Gene & Chromosomal mutation

6

38

78

62

22

0 10 20 30 40 50 60 70 80 90

A's B's C's D F

Genetics Exam 1, F2009

Series1

Chicken

Chicken??? New York State Fair Genetics Display

Scientific American, October 2005, Vol. 293 (4) pp.78-85

Mutations can be divided into three main types:

1. Single-gene mutations Relatively small changes in DNA structure that occur within a particular gene (promoter or transcriptional unit)

2. Chromosome mutations Changes in chromosome structure

3. Genome mutations Changes in chromosome number

Genetic variation

  allele - One of the different forms of a gene that exist at a single locus. •  locus - location of the gene on a

chromosome  Where do different alleles come from?   recombination of functional gene

domains and gene mutation (base deletions, additions, or substitutions)

 mutate - to change

Gene mutation terms

 wild-type (wt): designated standard (either in nature or lab)

  forward mutation - any change away from wt

  reverse mutation - any change back to the wt allele •  also called reversion or back mutation

Think: Mutation and Nature

 According to evolutionary theory, all genes are mutant genes, we arbitrarily name certain alleles as wt. Genes must mutate to evolve! •  Today’s mutation is tomorrows allele

 Mutation is the foundation of the diversity found in nature and agriculture.

 Remember the chickens

IGF1 allele is the major determinate of small size in dogs What causes gene mutations?

  A point mutation is a change in a single base pair •  It involves a base substitution

Gene Mutations Change the DNA Sequence

5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’

5’ AACGCGAGATC 3’ 3’ TTGCGCTCTAG 5’

•  A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine

•  A transversion is a change of a pyrimidine to a purine or vice versa

•  Transitions are more common than transversions

  Mutations may also involve the addition or deletion of short sequences of DNA

Gene Mutations Change the DNA Sequence

5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’

5’ AACGCTC 3’ 3’ TTGCGAG 5’

5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’

5’ AACAGTCGCTAGATC 3’ 3’ TTGTCAGCGATCTAG 5’

Deletion of four base pairs

Addition of four base pairs

Movie - nonsense mutation

Movie - supressor mutation Movie - example DNA repair

Movie - slippage mutation

  Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) •  The term refers to the phenomenon that a sequence of 3

nucleotides can increase from one generation to the next

  These diseases include •  Huntington disease (HD) •  Fragile X syndrome (FRAXA)

Mutations Due to Trinucleotide Repeats

  Certain regions of the chromosome contain trinucleotide sequences repeated in tandem •  In normal individuals, these sequences are transmitted

from parent to offspring without mutation •  However, in persons with TNRE disorders, the length of a

trinucleotide repeat increases above a certain critical size –  It also becomes prone to frequent expansion –  This phenomenon is shown here with the trinucleotide repeat CAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

n = 11

n = 18

  In some cases, the expansion is within the coding sequence of the gene •  Typically the trinucleotide expansion is CAG (glutamine) •  Therefore, the encoded protein will contain long tracks of

glutamine –  This causes the proteins to aggregate with each other –  This aggregation is correlated with the progression of the disease

  In other cases, the expansions are located in noncoding regions of genes •  These expansions are hypothesized to cause abnormal

changes in RNA structure –  Thereby producing disease symptoms

  There are two particularly unusual features that TNRE disorders have in common •  1. The severity of the disease tends to worsen in future

generations –  This phenomenon is called anticipation

•  2. The severity of the disease depends on whether it is inherited from the father or mother (paternal imprinting)

–  In Huntington disease, the TNRE is more likely to occur if inherited from the father

–  In myotonic muscular dystrophy, the TNRE is more likely to occur if inherited from the mother

  The “DNA” cause of TNRE is not well understood •  TNREs may produce alterations in DNA structure (such as

stem-loops), thereby leading to errors in DNA replication

Mutation induction  What is the leading cause of gene

mutation?  DNA replication   Inherent inaccuracy

•  evolved to be inaccurate? •  advantageous to viruses (flu, Aids, etc.)

  therefore, cancers occur more often in quickly dividing cells •  skin, lungs, digestive tract, mammary glands,

liver, reproductive organs

  mutation rate - likelihood that a gene will be altered by a new mutation •  expressed as the number of new mutations in a given gene

per generation •  range of 10-5 to 10-9 per generation

  mutation rate for a given gene is not constant •  It can be increased by the presence of mutagens

