APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 1994, p. 4279-42830099-2240/94/$04.00+0Copyright © 1994, American Society for Microbiology

Cloning of Frankia Species Putative tRNAPro Genes and Their Efficacyfor pSAM2 Site-Specific Integration in Streptomyces lividans

MARIA-TERESA ALEGRE,1 BENOIT COURNOYER,2* JUAN MANUEL MESAS,1 MICHEL GUERINEAU,3PHILIPPE NORMAND,2 AND JEAN-LUC PERNODET3

Politecnica Superior, 27002 Lugo, Spain,' and Laboratoire de Microbiologie des Sols, URA CNRS 1450, UniversiteClaude Bemard-Lyon I, 69622 Villeurbanne Cedex,2 and Institut de GMn&tique et de Microbiologie,

URA CNRS 1354, Universite Paris XI, 91405 Orsay Cedex, France

Received 23 June 1994/Accepted 10 October 1994

pSAM2 is a conjugative Streptomyces ambofaciens mobile genetic element that can transfer and integrate sitespecifically in the genome. The chromosomal attachment site (attB) for pSAM2 site-specific recombination fortwo Frankia species was analyzed. It overlaps putative proline tRNA genes having a 3'-terminal CCA sequence,

an uncommon feature among actinomycetes. pSAM2 is able to integrate into a cloned Frankia attB siteharbored in Streptomyces lividans. The integration event removes the 3'-terminal CCA sequence and introducesa single nucleotide difference in the TIC loop of the putative Frankia tRNA"" gene. Major differences betweenthe attP sequence from pSAM2 and the Frankia attB sequence restrict the identity segment to a 43-bp-longregion. Only one mismatch is found between these well-conserved alt segments. This nucleotide substitutionmakes a BstBI recognition site in Frankia attB and was used to localize the recombination site in a 25-bp regiongoing from the anticodon to the T'C loop of the tRNAP'r sequence. Integration of pSAM2 into the Frankia attBsite is the first step toward introduction of pSAM2 derivatives into Frankia spp.

pSAM2 is a mobile genetic element from Streptomycesambofaciens (26) that is capable of site-specific integration intothe genomes of several Streptomyces species (3). Site-specificintegration can also occur in a Mycobacterium sp. (18). Theintegration event involves recombination between two se-

quences, attP carried by pSAM2 and attB in the host chromo-some. The exact position of the recombination site remainsunknown. The resemblance between the integration events ofpSAM2 and those of bacteriophages suggests similarities be-tween the mechanisms involved (4). DNA sequence compari-sons evidenced the use of a site-specific recombinase of theintegrase family encoded by pSAM2 (4). After integration,pSAM2 is flanked by two att sequences, attL and attR (3). TheattR region is defined as the region closest to the integrasegene (int). The attB site overlaps a putative tRNA gene inStreptomyces spp., and its highly conserved domain was used toclone tRNA genes from other genera (19).

Here, we report the DNA sequences of putative tRNA genesfrom the actinomycete Frankia containing the attB sites for theintegration of pSAM2. Frankia species are slowly growingbacteria and are classified in the suprageneric group of acti-nomycetes producing multilocular sporangia (16). They are

involved in the regeneration of soil properties through symbi-otic nitrogen fixation. Knowledge about the presence of a

functional attB site for the integration of pSAM2 derivativeswould be the first step toward their use as integrative vectors inFrankia spp. Genetic transformation of Frankia spp. has notbeen achieved. Integrative vectors might circumvent problemsrelated to plasmid replication. The functionality of one of theFrankia putative attB sites isolated here was tested in Strepto-myces lividans.

* Corresponding author. Mailing address: University of the WestEngland, Faculty of Applied Sciences, Department of BiologicalSciences, Coldharbour Lane, Bristol BS16 1QY, United Kingdom.Fax: (44) 117 9 76 38 71.

