611Research Article

IntroductionPrimary cilia, the hair-like microtubule-based organelles found on

the majority of human cell types, have gained attention recently

owing to their involvement in a multitude of sensory processes,

signaling pathways and genetic disorders (Davis et al., 2006;

Davenport and Yoder, 2005; Marshall and Nonaka, 2006; Satir and

Christensen, 2007; Singla and Reiter, 2006). These non-motile cilia

are now implicated in most physiological sensory modalities,

including chemosensation, olfaction, mechanosensation,

photoreception and thermosensation (Davis et al., 2006; Davenport

and Yoder, 2005; Perkins et al., 1986; Satir and Christensen, 2007;

Tan et al., 2007). Primary cilia not only capture and transduce

environmental stimuli, but also have key roles in the transduction

of Wnt, Hedgehog and PDGFRαα signaling pathways (Christensen

et al., 2007; Eggenschwiler and Anderson, 2007; Gerdes et al., 2007;

Breunig et al., 2008). Moreover, ciliary assembly and disassembly

are coordinated intimately with the cell cycle (Pan and Snell, 2007;

Quarmby and Parker, 2005). In humans, defects in the sensory and

signaling functions of primary cilia lead to numerous developmental

disorders that collectively affect the renal, cardiac, hepatic,

pancreatic, skeletal, visual, nervous, olfactory and auditory systems

(Badano et al., 2006; Bisgrove and Yost, 2006; Tan et al., 2007).

Numerous cilia-associated disorders (ciliopathies) have been

described, including Bardet-Biedl syndrome (BBS), Meckel

syndrome (MKS) and polycystic kidney disease (PKD) (reviewed

by Pazour and Rosenbaum, 2002; Badano et al., 2006; Bisgrove

and Yost, 2006; Blacque and Leroux, 2006; Christensen et al., 2007;

Hildebrandt and Otto, 2005).

Meckel syndrome is a rare autosomal recessive disorder

characterized by central nervous system malformations

(encephalocele), polydactyly, renal cysts and hepatic ductal

dysplasia and cysts (Alexiev et al., 2006; Badano et al., 2006).

Numerous lines of evidence have defined MKS as a ciliopathy,

although the nature of the ciliary defect is unclear. The recently

identified MKS1 protein (Kyttälä et al., 2006), for example,

localizes to basal bodies, which are the centriolar structures required

for nucleating eukaryotic cilia. Together with a second identified

MKS-associated protein, MKS3/meckelin (Smith et al., 2006),

Meckel syndrome (MKS) is a ciliopathy characterized by

encephalocele, cystic renal disease, liver fibrosis and polydactyly.

An identifying feature of MKS1, one of six MKS-associated

proteins, is the presence of a B9 domain of unknown function.

Using phylogenetic analyses, we show that this domain occurs

exclusively within a family of three proteins distributed widely

in ciliated organisms. Consistent with a ciliary role, all

Caenorhabditis elegans B9-domain-containing proteins, MKS-

1 and MKS-1-related proteins 1 and 2 (MKSR-1, MKSR-2),

localize to transition zones/basal bodies of sensory cilia. Their

subcellular localization is largely co-dependent, pointing to a

functional relationship between the proteins. This localization

is evolutionarily conserved, because the human orthologues also

localize to basal bodies, as well as cilia. As reported for MKS1,

disrupting human MKSR1 or MKSR2 causes ciliogenesis

defects. By contrast, single, double and triple C. elegans

mks/mksr mutants do not display overt defects in ciliary

structure, intraflagellar transport or chemosensation. However,

we find genetic interactions between all double mks/mksrmutant combinations, manifesting as an increased lifespan

phenotype, which is due to abnormal insulin–IGF-I signaling.

Our findings therefore demonstrate functional interactions

between a novel family of proteins associated with basal bodies

or cilia, providing new insights into the molecular etiology of a

pleiotropic human disorder.

Supplementary material available online at

http://jcs.biologists.org/cgi/content/full/122/5/611/DC1

Key words: Meckel syndrome, Cilia, Basal body, Ciliopathy, Insulin,

Signaling

Summary

Functional interactions between the ciliopathy-associated Meckel syndrome 1 (MKS1) protein andtwo novel MKS1-related (MKSR) proteinsNathan J. Bialas1,*, Peter N. Inglis1,*, Chunmei Li1,*, Jon F. Robinson2, Jeremy D. K. Parker1, Michael P. Healey1, Erica E. Davis2, Chrystal D. Inglis1, Tiina Toivonen3, David C. Cottell3, Oliver E. Blacque4,Lynne M. Quarmby1, Nicholas Katsanis2,5,6 and Michel R. Leroux1,‡

1Department of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, BC V5A 1S6, Canada2McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA3Electron Microscopy Laboratory and 4School of Biomolecular and Biomedical Science, UCD Conway Institute, University College Dublin, Belfield,Dublin 4, Ireland5Department of Molecular Biology and Genetics, and 6Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205,USA*These authors contributed equally to this work‡Author for correspondence (e-mail: leroux@sfu.ca)

Accepted 20 October 2008Journal of Cell Science 122, 611-624 Published by The Company of Biologists 2009doi:10.1242/jcs.028621

Jour

nal o

f Cel

l Sci

ence

612

MKS1 is reported to have a role in basal body migration to the

apical membrane, and thus, ciliogenesis (Dawe et al., 2007). A third

protein implicated in MKS, NPHP6/CEP290/MKS4/BBS14, also

localizes to basal bodies, but its molecular function is unclear (Baala

et al., 2007; den Hollander et al., 2006; Leitch et al., 2008; Sayer

et al., 2006; Valente et al., 2006). RPGRIP1L (MKS5), also

implicated in Joubert syndrome, is a basal body protein that

interacts with the nephronophthisis-associated NPHP-4 protein;

although it is not required for cilium formation, it has an important

(and presumably cilium-based) role in Hedgehog signaling (Arts

et al., 2007; Delous et al., 2007; Vierkotten et al., 2007). Most

recently, two other proteins, NPHP3 (Bergmann et al., 2008), and

CC2D2A (MKS6), whose function is unknown but is associated

with the formation of cilia (Tallila et al., 2008), were found to be

disrupted in MKS patients.

The MKS1 protein contains no domains of recognized function.

Nonetheless, it does harbor a predicted so-called ‘B9’ domain of

undetermined function (Kyttälä et al., 2006). Two additional highly

conserved proteins containing B9 domains, referred to in mammals

as B9D1 and B9D2, can also be identified. We previously reported

that all three putative B9 protein orthologues in the nematode

Caenorhabditis elegans (R148.1/xbx-7, K03E6.4 and Y38F2AL.2)

are found solely in ciliated sensory neurons and possess X-box

sequences in the upstream promoter sequences of their associated

genes that are regulated by the ciliogenic transcription factor DAF-

19 (Blacque et al., 2005; Efimenko et al., 2005). These observations

are consistent with comparative genomic analyses of ciliated versus

non-ciliated organisms (Avidor-Reiss et al., 2004; Li et al., 2004a),

as well as the recent discovery that two of the Drosophilamelanogaster B9-domain-containing genes are also X-box regulated

(Laurençon et al., 2007), collectively implicating all three proteins

in ciliary function(s). This notion is also supported by the recent

finding that the murine B9D2 gene is abrogated in the stumpymutant, which is characterized by impaired ciliogenesis, cystic

kidneys and hydrocephalus (Town et al., 2008). Disruption of stumpyin this mouse model was further shown to be required for the

proliferation and neurogenesis of astrocyte-like neural precursor

(ALNP) cells, probably as a result of dramatically downregulated

cilium-dependent sonic hedgehog (Shh) signaling (Breunig et al.,

2008).

In C. elegans, defects in proteins implicated in cilia structure

and/or function have been associated with various sensory

phenotypes (Bae and Barr, 2008; Inglis et al., 2007; Perkins et

al., 1986; Scholey, 2008). For example, abrogation of the C.elegans orthologues of two proteins associated with the transition

zone/basal body and linked to nephronophthisis, NPHP-1 and

NPHP-4, leads to chemosensation, male mating, and various

axonemal and intraflagellar transport (IFT) defects (Jauregui and

Barr, 2005; Jauregui et al., 2008; Winkelbauer et al., 2005; Wolf

et al., 2005); disruption of BBS proteins results in partially

truncated cilia as well as chemo- and thermo-sensory phenotypes

(Blacque et al., 2004; Ou et al., 2005; Tan et al., 2007). Notably,

cilium- and/or basal-body-associated sensory inputs are transduced

by at least one major signaling pathway in the nematode, namely

the insulin–IGF-I pathway, which regulates longevity (Apfeld and

Kenyon, 1999). Hence, many basal body or cilium mutants,

including nphp-1 and nphp-4, as well as strains with defects in

the IFT process required for building all cilia (e.g. osm-5, che-11, ifta-2, etc.), display increased lifespans, indicative of impaired

ciliary signaling (Apfeld and Kenyon, 1999; Schafer et al., 2006;

Winkelbauer et al., 2005).

Williams et al. (Williams et al., 2008) recently reported on the

analysis of the three B9-domain-containing proteins found in C.elegans. Using GFP-tagged variants, they observed interdependent

localization of the proteins to ciliary transition zones (akin to basal

bodies), and as such, named the proteins encoded by Y38F2AL.2and K03E6.4 ‘ciliary transition zone associated’ protein-1 and

protein-2 (TZA-1 and TZA-2), respectively. Disruption of any of

the three respective proteins did not result in overt changes to ciliary

morphology nor in any specific behavioral or sensory abnormalities,

with the exception of a subtle foraging behavior phenotype.

Interestingly, unlike disruption of stumpy in mammals, C. eleganstransition zone positioning and ciliogenesis was only impaired by

further disruption of nphp-1 or nphp-4, suggesting a genetic

redundancy in the system.

In the present study, we investigated the molecular basis of

Meckel syndrome by characterizing in further detail the three C.elegans and human B9-domain-containing proteins. Our

phylogenetic analyses demonstrate that B9-domain-containing

proteins are invariably absent from non-ciliated organisms but co-

occur as a family of three different proteins with orthologues in

nearly all ciliated species. We show that the C. elegans MKS-1,

MKSR-1 and MKSR-2 proteins localize to transition zones/basal

bodies in a largely interdependent manner, and that the subcellular

localization to basal bodies is evolutionarily conserved for the

human B9 protein counterparts. Knockdown of the human MKSR1and MKSR2 genes using RNA interference (RNAi) leads to a

ciliogenesis defect, which is similar to that reported for MKS1 by

Dawe et al. (Dawe et al., 2007). By contrast, rigorous analysis of

IFT or cilia ultrastructure by electron microscopy for each of the

single, double and triple C. elegans mks/mksr gene mutants showed

no clear defects compared with the wild-type animals. However,

all double mks/mksr gene mutant combinations revealed genetic

interactions between the different family members that are

manifested by an increased lifespan dependent on the DAF-2

(insulin–IGF-I receptor)–DAF-16 (FOXO transcription factor)

pathway. Together, our data reveal that a highly conserved family

of three proteins functionally interact at basal bodies or cilia to

support ciliogenesis in human cells and a cilium-associated

signaling process in C. elegans. Based on our present study, we

propose a unified nomenclature that captures the evolutionary and

functional relatedness of the three proteins, namely Meckel

syndrome 1 (MKS-1) and MKS1-related proteins 1 and 2 (MKSR-

1 and MKSR-2).