  Mutation rates vary substantially between species and even within different strains of the same species

Mutation Rates and Frequencies   Within the same individual, some genes mutate at a

much higher rate than other genes

•  Some genes are larger than others –  This provides a greater chance for mutation

•  Some genes have locations within the chromosome that make them more susceptible to mutation

–  These are termed hot spots

•  Note: Hot spots can be also found within a single gene

Mutation Rates and Frequencies

Contain many mutations at exactly the same site

within the gene

  The mutation frequency for a given gene is the number of mutant forms of this gene divided by the total number of these genes in a population

•  If 1 million bacteria were plated and 10 were mutant – The mutation frequency would be 1 in 100,000 or 10-5

Mutation Rates and Frequencies

  The mutation frequency for a gene is the number of mutant genes divided by the total number of genes in a population

  mutation rate - likelihood that a gene will be altered by a new mutation •  expressed as the number of new mutations in a given gene per

generation

  Achondroplasia and hypochondroplasia. Comments on frequency, mutation rate, and radiological features in skull and spine, by F Oberklaid, DM Danks, F Jensen, L Stace and S Rosshandler •  An attempt was made to ascertain all the dwarfs in the State of

Victoria. The incidence of achondroplasia proved to be approximately 1 in 26,000 live births in the period 1969 to 1975 when ascertainment was nearly complete. This indicates a mutation rate of 1.93 X 10(-5) per generation in this locus. Paternal age was shown to influence mutation.

Mutation Rates and Frequencies Gene mutation

  Two classes (in multi-celled eukaryotes)   somatic mutation

•  mutation in vegetative cells, therefore usually not passed on to next generation.

•  involved in aging & cancers   germinal mutation

•  source of new alleles which can be passed on to the next generation

Therefore, the mutation can be

passed on to future generations

The size of the patch will depend on the timing of the mutation

The earlier the mutation, the larger the patch

An individual who has somatic regions that are genotypically different

from each other is called a genetic mosaic

Therefore, the mutation cannot be passed on to future generations

Mutant types:

  loss-of-function mutations •  null or leaky •  usually recessive or incomplete

dominant   gain-of-function mutations (rare)

•  usually dominant or codominant   silent mutations

•  no phenotypic change, only genotypic change (some exceptions)

Silent mutations Most of our produce are mutants

 Ruby red grapefruit •  arose as a spontaneous mutant in 1926 •  loss-of-function mutation - enzyme that

coverts red pigment to colorless pigment   Texas red grapefruit (Rio Red)

•  radiation breeding, 1988  Over 2000 crop varieties were

developed by radiation mutation

Mutation and Cancer �(oncogene/suppressor model)

  cancer is caused by somatic cell mutations •  gene or chromosome mutations

  most cancer cells must: •  gain rapid cell division (forms a tumor) •  gain a new blood supply •  gain ability to move and invade other tissues

(metastasis)   all are normal developmental functions caused by

proto-oncogenes •  Turn on cell growth & division

  controlled by tumor suppressor genes •  Suppress cell growth & division

Mutation and Cancer�(note: DNA damage can range from point mutation to sequence

deletions, insertions, sequence or gene duplications, etc.)

Mutation and Cancer�(note: DNA damage can range from point mutation to sequence

deletions, insertions, sequence or gene duplications, etc.) Mutation and Cancer�

(note: DNA damage can range from point mutation to sequence deletions, insertions, sequence or gene duplications, etc.)

Mutation and Cancer�(note: DNA damage can range from point mutation to sequence

deletions, insertions, sequence or gene duplications, etc.) Mutation and Cancer�

(note: DNA damage can range from point mutation to sequence deletions, insertions, sequence or gene duplications, etc.)