MATERIALS AND METHODS

Strains and culture conditions. F. alni ArI3 (1) was grown at28°C in FTW medium (34), and Casuarina-infective strain M2(ORS020609) (23) of genomic species 9 (12) was grown in BAPmedium (21) at 28°C. Cloning experiments with Streptomycesstrains were done with Streptomyces lividans JT46 (SLP2-SLP3- pro-2 str-6; deficient in intraplasmid recombination)(15, 36). S. ambofaciens ATCC 15154 was used in interspecificmating experiments because its chromosome harbors an inte-grated copy of pSAM2 (26). Streptomyces strains were grownon R2YE plates (36). Interspecific matings were performed bymixing spores of the two strains and spreading this mixedculture on R2YE plates. After sporulation, spores were har-vested and S. lividans exconjugants were selected by platingon R2YE containing 50 ,ug of streptomycin per ml. Beforeplasmid extraction, Streptomyces strains were grown in trypticsoy broth (Difco) containing 5 jLg of nosiheptide (kindlyprovided by Rhone-Poulenc Rorer, France) per ml. Cloningexperiments with Escherichia coli were done with strain HB101(5), DH5a (Bethesda Research Laboratories, Inc., Gaithers-burg, Md.), or JM101 (20).DNA manipulation. Vector pUC19 and phages M13mpl8

and M13mpl9 (40) were used for cloning in E. coli. VectorpIJ486 (38) was used for cloning in S. lividans. Total DNAsfrom pure cultures of Frankia strains were obtained as de-scribed by Simonet et al. (32). For plasmid or phage DNAextraction and manipulation and for cloning in E. coli or

Streptomyces strains, standard protocols were used (13, 29).For hybridization, OL-1, a 40-mer oligonucleotide whose

sequence corresponds to the conserved region between attPand attB, was used as a DNA probe (3). Following agarose gelelectrophoresis (29), DNA fragments were transferred toHybond N membranes (Amersham) and hybridized with the32P-labeled oligonucleotide by using the protocol recom-

mended by the supplier. After hybridization, filters were

washed at 50°C in 1x SSC (0.15 M NaCl, 0.015 M sodiumcitrate).PCR amplification. PCR DNA amplification was done as

4279

Vol. 60, No. 12

4280 ALEGRE ET AL.

1.2.3.

4.

ttcgggacgaagaggtcgtgggttcaaatcccgccaccccgacagagaaacaccaggtccgcgaegagcagcgacaatCGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGTCGTGGGTTCAAATCCCGCCACCCCGAcagagaaaca r-CQnt!tfFr-QtgL=at_ctaggca- eygAr-f,-+9Zttttcgtctgcgtgtccggtatgcttcatct tggtcgCGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGTCGTGGGTTCGAATCCCGCCACCCCGACCAagacact =tct gccgggggttggc

ggjtatgcttcatctcggtogCGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGT GTGGGTTC GAATCCGCACCCGACcgKc,aagccAct cag=crtac rrccg tcgtcgtctctgggctcgc

FIG. 1. DNA sequences of attB sites from two Frankia species. The attB sites of F. alni ArI3 and Frankia strain M2 are compared with the attBsite of S. ambofaciens. Identities are denoted by two dots. Nucleotides corresponding to the putative proline tRNA gene are in capital letters. Theimperfect inverted repeats that may play the role of transcriptional terminators are underlined. The Streptomyces att identity segment is shown. 1,Streptomyces att identity segment; 2, S. ambofaciens DSM40697; 3, Frankia strain M2; 4, F. alni ArI3.

described by Nazaret et al. (22) and Simonet et al. (33).Primers were defined from the pSAM2 partial sequence (4)and the sequence of Frankia chromosomal DNA close to attB(this work). Primers complementary to pSAM2 DNA wereOL-8 (5'-AGTCACGCAGATAGACACGC-3') and OL-9 (5'-CGGTCACACGAAGAGTGGAC-3'), and those comple-mentary to Frankia DNA were OLOF-1 (5'-CCAGTGCCCAAGCCGGCCGC-3') and OLOF-2 (5'-C'TTCAGTGGCGACCCAGAG-3'). DNA amplifications were performed withOL-8 and OLOF-1 to obtain the right attachment site (attR)and with OL-9 and OLOF-2 to obtain the left attachment site(attL). Annealing of the primers was done at 70°C. Visualiza-tion of positive PCR amplifications was done as described bySimonet et al. (33).DNA sequencing. DNA sequences of fragments cloned into

M13mpl8 and M13mpl9 were determined by the chain termi-nation procedure (30) with the modifications of Biggin et al.(2). Universal primers were used. Direct DNA sequencing ofPCR products was performed by the method of Winship (39).The primer used in these sequencing reactions was either OL-8or OLOF-2. T7 DNA polymerase (Pharmacia) was used forDNA elongation.

Nucleotide sequence accession numbers. The EMBL/Gen-Bank accession numbers of the sequences reported here areZ37512 and Z37513.