ResultsAn evolutionarily conserved family of B9-domain-containingproteins in ciliated organismsThe identification of C. elegans xbx-7/R148.1, K03E6.4 and

Y38F2AL.2 as genes expressed exclusively in ciliated cells initially

provided evidence that they might encode proteins with important

ciliary functions (Blacque et al., 2005; Efimenko et al., 2005).

Moreover, the presence of a single B9 domain of unknown function

in each of these three proteins hinted at the potential significance

of this protein motif, a notion that was strongly reinforced following

the cloning of the Meckel-syndrome-associated MKS1 gene, the

human orthologue of xbx-7/R148.1 (Kyttälä et al., 2006). On this

basis, we conducted comprehensive searches of sequence databases

to identify all possible proteins harboring the B9 domain. Without

exception, we failed to find B9-domain-containing proteins in

prokaryotes or in eukaryotes lacking cilia, such as Saccharomycescerevisiae, Dictyostelium discoideum and Arabidopsis thaliana

Journal of Cell Science 122 (5)

Jour

nal o

f Cel

l Sci

ence

613Meckel syndrome 1 and related proteins

(supplementary material Table S1). In the vast majority of fully

sequenced ciliated organisms queried (21 in total), however, we

uncovered three different proteins containing a single B9 domain.

The only exceptions were the moss Physcomitrella patens, the

parasitic species Giardia lamblia and the apicomplexan Plasmodiumfalciparum, which have no recognizable B9-domain-containing

proteins, and the free-living Tetrahymena thermophila, Parameciumtetraurelia and Chlamydomonas reinhardtii, which contain a fourth

family member that probably arose from an independent gene

duplication (supplementary material Table S1).

Using amino acid sequence alignments of B9 domains obtained

from a comprehensive list of species chosen to represent the major

eukaryotic groupings outlined previously (Keeling et al., 2005), we

derived phylogenetic trees of B9-domain-containing proteins. The

neighbour-joining algorithm of ClustalW (Higgins et al., 1994) and

the Bayesian phylogeny inference program MrBayes (Huelsenbeck

Fig. 1. Phylogenetic analysis showing that B9-domain-containing proteins from ciliated organisms belong to a family of proteins consisting of three clades orfamily members, namely Meckel Syndrome 1 protein (MKS-1), MKS-1-related protein 1 (MKSR-1) and MKS-1-related protein 2 (MKSR-2), and sequencecomparisons of different B9 domains. (A) Phylogenetic tree of B9-domain-containing proteins from several diverse ciliated eukaryotes. Support for nodes(posterior probabilities) are indicated by blue (1.0), green (>0.9) or red (>0.8) circles. The MKS-1, MKSR-1 and MKSR-2 protein families are shown in blue, greenand red, respectively. Scale bar denotes 0.1 substitutions per site. Bd, Batrachochytrium dendrobatidis; Ce, Caenorhabditis elegans; Cb, Caenorhabditis briggsae;Cr, Chlamydomonas reinhardtii; Dm, Drosophila melanogaster; Dr, Danio rerio; Hs, Homo sapiens; Mm, Mus musculus; Sp, Strongylocentrotus purpuratus; Tb,Trypanosoma brucei; Thaps, Thalassiosira pseudonana; Xl, Xenopus laevis. Supplementary material Table S1 provides the full listing of proteins (with accessionnumbers) considered in the analysis. (B) Multiple amino acid sequence alignment of 22 B9 protein domains from eight different species. MKS-1, MKSR-1 andMKSR-2 protein sequence names are colored blue, green and red, respectively. Dark blue highlights signify sequences that match the consensus sequence. Lightblue sequences do not match the consensus sequence, but have a positive Blosum62 score. Conservation values for each residue are calculated based on identitiesand conserved physicochemical properties between different amino acid residues in each column. Quality is a measurement of the likelihood of mutations in eachcolumn; lower quality signifies greater likelihood of mutations, if any, present between sequences. Species abbreviations are as above except for Tt, Tetrahymenathermophila.

Jour

nal o

f Cel

l Sci

ence

614

and Ronquist, 2001) were used independently on the protein

alignments to generate the trees. Each method produced essentially

identical phylogenies that group the sequences into three clades,

which we named MKS-1, MKSR-1 and MKSR-2 (the Bayesian

tree is shown in Fig. 1A). These analyses demonstrate that proteins

containing B9 domains are evolutionarily ancient; specifically, the

diversity of organisms represented in each clade shown in the tree

suggests that the gene duplications that led to the three clades

preceded the speciation events resulting in the emergence of major

eukaryotic lineages, the last common ancestor of which is inferred

to be ciliated (Richards and Cavalier-Smith, 2005).

We found that although the MKSR-1 and MKSR-2 family

members typically consist of little more than the B9 domain,

members of the MKS-1 clade were larger in size, with poorly

conserved regions outside of the B9 domain that sometimes contain

other domains (for example, in the Drosophila and ChlamydomonasMKS-1 proteins). These observations suggest that the B9 domain

is critically important for the function(s) of the proteins. An amino

acid sequence alignment of 22 B9 domains from MKS-1, MKSR-

1 and MKSR-2 proteins across six different species, shown in Fig.

1B, reveals sequence conservation throughout the ~115 residue

domain, where some residues are invariant in >90% of the

sequences.

All three B9-domain-containing proteins localize to basalbodies and/or ciliaThree human proteins associated to date with Meckel syndrome

(MKS1, CEP290/NPHP6/MKS4 and RPGRIP1L) localize to the

basal body at the base of the cilium, and a fourth, MKS3/Meckelin,

is distributed along the length of the cilium (Arts et al., 2007; Dawe

et al., 2007; Delous et al., 2007; Keller et al., 2005; Sayer et al., 2006;

Valente et al., 2006; Vierkotten et al., 2007). These findings, which

are consistent with MKS being a ciliopathy, led us to examine the

subcellular localization of all three human B9-domain-containing

proteins in a ciliated mouse cell line (IMCD3) derived from the inner

medullary collecting duct of the kidney. We confirmed the localization

Journal of Cell Science 122 (5)

Fig. 2. MKS-1, MKSR-1 and MKSR-2 proteinslocalize to centrosomes or basal bodies in humancells and transition zones in C. elegans.(A,B) IMCD3 cells transiently expressingconstructs encoding V5 epitope-tagged humanMKS1, MKSR1 (EPPB9/B9D1) and MKSR2(LOC80776/B9D2), are shown in the top, middleand bottom panels, respectively. In ciliated IMCD3cells (A), the V5-tagged MKS1, MKSR1 andMKSR2 proteins (red) colocalize with thecentrosomal γ-tubulin marker (green), as seen inthe merged images (yellow denotes overlap insignals). Cilia are labeled with an antibody againstacetylated tubulin (also green). In ciliated IMCD3cells stably expressing GFP-tagged versions of theMKS1, MKSR1 and MKSR2 proteins (green) (B),colocalization is observed with the acetylatedtubulin antibody (red), which highlights the ciliaryaxoneme. Arrows denote centrosomes or basalbodies; brackets show the ciliary axoneme.(C) GFP-tagged C. elegans MKS-1, MKSR-1 andMKSR-2 localize specifically to transition zones(akin to basal bodies) in ciliated sensory neurons.Transition zone staining near the tip of the head(left panels) at the base of amphid cilia and nearthe tail of the animal at the base of phasmid cilia(right panels) are indicated with arrowheads andare shown enlarged in the insets. The relativepositions of cilia, transition zones and dendritesare shown in some of the images. Scale bar: 5 μm(insets magnified �3).

Jour

nal o

f Cel

l Sci

ence

615Meckel syndrome 1 and related proteins

of a transiently-expressed, V5-epitope-tagged version of MKS1 to

the basal body in ciliated cells (Fig. 2A, top panels), and to

centrosomes in non-ciliated IMCD3 cells (supplementary material

Fig. S1) by co-staining with γ-tubulin (a centriolar marker) alone or

in combination with acetylated α-tubulin (a ciliary marker). The

previously uncharacterized human MKSR1 (B9D1) and MKSR2

(B9D2) proteins, also tagged with the V5 epitope and expressed

transiently, showed the same localization to basal bodies in ciliated

IMCD3 cells (Fig. 2A, middle and bottom panels, respectively), and

to centrosomes in non-ciliated IMCD3 cells (supplementary material

Fig. S1). The localization to centrosomes in non-ciliated cells is

consistent with the proposed pre-ciliogenic function(s) of MKS1 in

centriolar migration (Dawe et al., 2007), and the recent differential

localization of the murine stumpy protein (MKSR2) to basal bodies

or cilia (Town et al., 2008). Interestingly, in contrast to the transiently

transfected IMCD3 cells, versions of all three GFP-tagged B9

proteins produced from stably transfected IMCD3 cells localized to

the ciliary axonemes (Fig. 2B). These results suggest, along with the

findings of Town et al. (Town et al., 2008), that the B9 proteins can

localize differentially to the basal body alone or to the ciliary axoneme.

To investigate whether the colocalization of the three B9-domain-

containing proteins at basal bodies or cilia is evolutionarily conserved,

and to initiate a functional analysis of the three proteins in a

genetically tractable system, we generated transgenic C. elegansstrains harboring GFP-tagged versions of the respective protein

orthologues. The three expression constructs included the endogenous

promoter for each gene (encompassing the X-box regulatory element),

as well as the entire coding region fused in-frame to GFP at the C-

terminus (see supplementary material Fig. S2A for the gene

structures). Similar to our previous findings using promoter-GFP

(transcriptional) fusion constructs (Efimenko et al., 2005; Blacque et

al., 2005), the three mks/mksr transgenes were expressed specifically

in most, if not all ciliated cells, including the amphid and phasmid

sensory neurons. More notable, however, was that the three GFP-

tagged proteins (MKS-1, MKSR-1 and MKSR-2) localized

specifically to transition zones at the base of cilia (Fig. 2C), which

are akin to the basal bodies of other species (Perkins et al., 1986).

For each amphid bundle, we were able to observe up to ~12 transition

zones as fluorescent ‘spots’ near the head of the animal; for the

phasmid sensory neurons situated near the tail, two pairs of transition

zones could be seen (individual pairs are shown in Fig. 2C). This

localization pattern is equivalent to that observed for the mammalian

orthologues (supplementary material Fig. S1) except that the latter

proteins could also associate with the ciliary axonemes (Fig. 2B)

(Town et al., 2008). Of note, our findings confirm the localization of

the C. elegans proteins recently reported by Williams et al. (Williams

et al., 2008); furthermore, the C. elegans NPHP-1 and NPHP-4

proteins, whose respective genes interact with the mks/mksr genes,

also localize specifically to transition zones (Jauregui et al., 2005;

Winkelbauer et al., 2005; Williams et al., 2008).

Together, our findings establish that all B9-domain-containing

proteins associate with, and presumably function at, basal bodies

in two highly divergent species (humans and nematodes); in

humans, ciliary localization is also observed, suggesting two

potentially distinct regions of localization and thus, function. These

data, combined with our phylogenetic analysis revealing an

essentially strict co-occurrence of the three proteins in ciliated

organisms and absence from non-ciliated species (Fig. 1A;

supplementary material Table S1), raise the distinct possibility that

all MKS-1, MKSR-1 and MKSR-2 proteins share a common ciliary

function at the base of the organelle and within the cilium itself.

Interdependent localization of MKS-1, MKSR-1 and MKSR-2to basal bodiesOn the basis that all three C. elegans B9-domain-containing proteins

can be observed at transition zones/basal bodies, we hypothesized

that the proteins form a functional complex and that their localization

might be co-dependent. To test this possibility, we examined the

localization of the three individual C. elegans GFP-tagged MKS-

1, MKSR-1 and MKSR-2 proteins in each of their two

complementary mks/mksr mutant backgrounds.

