimate-solution-for-power-hungry-gizmos/Electricity from body heat - Ultimate solution for power-hungry gizmosBharat | August 2007



Piezoelectric- http://www.memsinvestorjournal.com/2010/04/microstructured-piezoelectric-shoe-power-generator-outperforms-batteries.htmlMicrostructured piezoelectric shoe power generator outperforms batteriesby Ville Kaajakari, Ph.D. Assistant Professor, Louisiana Tech University

Energy harvesting is an attractive way to power MEMS sensors and locator devices such as GPS; however,the power harvesting technologies often fall short in terms of power output. For example, vibratory MEMSgenerators might give out only microwatts of electrical power. While this may be sufficient for emerging ultralow power sensors, many current applications require milliwatt power levels. As an example, commerciallyavailable running sensors for shoes consume over 100 uW of electrical power and requirements for GPSlocators are even higher.Piezoelectric transducers generate electrical charge when compressed. This makes piezoelectric materialsespecially advantageous for power harvesting as they do not require bias voltage for operation. In principle, apiezoelectric transducer together with two rectifying diodes is sufficient for generating dc output voltage.The shoe power generator that our group has developed is based on a low-cost polymer transducer that hasmetallized surfaces for electrical contact. Unlike the conventional ceramic transducers, the plastic-basedgenerator is soft and robust matching the properties of regular shoe fillings. The transducer can thereforereplace the regular heel shock absorber with no loss in user experience.

A significant challenge in harvesting piezoelectric energy is that piezoelectic materials are optimal forgenerating high voltages but provide only a low current output. The polymer used in the shoe transducerprovides over 5 mJ of energy per step but at voltages too large (>50 V) to be directly used in low powersensors. A breakthrough in piezoelectric power generation is the new voltage regulation circuits that wedeveloped at Louisiana Tech University that efficiently converts the piezoelectric charge into a usable voltage.A conversion circuit coverts the high voltage to a regulated 3 V output for charging batteries or for directlypowering electronics at better than 70% conversion efficiency. Combined with the polymer transducer, theregulation circuit gives time-averaged power of 2 mW per shoe during a regular walk.The generated power output can be compared to typical storage capacity of 30 mAh for lithium coin/buttoncells -- with an average current consumption 0.5 mA, a miniature coin cell is depleted in less than three dayswhereas the shoe power generator gives power output as long as the user keeps walking. The total energyoutput can therefore easily surpass conventional batteries. In addition to running sensors and inertialnavigation, the show power generator can be used to power RF transponders, GPS receivers, and locatortags that require a milliwatt power source.

- http://www.explainthatstuff.com/piezoelectricity.htmlText copyright © Chris Woodford 2009. All rights reserved.

PiezoelectricityYou've probably used piezoelectricity (pronounced "pee-ay-zo-electricity") quite a few times today. If you'vegot a quartz watch, piezoelectricity is what helps it keep regular time. If you've been writing a letter or an essayon your computer with the help of voice recognition software, the microphone you spoke into probably usedpiezoelectricity to turn the sound energy in your voice into electrical signals your computer could interpret. Ifyou're a bit of an audiophile and like listening to music on vinyl, your gramophone would have been usingpiezoelectricity to "read" the sounds from your LP records. Piezoelectricity (literally, "pressing electricity") ismuch simpler than it sounds: it just means using crystals to convert mechanical energy into electricity or vice-versa. Let's take a closer look at how it works and why it's so useful!



What is piezoelectricity?Squeeze certain crystals (such as quartz) and you can make electricity flow through them. The reverse isusually true as well: if you pass electricity through the same crystals, they "squeeze themselves" by vibratingback and forth. That's pretty much piezoelectricity in a nutshell but, for the sake of science, let's have a formaldefinition:Piezoelectricity (also called the piezoelectric effect) is the appearance of an electrical potential (a voltage, inother words) across the sides of a crystal when you subject it to mechanical stress (by squeezing it).In practice, the crystal becomes a kind of tiny battery with a positive charge on one face and a negative chargeon the opposite face; current flows if we connect the two faces together to make a circuit. In the reversepiezoelectric electric, a crystal becomes mechanically stressed (deformed in shape) when a voltage is appliedacross its opposite faces.What causes piezoelectricity?

What scientists mean by a crystal: the regular, repeating arrangement of atoms in a solid. The atoms are essentially fixed in place but canvibrate slightly.

Think of a crystal and you probably picture balls (atoms) mounted on bars (the bonds that hold them together),a bit like a climbing frame. Now, by crystals, scientists don't necessarily mean intriguing bits of rock you find ingift shops: a crystal is the scientific name for any solid whose atoms or molecules are arranged in a veryorderly way based on endless repetitions of the same basic atomic building block (called the unit cell). So alump of iron is just as much of a crystal as a piece of quartz. In a crystal, what we have is actually less like aclimbing frame (which doesn't necessarily have an orderly, repeating structure) and more like three-dimensional, patterned wallpaper.

Quartz—probably the best known piezoelectric material. Photo by courtesy of US Geological Survey.

In most crystals (such as metals), the unit cell (the basic repeating unit) is symmetrical; in piezoelectriccrystals, it isn't. Normally, piezoelectric crystals are electrically neutral: the atoms inside them may not besymmetrically arranged, but their electrical charges are perfectly balanced: a positive charge in one placecancels out a negative charge nearby. However, if you squeeze or stretch a piezoelectric crystal, you deformthe structure, pushing some of the atoms closer together or further apart, upsetting the balance of positive andnegative, and causing net electrical charges to appear. This effect carries through the whole structure so netpositive and negative charges appear on opposite, outer faces of the crystal.The reverse-piezoelectric effect occurs in the opposite way. Put a voltage across a piezoelectric crystal andyou're subjecting the atoms inside it to "electrical pressure." They have to move to rebalance themselves—and



that's what causes piezoelectric crystals to deform (slightly change shape) when you put a voltage acrossthem.

How piezoelectricity works1. Normally, the charges in a piezoelectric crystal are exactly balanced, even if they're not symmetrically

arranged.2. The effects of the charges exactly cancel out, leaving no net charge on the crystal faces. (More

specifically, the electric dipole moments—vector lines separating opposite charges—exactly cancelone another out.)

3. If you squeeze the crystal you force the charges out of balance.4. Now the effects of the charges (their dipole moments) no longer cancel one another out and net

positive and negative charges appear on opposite crystal faces. By squeezing the crystal, you'veproduced a voltage across its opposite faces—and that's piezoelectricity!



Nanowires

- http://www.nature.com/nature/journal/v451/n7175/abs/nature06381.htmlEnhanced thermoelectric performance of rough silico n nanowiresNature 451, 163-167 (10 January 2008) | doi:10.1038/nature06381; Received 7 June 2007; Accepted 9 October 2007Allon I. Hochbaum1,5, Renkun Chen2,5, Raul Diaz Delgado1, Wenjie Liang1, Erik C. Garnett1, Mark Najarian3, Arun Majumdar2,3,4 & PeidongYang1,3,4

5. Department of Chemistry,6. Department of Mechanical Engineering,7. Department of Materials Science and Engineering, University of California, Berkeley, California 94720, USA8. Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720, USA9. These authors contributed equally to this work.

Correspondence to: Arun Majumdar2,3,4Peidong Yang1,3,4 Correspondence and requests for materials should be addressed to A.M. (Email:[email protected]) and P.Y. (Email: [email protected]).

Approximately 90 per cent of the world's power is generated by heat engines that use fossil fuel combustion asa heat source and typically operate at 30–40 per cent efficiency, such that roughly 15 terawatts of heat is lostto the environment. Thermoelectric modules could potentially convert part of this low-grade waste heat toelectricity. Their efficiency depends on the thermoelectric figure of merit ZT of their material components,which is a function of the Seebeck coefficient, electrical resistivity, thermal conductivity and absolutetemperature. Over the past five decades it has been challenging to increase ZT > 1, since the parameters ofZT are generally interdependent1. While nanostructured thermoelectric materials can increase ZT >, thematerials (Bi, Te, Pb, Sb, and Ag) and processes used are not often easy to scale to practically usefuldimensions. Here we report the electrochemical synthesis of large-area, wafer-scale arrays of rough Sinanowires that are 20–300 nm in diameter. These nanowires have Seebeck coefficient and electrical resistivityvalues that are the same as doped bulk Si, but those with diameters of about 50 nm exhibit 100-fold reductionin thermal conductivity, yielding ZT = 0.6 at room temperature. For such nanowires, the lattice contribution tothermal conductivity approaches the amorphous limit for Si, which cannot be explained by current theories.Although bulk Si is a poor thermoelectric material, by greatly reducing thermal conductivity without muchaffecting the Seebeck coefficient and electrical resistivity, Si nanowire arrays show promise as high-performance, scalable thermoelectric materials.

- http://www.sciencedaily.com/releases/2008/01/080110161823.htmBody Heat To Power Cell Phones? Nanowires Enable Re covery Of Waste Heat EnergyEnergy now lost as heat during the production of electricity could be harnessed through the use of siliconnanowires synthesized via a technique developed by researchers with the U.S. Department of Energy's (DOE)Lawrence Berkeley National Laboratory (Berkeley Lab) and the University of California (UC) at Berkeley.Copyright © 1995-2008 ScienceDaily LLC

- http://spie.org/x20171.xmlEnergy harvesting for self-powered nanosystemsZhong Lin (Z.L.) WangEnergy from sources such as body movement or blood flow is converted to electrical energy bydeforming piezoelectric semiconducting nanowires.25 March 2008, SPIE Newsroom. DOI: 10.1117/2.1200801.1040

Developing novel technologies for wireless nanodevices and nanosystems is of critical importance for in situ,real-time and implantable biosensing and defense applications, and even wearable personal electronics. Ananodevice requires a power source, which may be provided directly or indirectly by a battery. But it is highlydesirable for wireless devices to be self-powered. That requires exploring innovative nanotechnologies forconverting mechanical, vibration, and hydraulic energy into electric energy for battery-free nanodevices.



We have demonstrated an innovative approach for converting mechanical energy into electricity usingpiezoelectric zinc oxide (ZnO) nanowires that can be grown on any substrate (e.g., metals, ceramics,polymers, and textile fibers) of any shape.

Schematic diagram showing the DC nanogenerator built using aligned ZnO nanowire arrays with a zigzag topelectrode. The nanogenerator is driven by an external ultrasonic wave or mechanical vibration, and the outputcurrent is continuous. The lower plot is the output from a nanogenerator with the ultrasonic wave on and off.The output current reached 600nA for a 3mm2 nanogenerator.

The principle and technology demonstrated here have the potential to convert energy from mechanicalmovement (such as body motion, muscle stretching, and blood pressure), vibrations (such as acoustic andultrasonic waves), and hydraulic movement (such as flow of body fluid and blood, or contraction of bloodvessels) into electrical energy to power nanodevices and nanosystems. Relevant applications includeimplantable biosensing, wireless and remote sensing, nanorobotics, microelectromechanical systems, andsonic wave detection.This research was supported by the National Science Foundation, NASA, the Defense Research ProjectsAgency, and the National Institutes of Health. Thanks to Xudong Wang, Jinhui Song, and Jin Liu for theircontribution.



- http://gtresearchnews.gatech.edu/self-powered-nanosensors/Self-Powered Nanosensors: Researchers Use Improved Nanogenerators to Power Sensors Based onZinc Oxide NanowiresWriter: John Toon - Georgia Institute of TechnologyBy combining a new generation of piezoelectric nanogenerators with two types of nanowire sensors,researchers have created what are believed to be the first self-powered nanometer-scale sensing devices thatdraw power from the conversion of mechanical energy. The new devices can measure the pH of liquids ordetect the presence of ultraviolet light using electrical current produced from mechanical energy in theenvironment.

Figure shows (a) Fabrication of a vertical-nanowire integrated nanogenerator (VING), (b) Design of a lateral-nannowire integrated nanogenerator (LING) array, (c) Scanning electron microscope image of a row oflaterally-grown zinc oxide nanowire arrays, and (d) Image of the LING structure. (Click image for high-resolution version. Credit: Zhong Lin Wang)The alternating current output of the nanogenerators depends on the amount of strain applied. “At a strainrate of less than two percent per second, we can produce output voltage of 1.2 volts,” said Wang. “The poweroutput is matched with the external load.”Lateral nanogenerators integrating 700 rows of zinc oxide nanowires produced a peak voltage of 1.26 volts ata strain of 0.19 percent. In a separate nanogenerator, vertical integration of three layers of zinc oxidenanowire arrays produced a peak power density of 2.7 milliwatts per cubic centimeter.



PPrriinntteedd MMeemmoorryyhttp://www.thinfilm.se/news/38-press-releases/220-thinfilm-works-with-parc-to-develop-next-generation-printed-memory-solutions

Thinfilm Works with PARC to Develop Next-Generation Printed Memory SolutionsNovember 4th, 2010

Thinfilm (Thin Film Electronics ASA), a provider of advanced printed memory technology, and PARC (PaloAlto Research Center Incorporated), a premier center for commercial innovation, today announced that theyare working together to provide next-generation memory technology enabled through printed electronics.

- http://www.thinfilm.se/about-us/technology-overview

Thinfilm’s technology is based on using a ferroelectric polymer as the functional memory material sandwichedbetween two sets of electrodes in a passive matrix – each crossing of metal lines defines a memory cell.The memory function is based on an intrinsic mechanism related to orientation of the polymer chains. Thepolymer chains can be oriented in two different ways representing “0” and “1”. Each state is stable withoutapplication of an external field which means that information in the memory will not be lost when the power isturned off. This is referred to as a non-volatile memory. The intrinsic character of the polymer means that thetechnology is extremely scalable. Thinfilm has demonstrated 110 nm cells and shown that no lower limits



could be found. An additional important characteristic of the technology is that it is based on non-toxicmaterials. This is very important in realizing our Memory EverywhereTM visionThe Thinfilm-patented passive matrix is the “Holy grail” of memory architectures that dispenses with the needof active circuitry within the memory cell. This enables ultimate packing for high density memories as well asthe possibility to stack memory layers on top of each other. The passive array memory architecture allows thememory portion to be separate from the read/write electronics enabling stand alone application withoutintegration with printed logic.

- http://www.thinprofiletech.com/?p=46Custom Printed Circuits with Embedded PowerThe TPT AdvantageWhy design the circuit to fit the battery? With the Embedded Power Platform® and TPT’s customizable batterytechnology, we design the battery to fit the circuit and its product form factor requirements. By printing thebattery in-line with the circuit, we deliver a more robust solution that delivers more capacity at lower price.

Custom Design and ManufactureWith manual sheet-fed, automatic sheet-fed, and web roll-to-roll presses, TPT can tailor the size of each run tothe opportunity or substrate used, and easily scale up when demand rises. We handle a large variety ofsubstrates and conductive materials in both sheet and web format. Best of all, as pioneers in the field ofprinted electronics, we can put our knowledge and experience to work for you.

Battery SpecificationsProperty Specification

Battery Chemistry Carbon ZincCathode Manganese DioxideAnode ZincVoltage 1.5 V, 3.0 V, 4.5 V, 6.0 VCapacity Up to 2.5 mAh/cm2, depending on formulation and thicknessSelf-Discharge <1% per monthDurability and Flexibility ISO 7810 CompliantOperating Temperature -10°C (15°F) to 60°C (140°F)Storage Temperature -20°C (-5°F) to 40°C (105°F)Thickness 0.1 mm (100 microns; 4 mils) to 1.0 mm (1000 microns; 40 mils)Battery Tab Connection Anisotropic conductive film (ACF) or ultrasonic weldForm Factor Virtually unlimitedProduction Status Mass production



PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd AAAAAAAAnnnnnnnntttttttteeeeeeeennnnnnnnnnnnnnnnaaaaaaaassssssss- http://www.media.rice.edu/media/NewsBot.asp?MODE=VIEW&ID=13899Nano-based RFID tag, you're itRice, Korean collaboration produces printable tag that could replace bar codes3/18/2010

RFID tags printed through a new roll-to-roll process could replace bar codesCREDIT: GYOU-JIN CHO/SUNCHON NATIONAL UNIVERSITY

Rice researchers, in collaboration with a team led by Gyou-jin Cho at Sunchon National University in Korea,have come up with an inexpensive, printable transmitter that can be invisibly embedded in packaging. It wouldallow a customer to walk a cart full of groceries or other goods past a scanner on the way to the car; thescanner would read all items in the cart at once, total them up and charge the customer's account whileadjusting the store's inventory.The technology reported in the March issue of the journal IEEE Transactions on Electron Devices is based ona carbon-nanotube-infused ink for ink-jet printers first developed in the Rice lab of James Tour, the T.T. andW.F. Chao Chair in Chemistry as well as a professor of mechanical engineering and materials science and of



computer science. The ink is used to make thin-film transistors, a key element in radio-frequency identification(RFID) tags that can be printed on paper or plastic."We are going to a society where RFID is a key player," said Cho, a professor of printed electronicsengineering at Sunchon, who expects the technology to mature in five years. Cho and his team are developingthe electronics as well as the roll-to-roll printing process that, he said, will bring the cost of printing the tagsdown to a penny apiece and make them ubiquitous.Printable RFIDs are practical because they're passive. The tags power up when hit by radio waves at the rightfrequency and return the information they contain. "If there's no power source, there's no lifetime limit. Whenthey receive the RF signal, they emit," Tour said.Tour allayed concerns about the fate of nanotubes in packaging. _The amount of nanotubes in an RFID tag isprobably less than a picogram. That means you can produce one trillion of them from a gram of nanotubes —a miniscule amount. Our HiPco reactor produces a gram of nanotubes an hour, and that would be enough tohandle every item in every Walmart."In fact, more nanotubes occur naturally in the environment, so it's not even fair to say the risk is minimal. It'sinfinitesimal."

