EUKARYOTIC CELL, July 2006, p. 1157–1168 Vol. 5, No. 71535-9778/06/$08.00�0 doi:10.1128/EC.00042-06Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Gene Expression Induced by Copper Stress in the DiatomThalassiosira pseudonana

Aubrey K. Davis, Mark Hildebrand, and Brian Palenik*Marine Biology Research Division, Scripps Institution of Oceanography, University of California—San Diego, La Jolla, California 92093

Received 10 February 2006/Accepted 26 April 2006

Utilizing a PCR-based subtractive cDNA approach, we demonstrated that the marine diatom Thalassiosirapseudonana exhibits a rapid response at the gene level to elevated concentrations of copper and that thisresponse attenuates over 24 h of continuous exposure. A total of 16 copper-induced genes were identified, 11of which were completely novel; however, many of the predicted amino acid sequences had characteristicssuggestive of roles in ameliorating copper toxicity. Most of the novel genes were not equivalently induced byH2O2- or Cd-induced stress, indicating specificity in response. Two genes that could be assigned functionsbased on homology were also induced under conditions of general cellular stress. Half of the identified geneswere located within two inverted repeats in the genome, and novel genes in one inverted repeat had mRNAlevels induced by �500- to 2,000-fold by exposure to copper for 1 h. Additionally, some of the inverted repeatgenes demonstrated a dose-dependent response to Cu, but not Cd, and appear to belong to a multigene family.This multigene family may be the diatom functional homolog of metallothioneins.

Copper (Cu) is an essential micronutrient required as aredox cofactor in a number of enzymes, including cytochromeoxidase, plastocyanin, and Cu/Zn superoxide dismutase. How-ever, due to the redox chemistry of Cu, it is a potent toxin atelevated concentrations, and organisms utilize homeostaticmechanisms to tightly control both the intracellular concentra-tion and activity of Cu (26).

One means of Cu detoxification includes the synthesis ofmetal-binding ligands. The primary types of described metal-binding ligands are metallothioneins and phytochelatins, whichare cysteine-rich protein molecules found in the plant andanimal kingdoms (9), with metallothioneins also occurring inthe prokaryotic genus Synechococcus (36). The amino acidsequences of metallothioneins are gene encoded, while phy-tochelatins are enzymatically produced by phytochelatinsynthase. Although both of these ligands have importantroles in metal detoxification, additional functions have notbeen ruled out, including roles in essential metal ion ho-meostasis. (For a review of phytochelatins and metallothio-neins, see reference 9.)

A number of transporter families contain members that spe-cifically transport metals, such as the cation diffusion facilitator(CDF) family (40), a subgroup of P-type ATPase transportersreferred to as P1B-type ATPases (initially named CPx-typeATPases) (4, 50), and certain ABC-type transporters (39, 53).Cu-transporting P-type ATPases have been identified in a widevariety of organisms and are important for Cu homeostasis.While most described Cu-transporting P-type ATPases are re-sponsible for exporting Cu(I) (4), a possible role in metaluptake has also been suggested (35, 42). The action of Cu-specific transporters can ameliorate the effects of Cu stress byeither excreting Cu from the cell or transporting it into com-

partments where it is sequestered away from sensitive cellularsites. Some prokaryotes (for a review of efflux-mediatedmetal resistance in prokaryotes, see reference 34) and theeukaryote Candida albicans (57) utilize dedicated extrusiontransporters to remove excess Cu from the cytoplasm. Yeast(39), plants (56), and diatoms (33) sequester excess metals,such as cadmium, zinc, or copper, into vacuoles, and inSchizosaccharomyces pombe this mechanism relies on anABC-type transporter localized to the vacuolar membrane(39). Escherichia coli utilizes a Cu-exporting P-type ATPaseto transport excess Cu into the periplasmic space and awayfrom the cytoplasm (45).

Eukaryotes can also down-regulate the synthesis of metaluptake transporters in response to excess Cu (27). In Saccha-romyces cerevisiae, both the nutritional Cu sensor, Mac1p, andthe toxic Cu sensor, Ace1p, are required for cell survival undertoxic conditions (41). In this role, Mac1p is responsible forsensing excess Cu and down-regulating high-affinity Cu uptaketransporters. Additionally, yeast proteolytically degrades high-affinity Cu uptake transporters at the plasma membrane whenexposed to elevated levels of Cu (37). Down-regulation andproteolytic degradation of uptake transporters presumablyprevent additional import of Cu into cells already experiencingtoxic levels.

Cu stress has environmental ramifications. Cu pollution isincreasing in coastal California waters (52) and is likelyincreasing in other coastal environments, which may affectthe growth and species composition of phytoplankton at thebase of aquatic food webs. Most abundant among these arediatoms, which are unicellular, eukaryotic microorganismsthat are typically photosynthetic (47) and encased in a shellmade of silica called a frustule. Diatoms are ecologicallyimportant because they are found throughout the world inboth freshwater and marine systems, are major constituentsof the base of aquatic food webs, are responsible for �20%of global carbon fixation (5, 58), and are the dominantcontributors to biosilicification (55).

* Corresponding author. Mailing address: Marine Biology ResearchDivision, Scripps Institution of Oceanography, University of Califor-nia—San Diego, La Jolla, CA 92093-0202. Phone: (858) 534-7505. Fax:(858) 534-7313. E-mail: bpalenik@ucsd.edu.

1157

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

Until recently, little molecular information about diatomswas available. However, the genome sequence of the marinediatom Thalassiosira pseudonana (5) is now publicly available(www.jgi.doe.gov/). T. pseudonana was originally isolated froma polluted estuary, and it is highly resistant to Cu and cadmium(7). Molecular mechanisms for this resistance are undescribed,but the presence of a genome sequence facilitates the study ofCu homeostasis and detoxification mechanisms in this unex-plored unicellular eukaryotic system. In order to understandthe cellular response of these ecologically important organismsto Cu, we utilized in this study a PCR-based subtractive cDNAapproach to identify Cu-responsive genes.

MATERIALS AND METHODS

Cell culture. An axenic culture of Thalassiosira pseudonana (Hustedt) Hasleand Heimdal clone 3H (CCMP 1335) was obtained from the Provasoli-GuillardNational Center for Culture of Marine Phytoplankton, Bigelow Laboratory forOcean Sciences. Cultures were grown in f/2 medium (15) made with 0.2-�m-filtered, autoclaved, local seawater. f/2 vitamins and inorganic nutrients (15) were0.2-�m-filter sterilized and added after autoclaving. Cultures were incubated at18°C under continuous cool white fluorescent light at approximately 119 �molquanta · m�2 · s�1. Sterility was monitored by occasional inoculation into tryp-tone-enriched media to check for bacterial growth (3). Cells intended for nucleicacid extraction were grown in batch cultures, and growth was monitored by cellcounts with a Petroff Hausser counting chamber. Small-scale growth studies totest various stress conditions were performed by growing a 1-liter culture to earlyexponential phase and then aliquoting 20 ml into 50-ml glass tubes to whichvarious concentrations of Cu, H2O2, or Cd were added. Growth was monitoredby measuring chlorophyll fluorescence on a Turner Designs fluorometer (model0-AU-000, with a red-sensitive photomultiplier) using filters with an excitationwavelength of �450 nm and an emission wavelength of �670 nm. Cell countswere also performed to confirm trends observed by measuring chlorophyll fluo-rescence.

Incubations to induce cell stress. For cDNA subtraction, T. pseudonana wasgrown in three 8-liter batch cultures in polycarbonate bottles to a density of �3 �105 cells · ml�1. Eight liters of exponentially growing culture were harvested asa control. CuSO4 was added to a final concentration of 10 �M to the remaining16 liters of exponentially growing culture, and cells were incubated for 1 h.

Cells subjected to Cu stress that were intended for real-time reverse tran-scriptase PCR (RT-PCR) analysis were grown in three 8-liter batch cultures to acell density of approximately 1.5 � 105 cells · ml�1. One culture was harvested asa control, and the other two cultures were incubated with 10 �M CuSO4 for 1and 24 h. Cultures were treated with cycloheximide to arrest mRNA translationat a final concentration of 20 �g/ml at 10 min before cells were harvested bycentrifugation for 15 min at 10,000 � g.

Cells subjected to H2O2 stress that were intended for RT-PCR analysis weregrown in three 8-liter batch cultures to an approximate density of 4 � 105 cells ·ml�1. One culture was harvested as a control, and the other two cultures wereincubated with 0.1 mM H2O2 for 1 and 24 h. Cells were harvested by filtrationonto 1-�m polycarbonate filters (GE Osmonics), resuspended in 30 ml of f/2,transferred to a 40-ml centrifuge tube, and pelleted at 10,000 � g for 10 min.