To perform this study, we first obtained from the National

BioResource Project (NBRP, University of Tokyo, Japan) strains

with deletions in each of the respective mks-1/xbx-7, mksr-1/tza-2 and mksr-2/tza-1 genes; the three gene models and their lesions,

as deduced by RT-PCR analysis of the transcripts, are shown in

supplementary material Fig. S2A,B. In the Y38F2AL.2/mksr-2(tm2452) strain, the mutant allele encodes a protein roughly half

the size of the wild type, resulting from a significant truncation

(approximately 50 residues) within the B9 domain. In the case of

the xbx-7/mks-1(tm2705) mutant strain, the deletion results in the

splicing of exon 2 with exon 5, ultimately generating a protein

lacking approximately 70 residues in the N-terminal region, but

does not abrogate any of the B9 domain. Finally, in the

K03E6.4/mksr-1(tm3083) strain, mis-splicing results in the

inclusion of nucleotides 1032-1057 into the transcript, which then

fuse in-frame to nucleotide 1276 of exon 3 (at the start of the 3�flanking sequence of the deletion). The predicted MKSR-1 protein

encoded by this allele is one amino acid larger than the wild type,

and possesses a distinct 18 amino acid alteration to the B9 domain

(the sequences of which are shown in supplementary material Fig.

S2B). Although the possibility exists that all three deletion mutants

(tm2452, tm2705, tm3083) are hypomorphs rather than null

mutants, in two cases (mksr-1 and mksr-2) the B9 domain is

disrupted, and we confirm below that all alleles are associated with

observable protein mislocalization and/or lifespan and signaling

phenotypes.

By carrying out standard genetic crosses, we generated strains

carrying all six possible combinations of MKS-1, MKSR-1 and

MKSR-2 GFP-tagged proteins present in the two complementary

mks/mksr gene mutant backgrounds. Visualization of the MKSR-

1::GFP and MKSR-2::GFP proteins in the mks-1 mutant background

revealed no significant change in localization to the transition zones

compared with that of the wild-type strain, and no unusual or

prominent accumulations along the dendrites (Fig. 3C,E). By

contrast, the MKSR-1::GFP protein showed consistently reduced

or unclear localization to transition zones in the amphid (head) and

phasmid (tail) neurons of mksr-2 mutant animals, and pronounced

accumulations in the dendrites (Fig. 3D). Similarly, MKSR-2::GFP

showed reduced and less distinct signals at the transition zones of

mksr-1 mutants (compared with wild-type animals), although in

many cases the protein could be observed at or near the transition

zones and thus is likely to be only partly mislocalized (Fig. 3F).

The GFP-tagged MKS-1 protein was similarly mislocalized in the

mksr-1 and mksr-2 mutants (Fig. 3A,B); specifically, the protein

was less apparent at the transition zones and was found consistently

along the dendrites in a manner never observed for any of the MKS-

1, MKSR-1 and MKSR-2 proteins in wild-type animals (compare

Fig. 3A,B with Fig. 2C). All analyses were performed at least three

times using >50 worms/strain and blind to the genotype and the

identity of the GFP-tagged protein.

Our data are comparable, but not identical, to those recently

reported by Williams et al. (Williams et al., 2008). Unlike the

Jour

nal o

f Cel

l Sci

ence

616

previous study, which used the ok2092 allele of mksr-1, we were

able to observe at least partial mislocalization of MKSR-2 in the

mksr-1(tm3083) strain. Taken together, these data further

demonstrate that the proper localization of the MKS-1, MKSR-1

and MKSR-2 proteins to transition zones in C. elegans is co-

dependent, suggesting that they interact directly as a hetero-

oligomeric complex or indirectly as part of a larger, functional multi-

subunit complex.

The C. elegans MKS-1, MKSR-1 and MKSR-2 proteins are notessential for transition-zone positioning, cilium formation or IFTfunctionTo date, the majority (but not all) of C. elegans genes regulated

by the X-box-binding DAF-19 transcription factor encode

ciliogenic proteins, meaning that their disruption causes cilia

structure defects; these include Bardet-Biedl syndrome genes

(bbs-1, bbs-7 and bbs-8), and genes encoding core intraflagellar

transport (IFT) components (e.g. che-2, osm-5, osm-6 and che-11), that are collectively required for proper ciliogenesis in

nematodes (Ansley et al., 2003; Swoboda et al., 2000). Because

the three C. elegans mks/mksr genes are X-box regulated

(supplementary material Fig. S2A) (Blacque et al., 2005;

Efimenko et al., 2005), and MKS1 was first shown to be required

for ciliogenesis in mammalian cells (Dawe et al., 2006), we

hypothesized that all of the B9 proteins might be required for

cilium formation in C. elegans, and perhaps more specifically,

regulation of the IFT process. To investigate these possibilities,

we first tested each of the mks-1, mksr-1 and mksr-2 single

mutants for an inability to take up a fluorescent dye, a dye-filling

(Dyf) phenotype that is observed in all bbs and IFT gene mutants

(Inglis et al., 2007). None of the mutant strains displayed a Dyf

phenotype (Fig. 4A; supplementary material Fig. S3A),

suggesting that all possess full-length, environmentally exposed

cilia. To examine the structure of the amphid and phasmid cilia

in the mutants directly, we introduced into these strains several

GFP-tagged ciliary markers (the anterograde IFT motor

components OSM-3-kinesin and the kinesin-associated protein

KAP-1, the IFT protein CHE-2/IFT80 and the dynein light chain

component XBX-2 which is essential for driving retrograde IFT).

Consistent with the results of the Dyf assays, each of the ciliary

proteins localize correctly to the transition zones and cilia, with

no overt accumulations seen in dendrites leading to the transition

zones or within the cilia; taken together, the data provide strong

evidence that the relative positions of the transition zones, and

the ciliary structures, are not different from those of wild-type

animals (Fig. 4B shows the CHE-2::GFP results; data for OSM-

3-kinesin, KAP-1 and XBX-2 are presented in supplementary

material Fig. S4A). In addition, all GFP-tagged proteins appeared

Journal of Cell Science 122 (5)

Fig. 3. Interdependent localization of C.elegans MKS-1, MKSR-1 and MKSR-2proteins to transition zones. (A-F) Thelocalization patterns of GFP-taggedMKS-1, MKSR-1 and MKSR-2 proteinsin the indicated mks-1, mksr-1 or mksr-2mutant strains are shown in both amphid(head) and phasmid (tail) sensoryneurons. Arrowheads indicaterepresentative (individual) transitionzones, and asterisks highlight proteinaccumulations not normally observed forthe GFP-tagged MKS-1, MKSR-1 orMKSR-2 proteins in wild-type animals(see Fig. 2C). The orientations of theanimals are the same for all, i.e. the headis up and the tail is down. Scale bar:5 μm.

Jour

nal o

f Cel

l Sci

ence

617Meckel syndrome 1 and related proteins

Fig. 4. Single, double and triple C. elegans mks/mksr mutants exhibit normal transition zone positioning, ciliary axonemal structures, intraflagellar transport andchemosensory behaviors. (A) The mks/mksr single, double and triple mutants display normal filling of amphid and phasmid neurons with the fluorescent dye diI,indicating that the cilium structure is probably intact and that the ciliary endings are properly exposed to the external environment; representative images for N2(wild-type), bbs-8 mutant (dye-filling defective), mks-1;mksr-1;mksr-2 (triple) mutant, and mks-1;mksr-1;mksr-2;bbs-8 quadruple mutant animals are shown. Filledand hollow arrowheads indicate amphid and phasmid neurons that took up dye, respectively. (B) The GFP-tagged CHE-2 (IFT80) intraflagellar transport proteinlocalizes normally to the transition zones (TZ; arrowhead in each panel) and ciliary axonemes (labeled cilia) in both the head and tail sensory neurons of N2 (wild-type), and mks/mksr single, double and triple mutants, as indicated. All panels are oriented with the head up and tail down. Scale bar: 5μm. (C) The single, doubleand triple mks/mksr mutants exhibit normal intraflagellar transport. Kymographs of N2 and mutants (mks-1;mksr-1;mksr-2 triple mutant and mks-1;mksr-1;mksr-2;bbs-8 quadruple mutant) are shown for the ciliary middle segment (MS) and distal segment (DS) in the amphid (head) cilia using CHE-2::GFP in intraflagellartransport assays. For each strain, fluorescent images of phasmid cilia and the corresponding kymographs (actual kymographs and schematics/traces of particlemovement) for the MS and DS are shown; in the first fluorescent image, the transition zones (TZ) as well as MS and DS are labeled. The table shows themeasurement of CHE-2::GFP rates (in μm/second) in the MS and DS for the indicated strains. n, number of IFT particles measured. Note that the rates of CHE-2::GFP movement in the mks/mksr mutants do not deviate statistically from N2; in the bbs-8 background, CHE-2::GFP moves at the fast unitary rate of OSM-3kinesin in both the MS and DS (Ou et al., 2005). The asterisks in the image indicate CHE-2::GFP accumulations normally observed in the bbs-8 mutantbackground (Blacque et al., 2004). Scale bar: 5 μm. (D) IMCD3 cells cotransfected with GFP and short-hairpin RNAi constructs for MKSR1/B9D1 andMKSR2/B9D2 each show a significant reduction in the number of cilia, as assessed by staining with an acetylated tubulin antibody, in comparison with thosetransfected with GFP alone (control). *P<0.05. (E) The mks/mksr single, double and triple mutants show no statistically significant differences compared with wild-type animals with respect to chemotaxis towards a volatile attractant (isoamyl alcohol) or avoidance of a high-osmolarity solution (8 M glycerol). The osm-5 ciliarymutant, defective in both chemotaxis and osmoavoidance, is included as a positive control. The chemotaxis and osmoavoidance indices are calculated as describedin the Materials and Methods. *P<0.05.

Jour

nal o

f Cel

l Sci

ence

618

to display normal IFT; this was confirmed by observing, using

time-lapse microscopy, the expected (wild-type) rates of

movement of CHE-2::GFP in the middle (~0.7 μm/second) and

distal (~1.2 μm/second) segments of the cilia in the single

mks/mksr mutant animals (Fig. 4C) (reviewed by Blacque et al.,

2008; Inglis et al., 2007; Scholey, 2008). These data are similarly

supported using the OSM-3, KAP-1, and XBX-2 markers

(supplementary material Fig. S4B).

The presence of a common B9 protein domain in the three

proteins raises the possibility that their functions might be at least

partially redundant, where one or more mks/mksr genes may mask

the effect of a disruption in another (mutated) mks/mksr gene. To

address this possibility, we generated all possible double mutant

combinations, as well as the triple mutant. Similar to our

observations for each individual mutant, the double and triple

mks/mksr mutant strains had no observable defects in dye-filling

(supplementary material Fig. 3A; the representative triple mutant

strain is shown in Fig. 4A), or in transition zone positioning, ciliary

structure or IFT, as deduced from observing GFP-tagged CHE-2

and XBX-2 protein localization and transport behavior in live

animals (Fig. 4B,C; supplementary material Fig. S4).