- http://www.electroscience.com/smartcardappnotes.htmlNew Flexible Polymer Silver from ESL ElectroScienceThe rapid growth in the use of these devices has necessitated the search for a fast, cost-efficient, seamlessmanufacturing route. Reel to reel technology, such as is used in the newspaper industry, is considered to befaster than traditional methods of handling substrate material. Institutes like Fraunhofer IZM are preparingsmart cards/labels using continuous production lines.Central to the success of this manufacturing route is the use of polymer based thick-film pastes that can bescreen-printed using specially adapted printers that accept a reel to reel process.

Smart label from the Fraunhofer Institut Zuverlässigkeit undMikrointegration (IZM) in Munich, Germany

Fraunhofer IZM reel to reel process

The choice of substrate material allows for relatively high processing temperatures (up to 150 °C for the fewminutes it takes to cure the paste). Line/space resolutions of 200 µm have been achieved quite easily and thespread in resistance values of tracks printed at this thickness are good. The resistivity of ESL1901-S is 15-20mΩ/square at a thickness of 25 µm when cured at 80 °C for two hours. The substrate chosen is thee plasticthat is used for credit cards. It may well be that this resistivity is too high for some applications and ESL isworking on a lower-resistivity polymer silver. While silver is the metal that has been chosen to produce thepioneer product, other metals are being considered for inclusion in a polymer matrix to make a screen-printable conductor for antennas.Copyright © 2004-2008 ESL ElectroScience. All rights reserved



WWWWWWWWiiiiiiiirrrrrrrreeeeeeeelllllllleeeeeeeessssssssssssssss tttttttteeeeeeeecccccccchhhhhhhhnnnnnnnnoooooooollllllllooooooooggggggggiiiiiiiieeeeeeeessssssss

Wi-Fi

- http://en.wikipedia.org/wiki/Wi-FiWi-Fi is the trade name for a popular wireless technology used in home networks, mobile phones, videogames and more.

Wi-Fi networks have limited range. A typical Wi-Fi home router using 802.11b or 802.11g with a stock antennamight have a range of 32 m (120 ft) indoors and 95 m (300 ft) outdoors. Range also varies with frequencyband. Wi-Fi in the 2.4 GHz frequency block has slightly better range than Wi-Fi in the 5 GHz frequency block.Outdoor range with improved (directional) antennas can be several kilometres or more with line-of-sight.Wi-Fi performance decreases roughly quadratically as the range increases at constant radiation levels.

802.11 network standardsApproximate indoor

rangeApproximate Outdoor

range802.11

Protocol

Freq.(GHz)

Bandwidth(MHz)

Data rate per stream(Mbit/s) Modulation

(m) (ft) (m) (ft)– 2.4 20 1, 2 DSSS, FHSS 20 66 100 330

5 35 115 120 390a3.7[y]

20 6, 9, 12, 18, 24, 36, 48,54

OFDM-- -- 5,000 16,000

b 2.4 20 5.5, 11 DSSS 38 125 140 460

g 2.4 20 6, 9, 12, 18, 24, 36, 48,54

OFDM, DSSS 38 125 140 460

20 7.2, 14.4, 21.7, 28.9,43.3, 57.8, 65, 72.2[z]

70 230 250 820n 2.4/5

40 15, 30, 45, 60, 90, 120,135, 150[z]

OFDM70 230 250 820

• y IEEE 802.11y-2008 extended operation of 802.11a to the licensed 3.7 GHz band. Increased power limits allow a range upto 5000m. As of 2009[update], it is only being licensed in the United States by the FCC.

• z Assumes Short Guard interval (SGI) enabled, otherwise reduce each data rate by 10%.

WiMAX

- http://en.wikipedia.org/wiki/WiMaxWiMAX , the Worldwide Interoperability for Microwave Access, is a telecommunications technology thatprovides wireless data in a variety of ways, from point-to-point links to full mobile cellular type access. It isbased on the IEEE 802.16 standard, which is also called WirelessMAN.

WiMAX is a term coined to describe standard, interoperable implementations of IEEE 802.16 wirelessnetworks, similar to the way the term Wi-Fi is used for interoperable implementations of the IEEE 802.11Wireless LAN standard. However, WiMAX is very different from Wi-Fi in the way it works.

A commonly-held misconception is that WiMAX will deliver 70 Mbit/s over 50 kilometers. In reality, WiMAX cando one or the other — operating over maximum range (50 km) increases bit error rate and thus must use alower bitrate. Lowering the range allows a device to operate at higher bitrates.Typically, fixed WiMAX networks have a higher-gain directional antenna installed near the client (customer)which results in greatly increased range and throughput. Mobile WiMAX networks are usually made of indoor"customer premises equipment" (CPE) such as desktop modems, laptops with integrated Mobile WiMAX orother Mobile WiMAX devices. Mobile WiMAX devices typically have an omni-directional antenna which is oflower-gain compared to directional antennas but are more portable. In practice, this means that in a line-of-sight environment with a portable Mobile WiMAX CPE, speeds of 10 Mbit/s at 10 km could be delivered.However, in urban environments they may not have line-of-sight and therefore users may only receive 10Mbit/s over 2 km. In current deployments, throughputs are often closer to 2 Mbit/s symmetric at 10 km withfixed WiMAX and a high gain antenna. It is also important to consider that a throughput of 2 Mbit/s can mean 2



Mbit/s, symmetric simultaneously, 1 Mbit/s symmetric or some asymmetric mix (e.g. 0.5 Mbit/s downlink and1.5 Mbit/s uplink or 1.5 Mbit/s downlink and 0.5 Mbit/s uplink, each of which required slightly different networkequipment and configurations. Higher-gain directional antennas can be used with a Mobile WiMAX networkwith range and throughput benefits but the obvious loss of practical mobility.

Comparison with Wi-Fi

Comparisons and confusion between WiMAX and Wi-Fi are frequent, possibly because both begin with thesame two letters, are based upon IEEE standards beginning with "802.", and both have a connection towireless connectivity and the Internet. Despite this, the two standards are aimed at different applications.

· WiMAX is a long-range system, covering many kilometers that typically uses licensed spectrum(although it is possible to use unlicensed spectrum) to deliver a point-to-point connection to theInternet from an ISP to an end user. Different 802.16 standards provide different types of access, frommobile (similar to data access via a cellphone) to fixed (an alternative to wired access, where the enduser's wireless termination point is fixed in location.)

· Wi-Fi is a shorter range system, typically tens of meters, that uses unlicensed spectrum to provideaccess to a network, typically covering only the network operator's own property. Typically Wi-Fi isused by an end user to access their own network, which may or may not be connected to the Internet.If WiMAX provides services analogous to a cellphone, Wi-Fi is more analogous to a cordless phone.It's important to note, however, that free community wi-fi networks have shown that with properantennas, wi-fi can have very long ranges.

· WiMAX and Wi-Fi have quite different Quality of Service (QoS) mechanisms. WiMAX uses amechanism based on setting up connections between the Base Station and the user device. Eachconnection is based on specific scheduling algorithms, which means that QoS parameters can beguaranteed for each flow. Wi-Fi has introduced a QoS mechanism similar to fixed Ethernet, wherepackets can receive different priorities based on their tags. This means that QoS is relative betweenpackets/flows, as opposed to guaranteed.

· WiMAX is highly scalable from what are called "femto"-scale remote stations to multi-sector 'maxi'scale base that handle complex tasks of management and mobile handoff functions and includeMIMO-AAS smart antenna subsystems.

Due to the ease and low cost with which Wi-Fi can be deployed, it is sometimes used to provide Internetaccess to third parties within a single room or building available to the provider, often informally, andsometimes as part of a business relationship. For example, many coffee shops, hotels, and transportationhubs contain Wi-Fi access points providing access to the Internet for customers.

Bluetooth

- http://en.wikipedia.org/wiki/Bluetooth

Bluetooth is a wireless protocol utilizing short-range communications technology facilitating data transmissionover short distances from fixed and/or mobile devices, creating wireless personal area networks (PANs).

Maximum Permitted PowermW(dBm )

Range (approximate)

Class 1 100 mW (20 dBm) ~100 metersClass 2 2.5 mW (4 dBm) ~10 metersClass 3 1 mW (0 dBm) ~1 meter

In most cases the effective range of class 2 devices is extended if they connect to a class 1 transceiver,compared to pure class 2 network. This is accomplished by the higher sensitivity and transmission power ofClass 1 devices.

Version Data Rate

Version 1.2 1 Mbit/sVersion 2.0 + EDR 3 Mbit/sWiMedia Alliance(proposed)

53 - 480 Mbit/s



RFID

- http://en.wikipedia.org/wiki/RFIDRadio-frequency identification (RFID) is an automatic identification method, relying on storing and remotelyretrieving data using devices called RFID tags or transponders.An RFID tag is an object that can be applied to or incorporated into a product, animal, or person for thepurpose of identification using radio waves. Some tags can be read from several meters away and beyond theline of sight of the reader.Most RFID tags contain at least two parts. One is an integrated circuit for storing and processing information,modulating and demodulating a (RF) signal, and other specialized functions. The second is an antenna forreceiving and transmitting the signal. Chipless RFID allows for discrete identification of tags without anintegrated circuit, thereby allowing tags to be printed directly onto assets at a lower cost than traditional tags.

RFID tags come in three general varieties:- passive, active, or semi-passive (also known as battery-assisted).Passive tags require no internal power source, thus being pure passive devices (they are only active when areader is nearby to power them), whereas semi-passive and active tags require a power source, usually asmall battery.

Passive tags have practical read distances ranging from about 10 cm (4 in.) (ISO 14443) up to a fewmeters (Electronic Product Code (EPC) and ISO 18000-6), depending on the chosen radio frequency andantenna design/size. But thanks to deep-space technology, that distance is now 600 feet[6]. Due to theirsimplicity in design they are also suitable for manufacture with a printing process for the antennas. The lack ofan onboard power supply means that the device can be quite small: commercially available products exist thatcan be embedded in a sticker, or under the skin in the case of low frequency (LowFID) RFID tags.

Many active tags today have operational ranges of hundreds of meters, and a battery life of up to 10years. Active tags may include larger memories than passive tags, and may include the ability to storeadditional information received from the reader.Special active RFID tags may include temperature sensors. Temperature logging is used to monitor thetemperature profile during transportation and storage of perishable goods as fresh produce or certainpharmaceutical products. Other sensor types are combined with active RFID tags, including humidity,shock/vibration, light, radiation, temperature, pressure and concentrations of gases like ethylene.

Semi-passive tags are similar to active tags in that they have their own power source, but the batteryonly powers the microchip and does not power the broadcasting of a signal. The response is usually poweredby means of backscattering the RF energy from the reader, where energy is reflected back to the reader aswith passive tags. An additional application for the battery is to power data storage.If energy from the reader is collected and stored to emit a response in the future, the tag is operating activeWhereas in passive tags the power level to power up the circuitry must be 100 times stronger than with activeor semi-active tags, also the time consumption for collecting the energy is omitted and the response comeswith shorter latency time. The battery-assisted reception circuitry of semi-passive tags leads to greatersensitivity than passive tags, typically 100 times more. The enhanced sensitivity can be leveraged asincreased range (by one magnitude) and/or as enhanced read reliability (by reducing bit error rate at least onemagnitude).The enhanced sensitivity of semi-passive tags place higher demands on the reader concerning separation inmore dense population of tags. Because an already weak signal is backscattered to the reader from a largernumber of tags and from longer distances, the separation requires more sophisticated anti-collision concepts,better signal processing and some more intelligent assessment which tag might be where. For passive tags,the reader-to-tag link usually fails first. For semi-passive tags, the reverse (tag-to-reader) link usually collidesfirst.Semi-passive tags have three main advantages 1) Greater sensitivity than passive tags 2) Longer batterypowered life cycle than active tags. 3) Can perform active functions (such as temperature logging) under itsown power, even when no reader is present for powering the circuitry.

- http://www.gentag.com/technology.htmlA particular focus area for Gentag using RFID cell phones are diagnostic applications. RFID sensors can beintegrated into low cost, non-invasive, disposable diagnostic devices such as _smart" disposable wireless skinpatches or personal drug delivery systems and read directly with a cellphone under existing Gentag/Altivera patents.Copyright © 2008 Gentag, Inc



NNNNNNNNaaaaaaaannnnnnnnoooooooottttttttuuuuuuuubbbbbbbbeeeeeeee RRRRRRRRaaaaaaaaddddddddiiiiiiiioooooooo- http://www.lbl.gov/Tech-Transfer/techs/lbnl2431.htmlNanotube Radio for Communications and Medical Appli cationsAlex Zettl and his team at Berkeley Lab have invented and constructed a fully functional, integrated radioreceiver based on a single carbon nanotube (CNT). The nanotube serves simultaneously as all essentialcomponents of a radio -- antenna, tunable band-pass filter, amplifier, and demodulator—to convert anelectromagnetic signal into a mechanical signal and then into an electrical signal amplified and demodulated toproduce audible sound. The radio is several orders of magnitude smaller than previous radios due to the useof the nanotube's electro-mechanical movement instead of a conventional radio's electrical components.Berkeley Lab's nanotube radio promises smaller, less complex, and lower power-requirement wirelesscommunication devices. The radio can be configured to be either a receiver or a transmitter. Because its scaleis compatible with biological systems, the radio also offers unique opportunities for radio controlled devices tobe placed in the body for various diagnostic, therapeutic, monitoring, and sensory (auditory and visual)functions.In addition, the nanotube may be altered by contact with particles at the atomic scale that change theresonance frequency of the nanotube. This change may be used to detect the impingement of particles,whether solid or gaseous, to create a highly sensitive, inexpensive mass spectrometer or gas sensor. A massspectrometer constructed using this technology can detect the mass of less than a single hydrogen atom. Thenanotube application could also measure the masses of large molecules or those that are difficult to ionize,e.g., DNA, proteins, because it does not rely on ionizing a particle to make measurements, as in traditionalmass spectrometers.

(a) Schematic of the nanotube radio. Radio transmissions tuned to the nanotube's resonance frequency forcethe charged nanotube to vibrate. Field emission of electrons from the tip of the nanotube is used to detect thevibrations and also amplify and demodulate the signal. A current measuring device, such as a sensitivespeaker, monitors the output of the radio.(b) Transmissionelectron micrographs of a nanotube radio off resonance (top) and on resonance (bottom)during a radio transmission.

APPLICATIONS OF TECHNOLOGY:· All-in-one radio receiver for cell phones/wireless networks/GPS and other electronic devices· Radio controlled devices that can exist inside the body, e.g. used as drug release triggers, diagnostic

instrumentation, interfacing with muscle or brain function· Ultra small hearing aid· RF antenna, tunable pass filter, amplifier, or demodulator· Mass spectrometer· Chemical sensor

FOR MORE INFORMATION:Jensen, K., Weldon, J., Garcia, H., Zettl, A., Nanotube Radio, Nano Letters, Vol. 0, No. 0, A-D



- http://www.lbl.gov/Science-Articles/Archive/MSD-nanoradio.htmlPublished patent application WO/2009/048695 available at http://www.wipo.int/. Available for licensing.

- http://www.technologyreview.com/printer_friendly_article.aspx?id=20244Copyright Technology Review 2011

- http://www.lbl.gov/Science-Articles/Archive/MSD-nanoradio.htmlBerkeley Researchers Create First Fully Functional Nanotube Radio

Block diagram for a traditional radio. All four essential components of a radio, antenna, tuner, amplifier, anddemodulator may be implemented with a single carbon nanotube.