RESULTS

Cloning of attB sequences from the Frankia genome. A40-mer oligonucleotide sequence named OL-1, correspondingto the attP site of pSAM2 (3), was radiolabeled and used toscreen for the presence of a complementary sequence in totalDNA from F. alni ArI3 and Frankia strain M2 of genomicspecies 9. Frankia total DNA was single or double digestedwith various enzymes. A single strong hybridization signal wasdetected in all cases (data not shown). For instance, BamHI-Asp718 fragments of about 1 and 3.5 kb were detected for ArI3and M2, respectively. Pieces of agarose liable to contain theseDNA fragments after electrophoresis were cut from the gel,and the DNA was extracted by electroelution. These BamHI-Asp718 DNA fragments were ligated to pUC19 DNA cut bythe same enzymes. The ligated DNA was transformed into E.coli HB101. For each transformation, about 1,000 coloniescontaining pUC19 with inserted DNA fragments were trans-ferred on new plates and blotted onto nylon filters for colonyhybridization with DNA probe OL-1. In each case, fourbacterial colonies gave a strong, unambiguous response. Plas-mid DNA from these clones contained inserts of 1.1 kb forDNA from F. alni ArI3 and 3.5 kb for DNA from Frankiastrain M2. Southern blot experiments confirmed these insertsto be responsible for the hybridization signal. For furtherstudies, two plasmids were chosen: pLOF11, containing theDNA insert from F. alni, and pLOF25, containing the DNAinsert from Frankia strain M2.DNA sequences of attB sites. Restriction maps were estab-

lished for the inserts of pLOF11 and pLOF25 (data not

shown). Southern blots with pLOF11 and pLOF25 DNAs cutwith various restriction enzymes were hybridized with OL-1.This localized the att-like sequence in a 0.4-kb SmaI fragmentof pLOF11 and in a 0.4-kb Asp718-PstI fragment of pLOF25.The 0.4-kb SmaI fragment of pLOF11 was cloned in bothorientations in the SmaI site of M13mpl8. The 0.4-kb Asp718-PstI fragment of pLOF25 was cloned in M13mpl8 andM13mpl9 by using the Asp718 and BamHI sites. The nucle-otide sequences of these two fragments were determined.

In the two sequences, there are highly similar regions ofabout 100 nucleotides (nt) (Fig. 1). Parts of these regions arecomplementary to OL-1. These regions are similar to theidentity segment of the pSAM2 att site (Fig. 1): 46 of 58 nt areidentical in the sequence from F. alni ArI3, and 47 of 58 nt areidentical in the sequence from Frankia strain M2. Comparisonof the two sequences from Frankia species to the attB site fromS. ambofaciens DSM40697 revealed a remarkably conservedregion (74 of 75 nt are identical). This region includes the attidentity segment common to Frankia and Streptomyces spp. andextends 32 nt at the 5' end of this segment, as shown in Fig. 1.This conserved region corresponds to a putative tRNA geneand can be folded into the classical cloverleaf secondarystructure of tRNA (as shown in Fig. 2 for strain ArI3). Thisputative tRNA gene would encode a proline tRNA. It isnoteworthy that the CCA 3'-terminal sequence of these puta-tive tRNAs is encoded by the gene. Apart from this differenceat the 3' end, there is one mismatch between the sequence ofthe putative tRNAPro of Frankia and the Streptomyces se-quence. This change is located in the region corresponding to

3,ACC

5' AC-GG-CG-CG-CG-CT -AG-C TAAT C G C C C ATC GA G G*

CGCG GTGGGTGT iiai C T~C

GCGC TG GTA G AGC-G GT-AT -AC-GG-C

T AT GC GG

FIG. 2. Cloverleaf representation of the putative proline tRNAgene of Frankia strain ArI3. The sequence of the anticodon is5'-CGG-3'. The asterisk indicates the nucleotide variation betweenpSAM2 attP and Frankia attB which produces a recognition site forendonuclease BstBI. The putative proline tRNA gene of each Frankiastrain encodes the CCA 3'-terminal sequence, which is involved in theesterification of the amino acid.

