genetic and molecular analyses of nodulation in chickpea...
TRANSCRIPT
GENETIC AND MOLECULAR ANALYSES OF NODULATION
IN CHICKPEA (Cicer arietinum L.)
BY
ROZINA GUL
DEPARTMENT OF PLANT BREEDING & GENETICS FACULTY OF CROP PRODUCTION SCIENCES KHYBER PUKHTUNKHWA AGRICULTURAL
UNIVERSITY PESHAWAR, PAKISTAN JUNE, 2010
GENETIC AND MOLECULAR ANALYSES OF NODULATION
IN CHICKPEA (Cicer arietinum L.)
BY
ROZINA GUL
A dissertation submitted to the KP Agricultural University, Peshawar in partial fulfillment of the requirement for the degree of
DOCTOR OF PHILOSoPHY IN AGRICULTURE
(PLANT BREEDING AND GENETICS)
DEPARTMENT OF PLANT BREEDING & GENETICS FACULTY OF CROP PRODUCTION SCIENCES KHYBER PUKHTUNKHWA AGRICULTURAL
UNIVERSITY PESHAWAR, PAKISTAN JUNE, 2010
GENETIC AND MOLECULAR ANALYSES OF NODULATION IN
CHICKPEA (Cicer arietinum L.)
BY
ROZINA GUL
A dissertation submitted to the KPK Agricultural University, Peshawar in partial fulfillment of
the requirement for the degree of
DOCTOR OF PHILOSoPHY IN PLANT BREEDING AND GENETICS APPROVED BY: _________________________ Prof. Dr. Farhatullah Chairman, Supervisory Committee _________________________ Prof. Dr. Ko Harda Co-Supervisor for Research Forest Resource Biology Laboratory Faculty of Agriculture Ehime University Matsuyama Japan ______________________________ Prof. Dr.Iftikhar Hussain Khalil Member _________________________ Prof. Dr. Zahir Shah Member Deptt. of Soil and Envir. Science _________________________ Dr. Gul Sanat Shah Addl. Member Principle Scientist Nuclear Institute for Food and Agriculture Peshawar _________________________ Prof. Dr. Farhatullah Chairman/Convener Board of Studies _________________________ Prof. Dr. Zahoor A. Swati Dean, Faculty of Crop Production Sciences _________________________ Prof. Dr. Farhatullah Director, Advanced Studies and Research
DEPARTMENT OF PLANT BREEDING & GENETICS FACULTY OF CROP PRODUCTION SCIENCES
KHYBER PAKHTUNKHWA AGRICULTURAL UNIVERSITY PESHAWAR, PAKISTAN
JUNE, 2010
I dedicate this humble effort to
my loving Parents, caring husband and my sweet kids
i
TABLE OF CONTENTS _____________________________________________________________ Chapter No. Title Page
Table of contents i List of tables iv List of figures vi List of appendix vii List of abbreviations viii Acknowledgements ix Abstract xi
1 General Introduction and Background Information ........... 1
1.1 Origin and botanical classification of chickpea ................................ 1 1.2 Mode of reproduction ....................................................................... 1 1.3 Importance and utilization ................................................................ 2 1.4 Medicinal use of chickpea ................................................................ 2 1.5 Taxonomy, morphology and types ................................................... 3
1.6 Chemistry of chickpea ...................................................................... 3 1.7 Area and production ......................................................................... 3 1.8 Genetic variability in chickpea .......................................................... 4 1.9 Nodulation and nitrogen fixation ....................................................... 5 1.10 Nodulation mutants in chickpea ....................................................... 6 1.11 Inoculation of chickpea with rhizobium ............................................ 7 1.12 Linkage study in chickpea ............................................................... 7 1.13 Molecular study in chickpea ............................................................. 8 1.14 Aims and objectives of the study ...................................................... 9
2 Review of Literature ......................................................... 1
2.1 Characterization of chickpea for morphological markers and other quantitative traits ............................................................................ 10
2.3 Characterization of genotypes for nodulation and effect of rhizobil inoculation on nodulation ............................................................... 12
2.4 Molecular characterization of chickpea germplasm using microsatellite (SSR) markers……………………………………………………………………………16
2.6 Inheritance and linkage study of genes of nodulation in chickpea .. 19
ii
3 General Materials and Methods………………………………………………… 22
3.1 Procurement of seed ...................................................................... 22 3.2 Experimental sites .......................................................................... 23 3.3 Characterization of germplasm for various morphological markers and Quantitative traits .................................................................... 26 3.4 Characterization of genotypes for nodulation and effect of rhizobial
