forensics lab report

Abstract

The Alu family of short interspersed repeated DNA elements are distributed

throughout primate genomes. They are the most abundant transponons in the

human genome, accounting for 10% of its mass. It has previously been established

that Alu polymorphisms TPA-25, Angiotensin Converting Enzyme (ACE), YaNBC51a

and YaNBC182 are a useful indicators of genetic variation between individuals and

populations and thus are beneficial in forensic analysis.

The aim of this study is to screen the Forensics DNA analysis class 2008, along with

2 unknown samples, for the insertion/deletion of Alu polymorphisms and to compare

this with external populations. The Alu polymorphisms used are ACE, TPA-25,

YaNBC51, YaNBC182 and AluSTYa.

The Chelex method was used to extract DNA, which was then amplified by PCR and

viewed on a transilluminator. Analysis included calculations of allele and genotype

frequencies, heterzygosities, match probabilities and discriminative probabilities,

profile frequencies and likelihood ratios, and an evaluation of the Hardy-Weinberg

Equilibrium (HWE).

In the class population only ACE polymorphism did not exist in HWE, whereas all

markers in the pooled population were in HWE. Both class and pooled data had a

discrimination power of 0.98 which concludes that there is a potential power of 98%

to discriminate between two individuals chosen at random. Sample 39, with a profile

frequency of 0.026 was the most common with a likelihood ratio of 39 to 1. This

concludes that within our class a higher percentage of people will have a similar

profile frequency as sample 39.

Alus are found to be useful in forensic analysis as they are less laborious and

therefore cheaper to use, they have a low mutation making them a unique event

polymorphism.

1

A677310, A657895, A671788, A672415

Introduction

Alu polymorphisms are the most abundant transposable elements in the human

genome, accounting for approximately 10% of the total genome (Watkins, Rogers,

Ostler et al., 2003). Bi-allelic and 300 base pairs (bp) long, they arise by transposing

into a new location and are a member of the short interspersed nuclear elements

family (SINE). Their name is derived from the presence of a single recognition site

for endonuclease AluI (Kass, 2003).

In forensic analysis, Alu polymorphisms are preferred over VNTRs and RFLPs as

unlike the latter two, Alus are PCR able. The low mutation rate of Alus makes them

unique event polymorphisms and robust markers, making them useful in forensics

analysis (Gasper, 2004). They are also less laborious and cheaper to use than other

polymorphisms.

The most commonly studied Alus areTPA-25 and ACE, both of which are human

specific (Batzer et al. 1996) and belong to the Ya5/8 subfamilies (Roy et al. 2000).

As they have retroposed relatively recently they have not yet been fixed at specific

loci on chromosomes (Batzer et al. 1994).

TPA-25 is a tissue plasminogen activator gene, located on chromosome 8, which

has one 400bp allele for insertion of the element and one 100bp allele for deletion.

As it is highly dimorphic amongst humans and the allele frequencies of TPA-25 vary

in different human populations, this gene is particularly useful in forensic analysis

(Kass, 2003). Characterized by the presence or absence of a 287-bp AluI-repeat

sequence inside intron 16 (Feng, et al., 2002), the ACE gene is situated on

chromosome 17 and converts angiotensin-I to angiotensin-II.

Determination of gender from human DNA samples is important in forensic analysis.

This can be done by the identification of X-Y homologous Alu insertions method

which relies on the fixed nature of elements and the amplification of the DNA

material as part of the PCR process of Alu detection. AluSTRya primers have been

shown to be accurate markers for gender determination (Hedges et al, 2002). For

this reason AluSTRYa primers will be used to amplify Alu-filled site fragments of

528bp for the Y chromosome and an Alu empty site of 199bp for the X chromosome.

2

A677310, A657895, A671788, A672415

Additionally, it is also recommended that AluSTXa on the X chromosome is used

(Mastana, 2008), however will not be for this study.

Aims

The aim of this study is to screen the Forensics DNA analysis class 2008, along with

2 unknown samples, for the insertion/deletion of Alu polymorphisms and to compare

this with external populations. The Alu polymorphisms used are ACE, TPA-25,

YaNBC51, YaNBC182 and AluSTYa. A class database will be created which can

then be analysed and compared with a pool of the UK Caucasian population.

Unknown samples will also be analysed using the pooled database.

Method

Subjects

The study compromised of 67 undergraduate students from the 2008 Forensic DNA

analysis class at Loughborough University. Each individual was given an ID number,

which was used to label the 1.5ml microfuge tubes. 1 ml of RNAse/DNAse free water

was added into each the microfuge tube using a pipette.

