Gene Expression• Prokaryotes vs eukaryotes• Gene expression in prokaryotes

– Prokaryotic Promotor– Lac operon in E. coli– Lac operon: Catabolite repression– Trp operon attenuation & antitermination

• Gene expression in eukaryotes– Eukaryotic promotor – Assembly of a transcriptional complex – Control of Eukaryotic Transcription – chromatin structure & gene expression

Transcription

• RNA Polymerase transcribes the DNA code to mRNA.

• The mRNA Polymerase `unzips’ the double helix of the DNA to access the code.

Transcription Schematic

DNA Rewinding

DNA double helix

ribonucleotide triphosphatesnewly synthesized

sense mRNA transcript

antisense DNA strand

5’

3’

Translation• Nucleotides are

grouped into codons.

• Each codon contains three nucleotides.

• Each codon corresponds to an aminoacid or a stop.

2nd Posi-tion

1st Position 3rd Posi-tionU C A G

U Phe Ser Tyr Cys U

Phe Ser Tyr Cys C

Leu Ser STOP STOP A

Leu Ser STOP Trp G

C Leu Pro His Arg U

Leu Pro His Arg C

Leu Pro Gln Arg A

Leu Pro Gln Arg G

A Ile Thr Asn Ser U

Ile Thr Asn Ser C

Ile Thr Lys Arg A

Met Thr Lys Arg G

G Val Ala Asp Gly U

Val Ala Asp Gly C

Val Ala Glu Gly A

Val Ala Glu Gly G

P Site A Site

E Site

Amino Acids forming Peptide chain

Ribosome

tRNA

anti-codon

codon

Translation

UACAUG

Tyr

GUACAU

Val

mRNA strand

3’

5’

HisMet Pro

GGACCU

Eukaryotic vs Prokaryotic

Chromosome

Chromosomes

Eukaryotic Organism

Prokaryotic OrganismTranscription

here

Translationhere

Transcription and translation in prokaryotes vs eukaryotes

Transcription and translation in prokaryotes vs eukaryotes

• In prokaryotes, transcription and translation are tightly coupled.

• In contrast, transcription and translation are spatially separated in eukaryotes.

Procaryote: Example: E.coli• Chromosome: contains 4.6 £ 106 nucleotide

pairs, circular.

• DNA encodes approximately 4300 proteins.

• Only a fraction of these are made at any time.

• Expression is regulated according to available food.

Operon repressor•Active repressor (inducible operon)•Inactive repressor (repressible operon)

Lac operon in E. coli•Operon: a cluster of genes which are regulated collectively

•Structural Genes:Gene z - B-galactosidase - lactose catabolism, breaks down lactose into

galactose and glucose

Gene y - galactoside permease - concentrates lactose in cell

Gene a - thiogalactoside transacetylase - not in pathway

•Repressor gene: product (R) binds Operator to inhibit transcription (negative gene regulation)

•Operator (gene) , controls transcription of three structural genes.

•Inducer - Lactose (allolactose), binds repressor product, which no longer binds operator

•P: Promoter region - RNA polymerase binding + CAP-cAMP binding.

•CAP: Catabolite activator protein, binds promoter region to activate transcription of structural genes (positive gene regulation)

•cAMP: Cyclic adenosine monophosphate, complexes with CAP to allow efficient complexing to promoter region.

Breakdown of lactose: Lactose Glucose + Galactose

Inducer of lactose operon: Lactose

Gene regulation in procaryotes Lac operon

mRNA polycistronic

E. coli on Lactose : Lactose inducer complexes with repressor protein to change shape,

Operator not bound, structural gene induced (inducible system)

Positive Regulation: CAP protein acts as a gene activator.

a) Substrate glucose - CAP + cAMP, no transcription, repressor binds operator.

b) Substrate glucose + lactose - glucose suppresses cAMP, CAP binds inefficiently, little mRNA transcribed.

c) Substrate lactose only- cAMP levels elevated, cAMP-CAP complex forms, promotes RNA polymerase association, transcription high, translation high.

Comparison of Negative and Positive Control

Negative control = protein gene product functions to turn genes off.

Positive control = protein gene product functions to turn genes on.

Tryptophane operon

• Five genes which manufacture an enzyme to produce the amino acid tryptophan are adjacent.

• Region starts with a promoter.

promoter E D C B A

operator

operon

• When tryptophan is present in growth medium, a repressor protein binds to the operator repressing transcription.

• Activator proteins also exist.

Trp

operon

Chorismate-Anthrqanilate-phosphorybosyl anthranilate -Indole-3-glycerol P- Tryptophan

Tryptophane operon Attenuation & antitermination

AntiterminationAttenuation &termination

Tryptophane operon antitermination

Antitermination

Attenuation &termination

Tryptophane operon attenuationWhen there is HIGH tryptophane, the ribosome translate the segment 1 & 2. This allows the formation of hairpin

between section 3 & 4 leading to termination of transcription (Attenuation)

Tryptophane operon antiterminationWhen there is LOW tryptophane, the ribosome stall at

the segment 1. This allows the formation of hairpin between section 2 & 3 leading to antitermination

Only about 3-5% of all the genes in a human cell are expressed at any given time. The genes expressed can be specific for a particular cell type or tissue.