Inoculation on nodules number and seed yield plant-1 .................. 28 3.5 Inheritance and linkage study of nodulation in chickpea ............... 32 3.6 Molecular characterization of germplasm using microsatellite markers …. ............................................................................... 35
4 RESULTS AND DISCUSSIONS ......................................... 41
4.1 Expt.1. Characterization for morphological markers and
quantitative traits. ................................................. 41
4.1.1 Introduction ………………………………………………………………………………………………………….41 4.1.2 Materials and methods ................................................................... 42 4.1.3 Results . ................................................................................. 43 4.1.3.1 Characterization for genetic marker .............................................. 43 4.1.3.2 Characterization for quantitative characters ................................. 43 4.1.4 Discussion . .............................................................................. ….52
4.2 Expt.2. Characterization of genotypes for nodulation and
effect of rhizobial inoculation on nodules number
and seed yield plant-1 . ........................................... 55
4.2.1 Introduction .................................................................................. 55 4.2.2 Materials and Methods ................................................................. 57 4.2.3 Results . ................................................................................. 57 4.2.3.1 Characterization of accessions for presence or absence of Nodules . ................................................................................. 57 4.2.3.2 Number of Nodules Plant-1 genotype-1 ................................................................ 58 4.2.3.3 Effect of rhizobial inoculation on number of nodules plant-1 ........ 59
iii
4.2.3.3 Effect of rhizobial inoculation on seed yield plant-1 ................................... 60 4.2.4 Discussion .................................................................................. 66
4.3 Expt.3. Inheritance and linkage studies of nodulation in
chickpea. ............................................................... 71
4.3.1 Introduction ................................................................................. .71 4.3.2 Materials and Methods .................................................................. 73 4.3.3 Results…………………………………………………………………………………………………………………… 75 4.3.3.1 Inheritance of nodulation ............................................................... 75 4.3.3.2 Inheritance of leaf color ................................................................. 76 4.3.3.3 Nodulation Vs leaf color ................................................................ 76 4.3.4 Discussion . ................................................................................. 80
4.4 Expt.4. Molecular characterization of chickpea germplasm using microsatellite markers...................................85
4.4.1 Introduction ................................................................................. 85 4.4.2 Materials and methods ............................................................... 87 4.4.3 Results………………………………………………………………………………………………………………….87 4.4.3.1 Genetic variation ......................................................................... 87
4.4.3.2 Genetic relationship among accessions ..................................... 89
4.4.3.3 Grouping of chickpea genotypes based on morphological traits 91
4.4.4 Discussion ................................................................................ 101
Summary.. .................................................................... 105 Conclusions .................................................................. 109 Recommendations ........................................................ 110 Bibliography ................................................................... 111 Appendices ................................................................... 127
iv
List of Tables
No Title Page _____________________________________________________________
3.1 Pedigree and origin of genotypes/accessions used in the study ...... 25
3.2 Details of primers sequencing ........................................................... 39
4.1.1 Flower color, stem color and seed coat color of evaluated chickpea germplasm ........................................................................ 46 4.1.2 Mean square for days to 50% flowering, days to maturity, plant height and number of leaflets leaf-1 of chickpea germplasm ........... 47 4.1.3 Mean square for leaf area, seed yield plant-1, 100 seed weight and biological yield plant-1 of chickpea germplasm .......................... 47 4.1.4 Mean values of days to 50% flowering, days to maturity, plant height and number of leaflets leaf-1 in chickpea germplasm ........... 48