Predisposition for Cancer Predisposition for Cancer

Gene mutations that help lead to cancer

  Oncogenes   Tumor suppressors   Mutator genes

•  Genes involved with DNA repair if mutated allow higher levels of mutation in general

  Telomerase genes •  If mutated to turn on when it should be turned

off, could lead to immortal cells (i.e. unlimited cell division)

Min. number of mutations

 Retinoblastoma: 2 mutations •  usually in children

  colon cancer: 4-5 mutations •  usually in adults

  small-cell lung cancer: 10-15 mutations •  usually in adults with high exposure to

mutagens, i.e. smokers

Smoker’s lungs

Mutations Can Alter Chromosome Structure (Chromosome mutations)

  Deficiency (or deletion) •  The loss of a chromosomal segment

  Duplication •  The repetition of a chromosomal segment compared to

the normal parent chromosome   Inversion

•  A change in the direction of the genetic material along a single chromosome

  Translocation •  A segment of one chromosome becomes attached to a

different chromosome •  Simple translocations

– One way transfer •  Reciprocal translocations

–  Two way transfer

Human chromosome 1

Human chromosome 21

  Can cause a break in a gene   gene may be left intact, but its expression altered

because of its new location •  This is termed a position effect •  1. Movement next to regulatory sequences

•  2. Movement to a heterochromatic region

Changes in Chromosome Structure Can Affect Gene Expression

Regulatory sequences are often bidirectional

Chromosomal rearrangements

  duplications •  may or may not produce changes in the

phenotype   if not detrimental, provides an opportunity

for gene evolution without the loss of the original gene product

  example: lysozyme •  degrades the cell wall of bacteria •  normally found in the tears of mammals

Lysozyme

Lysozyme Lysozyme - gene duplication

Lysozyme - gene duplication Lysozyme - gene duplication

Changes (mutation) in �chromosome number

  Terms:   monoploid number (X) - number of sets

of chromosomes (# genomes) •  No duplicated or homologous

chromosomes in a set   can be different than haploid number (n)

- the number found in gametes   Examples:

•  human: 46 chromosomes (2n = 2x) •  wheat: 42 chromosomes (2n = 6x)

Euploids (multiples of X)

  1x - monoploid •  male bees, wasps, and ants •  artificially derived plants

  2x - diploid   3x - triploid   4x - tetraploid   5x - pentaploid   6x - hexaploid

polyploids

Polyploids (>2x)   two types   autopolyploids - multiple

chromosome sets from one species   allopolyploids - chromosome sets

from different species •  chromosome sets must be

homeologous – partially homologous which allows pairing

•  example: Triticale (wheat x rye)

Genetic modification of wheat

Many Brassica species rutabaga oil rape mustards

(1n but 2X)

(2n but 4X)

(1n but 3X)

(2n but 6X)

Triploids

  result from a cross of a tetraploid (4x) with a diploid (2x)

  sterile due to problems with pairing during meiosis

  example: bananas (no developed seeds!)

  example 2: seedless watermelon   other odd number of chromosome

sets will give similar results

Polyploidy in animals

 much more rare than in plants   examples: flatworms, leeches, brine

shrimp, some amphibians, and some fish

 Salmonidae (Salmon and trout) thought to be polyploids because they contain twice as much DNA that closely related fish

Aneuploidy   chromosome number differs from

wt by part of a chromosomal set (not euploid)

  nomenclature: •  2n-1 = monosomic •  2n+1 = trisomic •  2n-2 = nullisomic •  n+1 = disomic (in haploids)

  generally deleterious

Aneuploidy

  caused by nondisjunction during meioses or mitosis •  disjunction is the normal separation of

chromosomes to opposite poles during nuclear division

•  homologs in meiosis or sister chromatids in mitosis failing to separate

Aneuploidy - human disease  Down syndrome - trisomic (2n+1)

•  extra copy of autosome #21 •  most common human aneuploid •  1:600-700 of all births •  multiple phenotypes (vary):

– mental retardation – broad flat face – short stature – heart problems – etc.

Aneuploidy - human disease

  chances of nondisjunction increases with age

 Example: Down syndrome •  mother age 20 - 1:2,300 •  mother age 30 - 1:1,200 •  mother age 40 - 1:100 •  mother age 45 - 1:46

Downs syndrome

  5% of cases linked to nondisjunction in father

 Mother’s age more important •  eggs resting - incomplete meiosis •  meiosis completed only after conception

Most aneuploids die before birth Somatic Aneuploids

  occur during mitosis in early development

 mosaics called gynandromorphs   example: Io Moth (1/2 male, 1/2 female)