Individuals wiped the inside of their cheek with a cytology cotton swab to dislodge

loose cells. The swab was then rotated vigorously in the microfuge tube, and stirred

periodically for 30 minutes at room temperature to free collected cells. Two 4 x 3mm

diameter punches of the bloodstained filter paper were provided (unknown samples -

see Appendix1).

DNA from collected cells and unknown samples were successfully extracted using

the Chelex method (Appendix 2).

Maximum amount of supernatant was extracted from each sample without disturbing

pellet/filter paper and then transferred into a clean labelled centrifuge tube. 0.2ul

PCR tubes were labelled with ID numbers and corresponding master mix ID. 20µl of

relevant master mix was transferred to the labelled PCR tubes. 5µl of the extracted

DNA were added and gently mixed together.

3

A677310, A657895, A671788, A672415

Genotyping

The samples were then amplified using multiplex PCR, which uses more than one

set of primers in one reaction. Reactions were carried out using the appropriate

mastermixes containing specific primers for the Alu polymorphism being analysed

(Appendix 3). (Mastermixes for PCR reactions can be found in Appendix 4). Two

duplex PCR reactions were used for autosomal loci (one for Alu polymorphisms

ACE/TPA25 and another for 182/51A) and a third reaction amplified the gender

allele. Samples were then placed in a thermal cycler (Appendix 5) for DNA

amplification.

Products of PCR were then separated using gel electrophoresis using a 2% agarose

gel set in a mould containing wells (preparation shown in Appendix 6). Combs were

put in place, and Ethidium Bromide TBE was poured into the electrophoresis tank

covering the gel in 1-2 mm of solution. After the combs were removed, a reference

sample containing the investigated alleles with known fragment sizes was inserted,

creating a ladder to allow for identification of band sizes. 10µl of samples were then

inserted into the wells and electrophoresed for 30 minutes at 100volts. Gels were

then viewed on a transilluminator to visualise the bands.

Class genotypes were scored visually by comparison to a DNA ladder and

transferred to a database.

Materials- 20% Chelex, PCR Master Mix, RNAse/ DNAse free water, Control

Sample, Agarose, Ethidium Bromide/SYBR Safe Dye, Tris Boric EDTA (TBE) buffer

pH8.3

Statistical Analysis

For each polymorphism, allele frequencies were calculated using gene counting

method and are shown with standard errors. Chi square statistics were used to

consider deviations from Hardy-Weinberg. To analyse allele diversity of the class,

observed and expected heterozygosities were calculated. Random match

probabilities were calculated for each database along with discriminative probability,

and compared to the pooled data. To determine the probability of the genotypes

occurring in the pooled and class database, profile frequencies and likelihood ratios

were calculated for the individual samples within our group and our unknown 4

A677310, A657895, A671788, A672415

samples (samples 36-41). However the unknown samples were not included in the

databases constructed as they were unrepresentative of the class population.

Results

Figure 1 - Band detection of ACE and TPA-25

Participant

No

L 36 37 38 39 40

(unknown)

41

(unknown)

ACE DD II ID ID ID II

TPA25 II DD DD DD DD ID

Figure 2 - Band detection of 182 and 51A

Participant

No

L 36 37 38 39 40

(unknown)

41

(unknown)

182 ID ID - ID - DD

51A DD DD - II - DD

Figure 3 – Band detection for gender

5

A677310, A657895, A671788, A672415

Participant

No

L 36 37 38 39 40

(unknown)

41

(unknown)

Gender F F F F F M

Figures 1-3 show electrophoresis images which show the band detection of the

polymorphisms of four participants and two unknown samples. The table beneath

each displays the genotypes observed in relation to the ladder (L).

Table 1 - comparison of class an pooled data of TPA25

TPA-25 Class (n=67) Pooled (n=138)

Genotype frequencyII ID DD II ID DD

0.239 0.493 0.269 0.217 0.435 0.348

Allele frequencyI D

I D

0.485 0.515 0.435 0.565

Standard Error 0.043 0.043 0.03 0.03

In Hardy-Weinberg

EquilibriumX2=0.013 X2=1.837

Df=1, CV=3.84 In HWE In HWE

Observed Heterozygosity 0.493 0.435

Expected Heterozygosity 0.5 0.491

Match Probability 0.372 0.357

Probability of Discrimination 0.628 0.643

Table 2 - comparison of class an pooled data of ACE

ACE Class (n=64) Pooled (n=114)