4.1.5 Mean values of leaf area, seed yield plant-1, 100 seed weight and biological yield plant-1 in chickpea germplasm ......................... 49
4.1.6 Estimates of genotypic variance (Vg), phenotypic variance (vp), genotypic coefficient of variability (PCV), phenotypic coefficient of variability (GCV) and heritability ( h2
(bs) ) for various agronomic traits .................................................................................. 50 4.1.7 Description of chickpea accessions used in present study. ............. 51 4.2.1 Mean square for number of nodules plant-1 of chickpea germplasm .................................................................................. 61
4.2.2 Presence or absence of nodules and number of nodules plant-1 in
chickpea accession ........................................................................ 62
4.2.3 Estimates of variability parameters for number of nodules plant-1 in
chickpea germplasm ........................................................................ 63
4.2.4 Mean square for inoculation effect on number of nodules plant-1
and seed yield plant-1............................................................................................................ 63
4.2.5 Effect of control and rhizobial inoculation on nodules plant-1 in. ...... 64
v
No Title Page __________________________________________________________ 4.2.6 Effect of control and rhizobial inoculation on seed yield plant-1
in chickpea genotypes ...................................................................... 65 4.3.1 Morphological markers of parents and their F1 used in linkage studies of chickpea .......................................................................... 77 4.3.2 Nodulation response of non-nodulated (Nod-) and nodulated
(Nod+) parents, F1, F2, and backcross Progenies of
ICC 19181 X NDC 5-S10 cross to rhizobial Inoculation .................. 77 4.3.3 Nodulation response of non-nodulated (Nod-) and nodulated
(Nod+) parents, F1, F2, and backcross Progenies of
ICC 19181 X NDC 4-20-4 cross to rhizobial Inoculation ................. 78
4.3.4 Inheritance of leaf color in light green and dark green leaf colored parents, F1, F2, and backcross progenies of cross ICC 19181 X NDC 5-S10 ................................................................. 78
4.3.5 Inheritance of leaf color in light green and dark green leaf colored parents, F1, F2, and backcross progenies of cross ICC 19181 X NDC 4-20-4 ................................................................. 79 4.3.6 Joint segregation for markers of chickpea F2 population for leaf color and nodulation .................................................................. 79 4.4.1 Description of chickpea accessions used in Molecular study .......... 96 4.4.2 Primers used for amplifying chickpea microsatellite regions ........... 97 4.4.3 Genetic diversity statistics of 47 chickpea accessions .................... 98 4.4.4 AMOVA analysis of microsatellite data of 47 chickpea accessions 99 4.4.5 Summary of ANOVA for the 4 morphological traits of 47 chickpea
accessionsA ........................................................................................................................... 99 4.4.6 Correlation among four morphological traits of 47 chickpea accessions ................................................................................ 100 4.4.7 Principal component analysis on four morphological traits of 47
chickpea genotypes ....................................................................... 100
vi
List of Figures
No Title Page
3.1 Washing Procedure of Roots to check Nodules .............................. 30
5.1 Nodulated Root ............................................................................... 58
5.2 Non-nodulated Roots ...................................................................... 58
4.3.1 Chickpea Crossed Flower ................................................................ 74
4.3.1 Roots of nodulated (L) and non- nodulated plants (R) .................... 74
4.4.1 (a) UPGMA tree (b) ME tree............................................................. 93
4.4.2 Scatter plot of principal component analysis based on
morphological data ........................................................................... 94
4.4.3 Scatter plot of principal coordinate analysis based on
microsatellite allele frequencies ...................................................... 95
vii