Because of the apparent phenotypic and genotypic overlap

between the Bardet-Biedl and Meckel syndromes (Karmous-

Benailly et al., 2005; Leitch et al., 2008), we sought to test for a

possible genetic interaction between the three mks/mksr genes and

a bbs gene. We therefore generated a quadruple mutant (triple

mks/mksr mutant in a bbs-8 mutant genetic background) harboring

a CHE-2::GFP protein ciliary (IFT) marker and looked for cilia

structure and IFT defects. We found that the ciliary structures of

the quadruple mutant, based on the CHE-2::GFP marker, were

indistinguishable from those of the bbs-8 mutant alone, with nearly

full-length cilia and accumulations at the middle or distal segment

midpoint and at the tip of the truncated cilia (Fig. 4C) (Blacque et

al., 2004). By itself, the bbs-8 mutation has the effect of separating

the IFT machinery into two independently moving subassemblies

consisting of kinesin-II–IFT subcomplex A and OSM-3– kinesin–

IFT subcomplex B (Ou et al., 2005; Ou et al., 2007). In the mks-1;mksr-1;mksr-2;bbs-8 quadruple mutant strain, the localization and

behavior of CHE-2::GFP was indistinguishable from that of the

bbs-8 mutant, wherein it was transported along the length of the

proximal and (partially truncated) distal segments at the fast unitary

rate of OSM-3-kinesin (~1.2 μm/second) (Fig. 4C).

Recently, Jauregui et al. (Jauregui et al., 2008) demonstrated that

abrogation of the transition zone-specific protein NPHP-4 results

in relatively subtle yet significant changes to the microtubule

architecture of ciliary axonemes. We therefore sought to determine

whether similar ultrastructural changes were present in a

representative (mks-1;mksr-1) double mutant, which we demonstrate

(below) has a lifespan/signaling defect. Consistent with the results

of our GFP-based analyses of amphid cilia, transmission electron

microscopy (TEM) observation of cross-sections through the heads

of the mks-1;mksr-1 mutants revealed no significant differences in

the axonemal structures of amphid cilia compared with wild-type

worms (supplementary material Fig. S5). Specifically, the double

mutant exhibited well-formed transition zones, intact doublet

microtubules in the middle segments, and intact singlet microtubules

in the distal segments.

By contrast, we observed that disruption of the mammalian

MKSR1/B9D1 and MKSR2/B9D2 genes by RNAi in IMCD3 cells

caused ciliogenesis defects, namely a smaller proportion of ciliated

cells compared with the control cells (Fig. 4D). These results are

similar to those observed for the knockdown of the MKS1 gene

(Dawe et al., 2007). Hence, it appears that in C. elegans, disruption

of mks/mksr genes is less detrimental to cilium formation until a

‘second-hit’ mutation in nphp-4 or nphp-1 occurs, where transition

zone/basal body and ciliogenesis defects become apparent (Williams

et al., 2008).

Altogether, our data indicate that in contrast to the mammalian

B9-domain-containing proteins, the C. elegans counterparts are

unlikely to be directly implicated in the positioning of transition

zones/basal bodies, or the biogenesis of sensory cilia, or have an

essential role in intraflagellar transport. This raises the possibility

that the C. elegans MKS-1, MKSR-1 and MKSR-2 proteins

participate in other aspect(s) of basal body and/or cilia function that

relate not to the building of, but rather, the sensory/signaling roles

of the ciliary organelle.

Journal of Cell Science 122 (5)

Fig. 5. Genetic interactions between the C. elegans mks-1, mksr-1 and mksr-2genes revealed by an increased lifespan phenotype. (A) The mean lifespans ofthe individual mks-1, mksr-1 and mksr-2 mutant strains (as indicated) areindistinguishable from that of the wild-type (N2) strain. (B) All combinationsof double mutant animals (mks-1;mksr-1, mks-1;mksr-2, and mksr-1;mksr-2)exhibit statistically significant increases in lifespan relative to N2 animals(indicated by <0.0001*). The lifespan of the triple mutant is not statisticallydifferent from that of the N2 strain. (C) mks/mksr double mutant animals haveenhanced lifespans comparable with those of nphp-1 and nphp-4 animals(Winkelbauer et al., 2005) but shorter than that of the long-lived strain with adefect in the CHE-11 intraflagellar transport protein. All graphs showrepresentative experiments, and the tables present mean lifespans ± s.e.Experiments were repeated at least twice and the results were found to bereproducible. *P<0.0001 compared with the wild type.

Jour

nal o

f Cel

l Sci

ence

619Meckel syndrome 1 and related proteins

The C. elegans mks/mksr genes control lifespan via the insulinsignaling pathwayTo investigate the possibility that the C. elegans MKS-1, MKSR-

1 and MKSR-2 proteins have roles in the sensory functions of cilia,

we first tested the three single mks/mksr mutant strains for defects

in their ability to sense and move towards a volatile attractant

(isoamyl alcohol) using an established chemotaxis assay. Although

bbs and IFT mutant animals show clear sensory phenotypes in these

assays (Blacque et al., 2004; Inglis et al., 2007; Perkins et al., 1986),

no significant differences were observed between wild-type (N2)

animals and the single mks/mksr gene mutants (Fig. 4E, light gray

bars). Similarly, we assayed for the ability of the mks/mksr mutant

animals to recognize and avoid a solution of high osmolarity (8 M

glycerol). In this assay, where bbs and IFT gene mutants show

osmoavoidance defects (Inglis et al., 2007; Perkins et al., 1986)

(our unpublished data), the mks/mksr mutant strains exhibited wild-

type osmoavoidance (Fig. 4E, dark gray bars). Given the possibility

of functional overlap between the mks/mksr genes, we also tested

combinations of the double and triple mks/mksr mutant animals;

no defects in chemotaxis or osmoavoidance were observed (Fig.

4E). Likewise, another assay that can reveal cilia function defects

in the nematode – Nile Red staining to determine lipid content (Li

et al., 2008; Mak et al., 2006) – revealed no differences between

control animals and the mks-1, mksr-2 and mks-1;mksr-2 mutants

(supplementary material Fig. S3B).

These data are reminiscent of other C. elegans transition

zone/basal body proteins whose deletion does not overtly or

severely affect cilium formation or IFT, but might instead still be

required for specific sensory and/or signaling capacities of cilia.

Two examples are the homologues of the nephronophthisis-

associated NPHP-1 and NPHP-4 proteins. Their disruption causes

subtle ciliary structure anomalies, as well as male mating defects

and an increased lifespan phenotype, the latter two often being

associated with cilia dysfunction (Jauregui et al., 2005; Winkelbauer

et al., 2005; Wolf et al., 2005). Similarly, disruption of IFTA-2, a

protein associated with the IFT machinery, does not appear to result

in cilia structure or IFT defects but causes an increased lifespan

phenotype (Schafer et al., 2006).

We therefore tested all single and double mks/mksr mutants, as

well as the triple mutant, in ageing assays. None of the single or

triple mutants display alterations to lifespan compared with wild-

type animals (Fig. 5A,B). By contrast, all three double mutant

combinations (mks-1;mksr-1, mks-1;mksr-2 and mksr-1;mksr-2)

displayed statistically significant increases in lifespan when

compared with the single or triple mutants, or wild-type animals

(Fig. 5B). Interestingly, the lifespan increases seen in the mks/mksrdouble mutants were comparable to those of the ifta-2 (data not

shown) (see Schafer et al., 2006) and nphp-1 or nphp-4 (Fig. 5C)

(see also Winkelbauer et al., 2005) ciliary mutants, but were not

as pronounced as those exhibited by some IFT gene mutants, such

as che-11 (Fig. 5C) (see also Apfeld and Kenyon, 1999). Thus,

our genetic and functional analyses of the mks/mksr genes suggest

that, similarly to the nephrocystin proteins NPHP-1 and NPHP-

4, which localize to the transition zones at the base of cilia, the

MKS-1, MKSR-1 and MKSR-2 proteins perform function(s)

relevant to longevity control, suggesting a role in cilia-associated

signaling.

To support this hypothesis, we next tested for an epistatic

interaction between a representative double mutant (mksr-1;mksr-2) and daf-2(e1370). The daf-2 gene encodes the lone receptor

responsible for the well-established insulin–IGF-I signaling pathway

that regulates longevity in C. elegans (Kenyon et al., 1993; Kimura

et al., 1997). Lifespan assays demonstrate that the mksr-1;mksr-2;daf-2 triple mutant exhibits the same longevity as that of the

extremely long-lived daf-2 mutant (Fig. 6A), implying that the B9

proteins function upstream of DAF-2 in the insulin-signaling

pathway. To confirm this result, we tested the epistatic relationships

between all three mks/mksr double mutants and daf-16(mu86), the

gene encoding the FOXO transcription factor required for

downstream DAF-2–insulin–IGF-I-receptor-mediated signaling

(Ogg et al., 1997). All mks/mksr double gene mutants, when

combined by genetic crossing with the daf-16 mutation, displayed

lifespans that were shorter than the mks/mksr double mutants and

Fig. 6. MKS-1, MKSR-1 and MKSR-2 proteins appear to function upstreamof DAF-2 and DAF-16 in the insulin–IGF-I signaling pathway to regulatelifespan. (A) The lifespan of mksr-1;mksr-2;daf-2 triple mutant animals is thesame as that of the long-lived daf-2 mutants, supporting the notion that B9-domain-containing proteins function upstream of the DAF-2 insulin–IGF-Isignaling pathway. *P<0.0001 compared with daf-2. (B) The lifespan of allmks/mksr double mutants is shortened when introduced into a daf-16 mutantbackground, suggesting that the MKS-1, MKSR-1 and MKSR-2 proteinsfunction upstream of the DAF-16 FOXO transcription factor in theinsulin–IGF-I signaling pathway. *P<0.0001 compared with daf-16. (C) Themks/mksr double mutants have increased levels of DAF-16::GFP in thenucleus, consistent with their increased lifespan compared with wild-type (N2)animals and their corresponding single mutants (mks-1 and mksr-1). The osm-5ciliary mutant positive control is impaired in DAF-2 signaling and has anincreased level of nuclear DAF-16::GFP. Animals were categorized as havingmainly cytoplasmic DAF-16::GFP (white bars), intermediate localizationbetween the cytoplasm and nucleus (light gray bars), or mainly nuclearlocalization (dark gray bars); examples of these three localization patterns areshown on the right. *P<0.05 compared with N2.

Jour

nal o

f Cel

l Sci

ence

620

were indistinguishable from that of the short-lived daf-16 mutant

(Fig. 6B). These data support the notion that the B9 proteins function

upstream of DAF-16 in the insulin–IGF-I signaling pathway.

Consistent with the above observations, we observed a direct

effect of disrupting the B9 proteins and the activity of the DAF-16

protein. Within a population of worms at 20°C, DAF-16 is usually

phosphorylated in response to DAF-2 signaling, which leads to its

nearly complete exclusion from the nucleus; however, in long-lived

mutants such as daf-2(e1370) or cilia mutants such as osm-5, the

proportion of animals showing nuclear localization increases

significantly as a result of inhibited daf-2 signaling (reviewed by

Mukhopadhyay et al., 2006). We observed that GFP-tagged DAF-

16 in control animals normally shows ~0.8% localization to the

nucleus, which is similar to that of the mks-1 and mksr-1 single

mutant animals, which have a normal lifespan (Fig. 6C). By contrast,

the mks-1;mksr-1, mks-1;mksr-2 and mksr-1;mksr-2 double mutants

all displayed a statistically significant increase in GFP-tagged DAF-

16 nuclear localization (4-4.8%), and a corresponding decrease in

cytosolic localization, as expected from their increased lifespan

phenotypes (Fig. 6C). In conclusion, our findings strongly support

the notion that the C. elegans MKS-1, MKSR-1 and MKSR-2

proteins functionally interact at the base of cilia to support a process

that is required upstream of the DAF-2/DAF-16 insulin–IGF-I

signaling pathway to specify longevity.