0.172 0.25 0.578 0.211 0.482 0.307

Allele frequencyI D

I D

0.297 0.703 0.452 0.548

Standard Error 0.04 0.04 0.033 0.033

6

A677310, A657895, A671788, A672415

In Hardy-Weinberg


Df=1, CV=3.84 Not HWE In HWE





Table 3 - comparison of class an pooled data of 51A

51A Class (n=60) Pooled (n=134)


0.3 0.383 0.317 0.269 0.433 0.299

Allele frequencyI D

I D

0.492 0.508 0.485 0.515

Standard Error 0.046 0.046 0.031 0.031

In Hardy-Weinberg







Table 4 - comparison of class an pooled data of 182

182 Class (n=57) Pooled (n=135)


0.193 0.526 0.281 0.185 0.481 0.333

Allele frequency I D I D

7

A677310, A657895, A671788, A672415

0.456 0.544 0.426 0.574

Standard Error 0.047 0.047 0.03 0.03

In Hardy-Weinberg







Table 5 – Combined Match Probability and Discrimination of Class and Pooled data

Class Pooled

Combined Match Probability 0.021 0.017

Combined Probability of

Discrimination Value

0.979 0.983

% discriminatory 97.90% 98.30%

Table 6 - Profile Frequency and Likelihood ratio of class and pooled data.

Sample 36 Sample 37

Sample

38

Sample

39

Unknown

40

Unknown

41

TPA25 DD II ID ID ID II

ACE II DD DD DD DD ID

51A ID ID - ID - DD

182 DD DD - II - DD

Profile

Freq(Class) 0.003 0.017 0.247 0.026 0.247 0.008

Likelihood

Ratio(Class) 289.428 58.142 4.049 38.932 4.049 133.191

8

A677310, A657895, A671788, A672415

Profile Freq

(Pooled) 0.011 0.009 0.148 0.013 0.148 0.008

Likelihood Ratio

(Pooled) 93.164 106.902 6.769 74.693 6.769 122.215

Gender F F F F F M

Class Data

The most frequent genotype for Alu polymorphism TPA25, 51a & 182 was ID. Whilst

the most frequent for ACE was DD. For all STR's, allele D was most frequent. The

STR whose expected heterozygosity matched closest with observed heterozygosity

was TPA25. For ACE & 51a, the expected heterozygosity was higher than the

observed, whereas for 182 the observed was higher than the expected.

From the χ2 value we can conclude that with 95% confidence, all STRs except ACE

exist on HWE.

The combined match probability is 0.021, giving a probability of discrimination value

0.979. This database can thus be said to be 97.9% discriminatory.

The combined match probability for the class population is 0.021, indicating that

there is a 2.1% chance of two randomly selected individuals sharing the same

genotype for all four polymorphisms. The discrimination power is 0.979 concluding

that there is a potential power of 97.9% to discriminate between two individuals

chosen at random.

9

A677310, A657895, A671788, A672415

Pooled Data

For every STR, the highest genotype frequency was ID and the most common allele

was D.

Expected heterozygosity was higher than observed heterozygosity for all STRs

however in each case, it was only by a small amount.

All STRs were found to be in HWE as all χ2 values were below the critical value (95%

confidence).

The combined match probability was calculated to be 0.017 giving rise to a combined

probability discrimination value of 0.983. Therefore this database can be said to be

98.3% discriminatory.

Pooled data shows similar results with a combined match probability of 0.017 and a

discrimination power of 0.983, giving a potential power of 98.3% to discriminate

between two random individuals. These high discriminatory values conclude that the

calculations are reliable.

Discussion

Calculations of allele frequencies showed that ACE was the only polymorphism

which did not exist in HWE. For a population to exist in HWE, several assumptions

should be met. These include random mating, no mutation or selection, no migration

and infinitely large population (Goodwin, Linacre, Hadi, 2007).

Our class population violates many of these assumptions. Firstly, it is not a randomly

selected population. Secondly, humans also violate the assumption of random

mating. Our class was also comprised of many individuals who had migrated to this

area. As a result of this, we would not expect our χ2 values to be in HWE. Looking at

our class data however, ACE is the only polymorphism which is not in HWE. This

can be explained due to the fact that our population was so small (n=67) that it was

not a good representation of the proportions of subgroups that it was comprised of.

All the polymorphisms in the pooled data existed in HWE. This was to be expected

due to the fact that the majority of these individuals belonged to the same population

(UK Caucasian) and this population size was also larger (UK caucasian n=138).

10

A677310, A657895, A671788, A672415

Research has found that there are differences in allele frequencies amongst different

ethnicities (Ishigami, 1995). Our class population is comprised of different ethnicities.