There are several opportunities for control of gene expression…

Gene Expression in EukaryotesGenome : 1.2% coding & 98.8% non-coding

Gene expression in eukaryotes

Gene expression: Temporal for development and Spatial for cell specialization

No operon: each gene with own promotor and one or more enhancersVarious transcriptional/regulatory factors

Chromatin Structure

Chromatin Structure

chromatin structure & gene expression

Histones in the coding region either remain associated with DNA but become hyperacetylated to facilitate RNAPII mobility or alternatively, they are displaced from the coding region,

If the cytosine residues of DNA are methylated allows gene expression. Acetylation or methylation of lysine groups of the histones make the genes inaccessible to transcription factors.

chromatin structure & gene expressionmethylation / acetylation

PRC1: The Polycomb Repressive Complex 1 (PRC1) is a relatively enormous structure with a molecular weight of 2-6 MDa and contains stoichometric amounts of Polyhomeotic (PH), Polycomb (Pc), Posterior sex comb (PSC), and RING protein subunits The PRC2 complex (600kDa) has three highly conserved core proteins (ESC), Enhancer of Zeste E(z), and Suppressor of (Zeste SU(Z)12) found in divergent species such as human

Control of Eukaryotic Transcription

Processing or not?Which Exon retained? Calcitonin

No. of 3’ UTR (AUUUA)

mRNA in eggs

cytoskeletal tracks for mRNA transport

Transcriptional activators and factors

Phosphorylation / methylation

{Transcriptional(1), PostTr(2), Transl.(3), PostTsl(4)}

1 Chromatin structure

1 Binding of RNA polymerase to DNA

2 Processing of RNA

2 Efficiency of transport channel

2 Protection/destruction of transcript

2 Post transcriptional modification

3 Rate of translation

4 Protein transport

Eukaryotic promotor

b, Complex metazoan transcriptional control modules. Containing multiple clustered enhancers interspersed with silencer and insulator elements located 10−50 kb upstream or downstream of a composite core promoter containing TATA box (TATA), Initiator sequences (INR), and downstream promoter elements (DPE).

a, Simple eukaryotic transcriptional unit. A simple core promoter (TATA), upstream activator sequence (UAS) and silencer element spaced within 100−200 bp of the TATA box that is typically found in unicellular eukaryotes.

•The basal promoter TATA box•Enhancers •Silencers •Insulators

1. TFIID recognizes and binds to the TATA box. TFIID consists of TATA box binding protein - TBP and ~10 TBP associated factors - TAFs.TFIIA binds and stabilizes TFIID binding.

2. The RNA polymerase II holoenzyme assembles - The holoenzyme consists of the RNA polymerase II complex, and the following transcription factors TFIIA TFIIB TFIIE TFIIF TFIIH

3. Finally, the various regulatory factors (Srb-Mediator, Srb10-CDK and Swi-Snf) bind to complete formation of the pre-initiation complex

Assembly of a transcriptional complex 6 factors + RNAP II = Pre-Init. Complex6 Factors are TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH

D DA DAB DAB-PolF DAB-PolF-EHorder

Enhancers are brought into close physical proximity to the basal transcription complex through protein-protein interactions between sequence specific enhancer binding proteins and TBP (basal txn complex) as shown below.

The transcription activation domain interacts directly with the RNA polymerase II to pre-load RNA polymerase II near the basal transcription complex.

Transcriptional Regulation of Gene Expression

Assembly of transcriptional complex-II

The carboxy terminal domain (CTD) of the largest subunit of RNA polymerase II is phosphorylated.

This results in promoter clearance. RNA polymerase II dissociates from the Transcription factors and other protein complexes that were required for assembly.

Assembly of transcriptional complex-III

Transcriptional Factors

Structural Motifs in Eukaryotic Transcription Factors

Helix-Loop-Helix (HLH) Zinc Fingers Leucine Zipper Helix-Turn-Helix (HTH)

Representative Transcription Factors Factor Sequence Motif Commentsc-Myc and Max CACGTG c-Myc first identified as retroviral oncogene; Max specifically

associates with c-Myc in cellsc-Fos and c-Jun

TGAC/GTC/AA both first identified as retroviral oncogenes; associate in cells, also known as the factor AP-1

CREB TGACGC/TC/A

G/A

binds to the cAMP response element; family of at least 10 factors resulting from different genes or alternative splicing; can form dimers with c-Jun

c-ErbA; alsoTR (thyroid hormone receptor)

GTGTCAAAGGTCA

first identified as retroviral oncogene; member of the steroid/thyroid hormone receptor superfamily; binds thyroid hormone

c-Ets G/CA/CGGAA/TGT/C

first identified as retroviral oncogene; predominates in B- and T-cells

GATA T/AGATA family of erythroid cell-specific factors, GATA-1 to -6

c-Myb T/CAACG/TGfirst identified as retroviral oncogene; hematopoietic cell-specific factor

MyoD CAACTGAC controls muscle differentiation

NF-(kappa)B and c-Rel

GGGAA/CTNT/CCC(1)

both factors identified independently; c-Rel first identified as retroviral oncogene; predominate in B- and T-cells

RAR (retinoic acid receptor)

ACGTCATGACCT

binds to elements termed RAREs (retinoic acid response elements) also binds to c-Jun/c-Fos site

SRF (serum response factor)

GGATGTCCATATTAGGACATCT

exists in many genes that are inducible by the growth factors present in serum

Eukaryotic Transcription initiation

A set of molecules needed are:

• TBP (TATA Box Binding Protein)

• Auxillary factors binds RNAP & associated Proteins

• RNA Polymerase II• Activator proteins

Eukaryotic Transcription

• RNA Polymerase transcribes the DNA into mRNA.