fraction of citations within patents that are to non-patent documents a copy of this presentation is...
TRANSCRIPT
![Page 1: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/1.jpg)
Fraction of citationswithin patents that areto non-patent documents
A copy of this presentation is available at http://www.divshare.com/download/83012-a1c
![Page 2: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/2.jpg)
6.3%6.3% 6.4%6.4%
43%43%
total patentstotal citations to
other patentstotal citations to non-patents
Life science's share of...
![Page 3: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/3.jpg)
GovernmentGovernment Companies/Companies/UniversitiesUniversities
literature
publicfunding
![Page 4: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/4.jpg)
NIHNIH
GovernmentGovernment Companies/Companies/UniversitiesUniversities
literature!
literature
publicfunding
![Page 5: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/5.jpg)
GovernmentGovernment Companies/Companies/UniversitiesUniversities
patentdisclosure
monopoly
![Page 6: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/6.jpg)
??
GovernmentGovernment Companies/Companies/UniversitiesUniversities
patentdisclosures !
monopoly
patentdisclosures
![Page 7: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/7.jpg)
![Page 8: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/8.jpg)
<PubmedArticle> <MedlineCitation Owner="NLM" Status="MEDLINE"> <PMID>16051143</PMID> <DateCreated> <Year>2005</Year> <Month>07</Month> <Day>29</Day> </DateCreated> <DateCompleted> <Year>2005</Year> <Month>09</Month> <Day>20</Day> </DateCompleted> <DateRevised> <Year>2006</Year> <Month>11</Month> <Day>15</Day> </DateRevised> <Article PubModel="Print"> <Journal> <ISSN IssnType="Print">0092-8674</ISSN> <JournalIssue CitedMedium="Print"> <Volume>122</Volume> <Issue>2</Issue> <PubDate> <Year>2005</Year> <Month>Jul</Month> <Day>29</Day> </PubDate> </JournalIssue> <Title>Cell</Title> <ISOAbbreviation>Cell</ISOAbbreviation> </Journal> <ArticleTitle>Stochastic gene expression in a
lentiviral positive-feedback loop: HIV-1 Tatfluctuations drive phenotypic diversity.
</ArticleTitle> <Pagination>
![Page 9: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/9.jpg)
Pubmed
![Page 10: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/10.jpg)
CTTCATCAATTATCGTACTCTTGTTAATGTGGTAAAATATAAACTGGACCACATGAGAAGAAGAATTGAGACCGATGAGAGAGATTCGACCAACCGGGCTTCCTTCAAATGTCCTGTCTGTAGTAGTACTTTCACAGACTTAGAAGCTAATCAGCTCTTTGATCCTATGACAGGAACTTTCCGCTGTACTTTTTGCCATACAGAGGTAGAAGAGGATGAATCAGCAATGCCCAAAAAAGATGCACGCACACTTTTGGCAAGGTTTAATGAACAAATTGAGCCCATTTATGCATTGCTTCGGGAGACAGAGGATGTGAACTTGGCCTATGAAATACTTGAGCCAGAACCCACAGAAATCCCAGCCCTGAAACAGAGCAAGGACCATGCAGCAACTACTGCTGGAGCTGCTAGCCTAGCAGGTGGGCACCACCGGGAAGCATGGGCCACCAAAGGTCCTTCCTATGAAGACTTATACACTCAGAATGTTGTCATTAACATGGATGACCAAGAAGATCTTCATCGAGCCTCACTGGAAGGGAAATCTGCCAAAGAGAGGCCTATTTGGTTGAGAGAAAGCACTGTCCAAGGGGCATATGGTTCTGAAGATATGAAAGAAGGGGGCATAGATATGGACGCATTTCAGGAGCGTGAGGAAGGCCATGCTGGGCCACCAAAGGTCCTTCCTATGAAGACTTATACACTCAGAATGTTGTCATTAACATGGATGACCAAGAAGATCTTCATCGAGCCTCACTGGAAGGGAAATCTGCCAAAGAGAGGCCTATTTGGTTGAGAGAAAGCACTGTCCAAGGGGCATATGGTTCTGAAGATATGAAAGAAGGGGGCATAGATATGGACGCATTTCAGGAGCGTGAGGAAGGCCATGCTGAGAAGGGGGCATAGATATGGACGCATTTCAGGAGC
![Page 11: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/11.jpg)
![Page 12: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/12.jpg)
![Page 13: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/13.jpg)
Genome
Graphic stolen from NIH/NLM/NCBI
![Page 14: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/14.jpg)
Pubmed
![Page 15: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/15.jpg)
![Page 16: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/16.jpg)
![Page 17: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/17.jpg)
How can we patch the patent literature into this existingcyberinfrastructure in the life sciences?
![Page 18: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/18.jpg)
![Page 19: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/19.jpg)
![Page 20: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/20.jpg)
![Page 21: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/21.jpg)
![Page 22: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at](https://reader036.vdocuments.net/reader036/viewer/2022070415/5697bf911a28abf838c8e660/html5/thumbnails/22.jpg)
Pubmed
A copy of this presentation is availableat http://www.divshare.com/download/83012-a1c