Video- http://www.lbl.gov/Science-Articles/Archive/assets/images/2007/Oct/30-Tue/nanoradio-starwars.mov

This QuickTime video was recorded on the nanotube radio using a Transmission Electron Microscope. At thebeginning of the video, the nanotube radio is tuned to a different frequency than that of the transmitted radiosignal so the nanotube does not vibrate and only static noise can be heard. As the radio is brought into tunewith the transmitted signal, the nanotube begins to vibrate, which blurs its image in the video but allows themusic to become audible. The song is the theme music to Star Wars by John Williams.

- http://thefutureofthings.com/news/1185/nanoradio-smallest-radio-receiver-in-the-world.htmlSmallest Radio Receiver in the World

Radio evolution - the nanoradio is nineteen orders-of-magnitude smaller than the Philco vacuum tube radiofrom the 1930s (Credit: Berkeley / A. Zettl and K. Jensen)Copyright © 2008 The Future of Things. All rights reserved



SSSSSSSSoooooooouuuuuuuunnnnnnnnddddddddUltrathin loudspeakers made from transparent and f lexible carbon nanotube films, don't require anyof the bulky magnets and sound cones of conventiona l speakers.

- http://pubs.acs.org/doi/abs/10.1021/nl802750zFlexible, Stretchable, Transparent Carbon Nanotube Thin Film LoudspeakersLin Xiao, Zhuo Chen, Chen Feng, Liang Liu, Zai-Qiao Bai, Yang Wang, Li Qian, Yuying Zhang, Qunqing Li, Kaili Jiang, Shoushan FanDepartment of Physics & Tsinghua-Foxconn Nanotechnology Research Centre, Tsinghua University, Beijing 100084, People's Republic ofChina, and Department of Physics, Beijing Normal University, Beijing 100875, People's Republic of ChinaNano Lett., 2008, 8 (12), pp 4539—4545DOI: 10.1021/nl802750zPublication Date (Web): October 29, 2008

We found that very thin carbon nanotube films, once fed by sound frequency electric currents, could emit loudsounds. This phenomenon could be attributed to a thermoacoustic effect (see page 92). The ultra small heatcapacity per unit area of carbon nanotube thin films leads to a wide frequency response range and a highsound pressure level. On the basis of this finding, we made practical carbon nanotube thin film loudspeakers,which possess the merits of nanometer thickness and are transparent, flexible, stretchable, and magnet-free.Such a single-element thin film loudspeaker can be tailored into any shape and size, freestanding or on anyinsulating surfaces, which could open up new applications of and approaches to manufacturing loudspeakersand other acoustic devices.Copyright © 2008 American Chemical Society

- http://pubs.acs.org/cen/news/86/i45/8645notw9.html

Video Nanotube-based speaker plays music from an iPod beneath it.

- http://www.natureasia.com/asia-materials/highlight.php?id=340Carbon nanotubes: Loud and clearTo make a loudspeaker from the films was extremely simple. _All that was needed were two electrodesattached to the carbon nanotube films through which the audio frequency voltage is applied," says Kaili Jiangfrom the research team. The sound output from the loudspeaker was clear and the acoustic performancerelatively constant across the audible frequency spectrum.

A carbon nanotubes loudspeaker placed in front of an iPod to demonstrate the possible integration withdisplay devices

Xiao, L. et al. Flexible, stretchable, transparent carbon nanotubes thin film loudspeakers. Nano Lett. Doi:10.1021/nl802750z (2008).© 2008 Tokyo Institute of Technology

- http://www.newscientist.com/article/dn15098



by Colin Barras © Copyright 2008 Reed Business Information Ltd.Hot nanotube sheets produce music on demandSheets made of carbon nanotubes behave like a loudspeaker when zapped with a varying electric current, sayChinese researchers. The discovery could lead to new generation of cheap, flat speakers.

Video- http://thefutureofthings.com/news/5967/flexible-transparent-nanotube-based-loudspeakers.htmlFlexible, Transparent Nanotube-Based LoudspeakersResearchers from Tsinghua University and Beijing University have recently developed a thin film based oncarbon nanotubes (CNT) that could replace conventional magnetic loudspeakers. By applying an audiofrequency current through the CNT, the loudspeaker can generate sound with wide frequency range, highsound pressure levels (SPL), and low total harmonic distortion (THD). The uniqueness of this advancement isthat the films are flexible, stretchable, transparent, and can be tailored into many shapes and sizes,freestanding or placed on a variety of rigid or flexible insulating surfaces.

Flat flexible speakers

- http://www2.warwick.ac.uk/newsandevents/pressreleases/new_flat_flexible

A groundbreaking new loudspeaker, less than 0.25mm thick, has been developed by University of Warwickengineers, it's flat, flexible, could be hung on a wall like a picture, and its particular method of soundgeneration could make public announcements in places like passenger terminals clearer, crisper, and easierto hear.

Lightweight and inexpensive to manufacture, the speakers are slim and flexible: they could be concealedinside ceiling tiles or car interiors, or printed with a design and hung on the wall like a picture.All speakers work by converting an electric signal into sound. Usually, the signal is used to generate a varyingmagnetic field, which in turn vibrates a mechanical cone, so producing the sound.Warwick Audio Technology's FFL technology is a carefully designed assembly of thin, conducting andinsulating, materials resulting in the development of a flexible laminate, which when excited by an electricalsignal will vibrate and produce sound.

The speaker laminate operates as a perfect piston resonator. The entire diaphragm therefore radiates inphase, forming an area source. The wave front emitted by the vibrating surface is phase coherent, producing aplane wave with very high directivity and very accurate sound imaging.



- http://blogs.discovermagazine.com/80beats/2008/11/05/paper-thin-nanotube-speakers-can-turn-up-the-volume/Paper-Thin Nanotube Speakers Can Turn Up the Volumeby Nina Bai November 5th, 2008Next-generation loudspeakers could be as thin as paper, as clear as glass, and as stretchable as rubber.Chinese researchers have discovered that sheets of carbon nanotubes can amplify sound as loud asconventional speakers can. These nanotube speakers could eventually be used to add audio capabilities towindows, video screens, and clothing. "It is so wonderfully simple, that it brings up a strong wave of ‘Duh, whydidn’t I think of that!’," says physical chemist Howard Schmidt at Rice University [Nature News].

The researchers made the speaker by aligning carbon nanotubes, each about 10 nanometers in diameters,into thin flexible sheets. When they applied an electric current with an audio frequency to the sheets, thesheets broadcast the sounds loud and clear. The researcher describe their device in Nano Letters. Thephysics behind the nanotube speakers is different from that of conventional speakers. Unlike standardloudspeakers that generate sound by vibrations in the surrounding air molecules, the nanotube speakerdoesn’t emit vibrations. The team used a laser vibrometer to detect vibrations in the sheet, but found nothing[Physorg.com].

Instead, it generates sound much as lightning produces thunder. When an electric current is applied to thenanotubes, they heat and expand the air near them, creating sound waves. "The difference is that thunder isnot a controlled discharge. With carbon nanotubes, you can control the sound and play music," [researcherKaili] Jiang says [Nature News]. The phenomenon is known as the thermoacoustic effect. The thermallyinduced pressure oscillations can heat the speakers up to 80 °C but the researchers say temperatures s lightlyabove room temperature would be adequate for consumer applications.

The basic idea of using the thermoacoustic effect to make speakers isn’t new. In the late 19th century,researchers built a "thermophone" out of thin sheets of metal, but it could only produce a whisper of a sound.The new nanotube speakers can produce sounds 20 to 30 decibels louder than the thermophone, thanks tothe low heat capacity of the nanotubes. "A key parameter that determines the sound generation efficiency isthe heat capacity per unit area," [explains Jiang]. Put simply, that’s a measure of how much heat energy mustbe applied to a material to raise its temperature. The heat capacity per unit area of a carbon nanotube sheet is260 times smaller than that of a platinum foil sheet [New Scientist].©2008 discovermagazine.com

Carbon Nanotubes Speaker

- http://www.physorg.com/news144939492.htmlCarbon nanotubes could act as an efficient music sp eakerNovember 3, 2008 by Lisa Zyga

VideoExcerpt from a video of Lin Xiao´s nanotube music speaker. The speaker produces sound when a currentpasses through, due to a thermoacoustic effect. Credit: Lin Xiao, et al.

(PhysOrg.com) -- While carbon nanotubes are widely praised for their strength and electrical properties, noone has thoroughly investigated their acoustic properties, until now. A team of Chinese researchers has foundthat zapping sheets of carbon nanotubes with an electric current causes the nanotubes to emit sound.

The team, which consists of scientists Shoushan Fan and colleagues at Tsinghua University in Beijing, China,and Beijing Normal University, hope that the discovery could lead to the development of cheap, flatloudspeakers. Examples of carbon nanotubes´ musical abilities can be heard here and here.



To create the nanotube speaker, the researchers sent an audio frequency current through a thin sheet ofcarbon nanotubes, generating a sound. Unlike standard loudspeakers that generate sound by vibrations in thesurrounding air molecules, the nanotube speaker doesn´t emit vibrations. The team used a laser vibrometer todetect vibrations in the sheet, but found nothing.Instead, the nanotube speaker likely works as a thermoacoustic device: when an alternating current passesthrough the sheet, the sheet experiences rapid temperature oscillations alternating between room temperatureand 80 °C (176 °F). These temperature oscillations cause pressure oscillations in the surrounding air,producing the sound, while the nanotube sheet remains static. One advantage of this method is that, even ifpart of the nanotube sheet breaks, it should continue to emit sound, unlike conventional speakers.This thermoacoustic phenomenon was actually discovered in the late nineteenth century, when scientistspassed a current through a thin foil to produce sound, leading to the invention of the "thermophone." Althoughthe principle is the same, however, the nanotube sheet acts much more efficiently than foil because it doesn´trequire nearly as much applied heat to increase its temperature. Specifically, the nanotube sheet´s heatcapacity is 260 times smaller than platinum foil, making nanotubes 260 times more efficient and able toproduce a louder sound.The Chinese researchers envision several interesting applications for the nanotube speakers. Because thenanotube sheets can be stretched to be visually transparent and still produce sound, they might be fitted overthe front of an LCD screen to replace conventional speakers. Another possibility is incorporating the nanotubespeakers into textiles to create musical clothes.More information: Xiao, Lin, et al. "Flexible, Stretchable, Transparent Carbon Nanotube Thin Film Loudspeakers." ASAP Nano Lett., ASAPArticle, 10.1021/nl802750z.© 2009 PhysOrg.com

- http://www.gizmag.com/nanotube-sheets-for-stealthy-submarines/16231/Nanotube sheets could lead to stealthier submarinesBy Ben Coxworth September 2, 2010

One of the sound-generating carbon nanotube sheets

Two years ago, Chinese scientists coated one side of a flag with a thin sheet of nanotubes, then played asong using the flapping sheet-coated flag as a speaker. It was a demonstration of flexible speaker technology,in which nanotubes can be made to generate sound waves via a thermoacoustic effect – every time anelectrical pulse is sent through the microscopic layer of nanotubes, it causes the air around them to heat up,which in turn creates a sound wave. Now, an American scientist has taken that technology underwater, wherehe claims it could allow submariners to detect other submarines, and to remain hidden themselves.Research scientist Ali Aliev, of the University of Texas at Dallas, has determined that the low-frequency soundwaves created by carbon nanotube sheets can be used by sonar systems to determine the location, depth,and speed of underwater objects. Aliev and his team also determined that the sheets could be tuned totransmit specific frequencies that would cancel out certain noises... noises such as those that a submarinemakes while passing through the water, for instance.



One obstacle that Aliev had to overcome was the fact that the sheets do not do well in direct contact withwater. The sheets can oxidize when in contact with water at high temperatures, the high surface tension andvibrational frequency of water causes the nanotubes to bundle into acoustically-poor ropes, and ocean watercan cause the sheets to short circuit. On the plus side, however, the hydrophobic (water-repellent) nature ofthe sheets causes an air envelope to form around the nanotubes, which in turn acts as a kind of resonatingchamber for the sound waves, boosting their strength.Be that as it may, the sheets still needed to be protected from the water. In order to do so, Aliev encapsulatedthem in thin, flat gas-filled containers with acoustically-transparent windows. As with the air envelopes, theresonance that resulted from the sound waves being generated in such an enclosed space proved to be abenefit – the encapsulated sheets were actually ten times more effective at transmitting low-frequency soundunderwater than non-encapsulated sheets.

The researchers also experimented with stacking the sheets several deep, but found that this negativelyaffected the desired thermoacoustics. The optimum arrangement turned out to be a layer of just two separatedsheets, which received their electrical pulses alternately instead of simultaneously.The research has just been published in the journal Nano Letters.

- http://www.physorg.com/news195720997.htmlNanotech Speakers Hold Promise for Sonar UsesJune 14, 2010

Thin, almost transparent sheets of multi-walled (MWNT) nanotubes are connected to an electrical source,which rapidly heats the nanotubes causing a pressure wave in the surrounding air to produce sound.Led by Dr. Ali Aliev, a research scientist at the NanoTech Institute, the team discovered that nanotubes excelat producing low frequency sound waves, which are ideal for probing the depths of the ocean with sonar. Theteam also confirmed previous studies noting the ability of nanoscience speakers to cancel noise when tuned tothe correct frequency — say, the rumble of a submarine.“Nanotube sheets can easily be deployed on curved surfaces, like the hull of a sub,” Aliev said. “They’re verylight, about 20 microns thick, and they’re 99 percent porous. Layers of nanotube sheets can be built up, eachwith a different function, for sonar projector applications or for control of the boundary layer losses for marinevehicles. Meaning, periodically heating the skin of a sub—or even an airplane—warms the thin pocket of airaround the vehicle and reduces friction and turbulence. Or, these underwater sound generators could cancelout the sonar signal being sent out by another sub, leaving the friendly sub undetected.”More information: Journal paper: http://dx.doi.org/ … 21/nl100235n



Thermoacoustic effect- http://www.five-shades-of-green-energy.com/thermoacoustics.htmlThermoacoustics work both ways. Simply put, heat ma kes sound, sound makes heat.Thermoacoustics is heat that makes noise and noise that makes heat. More specifically sound oscillations thattransport heat or cold, both of which can be used to generate sound oscillations. A definition is in order – it’sthe study of phenomena influenced by thermodynamics and acoustics.

Resonance

- http://www.phys.unsw.edu.au/jw/musFAQ.htmlHow can a resonating chamber amplify sounds?Let's compare a string on immoveable mountings (an unplugged electric guitar approaches this) with a stringon an acoustic guitar. In the former, the bridge (almost) doesn't move, so no work is done by the string. Thestring itself is inefficient at moving air because it is thin and slips through the air easily, making almost nosound. So nearly all the energy of the pluck remains in the string, where it is gradually lost by internal friction.In contrast, the string on the acoustic guitar moves the belly of the instrument slightly. Even though the motionis slight, the belly is large enough to move air substantially and make a sound. So the string converts some ofits energy to sound in the air. Consequently, its vibration decreases more rapidly than does that of a similarstring on an electric guitar. (Internal losses in the string are still very important, however.)So there is no extra energy: the energy for the sound comes from the string. Which raises an obviousquestion: if there is no amplification, how does such a little vibration make such a lot of sound? The answer isthat our ears are rather sensitive (see our page on decibels and hearing). Consequently, even a small energy(even less than a millijoule) over several seconds makes a reasonably loud sound.Copyright © 2008 Joe Wolfe

- http://en.wikipedia.org/wiki/Sound_boxA sound box or sounding box , (sometimes written soundbox ), is an open chamber in the body of a musicalinstrument which alters the instrument's tone quality by modifying the way the instrument resonates.The purpose of the sound box is to amplify the volume of the instrument.

- http://en.wikipedia.org/wiki/Resonance_chamberA resonance chamber uses resonance to amplify sound. The chamber has interior surfaces which reflect anacoustic wave. When a wave enters the chamber, it bounces back and forth within the chamber with low loss(See standing wave). As more wave energy enters the chamber, it combines with and reinforces the standingwave, increasing its intensity (volume).