APPL. ENVIRON. MICROBIOL.

pSAM2 INTEGRATION IN FRANKL4 PUTATIVE tRNAPTO GENE 4281

No recombination zone goauP CccaaraXtCgagc2cccacccaa2tt c Ittcgggacgaagaggtcgtgggttc a aatcc:gccaccccgac arQaQaaacaccara gcagg accgtattB GTGTGGCGCAGCTTGGTAGCGCGCTTCG TTCGGGACGAAGAGGTCGTGGGTTC G AATCCCGCCACCCCGAC CAcgcaaagccctggtctcaggctcctauL o caag ccattgc ttcgggacgaagaggtcgtgggttc g aatcccgccaccccgac cacgcaaagccctggtctcaggctcctauR GTGTGGCGCAGCTTGGTAGCGCGCTTCG TTCGGGACGAAGAGGTCGTGGGTTC A AATCCCGCCACCCCGAc oqaaaaacaccato a pcaa

FIG. 3. Comparison of att DNA sequences after integration of pSAM2. auP from pSAM2, attB from F. alni ArI3, attL, and attR are aligned.The DNA sequences corresponding to the putative proline tRNA genes are in capital letters. Nucleotides identical in the four DNA sequencesare boxed, and nucleotides shared between two sequences are underlined. The zone of recombination is indicated.

the loop of the TPC arm in the mature tRNAPrO and createsa recognition site for restriction enzyme BstBI in the FrankiaDNA sequences. The two Frankia sequences are identicalupstream from the putative tRNAPrO gene, but downstreamthere is little similarity (Fig. 1). These putative tRNAPrO genesare both followed by imperfect inverted repeats, which couldform a stable hairpin loop structure (Fig. 1) (AG = -173.3 kJ -

mol-P' for Frankia strain ArI3, and AG = -142.3 LJ * mol-P' forFrankia strain M2, compared with AG = -209.3 UJ * molP- forS. ambofaciens DSM40697). These hairpin loop structuresmight act as transcriptional terminators for the tRNAPro genes.pSAM2 integration in a cloned Frankia attB site. Since the

DNA sequence of attB sites from Frankia spp. showed similar-ities to those reported for Streptomyces spp., the functionalityof one of these sites was assessed. These experiments weredone with the attB from F. alni ArI3. The 1.1-kb Asp718-BamHI fragment of pLOF11 containing the attB region wassubcloned into high-copy-number Streptomyces vector pIJ487.This new construction is named pLOF112. This plasmid wasintroduced into S. lividans JT46. Interspecific mating experi-ments between S. ambofaciens ATCC 15154 and S. lividans-(pLOF112) were then performed by mixing and plating sporesof S. lividans(pLOF112) with a 10-fold excess of spores from S.ambofaciens. During this mating, the pSAM2 plasmid inte-grated in the genome of S. ambofaciens is transferred to S.lividans by conjugation. The S. lividans(pLOF112) exconju-gants were selected for their resistance to streptomycin (due toa chromosomal mutation in S. lividans JT46). The S. lividansexconjugants produced pocks on a lawn of S. lividans JT46,indicating that they all received pSAM2. The pSAM2 plas-mid originating from S. ambofaciens ATCC 15154 is integratedinto the chromosome and is not observed as autonomouslyreplicating molecules. Thus, S. lividans containing pLOF112could have pSAM2 integrated in the attB site of the chromo-some of S. lividans and/or in the Frankia auB site of pLOF112.Since the Frankia attB site is carried by a multicopy plasmid,not necessarily all of these copies are used for integration.About 500 pock-forming S. lividans(pLOF112) exconjugantswere pooled and grown in liquid medium, and their plasmidDNA was extracted. This plasmid preparation was used totransform S. lividans. Transformants were selected for eitherresistance to nosiheptide conferred by the tsr gene carried bypLOF112 or the ability to form pocks because of the presenceof a pSAM2 sequence. Nosiheptide-resistant transformantswere all able to form pocks, showing that they were trans-formed by pLOF112 carrying an integrated copy of pSAM2and not by pLOF112 alone. Conversely, all pock-formingtransformants were shown to be nosiheptide resistant, indicat-ing that they were transformed by pLOF112 carrying anintegrated copy of pSAM2 and not by pSAM2 alone. Study ofthe plasmid preparation by restriction enzyme analysis con-firmed that only one type of pLOF112 carrying an integratedpSAM2 could be detected in this preparation. The restric-

tion patterns obtained were as expected after integration ofone copy of pSAM2 into the attB site of pLOF112. Theplasmid with pSAM2 integrated in pLOF112 was namedpLOF1121.