DiscussionA wealth of genomic, transcriptomic and proteomic data have

identified numerous basal body and ciliary proteins, several of which

are implicated in ciliopathies (Gherman et al., 2006; Inglis et al.,

2006; Keller et al., 2005). In this study, we report that B9-domain-

containing proteins uncovered in some of these studies belong to

three separate phylogenetic clades – MKS-1, MKSR-1 and MKSR-

2 – that are found exclusively in ciliated species. The three human

proteins and C. elegans orthologues localize to basal bodies/

transition zones, and, in the case of the mammalian proteins, to the

ciliary axoneme as well. We further demonstrate that the C. elegansproteins function cooperatively at the base of cilia to support the

proper function of the insulin–IGF-I signal transduction pathway

required for the specification of lifespan.

Evolutionary conservation of B9-domain-containing proteins inciliated organismsThe potential significance of the B9 protein domain was highlighted

recently when one of the first two genes linked to Meckel syndrome

MKS1 was identified by Kyttälä et al. (Kyttälä et al., 2006). The

559-residue human MKS1 protein lacks known protein motif(s) or

other recognizable features, but harbors an approximately 115-

residue B9 protein domain of unknown function (Fig. 1B). We

identified in nearly all ciliated organisms, two more members of

the MKS1/B9 protein family, which we name MKS1-related

proteins 1 and 2 (MKSR-1 and MKSR-2). The mutual presence of

three B9-domain-containing proteins in ciliated organisms, and

complete absence from organisms devoid of cilia (Fig. 1A;

supplementary material Table S1), suggests that these proteins

perform common cilia-associated function(s). It is notable that the

MKS-1, MKSR-1 and MKSR-2 proteins are absent from at least

three groups of organisms that possess cilia (the moss

Physcomitrella patens, the Diplomonad Giardia lamblia and the

Apicomplexan Plasmodium falciparum). Interestingly, G. lambliahas a much reduced complement of Bardet-Biedl syndrome proteins

compared with most ciliated organisms, and P. falciparum lacks

IFT and BBS proteins altogether. These observations suggest that

at least in some organisms, the MKS-1, MKSR-1 and MKSR-2

proteins, similarly to the BBS proteins, are not absolutely required

to build motile or non-motile cilia. In addition, MKS-1, MKSR-1

and MKSR-2 proteins might have more specific roles relating to

the sensory and/or signaling functions of cilia.

MKS1, MKSR1 and MKSR2 are associated with basal bodiesand ciliaHuman MKS1 was previously found to localize to basal bodies

(Dawe et al., 2007), as with the Chlamydomonas orthologue POC12

(Proteome of Centriole protein 12) (Keller et al., 2005). We have

confirmed the basal body or centrosomal localization of a transiently

expressed, V5-epitope-tagged version of MKS1 (Fig. 2A;

supplementary material Fig. S1), and further showed the same

subcellular localization for the other two human B9 domain-

containing proteins (Fig. 2A; supplementary material Fig. S1). In

addition, we found that GFP-tagged variants of all B9-domain-

containing proteins localized, in stably transfected cells, to the ciliary

axoneme (Fig. 2B). This dual-localization pattern (basal body and

cilia) is comparable to that of the mouse protein stumpy (MKSR-

2) (Town et al., 2008; Breunig et al., 2008). Importantly, we

confirmed that the localization of the MKS-1, MKSR-1 and MKSR-

2 proteins to basal bodies is evolutionarily conserved by observing

– as recently reported by Williams et al. (Williams et al., 2008) –

that the C. elegans MKS-1, MKSR-1 and MKSR-2 proteins reside

at ciliary transition zones (Fig. 2C), which are akin to basal bodies

(Perkins et al., 1986). The MKS-1, MKSR-1 and MKSR-2 protein

family therefore joins an increasing number of ciliopathy-associated

proteins that concentrate at the base of cilia or to the ciliary axoneme,

including among others the Meckel syndrome, Joubert syndrome

or nephrocystin proteins, RPGRIP1L, CEP290/NPHP6, NPHP1 and

NPHP4.

Function of the MKS-1, MKSR-1 and MKSR-2 proteins inciliogenesis and cilium-associated signalingThe notion that MKS1 is implicated in cilia function received strong

support from a recent study by Dawe et al. (Dawe et al., 2007),

which demonstrated that knockdown of mammalian MKS1,

similarly to the disruption of MKS3, is associated with basal body

positioning and thus ciliogenesis defects. The reason for the basal

body position phenotype remains unclear, but the downstream

effects on renal tubule formation were pronounced. Similarly, very

little is known about the functions of the other two B9-domain-

containing proteins, MKSR1 and MKSR2. Ponsard et al. (Ponsard

et al., 2007) showed that knockdown of ICIS-1 (orthologue of C.elegans mksr-2) by RNAi in Paramecium tetraurelia results in

defects in cilia stability or formation. Another recent study

demonstrated that stumpy (MKSR-2) is required for the proper

biogenesis or morphology of cilia in a mouse knockout model (Town

et al., 2008), and is essential for a Shh-based signaling pathway in

neural stem cells (Breunig et al., 2008). Finally, the Yoder laboratory

(Williams et al., 2008) reported genetic interactions between the

B9-domain genes and the nphp-4 gene (discussed further below).

Using C. elegans to dissect the relationship between, and

functions of, the MKS-1, MKSR-1 and MKSR-2 proteins, we

discovered that the proper localization of the proteins was largely

co-dependent. Specifically, in mksr-1 mutant animals, the MKS-1

and MKSR-2 proteins did not reproducibly show clear, wild-type

localization to the transition zones, and displayed accumulations in

the dendrites (Fig. 3A,F). Similarly, in the mksr-2 mutant strain,

Journal of Cell Science 122 (5)

Jour

nal o

f Cel

l Sci

ence

621Meckel syndrome 1 and related proteins

the MKS-1 and MKSR-1 proteins were also not tightly associated

with the transition zones (Fig. 3B,D). Nevertheless, some partial

localization to, or near, transition zones was often observed,

suggesting either that the disrupted genes encode aberrant truncated

proteins that retain some function or that the proteins can localize

independently, but with lower efficiency. This might be the case

for the mks-1 mutant, where we observe essentially wild-type

localization of MKSR-1 and MKSR-2 proteins (Fig. 3C,E).

Altogether, these data, which are comparable to those recently

reported (Williams et al., 2008), suggest that the three B9-domain-

containing proteins either interact directly, such that the disruption

of one can lead to the mislocalization of the other, or that they are

functionally associated via other transition-zone-localized proteins.

We favour the first possibility, given that a genome-wide C. elegansstudy uncovered a yeast two-hybrid interaction between K03E6.4

(MKSR-1) and Y38F2AL.2 (MKSR-2) (Li et al., 2004b). The

interdependent localization of the C. elegans MKS-1, MKSR-1 and

MKSR-2 proteins provides evidence of a functional relationship

between this family of proteins.

Interestingly, we found that the mks-1, mksr-1 and mksr-2 mutant

strains have no obvious defects in transition zone positioning, ciliary

structures, intraflagellar transport, chemo- and osmo-sensation or

lipid accumulation (Fig. 4A-C,E; supplementary material Figs S3-

S5). As the mks/mksr gene functions could be partly redundant, we

generated the three double mutant combinations as well as a triple

mutant, and tested them for the same ciliary phenotypes; we could

not, however, detect any difference from wild-type animals in these

assays (Fig. 4A-C,E; supplementary material Figs S3-S5). It is

unclear whether the gene deletion mutants available for these studies

represent hypomorphs instead of null mutants, although the

conserved B9 domains of the mksr-1(tm3083) and mksr-2(tm2452)gene mutants are disrupted (supplementary material Fig. S2) and

probably disrupt the function of the proteins. Nevertheless, all

mutant alleles give an observable longevity phenotype when

combined (see below), and we propose that the simultaneous

disruption of the three mks/mksr genes is highly likely to impair

their collective function. In light of our data, it seems possible or

even likely that unlike in mammalian cells (Dawe et al., 2007; Town

et al., 2008) (Fig. 4D), in C. elegans, the MKS-1, MKSR-1 and

MKSR-2 proteins do not perform an essential ciliogenic role (see

also Williams et al., 2008).

However, the possibility remained that the C. elegans mks/mksrgenes are specifically implicated in one or more ciliary signaling

pathways; we were able to test for this possibility in the absence

of potentially confounding major cilia structure defects by

analysing the strains for an increased lifespan phenotype that is

typical of ciliary gene mutants, including nphp-1, nphp-4, ifta-2, and most core IFT-associated mutants (Apfeld and Kenyon,

1999; Schafer et al., 2006; Winkelbauer et al., 2005). Although

none of the single mks/mksr mutants differed from wild-type

animals (Fig. 5A), all double mutant combinations (mks-1;mksr-1, mks-1;mksr-2, and mksr-1;mksr-2) displayed statistically

significant expansions in lifespan (Fig. 5B). This is reminiscent

of the single nphp-1 or nphp-4 mutants, which show no overt

cilia-dependent male mating defects, whereas the nphp-1;nphp-4 double mutant animals possess pronounced mating defects

(Jauregui and Barr, 2005). Also of note, the enhanced lifespan

of mks/mksr double mutants was comparable to that observed

when the nphp-1 and nphp-4 genes were individually disrupted,

but less than when ciliary structures were severely abrogated (e.g.

as in a che-11 mutant) (Fig. 5C).

It is intriguing that lifespan phenotypes are observed in double

but not single mks/mksr mutants given that the abrogation of either

MKSR-1 or MKSR-2 causes the improper localization of the others

(Fig. 3). However, our data indicate that in most cases, the co-

dependency of localization reflects an effect on the efficiency of

localization rather than an essential aspect of correct trafficking (Fig.

3); thus, at least partial function might be retained in the incorrectly

localized proteins. Nevertheless, it remains perplexing that the mks-1;mksr-1;mksr-2 triple mutant does not exhibit a longevity

phenotype. Although it is unclear why abrogation of the third

mks/mksr gene restores normal lifespan, it provides further evidence

of a functional (genetic) interaction between all three mks/mksrgenes, since the triple mutant phenotype is reproducibly distinct

from that of the three double mutant phenotypes. It might also

indicate a complex regulation – which probably includes NPHP-1

and NPHP-4 proteins (Williams et al., 2008) – of the various ciliary

signals modulating lifespan at the transition zone.

Longevity in C. elegans is specifically controlled by cilia-

dependent sensory inputs and the insulin–IGF-I signaling pathway

(Apfeld and Kenyon, 1999). We show by epistasis analyses, that

this is also the case for the MKS-1, MKSR-1 and MKSR-2

proteins, which appear to function upstream of both the

insulin–IGF-I receptor DAF-2 and the FOXO transcription factor

(DAF-16), which transduces insulin-like signals to regulate

lifespan (Fig. 6). But what are the function(s) of the MKS-1,

MKSR-1 and MKSR-2 proteins in this pathway? Given our results,

it is possible that components of the insulin–IGF-I signaling

cascade might be improperly trafficked in the mks/mksr double

mutants; given that the MKS-1, MKSR-1 and MKSR-2 proteins

localize at the base of cilia in C. elegans, they might cooperate

with other basal body proteins (such as NPHP-1, NPHP-4 or

Meckel syndrome-associated RPGRIP1L, for which there is a C.elegans orthologue, C09G5.8) in vesicle or protein trafficking (or

docking at the base of cilia) prior to incorporation into cilia (e.g.

by intraflagellar transport).