- http://www.glenbrook.k12.il.us/gbssci/Phys/Class/sound/u11l4b.html Resonance and Standing Waves

- http://www.murata-northamerica.com/murata/murata.nsf/pages/08032010Ultra-Thin Waterproof Piezoelectric SpeakerSmyrna, GA, August 3, 2010 - Murata Electronics North America today announced the launch of the world'sfirst ultra-thin waterproof piezoelectric speaker. With a thickness of only 0.9mm, this 19.5mm x 14.1mmspeaker enables greater design freedom for the rapidly growing and evolving mobile market. The speakerachieves IPX7 grade waterproof protection without the need of a costly water proof acoustic membrane.Using just ordinary acoustic mesh and double sided tape to seal the speaker to the front cavity, this waterproofspeaker application allows for decreased application costs, thin size, and good sound performance. The hightorque nature of the speaker's piezoelectric motor also makes it idea for operation in very small and thin backcavities where dynamic speakers struggle to operate. As such, these features make the speaker ideal formobile phones, music players, digital still cameras, digital video cameras, IC recorders, e-books and othermobile equipment.There have been numerous indicators that demonstrate the growing trend towards waterproofing mobileequipment. For example, of the 50 new Japanese mobile phone models announced in late 2010, almost one



in four were waterproof. This trend is aided by Murata's speaker ability to overcome the above mentionedtechnical and cost challenges. Specific speaker characteristics include an average sound pressure level of92.0±3.0dB (1400Hz±20%, 5Vrms sine wave, 10cm) and a capacitance of 0.9µF±30%.“We developed this waterproof speaker based on feedback from our customers and market trends," said PeterTiller, senior group product manager, Murata Electronics North America. “Too often we hear of consumerslosing a phone or camera due to accidental submersion in water. We hope our new speaker will allow moremobile consumer products to be waterproof and survive life's little accidents."Sample pricing of Murata's waterproof piezoelectric speaker is approximately $2.90 in small quantities and thelead-time is 11 weeks. Further information can be found on-line at http://www.murata-northamerica.com

- http://www.murata.com/new/news_release/2010/0608/index.html



LLLLLLLLeeeeeeeennnnnnnnssssssss- http://www.optoiq.com/index/machine-vision-imaging-processing/display/vsd-article-display/articles/optoiq2/machine-vision___image/technologies-__products/optics-__lenses_/2010/7/Tunable_Optics.html

Disparate technologies are being employed in the de velopment of miniaturized autofocus lensesAndrew Wilson, Editor - Jul 1, 2010

Many of the optical systems used in machine-vision and image-processing systems are based on glass orplastic lenses. While some of these systems employ fixed-focal-length lenses, others require lenses where thefocal length must be changed. In traditional mechanically based lens systems, this is accomplished bytranslating the optical elements within the lens against each other.

As the predominant method of focusing images for over a century, mechanical lens motion sharply contradictsthe biological methods found in nature. By leveraging principles based on these methods, manufacturers arenow developing different types of small deformable lenses that can be tuned over various focal distances.Because these lens systems can be miniaturized relatively easily, they are finding applications in smartmachine-vision cameras, endoscopy systems, and cell phones.

Electrowetting technologyFirst demonstrated more than five years ago by both Philips Research and Varioptic, liquid lenses that useelectrowetting technology perform autofocusing by employing a lens comprising two immiscible fluids ofdifferent refractive indexes. In both the Philips and Varioptic designs, these consist of an electricallyconducting water solution and electrically nonconducting oil (see figure below). The interface between theseliquids then forms a natural diopter, due to the index difference of the two liquids.

By employing an electrically conducting water solution and electrically nonconducting oil, an interface thatforms a natural diopter is created due to the index difference of the two liquids. To control the shape of the

lens, an electric field is applied across the hydrophobic coating and the aqueous solution wets the sidewalls ofthe tube, altering the radius of curvature of the meniscus between the two fluids and thus the lens' focal length.

To control the shape of the lens, an electric field is applied across the hydrophobic coating so that it becomesless hydrophobic—a process called electrowetting that results from an electrically induced change in surfacetension. As a result, the aqueous solution begins to wet the sidewalls of the tube, altering the radius ofcurvature of the meniscus between the two fluids and thus the lens' focal length. By increasing the electricfield, the surface of the initially convex lens can be made completely flat or even concave. As a result it ispossible to implement lenses that transition smoothly from being convergent to divergent and vice versa.



Liquid crystalsLiquid crystals are also being employed in other types of electro-optical adaptive lens designs to performautofocusing. In the technique used by LensVector, for example, a control voltage is applied to dynamicallychange the rotation of molecules in a liquid-crystal cell to achieve a change in refractive index. In applying thisvoltage, the differential rotation of the liquid-crystal molecules from the center to the periphery of the elementis changed, focusing light at the desired focal distance (see figure below). By tuning this voltage, thedifferential rotation of molecules in the element results in a lens that can be focused from infinity to 10 cm.

Liquid crystals are also being employed in other types of electro-optical adaptive lens designs to performautofocusing. Here, a control voltage is applied to dynamically change the rotation of molecules in a liquid-crystal cell to achieve a change in refractive index. By tuning this voltage, the differential rotation of moleculesin the element results in a lens that can be focused from infinity to 10 cm.

While such autofocus lenses have for a number of years been the subject of much research, they are nowbeing deployed by companies developing smart cameras for machine vision. Indeed, autofocus lenses basedon Varioptic's electrowetting technology have already been employed in both the DataMan 100 and 200 seriesof image-based ID readers from Cognex and the QX Hawk barcode imager from Microscan. In future, itappears that, whichever technology is adopted, such self-adaptive lenses will be used in other applications,most notably cell phones and endoscopy systems where miniaturization is an important design consideration.



- http://www.varioptic.com/en/tech/technology01.phpLiquid lens for AutofocusThe liquid lenses that we develop are based on the electrowetting phenomenon described below : a waterdrop is deposited on a substrate made of metal, covered by a thin insulating layer. The voltage applied to thesubstrate modifies the contact angle of the liquid drop. The liquid lens uses two isodensity liquids, one is aninsulator while the other is a conductor. The variation of voltage leads to a change of curvature of the liquid-liquid interface, which in turn leads to a change of the focal length of the lens.

- http://www.opticsinfobase.org/abstract.cfm?uri=oe-16-11-8084Liquid micro-lens array activated by selective elec trowetting on lithium niobate substratesS. Grilli, L. Miccio, V. Vespini, A. Finizio, S. De Nicola, and Pietro FerraroOptics Express, Vol. 16, Issue 11, pp. 8084-8093 (2008) doi:10.1364/OE.16.008084Lens effect was obtained in an open microfluidic system by using a thin layer of liquid on a polar electriccrystal like LiNbO3. An array of liquid micro-lenses was generated by electrowetting effect in pyroelectricperiodically poled crystals. Compared to conventional electrowetting devices, the pyroelectric effect allowed tohave an electrode-less and circuit-less configuration. An interferometric technique was used to characterizethe curvature of the micro-lenses and the corresponding results are presented and discussed. The preliminaryresults concerning the imaging capability of the micro-lens array are also reported.

2nd article- http://www.opticsinfobase.org/abstract.cfm?uri=OPN-19-12-34



- http://www.spectrum.ieee.org/dec04/4172Through a Lens SharplyFluidFocus lens, uses electrostatic forces to alter the shape of a drop of slightly salty water inside a glasscylinder 3 millimeters in diameter and 2.2 mm long.By Benno Hendriks and Stein © Copyright 2009 IEEE

Illustration: Bryan Christie



BBBBBBBBiiiiiiiioooooooo--------SSSSSSSSeeeeeeeennnnnnnnssssssssoooooooorrrrrrrrssssssss- http://www.upenn.edu/pennnews/news/penn-researchers-provide-first-step-towards-electronic-dna-sequencing-translocation-through-graResearchers at the University of Pennsylvania have developed a new, carbon-based nanoscaleplatform to electrically detect single DNA molecule s.Jordan Reese July 2010

Using electric fields, the tiny DNA strands are pushed through nanoscale-sized, atomically thin pores in agraphene nanopore platform that ultimately may be important for fast electronic sequencing of the fourchemical bases of DNA based on their unique electrical signature.

The pores, burned into graphene membranes using electron beam technology, provide Penn physicists withelectronic measurements of the translocation of DNA.

Graphene nanopore devices developed by the Penn team work in a simple manner. The pore divides twochambers of electrolyte solution and researchers apply voltage, which drives ions through the pores. Iontransport is measured as a current flowing from the voltage source. DNA molecules, inserted into theelectrolyte, can be driven single file through such nanopores.

As the molecules translocate, they block the flow of ions and are detected as a drop in the measured current.Because the four DNA bases block the current differently, graphene nanopores with sub-nanometer thicknessmay provide a way to distinguish among bases, realizing a low-cost, high-throughput DNA sequencingtechnique.

In addition, to increase the robustness of graphene nanopore devices, Penn researchers also deposited anultrathin layer, only a few atomic layers thick, of titanium oxide on the membrane which further generated acleaner, more easily wettable surface that allows the DNA to go through it more easily. Although graphene-only nanopores can be used for translocating DNA, coating the graphene membranes with a layer of oxideconsistently reduced the nanopore noise level and at the same time improved the robustness of the device.

Because of the ultrathin nature of the graphene pores, researchers were able to detect an increase in themagnitude of the translocation signals relative to previous solid state nanopores made in silicon nitride, forsimilar applied voltages.

Research was conducted by Merchant, Healy, Wanunu, Ray, Neil Peterman, John Bartel, Michael D.Fischbein, Kimberly Venta, Luo, Johnson and Drndiæ of Penn's Department of Physics and Astronomy.

The research was supported by a National Institutes of Health grant and also grants from the U.S. Departmentof Defense, Army Research Office, Penn Genome Frontiers Institute, Nano-Bio Interface Center at Penn,Nanotechnology Institute of the Commonwealth of Pennsylvania and Pennsylvania Department of Health. TheDepartment of Health specifically disclaims responsibility for any analyses, interpretations or conclusions.



- http://www.physics.upenn.edu/~drndic/group/graphene-nanopore.html

Graphene nanopore devices. (a) Device schematic. Few-layer graphene (1-5 nm thick) is suspended over a 1ìm hole in a 40 nm thick silicon nitride (SiN) membrane. The SiN membrane is suspended over an approx. 50x 50 ìm2 aperture in a silicon chip coated with a 5 ìm SiO2 layer. The device is inserted into a PDMSmeasurement cell with microfluidic channels that form reservoirs in contact with either side of the chip. A biasvoltage, VB, is applied between the reservoirs to drive DNA through the nanopore. (b) TEM image of ananopore in a graphene membrane. Scale bar is 10 nm. (c) Ionic current-voltage measurement for this 10-nmgraphene nanopore device in 1M KCl, pH 9.

- http://www.nanowerk.com/spotlight/spotid=4056.phpBiosensing mechanism with carbon nanotubes explaine dTransistors are the key elements of many types of electronic (bio)sensors. Since the discovery that individualcarbon nanotubes (CNTs) can be used as nanoscale transistors, researchers have recognized theiroutstanding potential for electronic detection of biomolecules in solution, possibly down to single-moleculesensitivity. To detect biologically derived electronic signals, CNTs are often - but not always - functionalizedwith (conductive) linkers such as proteins and peptides to interface with soluble biologically relevant targets(linkers need not be conductive as long as they are capable of localizing the target molecule in close vicinity ofthe tube). Although CNT transistors have been used as biosensors for some years now, the ultimate single-molecule sensitivity, which is theoretically possible, has not been reached yet. One of the reasons thathampers the full exploitation of these promising nanosensors is that the sensing mechanism is still not wellunderstood. Although a variety of different sensing mechanisms has been suggested previously, variousstudies contradict one another, and the sensing mechanism remained under debate. Researchers in TheNetherlands - through modeling and specific control experiments - now have succeeded in identifying thesensing mechanism. They found that the majority of their experiments can be explained by a combination ofelectrostatic gating and Schottky barrier effects. Because these two mechanisms have different gate-potentialdependence, the choice of gate potential can strongly affect the outcome of real-time biosensing experiments.



- http://en.wikipedia.org/wiki/Schottky_barrierSchottky barrierA Schottky barrier, named after Walter H. Schottky, is a potential barrier formed at a metal—semiconductorjunction which has rectifying characteristics, suitable for use as a diode. The largest differences between aSchottky barrier and a p—n junction are its typically lower junction voltage, and decreased (almostnonexistent) depletion width in the metal.Not all metal—semiconductor junctions form Schottky barriers. A metal—semiconductor junction that does notrectify current is called an ohmic contact. Rectifying properties depend on the metal's work function, the bandgap of the intrinsic semiconductor, the type and concentration of dopants in the semiconductor, and otherfactors. Design of semiconductor devices requires familiarity with the Schottky effect to ensure Schottkybarriers are not created accidentally where an ohmic connection is desired.

- http://www.nanowerk.com/spotlight/spotid=2749.phpReliably detecting foodborne pathogens with nanotec hnology and encoding/decoding techniques."With embedded forward error-correction function in biosensors, with the result that our multi-array biosensornot only can detect multiple pathogens simultaneously, but also could correct for errors induced by artifacts inbiosensors and environment, thus increasing the accuracy and reliability of biosensors" ShantanuChakrabartty explains to Nanowerk. "In our recent work we have demonstrated that we can successfullyconstruct basic logic circuits (AND and OR) using computational primitives inherent in antigen-antibodyinteraction. The operation of these logic gates relies on selective conjugation of polyaniline (PANI) nanowireswith an antigen-antibody complex. We have also developed corresponding electrical models for these logicgates which can be now be used in computer-aided design of biosensors. \d;0";3.0";Visualization of the finalmultii-array biosensor prototype (Reprinted with permission from IOP Publishing) Chakrabartty, an AssistantProfessor and Director of the Adaptive Integrated Microsystems Laboratory at Michigan State University, ledthe work that has been reported in a recent paper in Nanotechnology ("Fundamental building blocks formolecular biowire based forward error-correcting biosensors") where he, together with first author Yang Liuand Associate Professor Evangelyn C. Alocilja describes the fabrication, characterization and modeling offundamental logic gates that can be used for designing biosensors with FEC.By Michael Berger, Copyright 2008 Nanowerk LLC

- http://www.nano.org.uk/news/may2008/latest1395.htmNASA Nano-Biosensor Helps Detect BiohazardsNASA has developed a revolutionary nanotechnology-based biosensor that can detect trace amounts ofspecific bacteria, viruses and parasites. This biosensor will be used to help prevent the spread of potentiallydeadly biohazards in water, food and other contaminated sources.

This NASA developed nanotechnology-based biosensor, designed to detecttrace amounts of specific bacteria, viruses and parasites, has now been testedand licensed for commercialization by biosensor technology company EarlyWarning Inc., from Troy , N.Y. 23rd May 2008 NASA - ©2008 Institute ofNanotechnology

- http://www.patentstorm.us/patents/7303875.htmlNano-chem-FET based biosensors



VVVVVVVViiiiiiiirrrrrrrrttttttttuuuuuuuuaaaaaaaallllllll MMMMMMMMuuuuuuuusssssssscccccccclllllllleeeeeeeessssssssalmost invisible muscles to animate new elecronic devices

- http://www.unwiredview.com/2008/01/25/foldable-rollable-phone-from-motorola/By Staska on 25 Jan 08

Foldable/ rollable phone from MotorolaThe design of the mobile phones is always a fight between two opposite objectives - portability and usability.The more small and portable the device becomes, the less usable the user interface can be.You can make the phone screen only that small, until the information displayed on it becomes unreadable.The same goes for the input devices. Make the keyboard small enough, and the user will have a really hardtime pressing the correct keys.Well. Motorola has an interesting idea what to do about that. In a patent application “User Interface System” itdescribes a concept of mobile phone with rollable display and/or keyboard.

Of course, the idea of flexible/rollable screens and keyboards is nothing new. The are quite a few of thesegadgets on the market or at least in late prototype stage. The problem with these devices is thatflexible/rollable is by definition not rigid. And using the phone with a keypad or display flapping in the wind, isnot such a good idea.But Motorola has found the way around this little problem, by using a reservoir with electrorheological fluidbeneath the foldable display or keypad. This fluid becomes a solid material when electric current is applied toit, and then reverts again to fluid state when the electric current disappears.The phone with either rollable display or keypad will have all it’s working electronics in a solid part, with anenclosure for the flexible part located here as well. In inactive state the flexible part rests in an enclosure.Whenever the call comes in, or you want to make one, press a button. Electric current is applied, the displayrolls out and springs into a solid state, and you use the device as any other mobile phone. Press the buttonagain, and display folds back-in.To take it even further, both display and keypad can be made flexible. You just put all the necessaryelectronics into a solid container, with the enclosures for flexible display and keypad. This way you could makematchbox sized mobile mobile phone, which will be as easy to use as any other clamshell.Looks like an interesting, if pretty far fetched idea, which probably won’t come to life anytime soon.



- http://www.newscientist.com/blog/invention/2006/06/origami-gadgets.htmlJune 06, 2006

Sony patents fold-up origami gadgetryAt Sony Tokyo labs are working on a clever way to get bulky electronic devices into small pockets. Their planis to create handheld computers, phones and portable games consoles that fold up for carrying and thenbecome rigid for use.

The body and screen of folding gadgets would be made from a flexible polymer containing conductive rubberbracing struts filled with a gel of aluminosilicate particles suspended in silicone oil.