This explains why, for each polymorphism, the difference between observed and

expected heterozygosity varies.

From the pooled results the expected heterozygosity values for the all the

polymorphisms are higher than the observed heterozygosity indicating that these

STRs may be useful as genetic markers in forensics.

From our own samples, sample 38 had the highest profile (0.247) frequency giving a

likelihood ratio of 4 to 1. However this only accounts for two polymorphisms, ACE

and TPA 25, as results for 51a and 182 were inconclusive. If we were to exclude this

sample and look only at fully conclusive samples, sample 39, with a profile frequency

of 0.026 was the most common with a likelihood ratio of 39 to 1. Sample 36 has the

lowest profile frequency 0.003 and a likelihood ratio of 289 to 1. This concludes that

within our class a higher percentage of people will have a similar profile frequency as

sample 39. Within the pooled population, excluding the sample with inconclusive

results, sample 39 has the highest profile frequency (0.013) and therefore a

likelihood ratio of 75 to 1. Sample 37 had the lowest profile frequency (0.009) and a

likelihood ratio of 107 to 1. Three out of four of our known samples had higher

likelihood ratio in the class population compared to pooled population. This could be

the result of analyzing a very small and diverse population. When analyzing the

marker for gender, all our known samples were correctly identified as being female.

This provides us with confidence that the process of determining the gender of

unknown samples was reliable. However the accuracy of gender determination can

be improved by analyzing the markers AluSTXa with AluSTYa. (Mastana, 2007).

Some of the samples did not produce eligible results on the gel electrophoresis for

particular markers. This may have been due to contamination of samples, errors

made while preparing samples or errors made during the preparation of materials for

electrophoresis.

The advantages of using Alus in forensic analysis compared to other polymorphisms

include that they are less laborious and therefore cheaper to use, they have a low

mutation making them a unique event polymorphism (Gasper, 2004).

11

A677310, A657895, A671788, A672415

Appendices

Appendix 1- Blood Stained Filter Paper (Unknown Samples)

a. You have been provided with 4 x 3mm diameter punches of the bloodstained

filter paper (your unknown sample)

b. Pipette 1ml of RNAse/DNAse free water into the tube.

c. Incubate at room temperature for 30 minutes.

d. Vortex mix for 5 seconds.

e. Centrifuge in a microcentrifuge at 13 000rpm for 2 minutes.

f. Without disturbing the pellet, carefully remove the supernatant, leaving

enough behind (20-30µl) to cover the pellet without disturbing it. If the

sample is a bloodstain on filter paper/material, leave the filter paper/material

substrate in the tube with the pellet.

12

A677310, A657895, A671788, A672415

Appendix 2 – Chelex Method

a. Use 20% Chelex (w/v) prepared previously. Keep the solutions homogenous

using a magnetic stirrer.

b. Remove and discard the brush from the tube.

c. Vortex the sample for 5 seconds.

d. Centrifuge the sample for 2 mins @ maximum speed. Discard the

supernatant, leaving approx. 20-30µl residual fluid.

e. Add 170ul of 20% Chelex (w/v) to give a final volume of 200µl and incubate

30 mins @ 56°C (water bath).

f. Vortex (10 secs) and place in Dry Block (~ 100 °C) for 8 mins.

g. Vortex again and centrifuge for 3 mins @ max speed (13000 RPM).

h. Label a fresh microfuge tube with your ID number.

i. Remove supernatant to a clean labelled 1.5ml microfuge tube.

Appendix 3 - The oligonucleotide primers used in the duplex PCR reactions.

Alu I.D. Primer 1 (5’-3’) Primer 2 (5’-3’) +

Alu

-

Alu

Chr.

No

ACE ctggagaccactcccatcctttct gatgtggccatcacattcgtca

gat

490 190 17

TPA25 gtaagagttccgtaacaggaca

gct

ccccaccctaggagaacttct

cttt

400 100 8

Ya5NBC51

Aa

tttccttacatctagtgcccc cctccaagtaaagctacaccc

t

652 355 3

13

A677310, A657895, A671788, A672415

Ya5NBC18

2

gaaggactatgtagttgcagaag

c

aacccagtggaaacagaag

atg

563 287 7

AluSTYa catgtatttgatggggatagagg ccttttcatccaactaccactga 528 199 Y

Appendix 4- Mastermix components

Component ACE/TPA25 Master

Mix

182/51A Master Mix Gender ID Mix

(AluSTYa)