List of Appendices ____________________________________________________________________ No Title Page
1 Analysis of variance for days to 50% flowering ............................... 127
2 Analysis of variance for days to maturity ......................................... 127
3 Analysis of variance for plant height ................................................ 127
4 Analysis of variance for leaflets leaf-1 ........................................................................ 28
5 Analysis of variance for leaf area .................................................... 128
6 Analysis of variance for seed yield plant-1 ........................................................... 128
7 Analysis of variance for 100 seed weight ........................................ 129
8 Analysis of variance for biological yield plant-1 ................................................ 129
9 Analysis of variance for number of nodules plant-1 ....................................... 129
10 Analysis of variance for rhizobium effect on number
of nodules plant-1 .................................................................................................................... 130
11 Analysis of variance for rhizobium effect on seed
yield plant-1 ................................................................................................................................................ 130
viii
List of Abbreviations
AFLP Amplified fragment length polymorphism
AMOVA Analysis of molecular variance
ARS Ahmadwala research station
AUP Agricultural university Peshawar
CIB Cold isolation buffer
cM Centi Morgan
CRD Completely randomized design
CTAB Cetytriammoniumbromide
CV Coefficient of variation
GCV Genotypic co-efficient of variation
GRS Gram research station
h2 Heritability
IBGE Institute of biotechnology and genetic engineering
ICARDA International center for agricultural research in the dry areas, Syria
ICRISAT International crops research Institute for the semi-arid tropics, India
KP Khyber Pakhtunkhwa
LSD Least significant difference
ME Minimum-evolution method
NIFA Nuclear Institute for food and agriculture, Peshawar Pakistan
Nod- Non-nodulated
Nod+ Nodulated
PCA Principal component analysis
PCV Phenotypic co-efficient of variation
PCoA Principal coordinate analysis
PIC polymorphic information content
RAPD Random amplified polymorphic DNA
RCBD Randomized complete block design
RFLP Restriction fragment length polymorphism
SSR Simple sequence repeat
UPGMA: Unweighted pair-group method using arithmetic averages
ix
ACKNOWLEDGEMENTS
Today I am immensely pleased and feel elated on successful completion of
my dissertation-the project assigned to me during the last leg of my PhD
studies. I bow my head to Almighty Allah. The Omnipotent and Omnipresent,
for his blessing, especially the faculties that he endowed upon me and I was
able and capable enough to undertake the task and complete it in a befitting
manner.
It was an honor for me to have Prof. Dr Farhatullah as my major supervisor.
His sincere and continuous efforts, constant supervision, constructive
criticism, critical insight, judicious guidance, excellent editorial suggestions
and patience during these four years were invaluable for the development of
my study and research program.
Special thanks to my co-supervisor, Dr Ko Harada who supervised me in the
molecular part of my research study. His kind and excellent guidance, stable
supervision and incessant efforts were priceless for the completion of my
research project. His outstanding supervision made my study at Japan
memorable.
I am grateful to Dr Gul Sanat Shah, Dr NaquibulIa and Dr Iftikhar for their
help and support. I would extend my appreciation to Sahir, Sajjid, Nazma
and Sabra for helping in the field work. I am also thankful to Mr. Shaheen,
Mr. Naveed and Mr. Akram for providing their services whenever needed.
I would like to present my heartfelt thanks to my great father (Haji Gul Faraz
Khan) and mother for their care, love and life long support.
Finally I am extremely thankful to my considerate husband Dr. Hamayoon
Khan Yousafzai, whose uninterrupted support in various aspects of my life
and studies, kept me going with grace and honor, and the courage and
motivation that he gave me, made me able to complete this project. I am also
much more thankful to my sweet daughter Amina Khan, my precious sons
Mohsin Khan and Abdullah Khan who always remained a source of
refreshment for me and due to their love I remained successful.
Rozina Gul
x
GENETIC AND MOLECULAR ANALYSES OF NODULATION IN
CHICKPEA (Cicer arietinum L.)
Rozina Gul and Farhatullah
Department of Plant Breeding and Genetics
Faculty of Crop Production Sciences
Khyber Pakhtunkhwa Agricultural university Peshawar, Pakistan.