When a current is passed through the struts, the particles clump together and harden the gel, making thegadget solid enough to use. Sony has found that it would take very little power to make such a folding deviceharden, so the drain on its battery should be low. The company's patent adds that the transition from soft tohard takes just milliseconds. It suggests that the same technique could even be used in a video gamecontroller to make it jolt or change shape in response to on-screen action.

Electrorheological (ER) fluids

- http://en.wikipedia.org/wiki/Electrorheological_fluid

Electrorheological (ER) fluids are suspensions of extremely fine non-conducting particles (up to 50micrometres diameter) in an electrically insulating fluid. The apparent viscosity of these fluids changesreversibly by an order of up to 100,000 in response to an electric field. For example, a typical ER fluid can gofrom the consistency of a liquid to that of a gel, and back, with response times on the order of milliseconds.The effect is sometimes called the Winslow effect, after its discoverer the American inventor Willis Winslow,who obtained a US patent on the effect in 1947 and wrote an article published in 1949

ApplicationsThe normal application of ER fluids is in fast acting hydraulic valves and clutches, with the separationbetween plates being in the order of 1 mm and the applied potential being in the order of 1 kV. In simpleterms, when the electric field is applied, an ER hydraulic valve is shut or the plates of an ER clutch are lockedtogether, when the electric field is removed the ER hydraulic valve is open or the clutch plates are disengaged.Other common applications are in ER brakes (think of a brake as a clutch with one side fixed) and shockabsorbers (which can be thought of as closed hydraulic systems consisting of a valve with no external pump).There are many novel uses for these fluids, including use in the US army's planned future force warriorproject. They plan to create bulletproof vests using an ER fluid because the ability to soak the fluid into clothcreates the potential for a very light vest that can change from a normal cloth into a hard covering almostinstantaneously. Other potential uses are in accurate abrasive polishing and as haptic controllers and tactiledisplays.



ER fluid has also been proposed to have potential applications in flexible electronics, with the fluidincorporated in elements such as rollable screens and keypads, in which the viscosity-changing qualities ofthe fluid allowing the rollable elements to become rigid for use, and flexible to roll and retract for storing whennot in use. Motorola filed a patent application for mobile device applications in 2006

The change in apparent viscosity is dependent on the applied electric field, i.e. the potential divided by thedistance between the plates. The change is not a simple change in viscosity, hence these fluids are nowknown as ER fluids, rather than by the older term Electro Viscous fluids. The effect is better described as anelectric field dependent shear yield stress. When activated an ER fluid behaves as a Bingham plastic (a typeof viscoelastic material), with a yield point which is determined by the electric field strength. After the yieldpoint is reached, the fluid shears as a fluid, i.e. the incremental shear stress is proportional to the rate of shear(in a Newtonian fluid there is no yield point and stress is directly proportional to shear). Hence the resistanceto motion of the fluid can be controlled by adjusting the applied electric field.

- http://web.phys.ust.hk/index.php?option=com_content&task=view&id=88&Itemid=79Electrorheological (ER) fluids denote a class of materials consisting of nanometer to micrometer sized solidparticles dispersed in a liquid, whose rheological (i.e., deformation and flow) properties are controllable by anexternal electric field. In particular, they can reversibly transform from a liquid to a solid within one hundredthof a second. While in the solid state (with the electric field applied), the strength of that solid, measured by theyield stress, is the critical parameter that governs the application potential of the ER fluid.

Composition of ER fluids

Structural transition of ER fluid under electric field



At HKUST, eight years of research work on ER fluids led to a breakthrough last year in the synthesis of anovel type of ER fluid that consists of 70-nanometer-sized coated nanoparticles dispersed in insulating oil.These new fluids, which harness the extremely high electric field that exists in Debye double layers, exhibityield stress one order of magnitude higher than the best commercially available ER particles. The significanceof this breakthrough is that the yield stress has broken the theoretical upper bound predicted on the basis oflinear response of the component materials, thereby signifying a new mechanism. This new class of ER fluidsis thus denoted as having a 'Giant Electrorheological' (GER) Effect, surpassing the threshold that the GeneralMotors study has set for automotive applications. It is envisioned that HKUST's GER fluids can be used notonly in those classical applications, but also in micro-electromechanical systems (MEMS) or nano-EMS asreplacements for microgears, reducing cost and increasing reliability and simplicity of controlled mechanicalmotion in the micro- to nanoscale. After its publication in Nature Materials, this new breakthrough has beenreported around the world in the Washington Post, Science News, New Scientist, NanoToday, Nanotech,Technology Review News (TRN), and thirty other media outlets.

Magnetorheological fluid

- http://en.wikipedia.org/wiki/Magnetorheological_fluidA magnetorheological fluid (MR fluid) is a type of smart fluid. It is a suspension of micrometer-sizedmagnetic particles in a carrier fluid, usually a type of oil. When subjected to a magnetic field, the fluid greatlyincreases its apparent viscosity, to the point of becoming a viscoelastic solid. Importantly, the yield stress ofthe fluid when in its active ("on") state can be controlled very accurately by varying the magnetic field intensity.

How it worksThe magnetic particles, which are typically micrometer or nanometer scale spheres or ellipsoids, aresuspended within the carrier oil are distributed randomly and in suspension under normal circumstances, asbelow.

When a magnetic field is applied, however, the microscopic particles (usually in the 0.1-10 µm range) alignthemselves along the lines of magnetic flux, see below. When the fluid is contained between two poles(typically of separation 0.5-2 mm in the majority of devices), the resulting chains of particles restrict themovement of the fluid, perpendicular to the direction of flux, effectively increasing its viscosity. Importantly,mechanical properties of the fluid in its _on" state are anisotropic. Thus in designing a magnetorheological (orMR) device, it is crucial to ensure that the lines of flux are perpendicular to the direction of the motion to berestricted.



- http://science.howstuffworks.com/smart-structure1.htmWhat is MR FluidLooking at it in a beaker, MR fluid doesn't seem like such a revolutionary substance. It's a gray, oily liquidthat's about three times denser than water. It's not too exciting at first glance, but MR fluid is actually quiteamazing to watch in action.A simple demonstration by David Carlson, a physicist at the North Carolina lab, shows the liquid's ability totransform to solid in milliseconds. He pours the liquid into the cup and stirs it around with a pencil to show it'sliquid. He then places a magnet to the bottom of the cup, and the liquid instantly turns to a near-solid. Tofurther demonstrate that it's turned to a solid, he holds the cup upside down, and none of the MR fluid dropsout.

by David Carlson, a physicist at the North Carolina lab

Above, MR fluid prior to magnetization. Below, the fluid turned into a solid after it was magnetized. Notice theshiny surface of the liquid in the top photo and the dull surface in the bottom photo.

by David Carlson, a physicist at the North Carolina lab

Typical MR fluid consists of these three parts:· Carbonyl Iron Particles -- 20 to 40 percent of the fluid is made of these soft iron particles that are just

3 to 5 micrometers in diameter. A package of dry carbonyl iron particles looks like black flour becausethe particles are so fine.

· A Carrier Liquid -- The iron particles are suspended in a liquid, usually hydrocarbon oil. Water is oftenused in demonstrating the fluid.

· Proprietary Additives -- The third component of MR fluid is a secret, but Lord says these additivesare put in to inhibit gravitational settling of the iron particles, promote particle suspension, enhancelubricity, modify viscosity and inhibit wear.

So, what is it that gives MR fluid its unique ability to transform from liquid to solid and from solid to liquidquicker than you can blink an eye? The carbonyl iron particles. When a magnet is applied to the liquid, thesetiny particles line up to make the fluid stiffen into a solid. This is caused by the dc magnetic field, making theparticles lock into a uniform polarity. How hard the substance becomes depends on the strength of themagnetic field. Take away the magnet, and the particles unlock immediately.© 1998-2008 HowStuffWorks, Inc.



GGGGGGGGeeeeeeeecccccccckkkkkkkkoooooooo (new adhesive)

- http://www.nanowerk.com/spotlight/spotid=3180.phpFor super-strong nanotechnology dry adhesives look no further than the geckoAnimals that cling to walls and walk on ceilings owe this ability to micro- and nanoscale attachment elements.The highest adhesion forces are encountered in geckos. For centuries, the ability of geckos to climb anyvertical surface or hang from ceilings with one toe has always generated considerable interest. A gecko is theheaviest animal that can 'stand' on a ceiling, with its feet over its head. This is why scientists are intenselyresearching the adhesive system of the tiny hairs on its feet. On the sole of a gecko's toes there are some onebillion tiny adhesive hairs called setae (3-130 micrometers in length), splitting into even smaller spatulae(about 200 nanometers in both width and length) at the end. It was found that these elastic hairs induce strongvan der Waals forces. This finding has prompted many researchers to use synthetic microarrays to mimicgecko feet. Recentwork, mainly from A. Dhinojwala, P.M. Ajayan, M. Meyyappan, and L. Dai groups, as wellas the Max Planck Institute for Metals Research in Germany has indicated that aligned carbon nanotubes(CNTs) sticking out of substrate surfaces showed strong nanometer-scale adhesion forces.Although carbon nanotubes are thousands of times thinner than a human hair, they can be stronger than steel,lighter than plastic, more conductive than copper for electricity and diamond for heat.Applications of such bio-inspired development of artificial dry adhesive systems with aligned carbon nanotubescould range from low-tech fridge magnets to holding together electronics or evenairplane parts.

a) photo showing a stainless steel adapter of 473 g hanging on a SiO2/Si-wafer supported vertically alignedSWCNT dry adhesive film (4mm x 4mm)b) pre-pressed (2 kg) from the Si side onto a horizontally-placed glass surfacec) a comparison of the maximum achievable adhesion forces for:

(i) microfabricated polymer hairs(ii) vertically aligned MWCNT(iii) the as-grown aligned vertically aligned SWCNT.The dashed line represents the adhesion force for gecko feet

d) a side-top view SEM image of the vertically aligned SWCNT film under a high magnification.Copyright Wiley-VCH Verlag GmbH & Co. KGaA. Reproduced with permission.- http://dx.doi.org/doi:10.1002/adma.200700023By Michael Berger, Copyright 2008 Nanowerk LLC



- http://nanolab.me.cmu.edu/projects/geckohair/Nature can be an inspiration for innovations in science. One such inspiration is comes from the gecko lizardwhich can climb on walls and ceilings of almost any surface texture. Rather than using it's claws or stickysubstances, the gecko is able to stick to smooth surfaces through dry adhesion which requires no energy tohold it to the surface and leaves no residue. The dry adhesion force comes from surface contact forces suchas van der Waals forces which act between all materials in contact.Copyright © 2008 Mike Murphy & Yigit Menguc.

- http://www.lclark.edu/~autumn/dept/geckostory.html How Geckos Stick to Walls

Nature v. 405: 681-685 .

- http://polypedal.berkeley.edu/twiki/pub/PolyPEDAL/PolypedalPublications/57_adhesive_force.pdfNature — from http://www.lclark.edu/~autumn/private/u38j47a0t/



- http://www.nsf.gov/discoveries/disc_summ.jsp?org=OIG&cntn_id=116297&preview=falseResearchers move one step closer to nature with the development of polymers and directionaladhesion that follow the workings of a gecko's foot .February 9, 2010

Video on Stickybot

- http://www.nsf.gov/discoveries/disc_videos.jsp?org=OIG&cntn_id=116297&media_id=66263Stickybot employs the same principles as a gecko th rough the use of dry adhesion to climb walls.Credit: Mark R. Cutkosky, Stanford University and Sangbae Kim, MIT

- http://www.nsf.gov/news/news_summ.jsp?org=NSF&cntn_id=112445&preview=falseAs Sticky as a Gecko ... but Ten Times Stronger!By Zina Deretsky, NSF October 14, 2008

The secret behind the gecko's ability to stick so well is a forest of pillars at the micro-/nano-scale on theunderside of the gecko's foot. Because there are so many pillars so close together, they are held tightly to thesurface the gecko is walking on by a molecular force called the Van der Waals force. This relatively weak forcecauses uncharged molecules to attract each other.In an unprecedented feat, Liming Dai, at the University of Dayton, and colleagues report in the October 10thissue of Science successful construction of a gecko-inspired adhesive that is ten times stronger than a gecko,at about 100 newtons per square centimeter.The researchers constructed their adhesive out of two slightly different layers of multi-walled carbonnanotubes. The lower layer is composed of vertically-aligned carbon nanotubes, while the upper segment--which comes into contact with the surface it is sticking to--is curly, like a mess of spaghetti.As shown in the figure, the adhesive sticks best when it is pulled down parallel to the surface it is sticking to--this is called shear adhesion. This action arranges the tips of the curly nanotubes so they have maximumcontact with the substrate, thereby maximizing the Van der Waals force. Pulling the adhesive off in a motionperpendicular to the substrate is much easier--at this angle the sticking force is ten times weaker.In this way, the adhesive has strong shear adhesion for firm attachment and relatively weak adhesion fordetachment perpendicularly to the substrate. Just like a gecko, the adhesive can stick to a wall when needed,and then lift off easily to take the next step. This breakthrough, supported by the National Science Foundation,will have many technological applications.



- http://www.nsf.gov/news/news_images.jsp?cntn_id=112445&org=NSFResearchers have created a gecko-inspired adhesive with ten times the stickiness of a gecko's foot,by combining vertically aligned nanotubes with curl y spaghetti-like nanotubes.Credit: Zina Deretsky, National Science Foundation after Liangti Qu et al., Science 10/10/2008



Eecs.berkeley research

- http://robotics.eecs.berkeley.edu/%7Eronf/Gecko/index.htmlBiologically Inspired Synthetic Gecko AdhesivesLangmuir, Oct 2009

Combined Lamellar Nanofibrillar ArrayLamellar structures act as base support planes for high-aspect ratio HDPE fiber arrays. Nanofiber arrays onlamella can adhere to a smooth grating with 5 times greater shear strength than flat nanofiber array

Gecko Tire for Model Car (Nov. 2008) Microfiber array wrapped on model car tire demonstates high friction.(Note: so far, tire only works on smooth surfaces.)- High friction from a stiff polymer using micro-fiber arrays, Phys. Rev. Letters, 2006



Directional Adhesion of Angled Microfibers (Nov. 2008)Angled polypropylene microfibers show strong directional adhesion effects, with shear strength in direction offibers 45 times larger than sliding against fiber directions. A 1 sq. cm. patch supported a load of 450 grams inshear. - Directional adhesion of gecko inspired angled microfiber arrays, Applied Physics Letters, 2008.

Self Cleaning Gecko Adhesive (Sep. 2008)First synthetic gecko adhesive which cleans itself during use, as the natural gecko does. After contaminationby microspheres, the microfiber array loses all adhesion strength. After repeated contacts with clean glass, themicrospheres are shed, and the fibers recover 30% of their original adhesion. The fibers have a non-adhesivedefault state, which encourages particle removal during contact.- Contact Self-Cleaning of Synthetic Gecko Adhesive, Langmuir 2008



- http://robotics.eecs.berkeley.edu/~ronf/Gecko/gecko-facts.htmlGecko Adhesion Frequently Asked Questions

- http://robotics.eecs.berkeley.edu/~ronf/Gecko/gecko-compare.htmlComparison of Fibrillar Adhesives (to glass)

- http://robotics.eecs.berkeley.edu/~ronf/Gecko/prl-friction.htmlHigh Friction from a Stiff Polymer using Micro-Fibe r Arrays



MMMMMMMMeeeeeeeemmmmmmmmssssssss- http://www.memsnet.org/mems/what_is.htmlMicro-Electro-Mechanical Systems, or MEMS, is a technology that in its most general form can be defined asminiaturized mechanical and electro-mechanical elements (i.e., devices and structures) that are made usingthe techniques of microfabrication. The critical physical dimensions of MEMS devices can vary from well belowone micron on the lower end of the dimensional spectrum, all the way to several millimeters. Likewise, thetypes of MEMS devices can vary from relatively simple structures having no moving elements, to extremelycomplex electromechanical systems with multiple moving elements under the control of integratedmicroelectronics. The one main criterion of MEMS is that there are at least some elements having some sortof mechanical functionality whether or not these elements can move. The term used to define MEMS varies indifferent parts of the world. In the United States they are predominantly called MEMS, while in some otherparts of the world they are called “Microsystems Technology” or “micromachined devices”.

While the functional elements of MEMS are miniaturized structures, sensors, actuators, and microelectronics,the most notable (and perhaps most interesting) elements are the microsensors and microactuators.Microsensors and microactuators are appropriately categorized as “transducers”, which are defined as devicesthat convert energy from one form to another. In the case of microsensors, the device typically converts ameasured mechanical signal into an electrical signal.

A surface micromachined electro-statically-actuated micromotor fabricated by the MNX. This device is anexample of a MEMS-based microactuator.



A surface micromachined resonator fabricated by the MNX. This device can be used as both a microsensor aswell as a microactuator.