Metal titration incubations were performed as follows. Eight-liter batch cul-tures were grown to early exponential phase and divided into 1-liter aliquots, towhich increasing concentrations of either Cu (0, 0.1, 0.3, 1, 3, and 10 �M) or Cd(0, 0.1, 0.3, 1, 3, 10, and 30 �M) were added. Cells were incubated with the metalfor 1 h and harvested by filtration as described above.

RNA purification and reverse transcription. Total RNA was extracted with TriReagent (Sigma) as previously described (18). Contaminating genomic DNAwas removed from RNA intended for RT-PCR by using the RNeasy Mini Kit(QIAGEN) in conjunction with the RNase-free DNase Set (QIAGEN). AfterDNase treatment, mRNA was purified from total RNA extracted from cellsexposed to Cu for 1 and 24 h with the MicroPoly(A) Purist mRNA PurificationKit (Ambion) according to the manufacturer’s recommendations. mRNA wasnot purified from cells incubated with H2O2 or increasing concentrations of Cuor Cd; instead, total RNA was used for reverse transcription and RT-PCR,yielding comparable results. RNA was quantified with a fluorometric assay usingthe RiboGreen RNA Quantitation Assay Kit (Molecular Probes, Inc.) in a96-well microplate format according to the manufacturer’s recommendations.Fluorescence as a result of excitation at 532 nm was measured with a Typhoon

9410 instrument (Amersham Pharmacia Biotech) using the 526SP emission filter.An equivalent amount of total RNA or mRNA from each time point or metalconcentration in individual incubation experiments was reverse transcribed withSuperscript II RNase H� reverse transcriptase (Invitrogen) according to themanufacturer’s protocol. Reverse transcription was primed with oligo(dT)12–18

(Invitrogen) and carried out in the presence of RNasin (Promega) RNase inhib-itor. We confirmed that the RNA was free of contaminating genomic DNA byPCR using the resulting cDNA as a template and primers that encompassed anintron.

cDNA subtraction. cDNA subtraction was performed with the PCR-SelectcDNA Subtraction Kit (Clontech) as described by the manufacturer. Forwardand reverse subtraction libraries were designed to identify cDNAs whose expres-sion was increased or decreased, respectively, by Cu exposure. Briefly, forwardsubtraction was performed by converting mRNA populations from control andCu-exposed cells to double-stranded cDNA and digestion with RsaI to yieldblunt ends. cDNA from Cu-exposed cells, termed the “tester” cDNA population,was divided into two portions that were ligated with different adapters. cDNAfrom control cells, or “driver” cDNA, was added in excess and allowed tohybridize with each of the adapter-ligated tester populations. A second hybrid-ization was then performed between the two primary hybridization samples,allowing cDNAs unique to the tester population, and with different adapters, tohybridize. After hybridizations were complete, the overhanging adapters werefilled in with Taq DNA polymerase (Roche). Only cDNAs unique to the testerpopulation had different adapters at each end allowing exponential PCR ampli-fication. cDNAs having only one adapter, or the same adapter at each end, wouldamplify linearly, or form a secondary structure and not amplify, respectively. Thereverse subtraction was performed in the same way except that cDNA fromcontrol cells was used as the tester population and cDNA from Cu-exposed cellsacted as the driver population.

cDNA screening by autoradiography. Colony lifts of subtracted, clonedcDNAs onto Hybond N filters (Amersham) were performed as described previ-ously (48) except that DNA was cross-linked to the filters by UV exposure witha UV Stratalinker 1800 instrument (Stratagene). Filters were stripped (0.4 NNaOH) for 30 min at 65°C to remove residual bacterial debris and then neutral-ized (0.2 M Tris [pH 7.5], 0.1% sodium dodecyl sulfate, 0.1� SSC [1� SSC is 0.15M NaCl plus 0.015 M sodium citrate, pH 7]) for 30 min at 65°C. Filters were thenrinsed with water and prehybridized in hybridization solution (6� SSC, 0.25%nonfat dried milk). All hybridizations were performed at 55°C.

Probes were created from both the forward and reverse subtracted cDNAs.Products of the secondary PCR performed with nested adapter primers andsubtracted cDNAs as the template were digested with RsaI (New EnglandBiolabs) to remove the adapter sequence. This material was then sequentiallydigested with SmaI and EagI (New England Biolabs) to ensure the removal ofadapter sequence in the event that the RsaI site had been destroyed duringligation. Adapters were separated from cDNA with Sephacryl S-400 HR Micro-spin Columns (Amersham Biosciences). Probes were generated by random prim-ing in the presence of [32P]dCTP with the Prime-It II kit from Stratageneaccording to the manufacturer’s recommendations. Membranes containing for-ward and reverse subtracted cDNAs were first hybridized with the forward probe.Blots were then stripped as described above and hybridized with a probe madefrom the reverse cDNA library. Equivalent counts per minute of forward andreverse probes were added to the hybridization solution so that labeling intensitycould be directly compared. Clone 76 was selected to generate a probe to identifyhow many of the forward subtracted clones corresponded to the same or similargenes. The insert from clone 76 was PCR amplified, and the adapters wereremoved by digestion with NotI and EagI. DNA was excised from a 1% agarosegel and purified with the Rapid Gel Extraction System (Marligen Bioscience,Inc.). The probe was labeled by random priming as described above.

After overnight hybridization with the probe, filters were washed twice at roomtemperature in 2� SSC and 0.1% sodium dodecyl sulfate for 5 min and thentwice at 50°C for 40 min. Hybridization was imaged by exposing a general-purpose storage phosphor screen (Molecular Dynamics) to the radioactivelylabeled filters and subsequently scanning the screen with a Typhoon 9410 instru-ment (Amersham Pharmacia Biotech). The screen was exposed for equivalentamounts of time when forward and reverse subtracted cDNAs were used asprobes so that labeling intensity could be compared. Densitometry of labelingintensity was performed with ImageQuant software (Molecular Dynamics).

RT-PCR. mRNA levels corresponding to genes identified in the forward sub-tracted cDNA library were quantified after cells were exposed to Cu, Cd, orH2O2 by performing RT-PCR with a Lightcycler (Roche) and either the Light-Cycler DNA Master SYBR green I (Roche) or the Lithos qPCR MasterMix forSYBR green I (Eurogentec) DNA amplification kit. For genes on scaffold 73 thatwere highly induced, a 1:10 dilution was performed on the cDNA from 1 h of Cu

1158 DAVIS ET AL. EUKARYOT. CELL

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

exposure to prevent inhibition of target amplification due to excessive levels oftranscript. Additionally, replicate RT-PCRs were performed on the highly in-duced genes on scaffold 73, and the results of the replicates were averaged. A1:10 dilution of cDNA from cells exposed to H2O2 or increasing concentrationsof Cu or Cd was also performed. Table 1 lists primers used for each gene and thesize of the product amplified. A standard curve for each set of gene-specificprimers was generated from dilutions of genomic DNA. The crossing point foreach set of gene-specific primers was converted into nanogram equivalents withthe standard curve. In all experiments, the mRNA levels were then normalizedto mRNA levels in control cells. RT-PCR data are provided both graphically andin table format due to the logarithmic scale of the y axes in the figures.

RACE. To obtain full-length sequence, rapid amplification of cDNA ends(RACE) (13) was performed on a subset of copper-induced genes with the FirstChoice RLM-RACE kit from Ambion. Total RNA was ligated to an adapter atthe 5� end, and cDNA synthesis was initiated from an oligo(dT) primer contain-ing a 3� adapter sequence. Gene-specific primers were used in conjunction withprovided adapter primers to amplify 5� and 3� cDNA ends. PCR products wereexcised from a 1% agarose gel and purified with the Rapid Gel Extraction System(Marligen Bioscience, Inc).

Cloning, sequence determination, and analysis. PCR products resulting fromRACE and cDNA subtraction were cloned into pCR 2.1-TOPO vector (Invitro-gen) as recommended. RACE products were sequenced with BigDye TerminatorCycle Sequencing chemistry, version 3.1, on an ABI Prism 3100 Genetic Analyzer(Applied Biosystems). Cloned, subtracted cDNAs were sequenced either thisway or with DYEnamic ET Dye Terminator chemistry on a MegaBACE DNAAnalysis System (Amersham Biosciences) according to the manufacturer’s in-structions. The genome sequence of T. pseudonana is publicly available at www.jgi.doe.gov/. The browser window displays representations of genomic scaffoldsand contiguous assembled DNA sequence, as well as gene models based on Grailand Genewise prediction software. Amino acid sequence alignments were per-formed with CLUSTAL W (54), and signal peptides were predicted with SignalP(6). PredictNLS (10) was used to identify potential nuclear localization signals(NLSs), and transmembrane domains were predicted with TMHMM (51). Se-quence similarity searches were performed with BLAST (2), and conserveddomains were identified with SMART (28).