Although the functions of the MKS-1, MKSR-1 and MKSR-2

proteins appear to not be crucial for ciliogenesis in C. elegans(and perhaps other organisms), they are essential for establishing

important signaling cascade(s). Such a ‘non-essential’ function

might explain why some ciliated organisms, such as Plasmodiumand Giardia, lack the MKS-1, MKSR-1 and MKSR-2 proteins

altogether. In other systems, for example mammalian cells, the

MKS1, MKSR1 and MKSR2 proteins might carry out similar

trafficking or docking roles at basal bodies, but perhaps functional

interaction(s) with their cargo or binding partners are absolutely

necessary for establishing the positioning of the basal body at the

membrane (Dawe et al., 2007), and thus, ciliogenesis. Once cilia

formation has occurred in normal (wild-type) situations, the

mammalian MKS1, MKSR1 and MKSR2 proteins might then also

be necessary for the targeting or trafficking of ciliary cargo

required for the sensory/signaling functions of the primary cilia

(e.g. Shh and perhaps other signaling pathways) (Breunig et al.,

2008). In C. elegans, disruption of an MKS-1, MKSR-1 and

MKSR-2 protein together with the NPHP-1 or NPHP-4 protein

causes essentially the same defects in basal body positioning and

ciliogenesis (Williams et al., 2008), potentially suggesting greater

functional redundancy in the nematode ciliary system. This is

particularly insightful, given that the NPHP-1 and NPHP-4

proteins appear to be important regulators for the proper

localization or function of the IFT/BBS ciliary proteins (Jauregui

et al., 2008).

Jour

nal o

f Cel

l Sci

ence

622

MKSR1 and MKSR2 as potential Meckel syndrome genecandidatesOur functional data strongly suggest that, in addition to the six

presently known human Meckel syndrome-associated genes, namely

MKS1, MKS3, CEP290/NPHP6/MKS4, RPGRIP1L/MKS5, NPHP3and CC2D2A, the two MKS1-related genes MKSR1 and MKSR2are excellent Meckel syndrome, Joubert syndrome and Leber

congenital amaurosis gene candidates. The genetic locations of

MKSR1 (B9D1; 17p11.2) and MKSR2 (B9D2; 19q13.2d) are clearly

outside the uncloned MKS2 locus, which has been mapped to

chromosome 11q13 by Roume et al. (Roume et al., 1998); thus,

MKSR1 and MKSR2 might represent additional disease loci.

Understanding the roles of basal bodies and ciliary axonemes in

various sensory and signaling processes, and their implications in

various ciliopathies, will require the identification and analysis of

key, conserved components of the basal body-ciliary organelle. Here,

we have uncovered and characterized three B9-domain-containing

proteins, MKS-1, MKSR-1 and MKSR-2, as a family of basal

body/ciliary components whose functional interactions are required

for proper ciliary function/signaling in C. elegans, and are needed

for ciliogenesis in mammalian cells. Further analyses of these

proteins in C. elegans and other model organisms, as well as

exploration of their possible involvement in cilia-associated

diseases, will provide important insights into the physiological

functions of cilia and the molecular etiologies of ciliopathies such

as Meckel syndrome.

Materials and MethodsC. elegans strains and genetic crossesAll strains were maintained and cultured at 20°C. Strains carrying deletions in theC. elegans mks-1/xbx-7, mksr-1/tza-2, mksr-2/tza-1 genes, R148.1(tm2705),K03E6.4(tm3083) and Y38F2AL.2(tm2452) respectively, were obtained from theNational Bioresource Project (http://shigen.lab.nig.ac.jp/c.elegans/index.jsp) andoutcrossed to wild-type (N2) at least five times. Standard mating procedures wereused to introduce GFP-tagged protein constructs into different genetic backgroundsand to make the different combinations of double mutants or the triple mutant. Single-worm PCR reactions were used to genotype the three mks/mksr mutants. The otherstrains used were bbs-8(nx77), nphp-1(ok500), nphp-4(tm925), che-11(e1810), osm-5(p813), daf-2(e1370), and daf-16(mu86).

Characterization of the C. elegans mks-1, mksr-1 and mksr-2allelesN2 and mks/mksr cDNAs were initially isolated by RT-PCR. Briefly, followingsuspension of worms in Trizol reagent (Invitrogen) and purification with RNeasy(Qiagen), first-strand cDNAs were generated using the Superscript First-StrandSynthesis System for RT-PCR (Invitrogen). PCR amplifications specific to eachmks/mksr transcript were then performed to isolate appropriate double-stranded cDNAsequences. PCR products were then incorporated into the pGEM-T Easy Vector(Promega) and sequenced.

Subcellular localization of the human and C. elegans MKS-1,MKSR-1 and MKSR-2 proteinsTo assess the localization of the three human B9 proteins using transient expressionof V5-tagged proteins, the respective cDNAs (MKS1/BC010061.2, EPPB9/BC002944.2/MKSR1 and LOC80776/NM_030578.2/MKSR2 (Invitrogen UltimateORF clones IOH12254, IOH5726, and IOH4997, respectively) were cloned into themammalian Gateway pcDNA6.2/c-Lumio vector (Invitrogen), which contains a C-terminal V5 epitope tag. Murine IMCD3 cells were plated on glass coverslips andtransfected with both the expression vector and a pUC12-TAG tRNA suppressor(Invitrogen) at 70% confluency using FuGENE6 (Roche). 48 hours after transfection,cells were subjected to immunofluorescence analysis (below). To generate stableIMCD3 cell lines harboring GFP-tagged MKS1, MKSR1/B9D1 and MKSR2/B9D2,cells were transfected with each GFP-fusion construct, split 1:5 after 24 hours andgrown 24 hours later in the presence of geneticin (750 μg/ml); cells were kept underselection for 7 days, after which they were split 1:10 and several colonies were pickedto produce independent lines. Cells were grown to confluency and maintained for atleast 48 hours before immunofluorescence analysis.

For immunofluorescence analysis, cells were fixed in PFA at 4°C for 1 hour, andsubsequently fixed in ice-cold methanol at –20°C for 10 minutes. After rinsing withPBS, cells were permeabilized using 0.1% Triton-X (American Bioanalytical) in PBS

(10 minutes), washed, and blocked with 5.5% FBS (Gemini) for 1 hour. Cells were

stained with primary antibodies at 4°C overnight (rabbit anti-GFP, 1:1000, Invitrogen

A11122; mouse anti-γ-tubulin, 1:1000, Sigma T6557; goat anti-acetylated-tubulin,

1:1000, Sigma), washed in PBS, then incubated with secondary antibodies [goat anti-

mouse (A21206) and donkey anti-rabbit IgG conjugated to Alexa Fluor 488 (A11001)

or Alexa Fluor 594 (A11005), 1:1000, Invitrogen]. Cells where then incubated with

DAPI (1:5000, 500 mg/ml stock) at 25°C for 10 minutes, washed, and mounted with

Vectashield. Images were recorded using an epifluorescence microscope at �64

magnification.

For the C. elegans MKS-1, MKSR-1 and MKSR-2 proteins, we generated

translational constructs containing the natural promoter of each gene and the entire

coding region fused in-frame to EGFP, and generated transgenic lines harboring these

constructs as reported previously (Blacque et al., 2004). The subcellular localization

of the GFP-tagged proteins was assessed by fluorescence microscopy in either wild-

type (N2) animals or in the indicated mks/mksr mutant backgrounds. Mislocalization

phenotypes were assayed blind to the genotype and expressed GFP-tagged MKS-1,

MKSR-1 and MKSR-2 protein, on at least 50 different animals for each strain.

Mammalian RNAiMouse IMCD3 cells were grown in a 10 cm dish and co-transfected with short-hairpin

constructs for either murine MKSR1/B9D1 or MKSR2/B9D2, and GFP as a transfection

control using Fugene6 (Invitrogen) as directed. After 48-72 hours, the cells were

fixed in paraformaldehyde and co-stained with anti-acetylated tubulin and anti-GFP.

The cells expressing GFP, which coexpressed the short-hairpins, were then scored

for the percentage of cilia in comparison with cells expressing GFP alone. The

MKSR1/B9D1 short-hairpin construct was purchased from Open BioSystems. The

target sequence for the RNAi Consortium (TRC), TRC-Mm1.0 (Mouse) is not

published. The B9D1 short-hairpin construct is expressed from the p.KLO.1 vector

and has the following TRC ID: TRCN0000198329. The target sequence for

MKRSR2/B9D2 used in the pSuper-Basic vector (Oligoengine Cat. No. VEC-PBS-

0001/0002) is: GAACAGTTGGCACGGGCTT. The primers designed for cloning

of the short-hairpin into pSuper.basic are: 5�-GATCCCCGAACAGTTGG -

CACGGGCTTTTCAAGAGAAAGCCCGTGCCAACTGTTCTTTTTA-3� and 3�-GGGCTTGTCAACCGTGCCCGAAAAGTTCTCTTTCGGGCACGGTTGACAA -

GAAAAATTCGA-5�.

Phenotypic assays for ciliary structure, chemosensation and lipidcontentChemotaxis assays using isoamyl alcohol as an attractant were performed as

described (Blacque et al., 2006). Osmoavoidance assays were performed essentially

as described (Culotti and Russell, 1978) using a ring of 8 M glycerol as the source

of high osmolarity. The filling of environmentally exposed ciliated sensory neurons

with DiI was assessed as described in Blacque et al. (Blacque et al., 2004). Lipid

content measurements were performed essentially as described using Nile Red (Mak

et al., 2006). Experiments were done blind to the genotype and repeated at least three

times.

Lifespan assaysLifespan assays were similar to that described (Apfeld and Kenyon, 1999). Animals

were grown for one generation at 20°C before eggs were collected by treatment with

sodium hypochlorite. At the L4 molt, worms were transferred to NGM plates

containing 16 μm FUDR to prevent progeny growth and kept at 20°C for the duration

of the assay. 100 worms were picked for each of the indicated strains, with 10 worms

on each plate. Plates were scored every 1-2 days for live or dead worms. Individual

animals were considered dead when they no longer responded to harsh touch (prodding

with platinum wire). Worms that exploded or crawled off the plate were censored.

All assays were performed at least twice with consistent results.

DAF-16 nuclear localization analysesDAF-16 localization assays were performed essentially as described (Schafer et al.,

2006). Briefly, the various mks/mksr single or double mutant strains were crossed

into the integrated DAF-16::GFP strain {TJ356; N2(zIs356)[DAF-16::GFP+pRF4(rol-

6)]}. To observe the localization, healthy, well-fed worms grown at 20°C were

mounted on an agar pad containing 20 mM sodium azide and quantified immediately.

To quantify localization, DAF-16::GFP was determined to be either nuclear,

intermediate or cytosolic as reported (Oh et al., 2005). Control animals (TJ356 strain)

were assayed in parallel. For each strain analyzed, at least 200 worms were assayed

in triplicate.