- http://www.memx.com/This site is dedicated to providing educational material on this fascinating new technology.



EEEEEEEEccccccccoooooooollllllllooooooooggggggggyyyyyyyy

- http://community.safenano.org/blogs/andrew_maynard/archive/2008/05/21/carbon-nanotubes-the-new-asbestos-not-if-we-act-fast.aspx

Carbon nanotubes: the new asbestos? Not if we act f ast.Carbon nanotubes have great potential as a unique material that can be used in many unique and beneficialways—from reducing our environmental impact to curing diseases. But mis-steps now could easily underminetrust in this nascent industry, and prevent the material's potential from being realized.© 2009 Andrew Maynard - http://community.safenano.org/

- http://en.wikipedia.org/wiki/Wi-FiWi-Fi PollutionStandardization is a process driven by market forces. Interoperability issues between non-Wi-Fi brands orproprietary deviations from the standard can still disrupt connections or lower throughput speeds on all user'sdevices that are within range, to include the non-Wi-Fi or proprietary product. Moreover, the usage of the ISMband in the 2.45 GHz range is also common to Bluetooth, WPAN-CSS, ZigBee and any new system will takeits share.Wi-Fi pollution, or an excessive number of access points in the area, especially on the same or neighboringchannel, can prevent access and interfere with the use of other access points by others, caused byoverlapping channels in the 802.11g/b spectrum, as well as with decreased signal-to-noise ratio (SNR)between access points. This can be a problem in high-density areas, such as large apartment complexes oroffice buildings with many Wi-Fi access points. Additionally, other devices use the 2.4 GHz band: microwaveovens, security cameras, Bluetooth devices and (in some countries) Amateur radio, video senders, cordlessphones and baby monitors, all of which can cause significant additional interference. General guidance tothose who suffer these forms of interference or network crowding is to migrate to a Wi-Fi 5 GHz product,(802.11a, or the newer 802.11n if it has 5 GHz support) as the 5 GHz band is relatively unused and there aremany more channels available. This also requires users to set up the 5 GHz band to be the preferred networkin the client and to configure each network band to a different name (SSID). It is also an issue whenmunicipalities, or other large entities such as universities, seek to provide large area coverage. This opennessis also important to the success and widespread use of 2.4 GHz Wi-Fi.

- http://www.organicui.org/?page_id=70Sustainability Implications of Organic UI Technolog ies: An Inky ProblemThe moment you have decided that sustainability is an issue with respect to interaction design and the designof interactive devices is the moment you realize how complex the business of deciding what to actually doabout it is. It is not just a simple matter of calculating the energy and environmental costs of manufacturing,use, salvage, and disposal of one technology over another.For example, it was long ago claimed that computing technologies would create a paperless office—a claimwhich is not yet in sight. Many people around me print things rather than read on screen. They like to holdpaper in their hands and mark things up. Ever since I acquired a portrait mode capable LCD monitor, I havemostly stopped printing things personally. I can now read and write a whole page of text on my 1200×1600pixel screen at once at 140% of the size it would be if I printed it. As a result, I almost never print anythinganymore. The environmental costs of the energy used to power my display must be weighed against the costsof printing the page when I am just reading, assuming that I would actually power-off my display when I amreading what has been printed. Furthermore, the environmental cost of production of the portrait mode displayand the environmental costs of the premature obsolescence and disposal of the display I had before this oneare also part of the equation.by Eli Blevis © 2008 ACM and/or the authors



LLLLLLLLiiiiiiiinnnnnnnnkkkkkkkkssssssss ttttttttoooooooo ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss

Nanotechnology http://en.wikipedia.org/wiki/Nanotechnology

Printed electronics http://printedelectronics.idtechex.com/printedelectronicsworld/en/http://www.sciencenet.cn/blog/Print.aspx?id=50678

Transparent electronics http://techon.nikkeibp.co.jp/article/HONSHI/20071024/141211/http://www.nanowerk.com/spotlight/spotid=1858.phphttp://www.nanowerk.com/spotlight/spotid=2062.phphttp://www.nanowerk.com/spotlight/spotid=8787.php

http://npl.postech.ac.kr/?mid=Trans_Electronic

Gecko adhesive: http://en.wikipedia.org/wiki/Van_der_Waals_force

Electrorheological fluid: http://en.wikipedia.org/wiki/Electrorheological_fluid

Transparent solar cells http://www.hp.com/hpinfo/newsroom/press/2008/080604a.htmlhttp://www.octillioncorp.com/OCTL_20080818.htmlhttp://www.octillioncorp.com/nano-power.php

Solar Cell Sheet ThatCollects Energy at Night http://www.nextenergynews.com/news1/next-energy-news1.7d.html

Transparent acoustic transducer http://www.freshpatents.com/Thin-film-transparent-acoustic

Transparent sound http://thefutureofthings.com/news/5967/flexible-transparent-nanotube-based-loudspeakers.html

Witricity http://en.wikipedia.org/wiki/WiTricity

Transparent Ink http://www.inktec.com/english/product_info/electronic_tec.asp

Display http://nanoarchitecture.net/article/nanotubes-enable-flexiblehttp://dvice.com/archives/2008/04/firstpaper_erea.phphttp://www.sciencedaily.com/releases/2008/03/080331172507.htm

Lens http://www.ibridgenetwork.org/browse/by?categories=23

Oled http://www.oled-display.net/how-works-a-transparent-oled

Samsung Mobile Display's http://www.engadget.com/2010/01/07/samsungs-14-inch-transparent-oled-laptop-video/

Memory Device http://www.innovations-report.com/html/reports/physics_astronomy/clear_future_electronics_transparent_memory_device_124145.html

Flexible see-through battery power http://www.gizmag.com/go/7018/picture/32741/



aaaaaaaapppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ooooooooffffffff ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt oooooooorrrrrrrr fffffffflllllllleeeeeeeexxxxxxxxiiiiiiiibbbbbbbblllllllleeeeeeee eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss

LG GD900 transparent keypad mobile

- http://www.gadgetlite.com/2009/03/31/pictures-lg-gd900-transparent/More pictures of LG GD900 transparent keypad mobile ahead of CTIA 2009March 2009

LG is increasing the buzz on its 13.4mm thick GD900 handset ahead of the upcoming CTIA Wireless Show2009. The GD900 which you will recall was first shown at the MWC 2009, Barcelona. Its been said that thistime, the 7.2 HSPDA slider with world's first transparent glass (not plastic folks!) keypad will be functional,running LG's new S-Class UI on the three inch display. GD900 features a vibrational haptic feedback and thetransparent keypad seems to double as a touch-sensitive mouse pad. The GD900 will be available in Europeand Asia in May.

LG-GD900 transparent mobile



Transparent TFT-LCD

- http://techpatio.com/2009/mobiles/sony-ericsson/sony-ericsson-xperia-pureness-600-euro-november-uk-price

Transparent OLED

- http://www.engadget.com/2010/01/07/samsungs-14-inch-transparent-oled-laptop-video/



- http://www.intomobile.com/2009/04/02/lg-gd900-style-up-close-and-personal-with-the-transparent-phone/LG GD900 Style — Up close and personal with the 'tr ansparent' phoneby Will Thursday, April 2nd, 2009

Having a capacitance-based touchscreen and touch-sensitive keypad allows the LG Style to support multi-touch features like pinch-to-zoom. But, the touch-interaction isn't just limited to the display — multi-touchgestures are supported on both the touchscreen display and the keypad. The LG GD900 Style allows the userto navigate through the UI using swiping motions on the transparent slide-out keypad. The keypad also goesbeyond simple multi-touch with its support for finger-gestures. Simply trace a _W" (or whatever movement youchoose to program) on the keypad and the LG Style will launch the web browser. Trace an _M" and you getthe music player. It makes sense.

TDK the transparent OLED

- http://laptopreviewshop.com/tdk-joins-the-transparent-oled-fight.htmlTDK joins the transparent OLED fightMircea / October 4, 2010



TDK makes its entrance on the transparent OLED market with 2-inch passive matrix screen with a humbleQVGA (320 x 240) resolution. Sure, no eye-popping specs here, but a claimed 50 percent transmittance whichmeans that half of what's behind the screen can be seen through it, knocks out both Samsung and LG.

TDK also presented another 3.5 inch flexible OLED screen which is as thin as 0.3 mm. It's made using a resinsubstrate and squeezes only 256 x 54 pixels at the moment, but TDK plans to take both technologies step bystep into the realm of awesomeness. Be sure to keep your eye on these if you find yourself at CEATEC 2010,and who knows, maybe we'll even hear about a flexible transparent OLED screen soon if these technologieswill merge together.

- http://www.crunchgear.com/2010/10/05/ceatec-2010-eyes-on-with-tdks-bendable-and-transparent-oleds-video/TDK's two passive matrix mini OLED panelsby Serkan Toto on October 2010

t this year's CEATEC: TDK's two passive matrix mini OLED panels, one of which is transparent and the otherbendable (like the one Sony showed earlier this year). What's cool is that both prototypes are showcased asblack-and-white and color models.

You can see both displays in action in the videos I took at the exhibition below.

The flexible type is just 0.3mm thin and sized at 3.5 inches. Apparently, TDK plans to start mass-producingthis panel as early next year. Its picture quality wasn't really as high as you'd want it to be, but there is still timefor improvements.

The panel with the bigger wow-factor, the see-through type, was really cool. It has a transmittance of about50% and features QVGA resolution — which is OK, at a screen size of about 2 inches. I want one, but I amnot sure why exactly screens (of any size) would have to be transparent.

Video on TDK's displays



- http://www.engadget.com/2010/10/05/tdks-see-through-and-curved-oled-display-eyes-on/TDK's see-through and curved OLED display eyes-onBy Chris Ziegler posted Oct 5th 2010

Engadget.com - By Chris Ziegler

Remember the Sony Ericsson Xperia Pureness? At a list price of $1,000, it'd be hard to forget -- but with amonochrome see-through display, the whole transparency thing was little more than a novelty on a phone thatserved little practical purpose. TDK might have the solution with its new transparent QVGA OLEDs, availablenow to manufacturers in monochrome and in a lovely color variant by the end of the year. At two inches, theyoffer 200ppi pixel density and are more secure than you might think: the light only shines in one direction, soyou actually can't see any data from the back even though you can still see through the display. At a glance,the display's didn't seem as vibrant as the best AMOLEDs on the market, but then again, these are passivematrix -- and you can really tell in our videos after the break where the refresh scans stand out.

Video

- http://www.gizmag.com/tdk-unveils-flexible-oled-display-at-ceatec/16569/By Rick Martin October 5, 2010TDK unveils flexible OLED display at CEATEC

- http://www.kenteklaserstore.com/Category.aspx?CategoryID=315Toward roll-to-roll printed power sources and contr ol electronicsDr. Jukka Hast, Dr. Kimmo Solehmainen and Marja Vilkman, VTT Technical Research Centre of Finland

To pave the way for commercialization of printed electronics and optics applications, two European Union-funded projects are developing roll-to-roll-based fabrication technologies.

In the first project, called FACESS (Flexible Autonomous Cost efficient Energy Source and Storage), roll-to-rollprinted organic photovoltaics and energy storage devices are being developed. In the second one, Polaric(Printed, Organic and Large-Area Realisation of Integrated Circuits), the aim is to bring the performance ofprinted electronics to a new level by combining roll-to-roll compatible high-resolution steps in the transistorfabrication process, and to demonstrate the developed high-performance organic electronics in variousconsumer applications.



Traditionally, the primary function of printing has been the delivery of data and information for visual inspectionand further interpretation by humans or machines. Nowadays, printing and other large-area R2R (roll-to-roll)-compatible processes enable cost-efficient mass manufacturing of electronics and other functionalities onlarge-area and flexible substrates such as plastic, paper and fabrics.

New printable-functional materials, print-production processes and reading mechanisms are expanding therole and function of printing toward novel application fields. This is the opportunity gap between traditionalpaper, packaging and printing industry products, and ICT/ electronics industry products, and it can realizecompletely new types of applications and businesses; e.g., disposable sensors, simple “electronic”components and circuits, large-area functional paperlike intelligent products, smart packages, tag-and-codetechnology-based ICT and hybrid media services.

In the FACESS project, energy harvesting and storage are being tackled. The goal of the project partners –VTT Technical Research Centre and Suntrica Oy, both of Finland; Interuniversity Micro-Electronics Centre ofBelgium; Commissariat à l’Energie Atomique of France; Politechnika Warszawska of Poland; Umicore SA ofBelgium; and Coatema Coating Machinery GmbH and Coatema Maschinenbau GmbH, both of Germany – isto develop cost-efficient R2R production techniques for organic solar cell modules and rechargeable lithiumbatteries.

Also in development is an application-specific integrated circuit (ASIC) chip that would optimize and control thebattery charge from the organic solar modules. To be flexible, the chip is thinned to 30 µm and interconnectedon the flexible backplane. The plan is to use R2R-compatible production technologies to manufacture anenergy storage foil of four printed organic solar cell modules comprising a 100-cm2 area, a printed battery andan interconnected ASIC to control the charge operation. Under AM1.5, a reference organic solar cell modulecan produce 250 mW of power to charge the battery. The battery size is approximately 30 cm2 and itscapacity, between 1 and 3 mAh/cm2.

In Figure, four gravure-printed organic solar cell modules operate at 2.3 percent photon-conversion efficiencyat air mass 1.5 illumination on a 15.5-cm2 area per module. The modules are manufactured usingcommercially available conductive – and photoactive – polymers. The rechargeable lithium battery has anodeand cathode electrodes screen-printed on aluminum and copper foils, and an assembled commercialseparator foil. The battery produces ~40-mAh capacity. The 30-µm-thick ASIC is flip-chip-bonded usinganisotropically conducting adhesive on the backplane substrate.

This energy storage foil is from the FACESS project



All other components of the energy source built for the FACESS project are printed, except for the electronicpart. This is because the performance limitations of printed electronic circuits force the use of traditional,silicon-based microchips for the control electronics. To enable wholly printed devices, the printed circuits mustbe improved significantly.

After the FACESS and POLARIC projects, high-performing organic electronic building blocks andmanufacturing platforms can be used in all areas of printed electronics, including sensors, memory, batteries,photovoltaics, lighting and any combination of these devices. By combining different functionalities and blockson the same flexible foil, and integrating the whole process in a cost-efficient way, the huge market potentialfor printed electronics and optics will turn into reality.

Meet the authors Dr. Jukka Hast is a senior research scientist; e-mail: [email protected]. Kimmo Solehmainen also is a senior research scientist; e-mail: [email protected]. Marja Vilkman is a research scientist; e-mail: [email protected]. All three work at VTT Technical Research Centre of Finland, Printed Functional Solutions.

Flexible Autonomous Cost Efficient Energy Source and Storage = FACESS- http://www.vtt.fi/proj/facess/index.jsp

- http://www.vtt.fi/proj/facess/facess_overview.jspFlexible Autonomous Cost Efficient Energy Source an d StorageProject overviewThe general objectives of this project are the following: to manufacture efficient organic solar cells (OSC) anda thin film battery (TFB) on flexible substrate using commercially available materials and cost efficient roll-to-roll (R2R) mass production techniques, printing, as well as integrate a control transistor circuitry on a foil.The ultimate goal is to integrate these three structures to a single assembly resulting in a flexible, fullyautonomous energy source. In this assembly organic solar cells harvest the solar energy and charge the thinfilm batteries which provide the electricity for an external load. The Si-based transistor circuitry integrated onthe foil controls the charge operation.



IIIIIIIItttttttt’’’’’’’’ssssssss aaaaaaaa kkkkkkkkiiiiiiiinnnnnnnndddddddd ooooooooffffffff mmmmmmmmaaaaaaaaggggggggiiiiiiiicccccccc

Invisibility Cloak

- http://newscenter.lbl.gov/feature-stories/2009/05/01/invisibility-cloak/Blurring the Line Between Magic and Science: Berkel ey Researchers Create an _Invisibility Cloak"May 01, 2009

A team led by Xiang Zhang, a principal investigator with Berkeley Lab's Materials Sciences Division anddirector of UC Berkeley's Nano-scale Science and Engineering Center, has created a _carpet cloak" fromnanostructured silicon that conceals the presence of objects placed under it from optical detection. While thecarpet itself can still be seen, the bulge of the object underneath it disappears from view. Shining a beam oflight on the bulge shows a reflection identical to that of a beam reflected from a flat surface, meaning theobject itself has essentially been rendered invisible.

We have come up with a new solution to the problem of invisibility based on the use of dielectric(nonconducting) materials," says Zhang. _Our optical cloak not only suggests that true invisibility materials arewithin reach, it also represents a major step towards transformation optics, opening the door to manipulatinglight at will for the creation of powerful new microscopes and faster computers."