Nucleotide sequence accession numbers. cDNA sequences of characterizedCue genes have been deposited in the GenBank database (accession numbersDQ115006 to DQ115015). See Table 3 for a list of the Cue genes and corre-sponding accession numbers.

RESULTS

Subtraction library results. A forward subtracted cDNAlibrary was constructed to identify Cu-induced genes, yieldinga total of 143 clones. Fifty-six of the clones either could not besequenced or yielded poor-quality sequence. Many of theseclones had the same adapter ligated to both the 5� and 3� ends,which should have suppressed PCR amplification due to theformation of a secondary structure (49), thereby eliminatingthese cDNAs from the subtracted library. However, the sub-traction process is imperfect. These cDNA fragments werepresent in the subtracted library due to undesirable amplifica-tion and were omitted from further analysis. Seven clonescontained only vector sequence. In initial screening, we se-quenced 39 correctly subtracted clones and determined that 25were identical or nearly identical. One clone, 76, was selectedto generate a probe to quantify the number of clones corre-sponding to the same or similar genes. In addition to the 25sequenced clones, this probe strongly hybridized with an addi-tional 41 clones (data not shown) which were not sequenced.Therefore, a total of 66 clones out of 80 correctly subtractedclones represented the same or similar genes. In total, 17unique genes were identified in the forward subtracted cDNAlibrary, and the number of sequenced clones representing eachgene is shown in Table 2.

mRNA concentrations measured with RT-PCR. RT-PCRwas used to measure mRNA levels in Cu-exposed cells toconfirm that genes identified in the forward subtracted librarywere up-regulated and to observe expression patterns overtime. mRNA levels for each gene after 1 and 24 h of Cuexposure were normalized to levels measured in control cellsand displayed in Table 2 and Fig. 1A. Potential Cu-inducedgenes numbered 1 to 12, 14, 15, 18, and 19 were confirmed byRT-PCR to be induced by 1 h of Cu exposure (Table 2, Fig.1A; also see Fig. 3) and designated “Cu-expressed genes” (Cuegenes).

Cue genes located within an inverted repeat on scaffold 73 ofthe T. pseudonana genome. RT-PCR revealed that after 1 h ofCu exposure, mRNA concentrations corresponding to the Cuegenes located within an inverted repeat on genomic scaffold 73were between 500- and 2,000-fold higher than in control con-ditions (Table 2, Fig. 1). Replicate RT-PCRs were performed

TABLE 1. Oligonucleotides used in this study

Primer Orientation Sequence (5� to 3�) Fragmentsize (bp)a

1B Forward TCTCCCGAACGTCTTCAAGCCA1C Reverse ATCATTCCTCCACATAACAAAGG 3102C Reverse GCTTCCACACATGTTCACATTC 318b

3A Forward AGACGACGTGACGGTAATGGG3B Reverse AACATCGCCACTCTCATCGGAT 2804A Forward ACTATGCTCTACAGAAGGAGCTGAA4B Reverse ACTTCCAACCACCTTGTATGTCAC 422 (618)6A Forward AGATGGGCTTTCTTTCCTCTTGG6B Reverse CTATACAACCGCGTAAACAAATG 1487A Forward ACAAGGCACGCCATCCGCCG7B Reverse TCGGTACTACTCAGTCGCGTC 2918A Forward TTGCTGTTATCTCTGCTACTGCG8B Reverse TACCCTATTCCTCCTGGTTTAGG 2809A Forward TGGAGAGTTTCCTCCGGCGGT9B Reverse AAGGCTGTATAAAGTCGCAAACAT 27810A Forward CAAGAGTTTGAGACATCATGGTGA10B Reverse AACCATATGTCTCTACGGAAGGC 28011A Reverse ATCATAATCATCATCTTCTAAACTG11B Forward ATGACAAAGAGCGAAGAGAAGG 28512A ? GTTGAAGGCGTGTGCCATAGG12B ? ACAACCACACTTCGACGAGTAC 11913A Reverse? AGCGTTCTGTTGTAGGTCGAAG13B Forward? GGGAATATTAACCCGTTGTCCAT 20714A Forward ACACACCAAGGCATCAACAAGC14B Reverse GGCCTTATTGGAGAACGAGACA 26115A Forward CAACAATGTGCGTGCTCAGTATC15D Reverse ACAGCACGGTTGAATCCGTAGT 171 (283)16A Reverse TTGCTACCAGCACTCCTCCTCT16B Forward ACGTCTCCGCATTGGATCGCA 30917A Forward GAGTGGAAAGGCCGTCACTCAA17B Reverse ACTACCGCCCCAGGATGCGAT 12918B Reverse GCATGCATCTCCGTCGGGATC18A Forward ACTGTCCAAATTGCGGAGGTGG 32219A Forward TCGCCTGATCAAGGCTCAAGGA 277c

p150A Forward TTCAACGCATCTACTACAAGp150B Reverse GAGTGCAGCAGTGATGTAGAGC 334p150-likeA Forward TCCTGTGTGCGACGACCTTTCAp150-likeB Reverse ACTTCGTGGTACTCCCTCAACAT 306NR1 Forward CCTGGATACATTGGTGGAAGGATNR2 Reverse GGAGGCAAGATACGATTATCATG 106GPX1 F Forward CAAAGGCGACGTGCTATGCGTCGPX1 R Reverse GGCTCCTGAGCTCCAAACTGATT 192GPX2 F Forward TTCGGAGCAACTTTCCAGAGGTGGPX2 R Reverse TGCCCATAACTCTTGACAGCCCT 166GPX-like F Forward AAACTCCACCGCAAATACAAATCCGPX-like R Reverse CACGTAATCCTAGGAGGACCG 229Catalase F Forward GTTGATGATTCGGTTGGCTTGGCCatalase R Reverse AGTTGAGAGGTGCAAGACGGATG 101 (195)

a Genomic fragment sizes are in parentheses in cases in which the primersencompass an intron.

b Cue2 was amplified by primers 1B and 2C.c Cue19 was amplified by primers 18B and 19A.

VOL. 5, 2006 T. PSEUDONANA COPPER PROTEINS 1159

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

for each gene, and the average result is shown in Fig. 1A.These genes, Cue1, Cue2, Cue6, and Cue7, were the ones thatwere numerically highly represented in the forward subtractedcDNA library (Table 2). An additional pair of genes locatedwithin this inverted repeat and designated Cue18 and Cue19(Fig. 1B) were not represented in the subtracted library butwere determined by RT-PCR to also be highly induced by Cu(Table 2, Fig. 1). After 24 h of Cu exposure, mRNA levelscorresponding to the genes on scaffold 73 decreased to be-tween 4- and 25-fold higher than control levels.

Scaffold 73 could not be unambiguously assigned to a positionon the T. pseudonana chromosome map (5). The inverted repeaton scaffold 73 had a 3,279-bp single-copy spacer, and the individ-ual repeat regions encompassed 3,204 bp and 3,384 bp (Fig. 1B).Gene models on the T. pseudonana website were available forCue6 (grail.73.15.1), Cue7 (grail.73.16.1), Cue18 (grail.73.14.1),and Cue19 (grail.73.17.1) but not for Cue1 or Cue2.

5� and 3� RACE was performed to characterize full-lengthcDNA for Cue1, Cue2, Cue6, and Cue7. The full-length cDNAsof Cue1 and Cue2 were 560 bp and 585 bp, respectively; how-ever, both cDNAs coded for 134 amino acids, and the differ-

ence in length occurred only in the 3� untranslated region(UTR). Cue1 and Cue2 shared 99% similarity and 95% iden-tity at the amino acid level. Full-length cDNAs of Cue6 andCue7 were 1,035 bp and 1,025 bp, respectively, and Cue6 andCue7 shared 96% similarity and 93% identity at the amino acidlevel. Although the coding sequences for these gene pairs werenearly identical, the 3� UTRs for all four genes extended be-yond the inverted repeat and therefore were distinct for eachgene. Cue1, Cue2, Cue6, and Cue7 are related proteins, asdetermined by amino acid alignments (Fig. 2A), and collec-tively displayed 27% identity and 41% similarity. All of theseproteins share a 73-amino-acid domain, and Cue6 and Cue7are larger primarily due to a repeat of this domain. The do-main contains a number of potential metal-binding residues,including six cysteines and four methionines as well as sevenglutamic acid and seven aspartic acid residues.