May, 2010
ABSTRACT
A hallmark trait of chickpea (cicer arietinum L.) is its ability to form root nodules
and to fix atmospheric nitrogen in symbiosis with compatible rhizobia.
Chickpea plays a vital role in natural ecosystems, agriculture, and agro-
forestry, where its ability to fix nitrogen in symbiosis makes it an excellent
settler of low-N2 environments, and economic and environmentally friendly
crop. Forty seven chickpea genotypes were procured from Nuclear Institute for
Food and Agriculture (NIFA), Peshawar, Gram Research Station (GRS),
Karak, Pakistan and International Crops Research Institute for the Semi-Arid
Tropics (ICRISAT), India. Entire experiments of the reported project were
carried out from 2006 to 2009 at Agricultural University, and NIFA, Peshawar
except molecular characterization, which was accomplished at Ehime
University Matsuyama, Japan.
All genotypes were characterized for marker traits, quantitative parameters,
nodulation and molecular markers (SSR). Highly nodulated and non-nodulated
parents were picked and hybridized to study mode of inheritance of nodulation
and its linkage with marker trait loci. The germplasm was also grouped as desi
(pink flower, green with purplish tings stem and colored seed coat) and kabuli
(white flower, green stem and white seed coat) types. Highly significant
differences and high heritability estimates were recorded for days to 50%
flowering, days to maturity, leaf area, number of leaflets leaf-1, plant height,
100 seed weight, biological yield plant-1 and grain yield plant-1 in all the
genotypes. Genotypes from NIFA and GRS were nodulated while genotypes
from ICRISAT were Nod-. All genotypes also differed highly and significantly
for number of nodules plant-1. The genotypes NDC 5-S10 and NDC 4-20-4
xi
produced the maximum nodules plant-1. Highly significant response of
rhizobium inoculation was recorded for nodules plant-1 and seed yield plant-1.
Interaction of genotypes with treatments classified NDC 4-20-1(16.66) as
highly Nod+ and Karak 3 (33 g) as high seed yielder plant-1. The maximum
genotypic mean for nodulation and seed yield plant-1 was recorded for
accession NDC 5-S10 (14.83) and Karak 3 (30.20) respectively. Inoculated
genotypes exceeded control in treatment means both for nodules plant-1 (10.33
& 7.22) and seed yield plant-1 (14.40 g & 10.59 g).
Molecular characterization of 47 genotypes was performed using 10 simple
sequence repeat (SSR) markers. Eight of the 10 SSR markers were
polymorphic. Number of alleles ranged from 2 to 16, with an average of 7.4
locus-1. Polymorphic information content (PIC) values ranged from 0.227 to
0.876, with an average of 0.636. The average PIC was 0.582 in desi and 0.577
in kabuli genotypes, shows that both groups are distinct. Significant genetic
differentiation was found between desi and kabuli genotypes by using Analysis
of molecular variance (AMOVA) under stepwise mutation assumption (RST =
0.239, P ≤ 0.001). Unweighted pair-group method using arithmetic averages
(UPGMA) and Minimum-evolution method (ME) trees as well as Principal
Coordinate analysis (PCoA) classified the accessions into 6 groups and all the
6 accessions could be clearly separated. Grouping was mostly the same in
both the phylogenetic trees and PCoA, but the branching order differed
greatly. Inheritance of nodulation was studied in two cross combinations i.e.,
ICC 19181(non-nodulated and dark green leaves) x NDC 5-S10 (nodulated
and light green leaves) - Hybrid A and ICC 19181 x NDC 4-20-4 (Nod+ and
light green leaves) - Hybrid B. Hybrid A, showed monogenic dominant
inheritance, while hybrid B showed duplicate gene action for nodulation
confirming that both Nod+ genotypes are from different clusters. Both hybrids
revealed monogenic dominant inheritance of light green leaf color. Linkage
study revealed that loci for nod and leaf color resides on the same
chromosome at the distance of 15 centi Morgan (cM) in genotype NDC 5-S10
while in genotype NDC 4-20-4 the two loci for nodulation exists at the distance
of 26 cM and 15 cM from the locus of leaf color. The current research findings
show significant diversity both at morphological and molecular levels, and
valuable results regarding rhizobial inoculation, inheritance and linkage study
of nodulation, which could play a vital role in future chickpea breeding
programs.