Zhang and his team have published a paper on this research in the journal Nature Materials entitled: AnOptical Cloak Made of Dielectrics. Co-authoring the paper with Zhang were Jason Valentine, Jensen Li,Thomas Zentgraf and Guy Bartal, all members of Zhang's research group.

These three images depict how light striking an object covered with the carpet cloak acts as if there were noobject being concealed on the flat surface. In essence, the object has become invisible.

(Image by Thomas Zentgraf)

Previous work by Zhang and his group with invisibility devices involved complex metamaterials — compositesof metals and dielectrics whose extraordinary optical properties arise from their unique structure rather thantheir composition. They constructed one material out of an elaborate fishnet of alternating layers of silver andmagnesium fluoride, and another out of silver nanowires grown inside porous aluminum oxide. With thesemetallic metamaterials, Zhang and his group demonstrated that light can be bent backwards, a propertyunprecedented in nature.

While metallic metamaterials have been successfully used to achieve invisibility cloaking at microwavefrequencies, until now cloaking at optical frequencies, a key step towards achieving actual invisibility, has notbeen successful because the metal elements absorb too much light.



Image (a) is a schematic diagram showing the cloaked region (marked with green) which resides below thereflecting bump (carpet) and can conceal any arbitrary object by transforming the shape of the bump back intoa virtually flat object. Image (b) was taken with a scanning electron microscope image of the carpet coatedbump.

Says Zhang, _Even with the advances that have been made in optical metamaterials, scaling sub-wavelengthmetallic elements and placing them in an arbitrarily designed spatial manner remains a challenge at opticalfrequencies."

The new cloak created by Zhang and his team is made exclusively from dielectric materials, which are oftentransparent at optical frequencies. The cloak was demonstrated in a rectangular slab of silicon (250nanometers thick) that serves as an optical waveguide in which light is confined in the vertical dimension butfree to propagate in the other two dimensions. A carefully designed pattern of holes — each 110 nanometersin diameter — perforates the silicon, transforming the slab into a metamaterial that forces light to bend likewater flowing around a rock. In the experiments reported in Nature Materials, the cloak was used to cover anarea that measured about 3.8 microns by 400 nanometers. It demonstrated invisibility at variable angles oflight incident.Right now the cloak operates for light between 1,400 and 1,800 nanometers in wavelength, which is the near-infrared portion of the electromagnetic spectrum, just slightly longer than light that can be seen with the humaneye. However, because of its all dielectric composition and design, Zhang says the cloak is relatively easy tofabricate and should be upwardly scalable. He is also optimistic that with more precise fabrication this alldielectric approach to cloaking should yield a material that operates for visible light — in other words, trueinvisibility to the naked eye.

In this experiment, we have demonstrated a proof of concept for optical cloaking that works well in twodimensions" says Zhang. _Our next goal is to realize a cloak for all three dimensions, extending thetransformation optics into potential applications."

This research was funded in part by the U.S. Department of Energy's Office of Science through its BasicEnergy Sciences program and by the U.S. Army Research Office.

Berkeley Lab is a U.S. Department of Energy national laboratory located in Berkeley, California. It conductsunclassified scientific research and is managed by the University of California. Visit website athttp://www.lbl.gov.

Additional information:A copy of the Nature Materials paper _An Optical Cloak Made of Dielectrics" by Zhang, et al., can be read here:http://www.nature.com/nmat/journal/vaop/ncurrent/full/nmat2461.html

For more information about the research of Xiang Zhang, visit his Website at http://xlab.me.berkeley.edu/

To learn more about the earlier work by Zhang and his group on invisibility read a UC Berkeley press release athttp://www.universityofcalifornia.edu/news/article/18368



AAAAAAAAccccccccrrrrrrrroooooooonnnnnnnnyyyyyyyymmmmmmmmssssssss

See also: Nanotechnology vol.2 Technology for E-books Readers (B/W & colors display)www.biodomotica.com/public/e-paper_e-book.pdf

AFM Atomic Force MicroscopeAMOLED Active Matrix Organic light emitting diodeCIGS Copper Indium Gallium Selenide (semiconductor material)CMOS Complementary Metal-Oxide Semiconductor (transistor type)CNT Carbon NanotubeDEA Dielectric Elastomer ActuatorsDSSC Dye sensitized solar cell or Graetzel CellEAP Electroactive PolymersEW Electro-wettingEMF Electromotive forceERF Electrorheological fluidESD Electrostatic dischargeESNAM European Scientific Network for Artificial MusclesFFL Flat, Flexible LoudspeakersFEC Forward error-correction (biosensors)FET Field Effect TransistorF-OLED Flexible Organic light emitting diodeGPS Global Position SystemGUI Graphical User InterfaceIPMC Ionic polymer-metal-compositeITO Indium Tin OxideLAN Local area networksLCD Liquid Crystal DisplayLCM Liquid crystal moduleLED Light-emitting diodeLEP Light emitting polymerLOPE-C Large-area, Organic and Printed Electronics ConventionMEMS Micro Electronic Mechanical SystemsMR Magneto-ResistiveMRF Magnetorheological fluidMRAM Magnetoresistive Random Access Memory - A memory fabricated using nanotechnology

which uses electron spin to store data.MWNT Multi-walled nanotubesNEMS Nanoelectromechanical systemsOEL Organic Electroluminescent (display technology)OLED Organic Light-Emitting DiodeOrganic UI User InterfacePANI PolyanilinePH OLED Phosphorescent Organic Light-Emitting DiodePDA Personal Digital Assistant (electronic handheld information device)PDMS Polydimethylsiloxane (organic polymer)PEN Polyethylene Naphthalate (electrical insulation material)PET Plastic substrates: polyethylene teraphthalatePM-OLED Passive matrixP-OLED Polymer light emitting diodePV PhotovoltaicRFID Radio Frequency IdentificationRRAM Resistive random access memoryR2R Roll-To-Roll (manufacturing)STM Scanning tunneling microscopeSWNT Single-walled nanotubesTEC Transparent Electronic ConductiveTEG Thermoelectric generatorsTFT Thin Film Transistor (Liquid Crystal Display, LCD technology)TiO2 Titanium Dioxide (Photocatalyst coatings)



T-OLED Transparent organic light-emitting deviceTRRAM Transparent resistive random access memoryTUI Touch User InterfaceWECA Wireless Ethernet Compatibility AllianceWi-Fi Wireless Fidelity (IEEE 802.11 wireless networking)WiMAX Worldwide Interoperability for Microwave Access

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________



BBBBBBBBooooooooooooooookkkkkkkkssssssss

http://www.foresight.org/nano/Bookstore.html

http://www.azonano.com/BookReview.asp?cat=5

http://www.azom.com/bookreview.asp?cat=10

http://www.materialsviews.com/view/0/books.html

http://www.worldscibooks.com/nanosci/nanosci.shtml

http://www.nanolabweb.com/index.cfm/action/main.default.searchResults/topicID/6/CFID/5216341/CFTOKEN/29616759/index.html

Transparent Electronics

by Wager, John F., Keszler, Douglas A., Presley, Rick E.About this title: Transparent electronics is an emerging technology that employs wide band-gapsemiconductors for the realization of invisible circuits. This monograph provides the first roadmap fortransparent electronics, identifying where the field is, where it is going, and what needs to happen to move itforward. Although the central focus of this monograph involves transparent electronics, many of the materials,devices, circuits, and process-integration strategies discussed herein will be of great interest to researchersworking in other emerging fields of optoelectronics and electronics involving printing, large areas, low cost,flexibility, wearability, and fashion and design.

Computational Physics of Carbon Nanotubes

by Hashem Rafii-TabarAbout this title: Carbon nanotubes are the fabric of nanotechnology. Investigation into their properties hasbecome one of the most active fields of modern research. This book presents the key computational modelingand numerical simulation tools to investigate carbon nanotube characteristics. In particular, methods applied togeometry and bonding, mechanical, thermal, transport and storage properties are addressed.

Nanostructure Design: Methods and Protocols

by Ehud Gazit (Editor), Ruth Nussinov (Editor)About this title: As one of the fastest growing fields of research in the 21st century, nanotechnology is sure tohave an enormous impact on many aspects of our lives. Nanostructure Design: Methods and Protocols servesas a major reference for theoretical and experimental considerations in the design of biological and bio-inspired building blocks, the physical characterization of the formed structures, and the development of theirtechnical applications.

Current Topics in Elastomers Research

by Bhowmick K Bhowmick, Anil K Bhowmick (Editor)About this title: Written by a world-renowned expert, this concise and pioneering work explores the latestadvances in elastomers research. Discussion includes new developments with rubber, nanotechnology, andelastomers; the direction of current research; and the new materials derived using new technologies.

Conductive Electroactive Polymers: Intelligent Poly mer Systems, Third Edition

by Gordon G Wallace, Geoffrey M Spinks, Leon A P Kane-MaguireAbout this title: An in-depth look at intelligent polymer systems, this third edition features new chapters on thesynthesis and fabrication of nanocomponents and nanostructures for polypyrroles, polythiophenes, andpolyanilines.



Nanostructures in Electronics and Photonics

by Faiz Rahman (Editor)About this title: Nanotechnology is the buzzword these days. This book provides a broad overview ofnanotechnology as applied to contemporary electronics and photonics. The areas of application described aretypical of what originally set off the nanotechnology revolution.

Photonic Ink and Elastic Ink Lab-to-Market

by Ozin, Z. Anorg. Allg. Chem., 2008, 634, 1871-2100P-Ink is made of a metallopolymer opal gel that reversibly swells and shrinks with application and removal of avoltage. Elast-Ink is made of an elastomeric opal that undergoes reversible dimensional changes on applyingand removing a mechanical force.

Artificial Muscles: Applications of Advanced Polyme ric Nanocomposites

by Professor Mohsen Shahinpoor, Kwang J Kim, Mehran MojarradAbout this title: Smart materials are the way of the future in a variety of fields, from biomedical engineeringand chemistry to nanoscience, nanotechnology, and robotics. Featuring an interdisciplinary approach to smartmaterials and structures, "Artificial Muscles: Applications of Advanced Polymeric Nanocomposites" thoroughlyreviews the existing knowledge of ionic polymeric conductor nanocomposites (IPCNCs), including ionicpolymeric metal nanocomposites (IPMNCs) as biomimetic distributed nanosensors, nanoactuators,nanotransducers, nanorobots, artificial muscles, and electrically controllable intelligent polymeric networkstructures.

Challenges in the Management of New Technologies

by Marianne Horlesberger (Editor), Mohamed El-Nawawi (Editor), Tarek Khalil (Editor)About this title: New developments in bio- and nanotechnologies and also in information and communicationtechnologies have shaped the research environment in the last decade. Increasingly, highly educated expertsin R&D departments are collaborating with scientists and researchers at universities and research institutes todevelop new technologies.

Commercializing Micro-Nanotechnology Products

by David Tolfree (Editor), Mark J Jackson (Editor)About this title: Micro-nanotechnologies are already making a profound impact on our daily lives. Newapplications are well underway in the US, Asia, and Europe, but their potential disruptive nature, along withpublic concerns, have produced challenges that must be overcome.

Nanotechnology: Health and Environmental Risks (Per spectives in Nanotechnology)

by Shatkin, Jo AnneAbout this title: Nanotechnology promises to be the third wave of technological innovation, but the rapidintegration of nanomaterials into consumer products is not without concern. "Nanotechnological Risks"presents various methods for evaluating health, safety, and environmental nanotechnology risks

Encyclopedia of Nanoscience and Nanotechnology, Vol umes 1-10

by Smalley, RichardAbout this title: Professor Richard E. Smalley, Nobel Prize Laureate in Chemistry The Encyclopedia ofNanoscience and Nanotechnology is the world's first single most comprehensive reference source everpublished in the field of nanotechnology.

Nanotechnology: Ethics and Society

by Deb Bennett-WoodsAbout this title: Nanotechnology promises to be the next great human technological revolution, but suchchange often comes at the price of unforeseen consequences. "Navigating the Boundaries" explores severalof the practical and ethical dilemmas presented by this technological leap. This book provides a framework fordeciding how to best take advantage of nanotechnology opportunities while minimizing potential negativeeffects



Nanotechnology 101

by John MongilloAbout this title: What should the average person know about science? Because science is so central to life inthe 21st century, science educators and other leaders of the scientific community believe that it is essentialthat everyone understand the basic concepts of the most vital and far-reaching disciplines. "Nanotechnology101" does exactly that.

Organic Nanostructures

by Jerry L Atwood (Editor), Jonathan W Steed (Editor)About this title: Filling the need for a volume on the organic side of nanotechnology, this comprehensiveoverview covers all major nanostructured materials in one handy volume. Alongside metal organicframeworks, this monograph also treats other modern aspects, such as rotaxanes, catenanes, nanoporosityand catalysis

Nanotechnology for Dummies

by Richard Booker, Earl BoysenAbout this title: This title demystifies the topic for investors, business executives, and anyone interested in howmolecule-sized machines and processes can transform our lives. Along with dispelling common myths, itcovers nanotechnology's origins, how it will affect various industries, and the limitations it can overcome. Thishandy book also presents numerous applications such as scratch-proof glass, corrosion resistant paints, stain-free clothing, glare-reducing eyeglass coatings, drug delivery systems, medical diagnostic tools, burn andwound dressings, sugar-cube-sized computers, mini-portable power generators, even longer-lasting tennisballs, and more.

The Nanotech Pioneers: Where Are They Taking Us

by Steven A EdwardsAbout this title: Hype, hope, or horror? This work is a vivid look at nanotechnology, written by an insider andexperienced science writer. The variety of new products and technologies that will spin out of nanoscience islimited only by the imagination of the scientists, engineers and entrepreneurs drawn to this new field. SteveEdwards concentrates on the reader's self interest: no military gadgets, wild fantasies of horror nanobotpredators and other sci-fi stuff, but presents a realistic view of how this new field of technology will affectpeople in the near future.

Molecular Devices and Machines: A Journey Into the Nanoworld

by Vincenzo Balzani, Margherita Venturi, Alberto CrediAbout this title: The miniaturization of bulky devices and machines is a process that confronts us on a dailybasis. However, nanoscale machines with varied and novel characteristics may also result from theenlargement of extremely small building blocks, namely individual molecules. This bottom-up approach tonanotechnology is already being pursued in information technology, with many other branches about to follow.Written by a team of experienced authors headed by Vincenzo Balzani, one of the pioneers in thedevelopment of molecular machines Covers such diverse aspects as sensors, memory components, solarenergy conversion, biomolecules as molecular machines, and much more

Transparent Electronics: From Synthesis to Applicat ionsAntonio Facchetti (Editor), Tobin Marks (Editor)ISBN: 978-0-470-99077-3Hardcover 470 pages April 2010Structured to strike a balance between introductory and advanced topics, this monograph juxtaposesfundamental science and technology / application issues, and essential materials characteristics versus devicearchitecture and practical applications. The first section is devoted to fundamental materials compositions andtheir properties, including transparent conducting oxides, transparent oxide semiconductors, p-type wide-band-gap semiconductors, and single-wall carbon nanotubes. The second section deals with transparentelectronic devices including thin-film transistors, photovoltaic cells, integrated electronic circuits, displays,sensors, solar cells, and electro-optic devices.



Nanotechnology: New Promises, New Dangersby Toby ShelleyZed Books: 2006. 208 pp.Toby Shelley's book Nanotechnology provides a short, accessible primer on the world of nanotechnology —the revolutionary realm of seeing, measuring, controlling and making things on the scale of atoms andmolecules. It raises key questions about how this disruptive technology will affect human health, theenvironment, civil liberties, weaponry, and people in developing countries.

Microstrip and Printed AntennasNew Trends, Techniques and Applications1. Edition - November 2010 504 Pages, HardcoverISBN-10: 0-470-68192-6ISBN-13: 978-0-470-68192-3 - John Wiley & Sons

This book focuses on new techniques, analysis, applications and future trends of microstrip and printedantenna technologies, with particular emphasis to recent advances from the last decade. Attention is given tofundamental concepts and techniques, their practical applications and the future scope of developments.Several topics, essayed as individual chapters include reconfigurable antenna, ultra-wideband (UWB)antenna, reflectarrays, antennas for RFID systems and also those for body area networks. Also included areantennas using metamaterials and defected ground structures (DGSs). This book provides a reference forR&D researchers, professors, practicing engineers, and scientists working in these fields.