Cue1 and Cue2 were predicted to contain an N-terminalsignal sequence as well as a putative NLS (Fig. 2A). Cue6 andCue7 were predicted to have a 23-amino-acid N-terminal sig-nal sequence (Fig. 2A). Amino acid searches using BLASTfailed to identify proteins with significant similarity (Table 3);therefore, all four of these proteins are novel. Cue1 and Cue2contain weak homology to a domain (pfam07172, GRP) (E �0.012) found in a protein family that includes glycine-rich pro-teins as well as proteins induced in response to various stresses.Statistically significant domains could not be identified in Cue6or Cue7.

Cue18 and Cue19 were characterized based solely on theirgene models and were fully contained within the inverted re-peat. Amino acid sequence alignment revealed 81% similarityand 80% identity between them (Fig. 2B). Their predictedcoding sequences differ primarily due to a stretch of aminoacids consisting of multiple repeats of proline-threonine-pro-line-leucine (PTPL) within Cue19 that are absent from Cue18.Both proteins are predicted to have identical 22-amino-acidN-terminal signal sequences. No proteins with similar se-quences were identified by BLAST searches (Table 3). Cue18and Cue19 were both enriched in potential metal-binding andacidic amino acids. Statistically significant domains were notidentified.

Cue genes located within an inverted repeat on scaffold 23(chromosome 9) of the T. pseudonana genome. Cue4 and Cue5were represented by one clone in the forward subtractedcDNA library (Table 1). These genes are completely containedwithin an inverted repeat of 2,390 bp on genomic scaffold 23,located within chromosome 9, and were 100% identical at theamino acid level. Gene models for Cue4 and Cue5 were avail-able: grail.23.58.1 and grail.23.68.1, respectively. However, full-length cDNA revealed that these models contained errors,including a miscalled start codon and an incorrectly designatedintron which omitted part of the coding sequence from thegene model. The corrected amino acid sequence of Cue4 andCue5 could not be assigned function based on BLAST analysis(Table 3). Due to the level of similarity of Cue4 and Cue5, itwas not possible to develop unique primers and it could not bedetermined whether mRNA levels measured by RT-PCR rep-resented one or both genes. Although also located within aninverted repeat, Cue4 and/or Cue5 had a substantially lowerlevel of expression and a different expression pattern thangenes located on scaffold 73. After a 1-h Cu treatment, mRNA

TABLE 2. RT-PCR results

Gene(s)

No. of clonessequenced

fromsubtracted

cDNA library

Cu-induced foldchange in

mRNA concn

H2O2-induced

foldchange in

mRNAconcn

1 h 24 h 1 h 24 h

Potential Cu-expressedgenesa

1 11 1,977 4 2.9 5.12 11 1,545 23 2 8.43 1 49 21 3.4 19.94, 5 1 1 2 0.4 56 14 1,826 11 2 0.97 14 1,249 7 1.1 0.78 1 46 5 1.5 1.19 1 4 1 2.7 2.110 1 7 2 3.7 3.211 2 1,101 203 2 2.312 1 8 3 1.4 2.213 1 0.4 0.4 — —14 1 2 2 1.8 2.615 2 13 2 1.5 5.116 1 0.9 0.1 — —17 1 0.6 0.8 — —18 0 514 16 0.8 4.619 0 772 25 0.8 11

Cu-expressed genesb

p150 0 2 26 1.3 4.7p150-like 0 1 2 2 1.4

Genes potentially involvedin H2O2 degradation

GPX1 0 0.8 0.3 1.4 0.7GPX2 0 1.5 1.1 1.3 1.6GPX-like 0 2.7 2.3 2.1 2.2Catalase 0 2 2.4 0.5 0.6

a Details of 1-h forward subtracted cDNA library and RT-PCR results. —, notdetermined.

b RT-PCR results for genes previously shown to be induced by 24 h of Cuexposure.

1160 DAVIS ET AL. EUKARYOT. CELL

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

levels of Cue4 and/or Cue5 remained close to those of controlcells but displayed a longer-term response to Cu by increasingby twofold after 24 h (Table 2, Fig. 3).

Characterization of additional Cue genes for which full-length cDNA was acquired. Cue10 was represented in the for-ward subtracted cDNA library by a single clone. To confirm thegene model prediction (grail.22.30.1), full-length cDNA forCue10 was acquired. Cue10 is not predicted to have an N-terminal signal sequence but does have one transmembranedomain. Additionally, particular amino acids, such as glycine(13.2%), serine (12.9%), aspartic acid (10.1%), histidine(7.7%) and methionine (6.8%), are highly represented inCue10, frequently occurring in uninterrupted stretches. Thisgene could not be assigned a function based on amino acidsimilarity searches (Table 3); however, the large proportion ofamino acids that are well suited to bind metals suggests thatCue10 may have a role in metal binding. Statistically significantdomains could not be identified in Cue10; however, it is pre-dicted to contain a coiled-coil region at the C terminal end.mRNA levels for Cue10 were sevenfold higher than controlcells after 1 h of Cu exposure, decreasing to twofold higherafter 24 h (Table 2, Fig. 3).

Cue11 and Cue15 were not predicted in the genome andwere characterized only after cDNA was obtained. Cue11 didnot contain a predicted N-terminal signal sequence, but it didcontain seven predicted transmembrane segments. AlthoughBLAST analysis identified proteins with similarity to Cue11

(highest E value at 8e–57), the sequences were bacterial, pu-tative, or uncharacterized membrane proteins to which nofunction was assigned (Table 3). Cue11 contains a domain ofunknown function (pfam03988, DUF347) (E � 8.1e–5) thatoccurs in a family of bacterial membrane proteins. After 1 h ofCu exposure, Cue11 was highly induced, at 1,101-fold, and thendecreased to 203-fold above control levels after 24 h (Table 2,Fig. 3).

Cue15 was predicted to have a 19-amino-acid N-terminalsignal sequence. BLAST analysis identified an unnamed pro-tein product (E � 1e–4) that is a “pathogenesis-related-1”homolog from Nicotiana tabacum as being most significantlysimilar to Cue15. Cue15 and the pathogenesis-related-1 pro-tein both contain a conserved domain (pfam00188, SCP),which belongs to a family of extracellular domains with noknown function. Cue15 was induced by 13-fold after 1 h of Cuexposure and decreased to 2-fold after 24 h (Table 2, Fig. 3).

Characterization of additional Cue genes for which full-length cDNA was not acquired. Cue3, Cue8, and Cue9 wererepresented in the genome by gene model numbers grail.35.48.1,grail.10.4.1, and grail.3.377.1, respectively. Although these genemodels were incomplete, appearing to be truncated at their 5�ends, they had reasonable similarity to genes of known function(Table 3); therefore, characterization of full-length cDNA wasnot pursued. These genes displayed a pattern of induction withCu exposure similar to that of other Cue genes examined(Table 2, Fig. 3) in that they were more highly induced after 1 h

FIG. 1. Cue genes located within an inverted repeat on genomic scaffold 73. (A) Gene induction after 1 and 24 h of copper exposure monitoredby measuring mRNA levels with RT-PCR. mRNA concentrations are means normalized to control cells that were not treated with Cu. Error barsindicate standard deviations from two technical RT-PCR replicates. Note that the y axis is a logarithmic scale. (B) Schematic diagram of theinverted repeat region, indicated by gray bars. Cue gene designations and orientations are shown. The figure is shown to scale except for theintervening region between the inverted repeats, which is indicated by a double bar.

VOL. 5, 2006 T. PSEUDONANA COPPER PROTEINS 1161

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

than 24 h. Cue3 was most similar to a serine protease fromBdellovibrio bacteriovorus (E � 2e–37) and contained a domainfound in serine protease, trypsin family proteins (IPR001254).The characterized portion of Cue8 contains the HSF-typeDNA-binding domain (IPR000232) and a leucine zipper(IPR002158) and has significant similarity (E � 3e–12) to aHSTF from Danio rerio (zebrafish). Cue9 contains a RNase IIdomain (IPR001900) and was found to be significantly similar(E � 3e–88) to a hypothetical RNase II, RNB protein family

member from Schizosaccharomyces pombe that is similar to thegene dis3.

Cue12 and Cue14 were not predicted in the genome. 5�RACE was unsuccessful for Cue14; however, the 3� end con-sisted of 730 bp, coding for 160 amino acids. BLAST analysisfailed to identify amino acid sequences similar to this portionof the protein. Cue14 was induced by twofold at 1 h andremained at that level after 24 h of Cu exposure (Table 1, Fig.3). Neither 5� nor 3� RACE was successful for Cue12. It was

FIG. 2. Amino acid sequence comparisons of predicted Cue proteins located within an inverted repeat on genomic scaffold 73. Alignments wereperformed with CLUSTAL W (1.81) (54). Sequences are identified on the left, and amino acid residue numbers are indicated on the right. Dashesin sequences were introduced to facilitate maximum alignment. Below the sequences, asterisks denote amino acid residues conserved in allsequences and dots indicate conservative replacements. Signal sequences were predicted with SignalP 3.0 (6) and are enclosed within light grayboxes. (A) Alignment of Cue1, Cue2, Cue6, Cue7. The repeated domain in Cue6 and Cue7 is encompassed within unshaded boxes. PredictNLS(10) identified a potential NLS in Cue1 and Cue2, denoted by dark gray boxes. (B) Alignment of Cue18 and Cue19.