1
CHAPTER 1
INTRODUCTION
1.1 Origin and botanical classification of chickpea
Chickpea (Cicer arietinum L., 2x = 2n = 16) belongs to genus Cicer,
tribe Cicereae, family Fabaceae, and subfamily Papilionaceae. Cicer is Latin
name originated and derived from the Greek word 'kikus' that means force or
strength. The origin of the word is traced to the Hebrew 'kikar'', where 'kikar'
means round (Duschak, 1871). The word arietinum is also Latin, translated
from the Greek “krios", another name for both ram and chickpea, an allusion
to the shape of the seed which resembles the head of a ram (Aries) (Van der
Maesen, 1987). The oldest report concerning this species was 5450 BC
(Helbaek, 1959) and it has been cultivated for at least 7000 years (Van der
Maesen, 1972).
1.2 Mode of reproduction
Chickpea is highly self pollinated specie because of its cleistogamous
flower (Smithson et al., 1985). Self pollination takes place 12-24 hour before
the flower is fully opened. At the time of pollination the keel is closed and
foreign pollen can’t reach the stigma. Fertilization takes place about 24 hr
after flower is fully expanded. Due to fragility of flower artificial hybridization
are rather poor, overall seed setting is estimated as 5 – 25%. Emasculation
and pollination can be done at any time of the day, but simultaneous
emasculation and pollination gave higher percentage of seed set than
consecutive day operation (Singh and Ackuland, 1975).
2
1.3 Importance and utilization
Chickpea is one of the world's most important but less-studied
leguminous food crop with 740-Mb genome size. Chickpea ranks third
among pulses, fifth among grain legumes, and 15th among grain crops of the
world. It accounts for 12% of the world pulses production, with a 1.9% annual
growth rate of chickpea production during the last 20 years (Upadhyaya,
2003). Chickpea is one of the major pulse crops in West Asian and North
African regions. It has great importance as food, feed and fodder. Due to the
increasing need for legumes, chickpea is no longer considered a subsistence
crop. The rising trend in its trade suggests that the crop is grown increasingly
for the market (Saxena et al., 1996). In the developed world it represents a
valuable crop for export. It provides a protein-rich supplement to cereal-
based diets. Chickpea is valued for its nutritive seeds with high protein
content, 25.3-28.9 %, after de-hulling (Hulse, 1991).
1.4 Medicinal uses of chickpea
Among the food legumes, chickpea is the most hypocholesteremic
agent; germinated chickpea was reported to be effective in controlling
cholesterol level in rats (Geervani, 19991). Glandular secretion of leaves,
stem and pods consist of malic and oxalic acids, giving a sour taste. Acids
are supposed to lower the blood cholesterol levels. Medicinal applications
include use for bronchitis, aphrodisiac, catarrh, cholera, cutamenia,
constipation, diarrhea, flatulence, dyspepsia, snakebite, sunstroke, and
warts. Seeds are considered antibilious (Duke, 1981).
3
1.5 Morphology and types
There are two types of chickpea, depending on seed color, shape,
and size. Kabuli type, the seeds of this type are large, round or ram head,
and cream-colored. The plants are medium to tall (up to one m) in height,
with large leaflets and white flowers, and contain no anthocyanin
pigmentation. The second type is Desi type; this type has small seeds
angular in shape. The seed color varies from cream, black, brown, yellow to
green. There are 2-3 ovules per pod but on an average 1-2 seeds per pod
are produced. The plants are short, more prostrate with small leaflets and
purplish flowers, and contain anthocyanin pigmentation (Muehlbauer et al.,
1982; Cubero, 1975). Chickpea is grown in tropical, sub-tropical and
temperate regions. Kabuli type is grown in temperate regions while the desi
type chickpea is grown in the semi-arid tropics (Muehlbauer and Singh,
1987; Malhotra et al., 1987).