Site specificity of the recombination event. To ensure thatthe recombination event was site specific and did not occurrandomly in the cloned DNA fragment of F. alni showingsimilarity to pSAM2 attP, we took advantage of the DNAsequence differences between the identity segment of pSAM2attP and Frankia attB sites. Frankia attB and pSAM2 attP sitesshare a well-conserved DNA sequence of 43 bp (identitysegment) showing only one nucleotide difference. This mis-match creates a BstBI restriction site in the Frankia attB siteand separates the identity segment into two parts of 25 and 17bp, respectively. Therefore, random recombination crossoversshould position the nucleotide variation of the BstBI site inattL or attR in proportions approximately equal to 17 of 43 and25 of 43. Otherwise, a site-specific recombination would posi-tion the BstBI site in only one site, either attL or attR.pLOF1121 extracted from a pool of about 100 nosiheptide-resistant, pock-forming S. lividans transformants (as describedpreviously) was analyzed for the position of the BstBI site. Onlyone type of plasmid was detected. The BstBI site was localizedin the affL site. This result was further confirmed by direct

+1R2 auB

tRNA

IR2 attL pSAM2

B&BI

IRI attR

tRNA

FIG. 4. Schematic representation of the integration of pSAM2 intothe F. alni auB site. The putative tRNA gene is represented by anarrow. The black and white boxes represent the att sequences. Invertedrepeats present in the vicinity of att sites are also indicated (IR1 andIR2). Descriptions are given in the text.

VOL. 60, 1994

4282 ALEGRE ET AL.

sequencing of the attL and attR sites after PCR amplification.The sequences of attL and attR are presented in Fig. 3.Comparison of these sequences with those of attP and attBshowed clearly that the site-specific recombination event tookplace in a region of 25 nt (Fig. 3).

After pSAM2 integration, the putative tRNAPrO gene over-laps attR, as shown in Fig. 3 and 4. This gene remains under thecontrol of the chromosomal DNA sequences upstream of theputative start site of transcription. pSAM2 integration changesone nucleotide (associated with the BstBI site described be-fore) of the TTC loop in the putative tRNAPr, gene of F.alni. The CCA sequence at the 3' end of the Frankia puta-tive tRNAs is no longer encoded by the putative tRNAPrO geneafter pSAM2 integration. The transcription termination signalsof the Frankia putative tRNAPrO genes are separated from thetRNA gene by the entire pSAM2 sequence after its integration(Fig. 4). Other inverted repeats are present in pSAM2 nearattP. After pSAM2 integration, these inverted repeats are lo-cated near attR, close to the end of the putative tRNAPrO gene.They can form a stem-loop structure whose stability (AG =-163.7 kJ - mol-1) is comparable to that of the previousstructure (AG = -173.3 kJ * mol- 1) and that may well play therole of a transcriptional terminator.

DISCUSSION

Frankia spp. are nitrogen-fixing root nodule-forming actino-mycetes. The interactions of Frankia spp. with plants stronglyaffected their evolution. Their speciation is directly related totheir symbiotic properties (7). To identify and understand thekey events involved in the emergence of the various phyloge-netic lineages observed in Frankia spp., tools for the study ofthe molecular genetics of these microorganisms must bedeveloped. In this context, the efficacy of Frankia putativeattachment sites for pSAM2 integration was investigated withS. lividans.The pSAM2 attachment sites of two Frankia species have

been isolated and characterized. As described for Streptomycesand Mycobacterium spp. (11, 19), these sites overlap putativeproline tRNA genes. The 3'-terminal CCA sequence is en-coded by both Frankia genes. Amino acids are esterified to theribose of the terminal adenosine of the CCA 3' sequence.Usually, tRNA genes of actinomycetes do not encode thissequence. Among 18 tRNA genes characterized in S. lividans,only 1 encodes the 3'-terminal CCA sequence (31). Since othertRNA gene sequences from Frankia spp. are not available, it isnot possible to know if this is a general characteristic of thesebacteria.The two Frankia attB sites are highly similar over a region of

about 100 nt. This region encompasses a putative tRNAPr,gene (77 nt) and part of the sequence upstream. The twosequences differ downstream from the putative tRNAPrO gene.The identity segment, i.e., the sequence identical betweenpSAM2 attP and Frankia attB, is 43 nt long (with one mis-match) and spans from the sequence corresponding to the loopof the anticodon to the 3' end of the tRNA gene. This isshorter than the identity segment observed between pSAM2attP and S. ambofaciens DSM40697 attB. In the latter case, theidentity segment is 58 nt long and extends beyond the 3' end ofthe tRNAPro gene. Nevertheless, the Frankia attB site wasefficiently used by pSAM2 for site-specific integration. Thisindicates that elements essential for integration are not locateddownstream from the tRNAPro gene. For SLP1, a conjugativeintegrating element from S. coelicolor, an identity segment of112 nt has been found (17). The 88 nt downstream of theidentity segment are also not required for site-specific integra-