1162 DAVIS ET AL. EUKARYOT. CELL

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

possible to translate the short DNA fragment obtained fromthe subtracted library in two frames; however, BLAST analysisfailed to identify homologous amino acid sequences for eitherframe. Cue12 was induced by eightfold at 1 h and decreased tothreefold after 24 h of Cu exposure (Table 1, Fig. 3).

Genes down-regulated by copper stress. RT-PCR resultsrevealed that potential Cu-expressed genes 13, 16 and 17 werefalse positives and demonstrated a decrease in mRNA concen-tration relative to controls after Cu exposure (Table 2). Toserve as an example of a gene down-regulated by Cu stress, aclone was examined from the reverse subtracted cDNA library.Based on sequence similarity, this clone was found to representnitrate reductase (NR) and was confirmed by RT-PCR to be

down-regulated after Cu exposure for 1 h (Fig. 3). After 24 h,NR expression returned to levels slightly above those mea-sured in control cells (Fig. 3).

Expression patterns: Cue genes and previously character-ized, copper-induced proteins. Most of the Cue genes werehighly induced at 1 h and maintained an elevated but attenu-ating expression level after 24 h of exposure (Table 2, Fig. 1A,Fig. 3), which is consistent with a rapid and then attenuatingmetal stress response. We compared this response to that ofp150, a protein known to accumulate on the cell surface of T.pseudonana after 24 h of Cu exposure, as well as with a p150-like gene identified in the genome (11). In contrast to most ofthe Cue genes characterized in this study, the expression pat-

FIG. 3. Changes in mRNA concentrations corresponding to identified genes, other than those presented in Fig. 1, measured by RT-PCR after1 and 24 h of copper exposure. mRNA concentrations were normalized to control cells and are expressed in relative units. Note that the y axis isa logarithmic scale. RT-PCR results for p150, a gene whose induction by 24 h of copper exposure has already been described (11), as well as resultsfor a similar gene within the genome, designated “p150-like,” are shown as examples of genes known to be induced by copper stress. Nitratereductase (NR) was identified in a subtracted cDNA library enriched in genes down-regulated by 1 h of copper exposure and is included as anexample of a down-regulated gene.

TABLE 3. Features of Cue genes

Gene cDNA size(bp)

No. ofamino acids

No. ofintrons

Invertedrepeat Putative gene function E valuea Accession

no.

Genes for which completecDNA was obtainedb

Cue1 560 134 0 Yes Unknown NS DQ115006Cue2 585 134 0 Yes Unknown NS DQ115007Cue4 766 198 2 Yes Unknown NS DQ115008Cue5 766 198 2 Yes Unknown NS DQ115009Cue6 1,035 280 0 Yes Unknown NS DQ115010Cue7 1,025 286 0 Yes Unknown NS DQ115011Cue10 1,336 365 0 No Unknown NS DQ115012Cue11 1,207 331 1 No Putative membrane protein (B. pseudomallei) 8e–57 DQ115013Cue15 853 243 1 No Unnamed protein product; a pathogenesis-

related-1 homolog (N. tabacum)1e–4 DQ115014

Cue18* 678 225 0 Yes Unknown NSCue19* 831 276 0 Yes Unknown NS

Partially characterized genesCue3 1,326 441 2 No Trypsin protease (B. bacteriovorus) 2e–37Cue8 1,824 607 NDc No Heat shock transcription factor 1 (D. rerio) 3e–12Cue9 2,013 670 1 No Ribonuclease II RNB family protein; dis3-

like (S. pombe)3e–88

Cue12 115 ND ND No Unknown NSCue14 484 160 ND No Unknown NS DQ115015

a NS, not significant.b *, features of Cue18 and Cue19 are based on gene models.c ND, not determined.

VOL. 5, 2006 T. PSEUDONANA COPPER PROTEINS 1163

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

terns of the p150 and p150-like genes (Table 2, Fig. 3) suggestthat they are part of a longer-term response that may includesecondary effects of Cu toxicity, such as cell cycle arrest (11).

Behavior of Cue and other genes during stress induced byH2O2 exposure compared to Cu exposure. To determinewhether Cue genes responded to other cellular stresses, theirbehavior was examined in cells experiencing H2O2-inducedstress for 1 and 24 h. We first determined H2O2 levels thatinduced stress in T. pseudonana (Fig. 4A). H2O2 concentra-tions at or below 0.05 mM had no effect on growth relative tocontrols (Fig. 4A), and concentrations at 0.5 mM (Fig. 4A) orabove (data not shown) resulted in cell death. Growth wasinhibited by 0.1 mM H2O2 for at least 24 h after addition;however, cells were able to achieve control levels after 48 hprobably due to the destruction of H2O2 in the culture tubes.Because 0.1 mM H2O2 induced cell stress but not cell death,

similar to the Cu treatment, this concentration was used tomonitor the response of the Cue genes to H2O2-induced stressfor up to 24 h. In general, the timing and magnitude of theresponse of most of the Cue genes to H2O2 stress is differentfrom that for Cu stress (Table 2, Fig. 4B). For example, Cuegenes located in the inverted repeat on scaffold 73, Cue11,and Cue8 were much more highly induced by 1 h of Cuexposure than by H2O2 exposure. The response of these andmost other Cue genes attenuates after 24 h of Cu exposure;however, attenuation does not generally occur with H2O2

exposure (Fig. 4B).The response of additional non-Cue genes to H2O2 stress

was also examined. The p150 gene displayed a response overtime (i.e., increasing mRNA level with length of exposure)similar to that with Cu stress but at a lower magnitude (Table2, Fig. 4B). The p150-like gene was not highly induced by

FIG. 4. Effects of H2O2 exposure on T. pseudonana. (A) Growth of T. pseudonana exposed to various concentrations of H2O2. Cell growth wasfollowed by measurement of chlorophyll fluorescence, and results are presented in relative fluorescence units (RFU). Results shown are of arepresentative growth experiment. Cells grown in batch culture were aliquoted into different treatment conditions on day 0. Error bars representstandard deviations for replicate cultures and are contained within the corresponding symbol when not visible. (B) Gene expression changesmonitored by measuring mRNA levels with RT-PCR after 1 and 24 h of exposure to 0.1 mM H2O2. mRNA concentrations were normalized tocontrol cells and are expressed in relative units. Note that the y axis is a logarithmic scale. mRNA levels from copper-exposed cells are alsopresented for comparison and are represented as dashed lines and bars.

1164 DAVIS ET AL. EUKARYOT. CELL

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

either stressor, but levels appeared to be slightly higher after a1-h exposure to H2O2 than a 24-h exposure (Table 2, Fig. 4B).Genes potentially involved in H2O2 degradation, including glu-tathione peroxidase gene 1 (GPX1) and GPX2, as well as aglutathione peroxidase homolog (GPX-like), and a catalasegene were annotated in the T. pseudonana genome (newV2.0.genewise.27.59.1, newV2.0genewise.61.23.1, genewise.32.213.1,and grail.151.10.1, respectively) and were examined in an at-tempt to monitor oxidative stress at the transcription level(Table 2, Fig. 4B). The response of these genes to either

stressor was minimal. GPX1 and GPX2 were either down-regulated or close to control levels upon exposure to either Cuor H2O2. The GPX-like gene appeared to be slightly induced (2-to 2.7-fold increase in mRNA) by both conditions of stress. Thecatalase gene was induced approximately twofold by Cu exposurebut was down-regulated by H2O2 exposure. Multilevel (includingposttranscriptional and posttranslational) regulation of antioxi-dant enzymes has been described for a number of organisms (8,44), and the level of regulation of antioxidant genes in T. pseud-onana is not known at this time, which may explain these results.

FIG. 5. Effects of Cu and Cd exposure on T. pseudonana. Growth of T. pseudonana exposed to various concentrations of Cu (A) and Cd (B) isshown. Cell growth was followed by measurement of chlorophyll fluorescence, and results are presented in relative fluorescence units (RFU).Results shown are of representative growth experiments. Cells grown in batch culture were aliquoted into various treatment conditions on day 0.Error bars represent standard deviations for replicate cultures and are contained within the corresponding symbol when not visible. Expressionchanges of a subset of Cue genes were monitored by measuring mRNA levels with RT-PCR after cells had been exposed for 1 h to either Cu (C) orCd (D) at the concentrations indicated in the keys at right. Note that the y axes are logarithmic scales.