Intraflagellar transport assaysTransgenic animals harboring GFP-tagged proteins were mounted on 1% agarose

pads and immobilized with 100 mM levamisole. Amphid and phasmid cilia were

examined with a 100� 1.35 NA objective and an ORCA AG CCD camera mounted

on an Zeiss Axioskop 2 mot plus microscope, with time-lapse images being acquired

at 300-500 mseconds/frame, depending on the specific marker used. Images and

movies were obtained in Openlab version 5.02 (Improvision). Kymographs were

generated using the MultipleKymograph ImageJ plug-in (http://www.embl-

Journal of Cell Science 122 (5)

Jour

nal o

f Cel

l Sci

ence

623Meckel syndrome 1 and related proteins

heidelberg.de/eamnet/html/body_kymograph.html). Rates from middle and distal

segments were obtained essentially as described (Ou et al., 2007).

Bioinformatic and phylogenetic analysesB9-domain-containing proteins were identified using the NCBI Conserved Domain

Database (Marchler-Bauer et al., 2005) with human MKS1 as query. This dataset

was simplified by removal of duplicate sequences from species not of interest.

Sequences from species not shown here (but retrieved by the CDD) were manually

removed. Sequences from additional species were identified and/or confirmed using

BLAST (Altschul et al., 1997) with sequences from species closely related on the

eukaryotic tree [as defined by Keeling et al. (Keeling et al., 2005)] as queries at the

individual genome sites of each species. Sequences were retained only if reciprocal

BLAST identified B9-domain-containing proteins as the top hits. Bayesian analysis

of phylogenies was carried out using MrBayes 3.1.2 (Huelsenbeck and Ronquist,

2001) as previously described (Parker et al., 2007), except that whole protein sequences

were aligned using the Muscle algorithm (Edgar, 2004). Trees were visualized with

TreeView (Page, 1996) or Phylodrendrum (http://iubio.bio.indiana.edu/treeapp/

treeprint-form.html). An additional analysis (not shown) was carried out on a slightly

different protein dataset using the neighbor-joining algorithm of ClustalW (Higgins

et al., 1994).

We would like to thank the C. elegans Genetics Center (CGC) andShohei Mitani (National BioResource Project, University of Tokyo,Japan) for providing C. elegans strains used in this study, and theWestGrid computer cluster for phylogenetic analyses. This research isfunded by grants from the March of Dimes (M.R.L.), NSERC (L.M.Q.),grant R01HD04260 from the National Institute of Child Health andDevelopment, R01DK072301 and R01DK075972 from the NationalInstitute of Diabetes, and Digestive and Kidney Disorders (N.K), andthe Science Foundation Ireland PIYRA (O.E.B.). M.R.L. holds scholarawards from Canadian Institutes of Health Research and Michael SmithFoundation for Health Research (MSFHR). E.E.D. acknowledges anNRSA fellowship (F32 DK079541-01) and a doctoral fellowship fromthe Visual Neuroscience Training Program (National Eye Institute).P.N.I. and M.P.H. acknowledge MSFHR scholarships; P.N.I. also holdsan NSERC doctoral research award. Deposited in PMC for release after12 months.

ReferencesAlexiev, B. A., Lin, X., Sun, C. C. and Brenner, D. S. (2006). Meckel-Gruber syndrome:

pathologic manifestations, minimal diagnostic criteria, and differential diagnosis. Arch.Pathol. Lab. Med. 130, 1236-1238.

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and

Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein

database search programs. Nucleic Acids Res. 25, 3389-3402.

Ansley, S. J., Badano, J. L., Blacque, O. E., Hill, J., Hoskins, B. E., Leitch, C. C., Kim,

J. C., Ross, A. J., Eichers, E. R., Teslovich, T. M. et al. (2003). Basal body dysfunction

is a likely cause of pleiotropic Bardet-Biedl syndrome. Nature 425, 628-633.

Apfeld, J. and Kenyon, C. (1999). Regulation of lifespan by sensory perception in

Caenorhabditis elegans. Nature 402, 804-809.

Arts, H. H., Doherty, D., van Beersum, S. E., Parisi, M. A., Letteboer, S. J., Gorden,

N. T., Peters, T. A., Marker, T., Voesenek, K., Kartono, A. et al. (2007). Mutations

in the gene encoding the basal body protein RPGRIP1L, a nephrocystin-4 interactor,

cause Joubert syndrome. Nat. Genet. 39, 882-888.

Avidor-Reiss, T., Maer, A. M., Koundakjian, E., Polyanovsky, A., Keil, T.,

Subramaniam, S. and Zuker, C. S. (2004). Decoding cilia function: defining specialized

genes required for compartmentalized cilia biogenesis. Cell 117, 527-539.

Baala, L., Audollent, S., Martinovic, J., Ozilou, C., Babron, M. C., Sivanandamoorthy,

S., Saunier, S., Salomon, R., Gonzales, M., Rattenberry, E. et al. (2007). Pleiotropic

effects of CEP290 (NPHP6) mutations extend to Meckel syndrome. Am. J. Hum. Genet.81, 170-179.

Badano, J. L., Mitsuma, N., Beales, P. L. and Katsanis, N. (2006). The ciliopathies: an

emerging class of human genetic disorders. Annu. Rev. Genomics Hum. Genet. 7, 125-

148.

Bae, Y. K. and Barr, M. M. (2008). Sensory roles of neuronal cilia: cilia development,

morphogenesis, and function in C. elegans. Front. Biosci. 13, 5959-5974.

Bergmann, C., Fliegauf, M., Brüchle, N. O., Frank, V., Olbrich, H., Kirschner, J.,

Schermer, B., Schmedding, I., Kispert, A., Kränzlin, B. et al. (2008). Loss of

nephrocystin-3 function can cause embryonic lethality, Meckel-Gruber-like syndrome,

situs inversus, and renal-hepatic-pancreatic dysplasia. Am. J. Hum. Genet. 82, 959-970.

Bisgrove, B. W. and Yost, H. J. (2006). The roles of cilia in developmental disorders and

disease. Development 133, 4131-4143.

Blacque, O. E. and Leroux, M. R. (2006). Bardet-Biedl syndrome: an emerging

pathomechanism of intracellular transport. Cell Mol. Life Sci. 63, 2145-2161.

Blacque, O. E., Reardon, M. J., Li, C., McCarthy, J., Mahjoub, M. R., Ansley, S. J.,

Badano, J. L., Mah, A. K., Beales, P. L., Davidson, W. S. et al. (2004). Loss of C.

elegans BBS-7 and BBS-8 protein function results in cilia defects and compromised

intraflagellar transport. Genes Dev. 18, 1630-1642.

Blacque, O. E., Perens, E. A., Boroevich, K. A., Inglis, P. N., Li, C., Warner, A., Khattra,

J., Holt, R. A., Ou, G., Mah, A. K. et al. (2005). Functional genomics of the cilium,

a sensory organelle. Curr. Biol. 15, 935-941.

Blacque, O. E., Li, C., Inglis, P. N., Esmail, M. A., Ou, G., Mah, A. K., Baillie, D. L.,

Scholey, J. M. and Leroux, M. R. (2006). The WD repeat-containing protein IFTA-1

is required for retrograde intraflagellar transport. Mol. Biol. Cell 17, 5053-5062.

Blacque, O. E., Cevik, S. and Kaplan, O. I. (2008). Intraflagellar transport: from molecular

characterisation to mechanism. Front. Biosci. 13, 2633-2652.

Breunig, J. J., Sarkisian, M. R., Arellano, J. I., Morozov, Y. M., Ayarb, A. E., Sojitra,

S., Wang, B., Flavell, R. A., Rakic, P. and Town, T. (2008). Primary cilia regulate

hippocampal neurogenesis by mediating sonic hedgehog signaling. Proc. Natl. Acad.Sci. USA 105, 13127-13132.

Christensen, S. T., Pedersen, L. B., Schneider, L. and Satir, P. (2007). Sensory cilia and

integration of signal transduction in human health and disease. Traffic 8, 97-109.

Culotti, J. G. and Russell, R. L. (1978). Osmotic avoidance defective mutants of the

nematode Caenorhabditis elegans. Genetics 90, 243-256.

Davenport, J. R. and Yoder, B. K. (2005). An incredible decade for the primary cilium:

a look at a once-forgotten organelle. Am. J. Physiol. Renal Physiol. 289, F1159-F1169.

Davis, E. E., Brueckner, M. and Katsanis, N. (2006). The emerging complexity of the

vertebrate cilium: new functional roles for an ancient organelle. Dev. Cell 11, 9-19.

Dawe, H. R., Smith, U. M., Cullinane, A. R., Gerrelli, D., Cox, P., Badano, J. L., Blair-

Reid, S., Sriram, N., Katsanis, N., Attie-Bitach, T. et al. (2007). The Meckel-Gruber

Syndrome proteins MKS1 and meckelin interact and are required for primary cilium

formation. Hum. Mol. Genet. 16, 173-186.

Delous, M., Baala, L., Salomon, R., Laclef, C., Vierkotten, J., Tory, K., Golzio, C.,

Lacoste, T., Besse, L., Ozilou, C. et al. (2007). The ciliary gene RPGRIP1L is mutated

in cerebello-oculo-renal syndrome (Joubert syndrome type B) and Meckel syndrome.

Nat. Genet. 39, 875-881.

den Hollander, A. I., Koenekoop, R. K., Yzer, S., Lopez, I., Arends, M. L., Voesenek,

K. E., Zonneveld, M. N., Strom, T. M., Meitinger, T., Brunner, H. G. et al. (2006).

Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital

amaurosis. Am. J. Hum. Genet. 79, 556-561.

Edgar, R. C. (2004). MUSCLE: a multiple sequence alignment method with reduced time

and space complexity. BMC Bioinformatics 5, 113.

Efimenko, E., Bubb, K., Mak, H. Y., Holzman, T., Leroux, M. R., Ruvkun, G., Thomas,

J. H. and Swoboda, P. (2005). Analysis of xbx genes in C. elegans. Development. 132,

1923-1934.

Eggenschwiler, J. T. and Anderson, K. V. (2007). Cilia and developmental signaling.

Annu. Rev. Cell Dev. Biol. 23, 345-373.

Gerdes, J. M., Liu, Y., Zaghloul, N. A., Leitch, C. C., Lawson, S. S., Kato, M., Beachy,

P. A., Beales, P. L., DeMartino, G. N., Fisher, S. et al. (2007). Disruption of the basal

body compromises proteasomal function and perturbs intracellular Wnt response. Nat.Genet. 39, 1350-1360.

Gherman, A., Davis, E. E. and Katsanis, N. (2006). The ciliary proteome database: an

integrated community resource for the genetic and functional dissection of cilia. Nat.Genet. 38, 961-962.

Higgins, D., Thompson, J., Gibson, T., Thompson, J. D., Higgins, D. G. and Gibson,

T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence

alignment through sequence weighting,position-specific gap penalties and weight matrix

choice. Nucl. Acids Res. 22, 4673-4680.

Hildebrandt, F. and Otto, E. (2005). Cilia and centrosomes: a unifying pathogenic concept

for cystic kidney disease? Nat. Rev. Genet. 6, 928-940.

Huelsenbeck, J. P. and Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogeny.

Bioinformatics 17, 754-755.

Inglis, P. N., Boroevich, K. A. and Leroux, M. R. (2006). Piecing together a ciliome.

Trends Genet. 22, 491-500.

Inglis, P. N., Ou, G., Leroux, M. R. and Scholey, J. M. (2007). The sensory cilia of

Caenorhabditis elegans. WormBook 8, 1-22.

Jauregui, A. R. and Barr, M. M. (2005). Functional characterization of the C. elegansnephrocystins NPHP-1 and NPHP-4 and their role in cilia and male sensory behaviors.

Exp. Cell Res. 305, 333-342.