Chapters 1-4 Presentation Slides forScience at the Nanoscale: An Introductory Textbookby Chin Wee Shong, Sow Chorng Haur & Andrew T. S. WeeNational University of SingaporeISBN: 9789814241038 August 2009 228 pages- http://www.panstanford.com/books/nanosci/v004.html

Unbounding the Future: the Nanotechnology Revolutio nBy Eric Drexler and Chris Peterson, with Gayle PergamitWilliam Morrow and Company, Inc.New YorkThis book delivers a rich array of micro-scenarios of nanotechnology at work, some thrilling,some terrifying, all compelling. Probably none represent exactly what will happen, but in aggregatethey give a deep sense of the kind of thing that will happen. Strategies of how to stay ahead of theprocess are proposed, but the ultimate responsibility for the wholesome use and development ofnanotechnology falls on every person aware of it. That now includes you. — Stewart Brandhttp://crnano.org/unbounding.htm

Jet-printed Si nanowires for flexible backplane app licationsW.S. Wong, S. Raychaudhuri, S. Sambandan, R. Lujan, R.A. StreetISBN: 978-1-4398-3402-2 - Pages: 862The integration of Si nanowire (Si NW) materials with low-temperature plastic substrates can enhance theperformance of low-cost flexible electronics. We report the properties of Si NW field-effect transistors (FETs)fabricated with various contact metals and passivation layers. We also demonstrate the use ofdielectrophoresis and inkjet printing to pattern and assemble active matrix display backplane arrays of Si NWFETs from a liquid suspension.

Brochure: " Nanotechnology: Innovation for tomorrow's world "Brochure of the European Commission to illustrate to the public what nanotechnology isBrochure is available as pdf in Danish, German, English, Greek, Spanish, French, Italian, Dutch, Polish,Portuguese, Slovenian, Finnish, Swedish, Arab, Chinese, Russian , Czech, Slovak and in Estonian.http://cordis.europa.eu/nanotechnology/src/pe_leaflets_brochures.htm

This site is designed to help you find out about European Research . Whether you are a researcher or ateacher, in business or in politics, there is something for you here. You can read about the latest politicaldecisions, or the latest advances in research; there is even a set of online leaflets about European Researchin Action, written for the non-specialist and available in 11 or more languages.http://ec.europa.eu/research/index.cfm?lg=en&pg=about



7 things every reporter should know before writing about nanotechnology and 7 questions to ask every _nano"companyby Nathan Tinker, PhD, Senior Director The Nanotech Company, with Darrell Brookstein, Managing Directorhttp://www.merlinq.nl/index.php?option=com_content&task=view&id=280&Itemid=74

What are nanoscience and nanotechnologies?http://www.nanotec.org.uk/finalReport.htm

For Italian readers:Quanto è piccolo il mondo . Sorprese e speranze dalle nanotecnologiePacchioni Gianfranco, 2007, Zanichelli

Cosa sono le nanotecnologie . Istruzioni per l'uso della prossima rivoluzione scientificaNarducci Dario,2008, Sironi (collana Galápagos)

Brochure: " La Nanotecnologia: Innovazione per il mondo di dom ani "http://cordis.europa.eu/nanotechnology/src/pe_leaflets_brochures.htm

JJJJJJJJoooooooouuuuuuuurrrrrrrrnnnnnnnnaaaaaaaallllllll PPPPPPPPaaaaaaaappppppppeeeeeeeerrrrrrrrssssssss

http://rogers.mse.uiuc.edu/publications.html

Journal Papers on Transparent ElectronicsDisclaimer: The PDF documents on this WebPages are provided for educational and personal purposes alone and aresubject to their respective publisher's copyrights.

J. Yoon, A.J. Baca, S.-I. Park, P. Elvikis, J.B. Geddes, L. Li, R.H. Kim, J. Xiao, S. Wang, T.H. Kim, M.J.Motala, B.Y. Ahn, E.B. Duoss, J.A. Lewis, R.G. Nuzzo, P.M. Ferreira, Y. Huang, A. Rockett and J.A. Rogers,_Ultrathin Silicon Solar Microcells for Semitransparent, Mechanically Flexible and Microconcentrator ModuleDesigns," Nature Materials 7, 907-915 (2008).

S. Jeon, D.J. Shir, Y.S. Nam, R. Nidetz, M. Highland, D.G. Cahill, J.A. Rogers, M.F. Su, I.F. El-Kady, C.G.Christodoulou and G.R. Bogart, _Molded Transparent Photopolymers and Phase Shift Optics for FabricatingThree Dimensional Nanostructures," Optics Express 15(10), 6358-6366 (2007).

Q. Cao, Z.T. Zhu, M.G. Lemaitre, M.G. Xia, M. Shim and J.A. Rogers, "Transparent Flexible Organic Thin-FilmTransistors That Use Printed Single-Walled Carbon Nanotube Electrodes," Applied Physics Letters 88,113511 (2006).http://www.interscience.wiley.comWiley InterScience® is a leading international resource for scientific, technical, medical and scholarly content.

http://www3.interscience.wiley.com/journal/10008336/homeAdvanced Materials

http://www3.interscience.wiley.com/journal/117935002/grouphomeAdvanced Functional Materials

http://www3.interscience.wiley.com/journal/67500980/homeAdvanced Engineering Materials

http://www3.interscience.wiley.com/journal/121524295/homeNanomedicine and Nanobiotechnology



LLLLLLLLiiiiiiiinnnnnnnnkkkkkkkkssssssss

http://www.nano.org.ukThe Institute of Nanotechnology (IoN) is a registered Charity, whose core activities are focused on education and trainingin nanotechnology, in the widest sense. The Institute was one of the world's first nanotechnology information providers andis now a global leader.

http://www.crnano.org/whatis.htmThe Center for Responsible Nanotechnology (CRN) is a non-profit research and advocacy think tank concerned with themajor societal and environmental implications of advanced nanotechnology.

http://www.nanowerk.comNanowerk is committed to educate, inform and inspire about nanosciences and nanotechnologies.

http://nanotechweb.org/cws/homeNanotechnology journal

http://thefutureofthings.comThe Future of Things (TFOT) is an online magazine dedicated to bringing original content on science,technology, and medicine from around the world.

http://www.citala.com/index.phpA leader in flexible displays, Citala is the pioneer of the Active Pixel Display (APD_)—a flexible reflective display thatrepresents a paradigm shift in the display arena.

http://www.electroscience.com/smartcardappnotes.htmlThick-Film Materials and Ceramic Tapes

http://www.cdtltd.co.ukCambridge Display Technology, a subsidiary of Sumitomo Chemical, leads the development of display technology basedon polymer organic light emitting diodes (P-OLEDs).

http://www.vdma.org/wps/portal/Home/enThe Organic Electronics Association is a working group within VDMA, representing the whole process chain in organicelectronics like e.g. plastic chips, organic displays, sensors and photovoltaics. Our members are international leadingcompanies and institutions and include component and material suppliers, equipment and tool suppliers, producers andsystem integrators, end-users and research institutes.



http://www.nanotechobserver.com/Nanotech Observer is a multilingual, Web-based, free-content encyclopedia project based mostly on anonymouscontributions. Nanotech Observer's articles provide links to guide the user to related pages with additional information.

http://printedelectronics.idtechex.com/printedelectronicsworld/en/Printed Electronics World provides you with a daily update of the latest industry developments. Launched in May 2007, thisfree portal covers the progress to printed electronics in all its forms - from transistor circuits to power, sensors, displays,materials and manufacturing.

http://www.sciencedaily.comScienceDaily is one of the Internet's leading online magazines and Web portals devoted to science, technology, andmedicine.

http://www.nanoforum.org/European Nanotechnology CommunityNanoforum has produced Nanotechnology Education Tree which is designed to give an introduction to nanotechnologyapplications in health, the environment, energy, electronics and modern life

http://www.nanotech-now.comVery much like a White Paper, we seek to provide a forum and format that helps clarify nanotechnology and nanoscalescience, to laymen, general business persons, non-specialists, highly skilled technicians, professionals, and academics."

http://www.foresight.orgFounded in 1986, we were the first organization to educate society about the benefits and risks of nanotechnology. At thattime our focus was on preparing society for nanotechnology, then a little known science and technology.

http://www.zyvex.comWe started Zyvex to develop practical uses for molecular nanotechnology to transform how we make physical goods —creating clean, flexible, and powerful manufacturing for the 21st century.

http://www.sciencemuseum.org.uk/antenna/nanoThe Science Museum provides an educational and interactive overview of nanotechnology

http://www.nanotechproject.org/consumerproductsAn inventory of nanotechnology-based consumer products currently on the market.

http://www.rmnanotech.comRMNanotech.com contains links to sites where you can purchase Nanotechnology products andNanotechnology books.

http://www.almaden.ibm.com/st/nanoscale_st/IBM Research at Almaden participates in a wide variety of activities that fall under the broad scope of nanoscale scienceand technology. The activities span synthesizing nanoscale materials, nanoscale fabrication for creating nanoscalestructures and devices, and developing novel methods to probe and manipulate atoms.

http://www.cordis.europa.eu/nanotechnologyNanotechnology Homepage of the European Commission

http://www.nano.govThe National Nanotechnology Initiative (NNI) is the program established in fiscal year 2001 to coordinate Federalnanotechnology research and development.

http://www.futuretechnologycenter.euThe Future Technology Center offers forecasting services on new technologies based on continuous tracking and trendanalysis of global technological developments.

http://www.physorg.com/nanotech-news/Internet news portal provides the latest news on science including: Physics, Space Science, Earth Science, Health andMedicine

http://community.safenano.org/The UK's premier source of information on nanoparticle hazard, and nanotoxicology

http://www.oled-display.net This site informs about OLED - Organic light emitting diodes



http://www.nanotech.it Italian

http://www.venetonanotech.it Italian

http://www.nanotecnologica.com Spanish

http://www.nanovip.com video — Spanish

http://www.nanomicro.recherche.gouv.fr/fr/cnano.html French

http://fr.wikipedia.org/wiki/Nanotechnologie French

http://www.mannometer-nanometer.de German

http://nanonet.mext.go.jp Japanese/EnglishNanotechJapan is the official web site for the Nanotechnology Network Project (2007-2012) funded by the JapaneseMinistry of Education, Culture, Sports, Science and Technology (MEXT). The primary aim of the Project is to providenanotechnology researchers with access to advanced research facilities of the participating institutions.

http://www.aist.go.jp/index_en.html Japanese/EnglishNational Institute of Advanced Industrial Science and Technology (AIST)

http://www.nanochina.cn/ Chinese/EnglishNanoChina.cn provides a bridge between the nanotechnology activities that are taking place in China and the rest of theworld, with the aim of disseminating information and setting up nano-business and networking opportunities.

SSSSSSSShhhhhhhhoooooooowwwwwwww////////CCCCCCCCoooooooonnnnnnnnvvvvvvvveeeeeeeennnnnnnnttttttttiiiiiiiioooooooonnnnnnnn////////EEEEEEEExxxxxxxxppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiioooooooonnnnnnnnBvents is the largest source of information on conferences, tradeshows, conventions, corporate events andexhibitions worldwide.http://www.bvents.com

BBBBBBBBllllllllooooooooggggggggssssssssTop 50 Nanotech & Biomaterial Blogsby Miranda on January 12, 2010http://mastersinhealthinformatics.com/2010/top-50-nanotech-biomaterial-blogs/

50 Forward Thinking Nanotech Blogshttp://becomingacomputertechnician.com/?page_id=98

http://www.gizmag.comhttp://www.engadget.comhttp://us.gizmodo.comhttp://www.crunchgear.comhttp://www.howtogeek.com

Italian Blogshttp://www.blogtopsites.com/technology/italianhttp://chiacchieresulnano.blogspot.com/search/label/nanotecnologie



TTTTTTTToooooooooooooooollllllllbbbbbbbbooooooooxxxxxxxx

http://www.nanoword.netNanoword.net is an online nanotechnology resource focusing on education of the general public and distribution ofnanotech products.

http://www.nanoengineer-1.com/mamboFounded in 2004, Nanorex Inc. is a developer of open-source computational modeling tools for the design and analysis ofatomically precise nanosystems.

http://www.ides.com/?source=.NetProspector Plastic Properties

http://www.plastics-extrusion.co.uk Plastic Properties

http://www.dynalabcorp.com/home_defaultpage.asp Plastic Properties

http://www.claremicronix.com/ o Products o Display Drivers o E Ink and ePaper

http://www.wikipedia.com Free Online Encyclopedia

http://www.howstuffworks.comHowStuffWorks, a wholly owned subsidiary of Discovery Communications, is the award-winning source of credible,unbiased, and easy-to-understand explanations of how the world actually works.

http://www.google.com Internet search engine

http://www.thefreedictionary.com/ Free Online Dictionary, Thesaurus, Encyclopedia, Acronyms

http://www.patentstorm.us/PatentStorm offers full-text U.S. patents and patent applications from the U.S. Patent Office, providing advanced searchcapabilities and full image retrieval in handy PDF format.

http://www.wipo.int/portal/index.html.en Patents and patent applications

http://translate.google.com Online translator

http://world.altavista.com Online translator

http://www.babylon.com Online / Offline translator



iiiiiiiiPPPPPPPPaaaaaaaadddddddd && iiiiiiiiPPPPPPPPhhhhhhhhoooooooonnnnnnnneeeeeeee aaaaaaaapppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ffffffffoooooooorrrrrrrr NNNNNNNNaaaaaaaannnnnnnnooooooootttttttteeeeeeeecccccccchhhhhhhh

iPhone

- AzoNano http://www.azonano.com/iphone/

The AZoNanotechnology App from wwww.azonano.com — The A to Z of Nanotechnology,represents the world of Nanotechnology in the palm of your hand.

- findNano http://www.nanotechproject.org/news/archive/8295/

findNano allows users to browse an inventory of more than 1,000 nanotechnology-enabledconsumer products, from sporting goods to food products and electronics to toys, using theiPhone and iPod Touch. Using the built-in camera, iPhone users can even submit newnanotech products to be included in future inventory updates.

- Nanovip http://www.nanovip.com/free-nanovip-app

Nanovip is an online Nanotechnology Portal bringing you the latest nanotech news, jobs andmore. Updated in real time

- PhysOrg.con News Lite http://www.physorg.com/help/iphone/

- Technology NewsThis news application will provide you the relevant information of all type of academic andresearch technologies. Like biotechnology, Information technology, Auto technology,communication, computing, Biometrics, nanotechnology, robotic technology and so on

- Tiscali http://itunes.apple.com/it/app/tiscali/id361736404?mt=8Italian Apps

iPad

- PhysOrg.con News Lite HD http://www.physorg.com/help/ipad/

- Tiscali per iPad http://itunes.apple.com/it/app/tiscali-per-ipad/id396097628?mt=8 Italian Apps



AAAAAAAAnnnnnnnnddddddddrrrrrrrrooooooooiiiiiiiidddddddd aaaaaaaapppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ttttttttoooooooo rrrrrrrreeeeeeeeaaaaaaaadddddddd RRRRRRRRSSSSSSSSSSSSSSSS NNNNNNNNaaaaaaaannnnnnnnooooooootttttttteeeeeeeecccccccchhhhhhhh

http://www.talkandroid.com/8805-top-5-android-rss-readers/

gReader

gReader is an RSS feed client that allows you to view your feeds by site, or view all at thesame time

FeedR

FeedR allows you to view you feeds by category. Even better, you can color code yourcategories so that you can find the news that you want to read fast.

FastReader

FastReader is an RSS feed client that gets you your news in a time efficient manner. The apphas 2 tabs, one that shows you each feed, and another that lets you view all of the feeds atonce.

FeedSquares

FeedSquares is not your ordinary RSS reader. In fact, there are no apps like it. Instead ofgiving you a boring list of your feeds, FeedSquares gives you colorful boxes that represent

each feed. If you only have one or two feeds that you get news from, then this app is not for you. But if youhave a bunch of news from a bunch of places, then look no further.

NewsRob

NewsRob is a very sleek app that gets you your news from your Google Reader account.

Comparison



22222222000000001111111111111111 UUUUUUUUppppppppddddddddaaaaaaaatttttttteeeeeeee

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………

…………………………………………………………………………………………………………



BIODOMOTICABIODOMOTICABIODOMOTICABIODOMOTICA

Massimo Marrazzowww.biodomotica.com [email protected]

DisclaimerNo one can sell or ask money for this e-book.

Every info in this document is available free on Internet, like this e-book.I don’t receive money or any other benefits by the companies cited.

I’m not responsible for errors, damages, mistakes o any fraud by websites listed in this e-book.If you don’t want be mentioned here just write me an email to ([email protected])

and I’ll delete any reference of you from this e-book.

Copyright © 2011 Massimo Marrazzo - BiodomoticaThis document may be used and distributed provided that this copyright statement is not removed

from the file and that any derivative work contains the original copyright notice.If you want reproduce, distribute, print articles mentioned in this e-book

you must contact owners of copyright, not me.

Any of the trademarks, service marks, collective marks, design rights or similar rights that are mentioned,used or cited in “A foldable World” are the property of their respective owners.