VOL. 5, 2006 T. PSEUDONANA COPPER PROTEINS 1165

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

Responses of Cue genes to increasing concentrations of Cuand Cd. To further evaluate the specificity of the response ofCue genes to Cu, the dose-dependent behaviors of these genesto different concentrations of Cu and Cd were examined.Small-scale experiments were performed to determine the ef-fects of various Cu or Cd concentrations on cell growth (Fig.5A and B). Final Cu or Cd concentrations at or below 3 �Mdid not inhibit growth. However, 10 �M Cu halted cell growthand 30 �M Cu resulted in cell death (Fig. 5A). A concentrationof 10 �M Cd inhibited growth compared to controls; however, 30�M Cd was required to completely halt growth (Fig. 5B). Theexpression behaviors of select Cue genes were monitored in con-centrations of Cu and Cd that did not result in cell death. For Cu,all six Cue genes within the inverted repeat on scaffold 73 wereexamined, as well as the highly Cu-induced Cue11 gene (Table 4,Fig. 5C). In addition to these genes, Cue3, Cue8, and Cue9 weremonitored in Cd-exposed cells (Table 4, Fig. 5D).

Cue1 and Cue2 displayed a dose-dependent response to in-creasing Cu concentrations (Table 4, Fig. 5C); however, theywere down-regulated by all but the lowest concentration of Cd,further suggesting their specificity for Cu. The pattern of in-duction of Cue6, Cue7, Cue11, Cue18, and Cue19 was slightlydifferent in that mRNA levels were dependent on Cu concen-tration but only when cells were exposed to at least 3 �M Cu.All of the Cue genes examined were moderately induced incells exposed to the lowest concentration of Cd (0.1 �M);however, mRNA levels did not consistently increase with in-creasing concentrations of Cd (Table 4, Fig. 5D), as was ob-served for Cu. In addition, the magnitude of the induction ofthese genes by Cd was substantially lower (Fig. 5D) than withCu exposure (Fig. 5C). Although the two highest Cd concen-trations tested (10 and 30 �M) inhibited cell growth, mRNAlevels for most of the Cue genes at these concentrations werelower than in control cells. Cue3 was induced at all Cd con-centrations without a consistent trend, with the highest induc-

tion being 10.4-fold at 3 �M Cd. Cue9 was induced at Cdconcentrations at or below 3 �M, above which it was down-regulated.

DISCUSSION

Using subtractive hybridization, we identified 16 genes inducedby 1 h of Cu stress. Two sets of them were located in invertedrepeats. All of the genes located within the inverted repeat onscaffold 73 were functional and highly induced by Cu, did notcontain introns, and encoded novel proteins (Table 3). Cue1,Cue2, Cue6, and Cue7 were related, based on amino acid align-ments (Fig. 2A), and we refer to them as the Cue1 gene family.All of these proteins were predicted to contain N-terminal signalsequences (Fig. 2); however, Cue1 and Cue2 also contained apotential NLS (Fig. 2A), suggesting that members of this genefamily may perform similar functions in different cellular com-partments, such as the nucleus and chloroplast.

Many proteins that have the ability to sequester and trans-port heavy metals contain a CXXC metal-binding motif (whereX is any amino acid) (12, 38), although this motif can also befound in some non-metal-binding domains. A repeated CXCsequence is a key structural motif present in all metallothio-nein classes (21, 32). Cue1, Cue2, Cue6, and Cue7 share a73-amino-acid domain enriched in charged amino acids, suchas aspartic and glutamic acid, and containing cysteine andmethionine residues; the functional groups in the side chains ofthese amino acids are particularly well suited for metal coor-dination (22). Cue6 and Cue7 are longer than Cue1 and Cue2primarily due to a repeat of this domain (Fig. 2A), whichcontains the sequence CXCC. Cue18 and Cue19 are also richin cysteine and aspartic acid residues, and Cue18 contains asingle CXXC motif. These characteristics, plus the high andapparently specific induction of the Cue1 gene family, suggestthat they may bind Cu and possibly other metals with bothcharacterized and novel metal-binding motifs.

Metallothioneins are characterized as low-molecular-weight,cysteine-rich, metal-binding proteins that contain CXC clus-ters. Metallothioneins are typically part of multigene families(9, 23, 24) and in plants occur in gene clusters, which have beendescribed within inverted repeats (as seen with the Cue1 genefamily [Fig. 1B]) (9) and tandem arrays (20). Amplification ofmetallothionein genes has been observed in a variety of organ-isms in cells selected for enhanced tolerance to certain tracemetals (16, 46, 59). Munger et al. (31), working on the asco-mycete Neurospora crassa, demonstrated that in response toCu shock metallothionein mRNA increased, attaining maxi-mum levels at 1 h after addition of Cu, and then rapidlydecreased to initial concentrations (as also seen with the Cue1gene family [Fig. 1A]) after metallothionein protein was syn-thesized. The transcription of metallothionein in Saccharomy-ces cerevisiae is similarly negatively autoregulated (17).

While metallothioneins from diatoms have not been char-acterized, a number of incomplete gene models in the T. pseudo-nana genome were identified as having some similarity to me-tallothioneins or metallothionein-like proteins. The mostsignificantly matching metallothionein-like gene models in T.pseudonana were similar to tesmin, which is a metal-bindingtranscription factor (29). Similarity searches against the T.pseudonana genome using several described plant and fungal

TABLE 4. Changes in mRNA expression of selected Cue genesupon exposure to Cu or Cd for 1 h

GeneChange in mRNA expression at Cu or Cd concn (�M) of a:

0.1 0.3 1 3 10 30

Cu exposureCue1 1.8 4 16.4 365.2 5376.1 NDCue2 1.5 2.4 5.6 476.7 7585.3 NDCue6 0.8 1.2 1.9 28.3 553.9 NDCue7 0.7 1.2 0.6 18 442.6 NDCue11 1 1 1 67.4 3578.6 NDCue18 1.1 0.8 0.7 1.5 13.9 NDCue19 0.4 2.2 0.7 3.3 46.3 ND

Cd exposureCue1 7.5 0.3 0.3 0.9 0.01 0.03Cue2 2.8 0.4 0.1 0.4 0.1 0.4Cue3 4.2 2 2.2 10.4 2 1.3Cue6 9 1.4 1.9 2.7 0.7 1.1Cue7 11.1 1.1 3.4 4.3 2.5 1.2Cue8 0.9 1.3 0.8 2.4 0.9 0.2Cue9 8.2 3.1 8.9 10.9 0.7 0.6Cue11 25.1 0.2 1.8 4.8 0.9 1.3Cue18 1.1 0.4 4.9 2.3 0.03 1.4Cue19 8.4 2.3 2.4 7.1 7.4 0.004

a ND, not determined.

1166 DAVIS ET AL. EUKARYOT. CELL

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

metallothioneins failed to identify strict homologs; however,similarity searches may not be effective due to the diversenature of class II metallothioneins (9, 21). Metallothioneinhomologs were not represented in the subtracted cDNA li-brary. If true homologs are absent in T. pseudonana, this sug-gests that the relatively small, cysteine-rich proteins from theCue1 gene family could be functional homologs to the metal-lothioneins; however, direct proof of this function will requiremetal-binding studies.

Cadmium is the most effective inducer of phytochelatin syn-thase in plants (14) and in the diatom T. weissflogii (1). Phy-tochelatin synthase genes were identified in the T. pseudonanagenome (5) but were not represented in the subtracted cDNAlibrary. In organisms equipped to synthesize both ligands, phy-tochelatins are induced by cadmium exposure while metallo-thioneins are produced in response to Cu (30, 60), which mayexplain the absence of phytochelatin synthase genes in thesubtracted library. Alternatively, it is possible that in T. pseudo-nana phytochelatin synthase is constitutively expressed, as hasbeen described for many organisms (9).

A gene similar to Cu-transporting P-type ATPases in otherorganisms was identified in the T. pseudonana genome(newV2.0.genewise.122.68.1); however, this gene was not rep-resented in our subtracted cDNA library. While Cu-transport-ing P-type ATPases are present in most organisms and areinvolved in Cu homeostasis, the P-type ATPase homolog in T.pseudonana has not been characterized; therefore, the level ofgene regulation and direction of Cu transport by the resultingprotein have yet to be determined. However, Cue11 was iden-tified in our cDNA library, was highly Cu inducible, and waspredicted to contain seven transmembrane segments. Cue11 issignificantly similar (E � 6e–51) to COG4705, which repre-sents an uncharacterized membrane-anchored protein con-served in bacteria. Since transporters typically contain multipletransmembrane segments, it is tempting to speculate thatCue11 could be a novel type of Cu or Cu chelate transporter.