Jauregui, A. R., Nguyen, K. C., Hall, D. H. and Barr, M. M. (2008). The Caenorhabditiselegans nephrocystins act as global modifiers of cilium structure. J. Cell Biol. 180, 973-

988.

Karmous-Benailly, H., Martinovic, J., Gubler, M. C., Sirot, Y., Clech, L., Ozilou, C.,

Auge, J., Brahimi, N., Etchevers, H., Detrait, E. et al. (2005). Antenatal presentation

of Bardet-Biedl syndrome may mimic Meckel syndrome. Am. J. Hum. Genet. 76, 493-

504.

Keeling, P. J., Burger, G., Durnford, D. G., Lang, B. F., Lee, R. W., Pearlman, R. E.,

Roger, A. J. and Gray, M. W. (2005). The tree of eukaryotes. Trends Ecol. Evol. 20,

670-676.

Keller, L. C., Romijn, E. P., Zamora, I., Yates, J. R. r. and Marshall, W. F. (2005).

Proteomic analysis of isolated Chlamydomonas centrioles reveals orthologs of ciliary-

disease genes. Curr. Biol. 15, 1090-1098.

Kenyon, C., Chang, J., Gensch, E., Rudner, A. and Tabtiang, R. (1993). A C. elegansmutant that lives twice as long as wild type. Nature 366, 461-464.

Kimura, K. D., Tissenbaum, H. A., Liu, Y. and Ruvkun, G. (1997). daf-2, an insulin

receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans.

Science 277, 942-946.

Kyttälä, M., Tallila, J., Salonen, R., Kopra, O., Kohlschmidt, N., Paavola-Sakki, P.,

Peltonen, L. and Kestila, M. (2006). MKS1, encoding a component of the flagellar

Jour

nal o

f Cel

l Sci

ence

624

apparatus basal body proteome, is mutated in Meckel syndrome. Nat. Genet. 38, 155-

157.

Laurençon, A., Dubruille, R., Efimenko, E., Grenier, G., Bissett, R., Cortier, E., Rolland,

V., Swoboda, P. and Durand, B. (2007). Identification of novel regulatory factor X

(RFX) target genes by comparative genomics in Drosophila species. Genome Biol. 8,

R195.

Leitch, C. C., Zaghloul, N. A., Davis, E. E., Stoetzel, C., Diaz-Font, A., Rix, S., Al-

Fadhel, M., Lewis, R. A., Eyaid, W., Banin, E. et al. (2008). Hypomorphic mutations

in syndromic encephalocoele genes are associated with Bardet-Biedl syndrome. Nat.Genet. 40, 443-448.

Li, C., Inglis, P. N., Leitch, C. C., Efimenko, E., Zaghloul, N. A., Mok, C. A., Davis,

E. E., Bialas, N. J., Healey, M. P., Héon, E. et al. (2008). An essential role for DYF-

11/MIP-T3 in assembling functional intraflagellar transport complexes. PLoS Genet. 4,

e1000044.

Li, J. B., Gerdes, J. M., Haycraft, C. J., Fan, Y., Teslovich, T. M., May-Simera, H.,

Li, H., Blacque, O. E., Li, L., Leitch, C. C. et al. (2004a). Comparative genomics

identifies a flagellar and basal body proteome that includes the BBS5 human disease

gene. Cell 117, 541-552.

Li, S., Armstrong, C. M., Bertin, N., Ge, H., Milstein, S., Boxem, M., Vidalain, P. O.,

Han, J. D., Chesneau, A., Hao, T. et al. (2004b). A map of the interactome network

of the metazoan C. elegans. Science 303, 540-543.

Mak, H. Y., Nelson, L. S., Basson, M., Johnson, C. D. and Ruvkun, G. (2006). Polygenic

control of Caenorhabditis elegans fat storage. Nat. Genet. 38, 363-368.

Marchler-Bauer, A., Anderson, J. B., Cherukuri, P. F., DeWeese-Scott, C., Geer, L.

Y., Gwadz, M., He, S., Hurwitz, D. I., Jackson, J. D., Ke, Z. et al. (2005). CDD: a

Conserved Domain Database for protein classification. Nucleic Acids Res. 33, D192-

D196.

Marshall, W. F. and Nonaka, S. (2006). Cilia: tuning in to the cell’s antenna. Curr. Biol.16, R604-R614.

Mukhopadhyay, A., Oh, S. W. and Tissenbaum, H. A. (2006). Worming pathways to

and from DAF-16/FOXO. Exp. Gerontol. 41, 928-934.

Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A. and

Ruvkun, G. (1997). The Fork head transcription factor DAF-16 transduces insulin-like

metabolic and longevity signals in C. elegans. Nature 389, 994-999.

Oh, S. W., Mukhopadhyay, A., Svrzikapa, N., Jiang, F., Davis, R. J. and Tissenbaum,

H. A. (2005). JNK regulates lifespan in Caenorhabditis elegans by modulating nuclear

translocation of forkhead transcription factor/DAF-16. Proc. Natl. Acad. Sci. USA 102,

4494-4499.

Ou, G., Blacque, O. E., Snow, J. J., Leroux, M. R. and Scholey, J. M. (2005). Functional

coordination of intraflagellar transport motors. Nature 436, 583-587.

Ou, G., Koga, M., Blacque, O. E., Murayama, T., Ohshima, Y., Schafer, J. C., Li, C.,

Yoder, B. K., Leroux, M. R. and Scholey, J. M. (2007). Sensory ciliogenesis in

Caenorhabditis elegans: assignment of IFT components into distinct modules based on

transport and phenotypic profiles. Mol. Biol. Cell 18, 1554-1569.

Page, R. D. (1996). TreeView: an application to display phylogenetic trees on personal

computers. Comput. Appl. Biosci. 12, 357-358.

Pan, J. and Snell, W. (2007). The primary cilium: keeper of the key to cell division. Cell129, 1255-1257.

Parker, J. D., Bradley, B. A., Mooers, A. O. and Quarmby, L. M. (2007). Phylogenetic

analysis of the Neks reveals early diversification of ciliary-cell cycle kinases. PLoS ONE24, e1076.

Pazour, G. J. and Rosenbaum, J. L. (2002). Intraflagellar transport and cilia-dependent

diseases. Trends Cell Biol. 12, 551-555.

Perkins, L. A., Hedgecock, E. M., Thomson, J. N. and Culotti, J. G. (1986). Mutant

sensory cilia in the nematode Caenorhabditis elegans. Dev. Biol. 117, 456-487.

Ponsard, C., Skowron-Zwarg, M., Seltzer, V., Perret, E., Gallinger, J., Fisch, C., Dupuis-

Williams, P., Caruso, N., Middendorp, S. and Tournier, F. (2007). Identification of

ICIS-1, a new protein involved in cilia stability. Front. Biosci. 12, 1661-1669.

Quarmby, L. M. and Parker, J. D. (2005). Cilia and the cell cycle? J. Cell Biol. 169,

707-710.

Richards, T. A. and Cavalier-Smith, T. (2005). Myosin domain evolution and the primary

divergence of eukaryotes. Nature 436, 1113-1118.

Roume, J., Genin, E., Cormier-Daire, V., Ma, H. W., Mehaye, B., Attie, T., Razavi-

Encha, F., Fallet-Bianco, C., Buenerd, A., Clerget-Darpoux, F. et al. (1998). A gene

for Meckel syndrome maps to chromosome 11q13. Am. J. Hum. Genet. 63, 1095-1101.

Satir, P. and Christensen, S. T. (2007). Overview of structure and function of mammalian

cilia. Annu. Rev. Physiol. 69, 377-400.

Sayer, J. A., Otto, E. A., O’Toole, J. F., Nurnberg, G., Kennedy, M. A., Becker, C.,

Hennies, H. C., Helou, J., Attanasio, M., Fausett, B. V. et al. (2006). The centrosomal

protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor

ATF4. Nat. Genet. 38, 674-681.

Schafer, J. C., Winkelbauer, M. E., Williams, C. L., Haycraft, C. J., Desmond, R. A.

and Yoder, B. K. (2006). IFTA-2 is a conserved cilia protein involved in pathways

regulating longevity and dauer formation in Caenorhabditis elegans. J. Cell Sci. 119,

4088-4100.

Scholey, J. M. (2008). Intraflagellar transport motors in cilia: moving along the cell’s

antenna. J. Cell Biol. 180, 23-29.

Singla, V. and Reiter, J. F. (2006). The primary cilium as the cell’s antenna: signaling at

a sensory organelle. Science 313, 629-633.

Smith, U. M., Consugar, M., Tee, L. J., McKee, B. M., Maina, E. N., Whelan, S.,

Morgan, N. V., Goranson, E., Gissen, P., Lilliquist, S. et al. (2006). The transmembrane

protein meckelin (MKS3) is mutated in Meckel-Gruber syndrome and the wpk rat. Nat.Genet. 38, 191-196.

Swoboda, P., Adler, H. T. and Thomas, J. H. (2000). The RFX-type transcription factor

DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol. Cell 5, 411-421.

Tan, P. L., Barr, T., Inglis, P. N., Mitsuma, N., Huang, S. M., Garcia-Gonzalez, M. A.,

Bradley, B. A., Coforio, S., Albrecht, P. J., Watnick, T. et al. (2007). Loss of Bardet

Biedl syndrome proteins causes defects in peripheral sensory innervation and function.

Proc. Natl. Acad. Sci. USA 104, 17524-17529.

Tallila, J., Jakkula, E., Peltonen, L., Salonen, R. and Kestila, M. (2008). Identification

of CC2D2A as a Meckel syndrome gene adds an important piece to the ciliopathy puzzle.

Am. J. Hum. Genet. 82, 1361-1367.

Town, T., Breunig, J. J., Sarkisian, M. R., Spilianakis, C., Ayoub, A. E., Liu, X.,

Ferrandino, A. F., Gallagher, A. R., Li, M. O., Rakic, P. et al. (2008). The stumpygene is required for mammalian ciliogenesis. Proc. Natl. Acad. Sci. USA 105, 2853-2858.

Valente, E. M., Silhavy, J. L., Brancati, F., Barrano, G., Krishnaswami, S. R., Castori,

M., Lancaster, M. A., Boltshauser, E., Boccone, L., Al-Gazali, L. et al. (2006).

Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of

Joubert syndrome. Nat. Genet. 38, 623-625.

Vierkotten, J., Dildrop, R., Peters, T., Wang, B. and Ruther, U. (2007). Ftm is a novel

basal body protein of cilia involved in Shh signalling. Development 134, 2569-2577.

Williams, C. L., Winkelbauer, M. E., Schafer, J. C., Michaud, E. J. and Yoder, B. K.

(2008). Functional redundancy of the B9 proteins and nephrocystins in Caenorhabditiselegans ciliogenesis. Mol. Biol. Cell 19, 2154-2168.

Winkelbauer, M. E., Schafer, J. C., Haycraft, C. J., Swoboda, P. and Yoder, B. K.

(2005). The C. elegans homologs of nephrocystin-1 and nephrocystin-4 are cilia transition

zone proteins involved in chemosensory perception. J. Cell Sci. 118, 5575-5587.

Wolf, M. T., Lee, J., Panther, F., Otto, E. A., Guan, K. L. and Hildebrandt, F. (2005).

Expression and phenotype analysis of the nephrocystin-1 and nephrocystin-4 homologs

in Caenorhabditis elegans. J. Am. Soc. Nephrol. 16, 676-687.

Journal of Cell Science 122 (5)

Jour

nal o

f Cel

l Sci

ence