tion. Vogtli and Cohen (37) recently positioned the recombi-nation site of SLP1 in a region of attB which overlaps thesequence between the TPC loop and the anticodon of atRNATYr gene.tRNA genes frequently serve as integration sites for pro-

karyotic genetic elements, and the identity segment oftenextends from the anticodon loop through the 3' end of thegene (6, 27). The crossover point has been localized for someelements and been observed in the 5'-end portion of theidentity segment. Our results are in agreement with thisobservation. In the Frankia attB site, the recombination eventwas shown to occur in a 25-nt-long sequence going from theanticodon loop to the TPC loop. pSAM2 integration wasinvestigated only for the cloned attB site of F. alni ArI3, but asthe two sequences reported here are highly similar, it isreasonable to predict the same site-specific integration in theattB sites of the other Frankia genomic species studied.The work presented here is a first step towards the integra-

tion of pSAM2-based vectors into the Frankia chromosome. Inthese organisms, the use of integrative vectors may circumventsome of the problems related to the use of replicative vectors.Since it is now possible to introduce foreign DNA into Frankiaspp. by electroporation (8, 9), and since we have shown herethat the Frankia attB site is functional in S. lividans, the mainproblems to be solved to get pSAM2 integration in Frankiaspp. are (i) heterologous expression of the pSAM2 int gene,whose product is necessary for integration, (ii) the potentialrequirement of a host integration factor, and (iii) the possiblelethal effect of pSAM2 integration. Concerning heterologousexpression of the int gene, if expression in Frankia spp. fromthe int promoter is not achieved, it should be possible tointroduce a Frankia promoter upstream from this gene. Pro-moters in Frankia spp. were recently characterized (10). Con-cerning the second point, it is not known if host factors arerequired for pSAM2 integration. Such factors would not bedetected here, since the functionality of the Frankia attB sitewas tested only in a Streptomyces sp. It is noteworthy thatpSAM2 site-specific integration has been observed in a widerange of Streptomyces species and in a Mycobacterium sp. (18,35). Moreover, site-specific integration of pSE211, an integrat-ing element from Saccharopolyspora erythraea, was observed inE. coli (14). This recombination was promoted by pSE211integrase and was not affected by a deletion in himA, the geneencoding a subunit of the integration host factor (required forA site-specific integration in E. coli). From these observations,it is most likely that host factors are either not required forpSAM2 integration or conserved among a wide range ofbacteria.The third point concerns the potential lethal effect of

pSAM2 integration on the Frankia putative tRNA gene. In asituation in which the gene would be the only one to encode aCCG proline tRNA, any modification in the expression or inthe transcript should be lethal to the bacteria. This CCG codonhas the highest frequency of appearance among the prolinecodons in the Frankia genes reported (24, 25, 28). According tothis work, pSAM2 integration will introduce a mismatch in thetRNAPrO sequence and the CCA 3'-terminal sequence will nolonger be encoded by the gene. pSAM2 integration will notseparate the tRNA gene from its normal promoter but willchange the inverted repeat able to form a stem-loop structureto another inverted repeat. These inverted repeats should forman equivalent terminator-like structure. Such modificationscan affect the expression of a tRNA gene or the processing ofthe primary transcript necessary to obtain a functional tRNA.Nevertheless, pSAM2 can be modified to maintain the struc-ture of this putative gene in Frankia spp. For example, by in

APPL. ENVIRON. MICROBIOL.

pSAM2 INTEGRATION IN FRANKIA PUTATIVE tRNAPro GENE 4283

vitro mutagenesis, three nucleotides in the attP sequence canbe modified to obtain a putative tRNAPrO gene with a CCA3'-terminal sequence.

ACKNOWLEDGMENTS

B. Cournoyer is thankful for FCAR (Quebec, Canada) and NSERCawards (Canada). This work was partly supported by a French-Spanish"action integree."