The Cue genes that had clear homologs were identified as aserine protease (Cue3), a heat shock-like transcription factor(HSTF) (Cue8), and an RNase (Cue9), all of which may facil-itate a cell’s response to changing conditions. Proteases areinduced by cellular stress and are required to prevent damagedand abnormally formed proteins from accumulating within thecell (19), as well as to enable the cell to reduce the level of aprotein if its presence becomes disadvantageous. Similarly, theinduction of Cue8, an HSTF, may allow the cell to induce thetranscription of genes required to respond to conditions ofcellular stress. Cue9 was similar to dis3, which is essential formitotic control (25) and is a component of the exosome, acomplex consisting primarily of exoribonucleolytic proteinsthat is involved in maintaining correct RNA levels in eukary-otic cells (43). Induction of an exoribonucleolytic protein mayfacilitate changes in mRNA levels as a result of cellular stress.

Because Cue3 and Cue9 were also induced by H2O2 (Table2, Fig. 4B) and most Cd concentrations examined (Table 4,Fig. 5D), they may represent general stress response genes.Although Cue4, Cue5, and Cue14 represent novel genes, theywere similarly or more highly induced by H2O2 than by Cu atall times examined and may also represent genes that respondto general or oxidative stress. In contrast, the response of Cue8to Cu was decidedly higher than to either H2O2 or Cd, sug-

gesting that it may be a transcription factor involved in aCu-specific response.

Evaluation of the responses of selected Cue genes to stressinduced by H2O2 revealed that most of the Cue genes were muchmore highly induced by short-term Cu stress than by H2O2 stress.In general, the timing and magnitude of the response of the Cuegenes to H2O2 was different from that for Cu exposure (Fig. 4B).Some of the Cue genes were similarly induced by both stressorsafter 24 h; however, the response to long-term exposure mayinclude secondary effects. Overall, these results suggest that mostof the Cue genes respond specifically to Cu.

To further evaluate specificity, we tested the responses ofselected Cue genes to different concentrations of Cu and Cd. Inthe ascomycete N. crassa, Cu metallothionein mRNA levelswere strongly dependent on the Cu ion concentration in themedium, and these metallothioneins did not respond to othermetals, including Cd, Co, Ni, and Zn (31). Cue1 and Cue2responded to Cu in a dose-dependent manner, and Cue6,Cue7, Cue18, Cue19, and Cue11 were strongly induced at a Cuconcentration that did not significantly affect cell growth (Fig.5A and C), a response consistent with the idea that these geneproducts ameliorate the effects of high Cu levels. The levels ofinduction of Cue genes examined in this titration experimentvaried from previous results (Table 2, Fig. 1A, Fig. 3); how-ever, these data were obtained from independent incubationexperiments, and it is not unexpected that induction levels mayvary due to slight differences between cultures, such as celldensity upon metal exposure. In contrast to their strong Curesponse, this subset of Cue genes did not demonstrate a strongresponse or pattern of induction upon Cd exposure. While itcannot be concluded that this subset of Cue genes is completelyCu specific, its involvement in a general stress response (withCd and H2O2 used as examples) can be ruled out.

ACKNOWLEDGMENTS

We thank Eric Allen, Jon Flowers, and Chris Willis for helpfuladvice and the University of California Toxic Substances Research andTraining Program for providing a forum for discussing these researchresults at annual meetings and retreats. We thank anonymous review-ers for improving the manuscript.

Funding for this research was provided by an Environmental Pro-tection Agency STAR Exploratory Research Grant (R827107-01-0)and a National Science Foundation graduate fellowship. Instrumenta-tion used here was purchased with support from a National ScienceFoundation MRI Grant (0115801).

REFERENCES

1. Ahner, B., and F. M. M. Morel. 1995. Phytochelatin production in marinealgae. 2. Induction by various metals. Limnol. Oceanogr. 40:658–665.

2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.Basic local alignment search tool. J. Mol. Biol. 215:403–410.

3. Andersen, R. A., S. L. Morton, and J. P. Sexton. 1997. Provasoli-GuillardNational Center for Culture of Marine Phytoplankton. J. Phycol. 33(Suppl.):1–75.

4. Arguello, J. M. 2003. Identification of ion-selectivity determinants in heavy-metal transport P1B-type ATPases. J. Membr. Biol. 195:93–108.

5. Armbrust, E. V., J. A. Berges, C. Bowler, B. R. Green, D. Martinez, N. H.Putnam, S. G. Zhou, A. E. Allen, K. E. Apt, M. Bechner, M. A. Brzezinski, B. K.Chaal, A. Chiovitti, A. K. Davis, M. S. Demarest, J. C. Detter, T. Glavina, D.Goodstein, M. Z. Hadi, U. Hellsten, M. Hildebrand, B. D. Jenkins, J. Jurka,V. V. Kapitonov, N. Kroger, W. W. Y. Lau, T. W. Lane, F. W. Larimer, J. C.Lippmeier, S. Lucas, M. Medina, A. Montsant, M. Obornik, M. S. Parker, B.Palenik, G. J. Pazour, P. M. Richardson, T. A. Rynearson, M. A. Saito, D. C.Schwartz, K. Thamatrakoln, K. Valentin, A. Vardi, F. P. Wilkerson, and D. S.Rokhsar. 2004. The genome of the diatom Thalassiosira pseudonana: ecology,evolution, and metabolism. Science 306:79–86.

6. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improvedprediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783–795.

VOL. 5, 2006 T. PSEUDONANA COPPER PROTEINS 1167

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

7. Brand, L. E., W. G. Sunda, and R. R. L. Guillard. 1986. Reduction of marinephytoplankton reproduction rates by copper and cadmium. J. Exp. Mar. Biol.Ecol. 96:225–250.

8. Clerch, L. B. 2000. Post-transcriptional regulation of lung antioxidant en-zyme gene expression. Ann. N. Y. Acad. Sci. 899:103–111.

9. Cobbett, C., and P. Goldsbrough. 2002. Phytochelatins and metallothioneins:roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant Biol.53:159–182.

10. Cokol, M., R. Nair, and B. Rost. 2000. Finding nuclear localization signals.EMBO Rep. 1:411–415.

11. Davis, A., M. Hildebrand, and B. Palenik. 2005. A stress-induced proteinassociated with the girdle band region of the diatom Thalassiosira pseudo-nana (Bacillariophyta). J. Phycol. 41:577–589.

12. DeSilva, T. M., G. Veglia, F. Porcelli, A. M. Prantner, and S. J. Opella. 2002.Selectivity in heavy metal-binding to peptides and proteins. Biopolymers64:189–197.

13. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production offull-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998–9002.

14. Grill, E., S. Loffler, E.-L. Winnacker, and M. H. Zenk. 1989. Phytochelatins,the heavy-metal-binding peptides of plants, are synthesized from glutathioneby a specific gamma-glutamylcysteine dipeptidyl transpeptidase (phytochelatinsynthase). Proc. Natl. Acad. Sci. USA 86:6838–6842.

15. Guillard, R. R. L. 1975. Culture of phytoplankton for feeding marine inver-tebrates, p. 29–60. In W. L. Smith and M. H. Chanley (ed.), Culture ofmarine invertebrate animals. Plenum Press, New York, N.Y.

16. Gupta, A., B. A. Whitton, A. P. Morby, J. W. Huckle, and N. J. Robinson.1992. Amplification and rearrangement of a prokaryotic metallothioneinlocus smt in Synechococcus PCC6301 selected for tolerance to cadmium.Proc. R. Soc. Lond. B 248:273–281.

17. Hamer, D. H., D. J. Thiele, and J. E. Lemontt. 1985. Function and autoreg-ulation of yeast copperthionein. Science 228:685–690.

18. Hildebrand, M., and K. Dahlin. 2000. Nitrate transporter genes from thediatom Cylindrotheca fusiformis (Bacillariophyceae): mRNA levels con-trolled by nitrogen source and by the cell cycle. J. Phycol. 36:702–713.

19. Hilt, W., and D. H. Wolf. 1996. Proteasomes: destruction as a programme.Trends Biochem. Sci. 21:96–102.

20. Hudspeth, R. L., S. L. Hobbs, D. M. Anderson, K. Rajasekaran, and J. W.Grula. 1996. Characterization and expression of metallothionein-like genesin cotton. Plant Mol. Biol. 31:701–705.