Buffer 75mM Tris-Hcl buffer pH 8.8

dNTPs 0.2M each of dATP, dCTP, dTTP, dGTP

Taq Taq DNA polymerase enzyme (1.25 units)

MgCl2 2.5mM 2.5mM 1.5mM

Primers

Forward-1 ACE-F 0.18M 182-F 0.1M AluSTYa-F 0.2M

Reverse-1 ACE-R 0.18M 182 –R 0.1M AluSTYa-R 0.2M

Forward-2 TPA25-F 0.18M 51A-F 0.24M

Reverse-2 TPA25-R 0.18M 51A-R 0.24M

Sterile 18M H2O

Precipitant and red dye for electrophoresis

Appendix 5- Thermal Cycling Conditions

Thermal Cycling Conditions

14

A677310, A657895, A671788, A672415

Initial Denature 1 cycle of 3 mins

@940C

1 cycle of 3 mins

@940C

1 cycle of

2 mins 30 secs

@940C

Cycles 32 cycles of 32 cycles of 32 cycles of

Denature 1 min @940 C 1 min @940 C 1 min @940 C

Anneal 1 min @550C 1 min @550C 1 min @580C

Extension 1 min @720C 1 min @720C 1 min @720C

Followed by Final

Cycle

5 min @720C 5 min @720C 10 min @720C

Cooling to 40C. Cooling to 40C. Cooling to 40C.

Appendix 6 – 2% Agarose Gel Preparation

Weigh 2g of agarose and place into a 250ml conical flask.

Add 100ml, 1X ethidium bromide -TBE pH8.3 and cover with cling film.

Pierce the cling film and swirl the mixture before placing in a microwave for 1minute.

Remove and swirl again. If the solution has not gone clear then heat for a further 1

minute, checking that the solution has not boiled over.

Allow the agarose to cool to hand hot and gently pour into the mould, with the combs

in place and allow to set (Approximately 30 minutes).

References

Batzer, M.A., Arcot, S.S., Phinney, J.W., Alegria-Hartman, M., Kass, D.H.,

Milligan,S.M., Kimpton, C., Gill, P., Hochmeister, M., Ioannou, P.A., Herrera, R.J.,

Boudreau, D.A., Scheer, W.D., Keats, B.J., Deininger, P.L., Stoneking, M., 1996.

Genetic variation of recent Alu insertions in human populations. Journal of Molecular

Evolution, 42, pp. 22-29.

15

A677310, A657895, A671788, A672415

Batzer, M.A., Stoneking, M., Alegria-Hartman, M., Bazan, H., Kass, D.H., Shaikh,

T.H., Novick, G.E., Ioannou, P.A., Scheer, W.D., Herrera, R.J., 1994. African origin

of human-specific polymorphic Alu insertions. Proceedings of the National Academy

of Sciences of the United States of America, 91(25), pp.12288-12292.

Feng, Y., Niu, T., Chen, C., Li, Q., Qian, R., Wang, G., Xu, X.,2002. Insertion/Deletion

Polymorphism of the ACE Gene Is Associated With Type 2 Diabetes. Diabetes, 51,

pp.1986-1988.

Gasper, P., Seixas, S., Rocha, J., 2004. Genetic Variation in a Compound Short

Tandem Repeat/Alu Haplotype System at the SB19.3 Locus: Properties and

Interpretation. Human Biology, 76(2), pp.277-287.

Goodwin, W., Linacre, A., Hadi, S., An introduction to Forensic Genetics.

Sussex:Wiley.

Hedges, D.J., Walker, G.A., Callinan, P.A., Shewale, G.A., Sinha,

S.K.,Batzer, M,A., 2003. Mobile element-based assay for human gender

determination. Analytical Biochemistry, 312, pp. 77–79.

Kass, D.H., Generation of Human DNA profiles by Alu-based multiplex polymerase

chain reaction. Analytical Biochemistry, 321, pp.146-149.

Mastana, S.S., 2008. Laboratory Protocol. Forensic DNA Analysis.

Roy, A.M., Carroll, M.L., Kass, D.H., Nguyen, S.V., Salem, A.H., Batzer, M.A.,

Deininger, P.L., 1999. Recently integrated human Alu repeats: finding needles in the

haystack. Genetica, 107(1-3), pp.149-161.

Watkins, W.S., Rogers, A.R., Ostler, C.T., Wooding, S., Bamshad, M.J., et al., 2003.

Genetic variation among world populations: Inferences From 100 Alu insertion

polymorphisms. Genome, 13, pp.1607-1618.

16

A677310, A657895, A671788, A672415

forensics lab report

Documents