REFERENCES1. Berry, A., and T. G. Torrey. 1979. Isolation and characterization in

vivo and in vitro of an actinomycetous endophyte from Alnus rubraBong, p. 69-83. In J. C. Gordon, C. T. Wheeler, and D. A. Perry(ed.), Symbiotic nitrogen fixation in the management of temper-ature forests. Oregon State University, Corvallis.

2. Biggin, M. D., T. J. Gibson, and G. F. Hong. 1983. Buffer gradientgels and 35S label as an aid to rapid DNA sequence determina-tion. Proc. Natl. Acad. Sci. USA 80:3963-3965.

3. Boccard, F., T. Smokvina, J.-L. Pernodet, A. Friedmann, and M.Guerineau. 1989. Structural analysis of loci involved in pSAM2site-specific integration in Streptomyces. Plasmid 21:59-70.

4. Boccard, F., T. Smokvina, J.-L. Pernodet, A. Friedmann, and M.Guerineau. 1989. The integrated conjugative plasmid pSAM2 ofStreptomyces ambofaciens is related to temperate bacteriophages.EMBO J. 8:973-980.

5. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementationanalysis of the restriction and modification of DNA in Escherichiacoli. J. Mol. Biol. 41:459-471.

6. Campbell, A. M. 1992. Chromosomal insertion sites for phages andplasmids. J. Bacteriol. 174:7495-7499.

7. Cournoyer, B., M. Gouy, and P. Normand. 1993. Molecular phylog-eny of the symbiotic actinomycetes of the genus Frankia matcheswith host-plant infection processes. Mol. Biol. Evol. 10:1303-1316.

8. Cournoyer, B., and P. Normand. 1992. Relationship betweenelectroporation conditions, electropermeability and respiratoryactivity for Frankia strain ACN14a. FEMS Microbiol. Lett. 94:95-100.

9. Cournoyer, B., and P. Normand. 1992. Electropermeabilization ofFrankia intact cells to plasmid DNA. Acta Oecol. 13:369-378.

10. Cournoyer, B., and P. Normand. 1994. Gene expression inFrankia: characterization of promoters. Microbios 78:229-236.

11. Eiglmeier, K., N. Honore, and S. T. Cole. 1991. Towards theintegration of foreign DNA into the chromosome of Mycobacte-rium leprae. Res. Microbiol. 142:617-622.

12. Fernandez, M. P., H. Meugnier, P. A. D. Grimont, and R. Bardin.1989. Deoxyribonucleic acid relatedness among members of thegenus Frankia. Int. J. Syst. Bacteriol. 39:424-429.

13. Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton,H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H.Schrempf. 1985. Genetic manipulation of Streptomyces: a labora-tory manual. John Innes Foundation, Norwich, United Kingdom.

14. Katz, L., D. P. Brown, and S. Donadio. 1991. Site-specific recom-bination in Eschenichia coli between the att sites of plasmidpSE211 from Saccharopolyspora erythraea. Mol. Gen. Genet. 227:155-159.

15. Kieser, H. M., D. J. Henderson, C. W. Chen, and D. A. Hopwood.1989. A mutation of Streptomyces lividans which prevents in-traplasmid recombination has no effect on chromosomal recom-bination. Mol. Gen. Genet. 220:60-64.

16. Lechevalier, M. P. 1989. Actinomycetes with multilocular spo-rangia, p. 2405-2417. In S. T. Williams, M. E. Sharpe, and J. G.Holt (ed.), Bergey's manual of systematic bacteriology. The Wil-liams & Wilkins Co., Baltimore.

17. Lee, S. C., C. A. Omer, M. A. Brasch, and S. N. Cohen. 1988.Analysis of recombination occurring at SLP1 att sites. J. Bacteriol.170:5806-5813.

18. Martin, C., P. Mazodier, M. V. Mediola, B. Gicquel, T. Smokvina,C. J. Thompson, and J. Davies. 1991. Site-specific integration ofthe Streptomyces plasmid pSAM2 in Mycobacterium smegmatis.Mol. Microbiol. 5:151-157.

19. Mazodier, P., C. J. Thompson, and F. Boccard. 1990. The chro-mosomal integration site of the Streptomyces element pSAM2

overlaps a putative tRNA gene conserved among actinomycetes.Mol. Gen. Genet. 222:431-434.