21. Kagi, J. H. R. 1993. Evolution, structure and chemical activity of class Imetallothioneins: an overview, p. 1–55. In K. T. Suzuki, N. Imura, and M.Kimura (ed.), Metallothionein III: biological roles and medical implications.Birkhauser Verlag, Basel, Switzerland.

22. Kaim, W., and B. Schwederski. 1991. Bioinorganic chemistry: inorganicelements in the chemistry of life. John Wiley & Sons, New York, N.Y.

23. Karin, M., and R. I. Richards. 1982. Human metallothionein genes—pri-mary structure of the metallothionein-II gene and a related processed gene.Nature 299:797–802.

24. Kawashima, I., T. D. Kennedy, M. Chino, and B. G. Lane. 1992. Wheat Ecmetallothionein genes. Like mammalian Zn2� metallothionein genes, wheatZn2� metallothionein genes are conspicuously expressed during embryogen-esis. Eur. J. Biochem. 209:971–976.

25. Kinoshita, N., M. Goebl, and M. Yanagida. 1991. The fission yeast dis3�

gene encodes a 110-kDa essential protein implicated in mitotic control. Mol.Cell. Biol. 11:5839–5847.

26. Labbe, S., and D. J. Thiele. 1999. Pipes and wiring: the regulation of copperuptake and distribution in yeast. Trends Microbiol. 7:500–505.

27. Labbe, S., Z. Zhu, and D. J. Thiele. 1997. Copper-specific transcriptionalrepression of yeast genes encoding critical components in the copper trans-port pathway. J. Biol. Chem. 272:15951–15958.

28. Letunic, I., R. R. Copley, S. Schmidt, F. D. Ciccarelli, T. Doerks, J. Schultz,C. P. Ponting, and P. Bork. 2004. SMART 4.0: towards genomic data inte-gration. Nucleic Acids Res. 32:D142–D144.

29. Matsuura, T., Y. Kawasaki, K. Miwa, S. Sutou, Y. Ohinata, F. Yoshida, andY. Mitsui. 2002. Germ cell-specific nucleocytoplasmic shuttling protein,tesmin, responsive to heavy metal stress in mouse testes. J. Inorg. Biochem.88:183–191.

30. Mehra, R. K., J. R. Garey, T. R. Butt, W. R. Gray, and D. R. Winge. 1989.Candida glabrata metallothioneins. J. Biol. Chem. 264:19747–19753.

31. Munger, K., U. A. Germann, and K. Lerch. 1987. The Neurospora crassametallothionein gene. J. Biol. Chem. 262:7363–7367.

32. Munger, K., and K. Lerch. 1985. Copper metallothionein from the fungusAgaricus bisporus: chemical and spectroscopic properties. Biochemistry 24:6751–6756.

33. Nassiri, Y., J. L. Mansot, J. Wery, T. Ginsburger-Vogel, and J. C. Amiard.1997. Ultrastructural and electron energy loss spectroscopy studies of se-

questration mechanisms of Cd and Cu in the marine diatom Skeletonemacostatum. Arch. Environ. Contam. Toxicol. 33:147–155.

34. Nies, D. H. 2003. Efflux-mediated heavy metal resistance in prokaryotes.FEMS Microbiol. Rev. 27:313–339.

35. Odermatt, A., H. Suter, R. Krapf, and M. Solioz. 1993. Primary structure oftwo P-type ATPases involved in copper homeostasis in Enterococcus hirae.J. Biol. Chem. 268:12775–12779.

36. Olafson, R. W., W. D. McCubbin, and C. M. Kay. 1988. Primary- andsecondary-structural analysis of a unique prokaryotic metallothionein from aSynechococcus sp. cyanobacterium. Biochem. J. 251:691–699.

37. Ooi, C. E., E. Rabinovich, A. Dancis, J. S. Bonifacino, and R. D. Klausner.1996. Copper-dependent degradation of the Saccharomyces cerevisiae plasmamembrane copper transporter Ctr1p in the apparent absence of endocytosis.EMBO J. 15:3515–3523.

38. Opella, S. J., T. M. DeSilva, and G. Veglia. 2002. Structural biology ofmetal-binding sequences. Curr. Opin. Chem. Biol. 6:217–223.

39. Ortiz, D. F., L. Kreppel, D. M. Speiser, G. Scheel, G. McDonald, and D. W. Ow.1992. Heavy metal tolerance in the fission yeast requires an ATP-binding cas-sette-type vacuolar membrane transporter. EMBO J. 11:3491–3499.

40. Paulsen, I. T., and J. M. H. Saier. 1997. A novel family of ubiquitous heavymetal ion transport proteins. J. Membr. Biol. 156:99–103.

41. Pena, M. M. O., K. A. Koch, and D. J. Thiele. 1998. Dynamic regulation ofcopper uptake and detoxification genes in Saccharomyces cerevisiae. Mol.Cell. Biol. 18:2514–2523.

42. Phung, L. T., H. Ajlani, and R. Haselkorn. 1994. P-type ATPase from thecyanobacterium Synechococcus 7942 related to the human Menkes andWilson disease gene products. Proc. Natl. Acad. Sci. USA 91:9651–9654.

43. Raijmakers, R., G. Schilders, and G. J. M. Pruijn. 2004. The exosome, amolecular machine for controlled RNA degradation in both nucleus andcytoplasm. Eur. J. Cell Biol. 83:175–183.

44. Reimer, D. L., J. Bailley, and S. M. Singh. 1994. Complete cDNA and 5�genomic sequences and multilevel regulation of the mouse catalase gene.Genomics 21:325–336.

45. Rensing, C., and G. Grass. 2003. Escherichia coli mechanisms of copperhomeostasis in a changing environment. FEMS Microbiol. Rev. 27:197–213.

46. Robinson, N. J., A. M. Tommey, C. Kuske, and P. J. Jackson. 1993. Plantmetallothioneins. Biochem. J. 295:1–10.

47. Round, F. E., R. M. Crawford, and D. G. Mann. 1990. The diatoms: biologyand morphology of the genera. Cambridge University Press, Cambridge,England.

48. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning, alaboratory manual. Cold Spring Harbor Laboratory Press, Plainview, N.Y.

49. Siebert, P. D., A. Chenchik, D. E. Kellogg, K. A. Lukyanov, and S. A.Lukyanov. 1995. An improved PCR method for walking in unclonedgenomic DNA. Nucleic Acids Res. 23:1087–1088.

50. Solioz, M., and C. Vulpe. 1996. CPx-type ATPases: a class of P-type ATPasesthat pump heavy metals. Trends Biochem. Sci. 21:237–241.

51. Sonnhammer, E. L. L., G. von Heijne, and A. Krogh. 1998. A hidden Markovmodel for predicting transmembrane helices in protein sequences, p. 175–182. In J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C.Sensen (ed.), Proceedings of the Sixth International Conference on Intelli-gent Systems for Molecular Biology. AAAI Press, Menlo Park, Calif.

52. Stephenson, M. D., and G. H. Leonard. 1994. Evidence for the decline ofsilver and lead and the increase of copper from 1977 to 1990 in the coastalmarine waters of California. Mar. Pollut. Bull. 28:148–153.

53. Tam, R., and J. Milton H. Saier. 1993. Structural, functional, and evolution-ary relationships among extracellular solute-binding receptors of bacteria.Microbiol. Rev. 57:320–346.

54. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment throughsequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 22:4673–4680.

55. Treguer, P., D. M. Nelson, A. J. V. Bennekom, D. J. DeMaster, A. Leynaert,and B. Queguiner. 1995. The silica balance in the world ocean: a reestimate.Science 268:375–379.

56. Vogeli-Lang, R., and G. J. Wagner. 1990. Subcellular localization of cad-mium and cadmium-binding peptides in tobacco leaves. Plant Physiol. 92:1086–1093.

57. Weissman, Z., I. Berdicevsky, B.-Z. Cavari, and D. Kornitzer. 2000. The highcopper tolerance of Candida albicans is mediated by a P-type ATPase. Proc.Natl. Acad. Sci. USA 97:3520–3525.

58. Werner, D. 1977. Introduction with a note on taxonomy, p. 1–498. In D.Werner (ed.), The biology of diatoms, vol. 13. University of California Press,Los Angeles, Calif.

59. Winge, D. R., K. B. Nielson, W. R. Gray, and D. H. Hamer. 1985. Yeastmetallothionein. J. Biol. Chem. 260:14464–14470.

60. Zhou, J., and P. B. Goldsbrough. 1994. Functional homologs of fungalmetallothionein genes from Arabidopsis. Plant Cell 6:875–884.

1168 DAVIS ET AL. EUKARYOT. CELL

on April 23, 2020 by guest

http://ec.asm.org/

Dow

nloaded from