20. Messing, J., R. Crea, and P. H. Seeburg. 1981. A system forshotgun DNA sequencing. Nucleic Acids Res. 9:309-321.

21. Murry, M. A., M. S. Fontaine, and J. G. Torrey. 1984. Growthkinetics and nitrogenase induction in Frankia sp. HFP ArI3 grownin batch culture. Plant Soil 78:61-78.

22. Nazaret, S., B. Cournoyer, P. Normand, and P. Simonet. 1991.Phylogenetic relationships among Frankia genomic species deter-mined by use of amplified 16S rDNA sequences. J. Bacteriol.173:4072-4078.

23. Nazaret, S., P. Simonet, P. Normand, and R. Bardin. 1989.Genetic diversity among Frankia isolated from Casuarina nodules.Plant Soil 118:241-247.

24. Normand, P., M. Gouy, B. Cournoyer, and P. Simonet. 1992.Nucleotide sequence of niJD from Frankia alni strain ArI3:phylogenetic inferences. Mol. Biol. Evol. 9:436-447.

25. Normand, P., P. Simonet, and R. Bardin. 1988. Conservation of nifsequences in Frankia. Mol. Gen. Genet. 213:238-246.

26. Pernodet, J.-L., J.-M. Simonet, and M. Guerineau. 1984. Plasmidsin different strains of Streptomyces ambofaciens: free and inte-grated forms of plasmid pSAM2. Mol. Gen. Genet. 198:35-41.

27. Reiter, W.-D., P. Palm, and S. Yeats. 1989. Transfer RNA genesfrequently serve as integration sites for prokaryotic genetic ele-ments. Nucleic Acids Res. 17:1907-1914.

28. Rochefort, D. A., and D. R. Benson. 1990. Molecular cloning,sequencing, and expression of the glutamine synthetase II (glnII)gene from the actinomycete root nodule symbiont Frankia sp.strain CpIl. J. Bacteriol. 172:5335-5342.

29. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-ratory Press, Cold Spring Harbor, N.Y.

30. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencingwith chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA74:5463-5467.

31. Sedlmeier, R., T. Werner, H. M. Kieser, D. A. Hopwood, and H.Schmieger. 1994. tRNA genes of Streptomyces lividans: new se-quences and comparison of structure and organization with thoseof other bacteria. J. Bacteriol. 176:5550-5553.

32. Simonet, P., A. Capellano, E. Navarro, R. Bardin, and A. Moiroud.1984. An improved method for lysis of Frankia with achromopep-tidase allows detection of new plasmids. Can. J. Microbiol. 30:1292-1295.

33. Simonet, P., M.-C. Grosjean, A. K. Misra, S. Nazaret, B.Cournoyer, and P. Normand. 1991. Frankia genus-specific charac-terization by polymerase chain reaction. Appl. Environ. Microbiol.57:3278-3286.

34. Simonet, P., P. Normand, A. Moiroud, and M. Lalonde. 1985.Restriction enzyme digestion patterns of Frankia plasmids. PlantSoil 87:49-60.

35. Smokvina, T., F. Boccard, J. Hagege, M. Luzzati, A. Friedman,J.-L. Pernodet, and M. Guerineau. 1990. Applications of theintegrated plasmid pSAM2, p. 403-412. In H. Heslot, J. Davies, J.Florent, L. Bobichon, G. Durand, and L. Penasse (ed.), Proceed-ings of the 6th International Symposium on Genetics of IndustrialMicroorganisms. Societe Francaise de Microbiologie, Paris.

36. Tsai, J. F.-Y., and C. W. Chen. 1987. Isolation and characterizationof Streptomyces lividans mutants deficient in intraplasmid recom-bination. Mol. Gen. Genet. 208:211-218.

37. Vogtli, M., and S. N. Cohen. 1992. The chromosomal integrationsite for the Streptomyces plasmid SLP1 is a functional tRNATYrgene essential for cell viability. Mol. Microbiol. 6:3041-3050.

38. Ward, J. M., G. R. Janssen, T. Kieser, M. J. Bibb, M. J. Buttner,and M. J. Bibb. 1986. Construction and characterization of a seriesof multi-copy promoter-probe vectors for Streptomyces using theaminoglycoside phosphotransferase gene from TnS as indicator.Mol. Gen. Genet. 203:468-475.

39. Winship, P. R. 1989. An improved method for directly sequencingPCR amplified material using dimethyl sulfoxide. Nucleic AcidsRes. 17:1266.

40. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide sequencesof the M13mpl8 and pUC19 vectors. Gene 33:103-119.

VOL. 60, 1994