1.6 Chemistry of chickpea
Chickpea is important due to its nutritive seeds which is a rich and
cheap source of protein in human diet as compared to the animal protein.
Chickpea seed has 38-59% carbohydrate, 4.8-5.5% oil, 3% fiber, 3% ash,
0.3% phosphorus and 0.2% calcium,. Digestibility of protein varies from 76-
78% and its carbohydrate from 57-60% (Hulse, 1991).
1.7 Area and Production
Pakistan is the second big producer of chickpea after India in the
world. In Pakistan total cropped area is 22.51 million hectare. Out of this
4
area, 1.492 m.ha is under pulse cultivation which is 7% of the total cropped
area, and 73% of the area under pulse production is occupied by chickpea
cultivation. Total area under chickpea cultivation in our country is 1052.3
thousand hectares with a production of 823 thousand tones and an average
yield of 795.4 Kg ha-1. In Khyber Pakhtunkhwa (KPK) it was cultivated on an
area of 49.0 thousand hectares with a production of 21.0 thousand tones
with an average yield of 427.5 kg ha-1 (MINFAL, 2007-08). In KP about 75%
chickpea is grown on rainfed lands and its cultivation is concentrated in the
southern districts of the province including D.I. Khan, Tank, Lakki Marwat,
Bannu and Karak.
1.8 Genetic variability
Genetic diversity plays a vital role in survival and development of
many natural populations and wild species. The crops genetic variability not
only helps varieties to adopt to diverse environments, to enhance the
tolerance of unfavorable conditions and resistance to pest and diseases, but
also to produce the diversity and to get better yield and quality of product to
serve needs of people. Utilization of exotic and diverse germplasm is needed
to enhance the genetic diversity of cultivars. Genetically diverse lines provide
sufficient opportunity to create favorable gene combinations, and the
probability of producing a unique genotype, increase in proportion to the
number of genes by which the parents differ.
Genetic variability is prerequisite for crop improvement as it provides
raw material to plant breeders to recombine the genes of different characters
in same plant for development of desirable variety. Plant genetic resources
are the basis of global food security. They contain diversity of genetic
5
material contained in traditional varieties, modern cultivars, crop wild
relatives and other wild species. To fulfill the demand of increasing
population and to produce more food, it would be essential to make better
use of a broader range of the world’s plant genetic diversity (Farshadfar and
Farshadfar, 2008).
1.9 Nodulation and nitrogen fixation
Plant requires amino acids to form proteins and for the synthesis of
amino acids nitrogen is one of the most important elements. Plants cannot
take the atmospheric nitrogen as such they primarily take nitrogen in the
ionic form of either ammonium (NH+,) or nitrate (NO3) (Cleyet-marel et al.
1990). Leguminous plants form nitrogen-fixing root nodules post
embryonically with symbiotic bacteria called rhizobia.
The cross-kingdom symbiosis is commenced by reciprocal signal
exchange between the two organisms (Oldroyd and Downie, 2004). Root of
legumes secrets flavonoid which is sense by rhizobia. Flavonoids trigger the
secretion of nod factor by rhizobia, that in turn, recognized by the host plant
which can lead to root hair deformation and many other cellular reactions
such as ion fluxes. The rhizobia enter through a deformed root hair just like
endocytosis, making an intracellular tube known as infection thread. The
infection starts cell division in the cortex of the root where a new organ, the
nodule appears as a result of successive processes. Infection threads infect
the central tissue of nodule and release the rhizobia in these cells where
they differentiate morphologically into bacteroids and start fixation of
atmospheric nitrogen into plant useable form ammonia (NH4+), by using
nitrogenase enzyme. In return the plant provides carbohydrates, proteins
6
and oxygen to the bacteria. Plant protein leghaemoglobins (similar to human
hemoglobins) helps in providing oxygen for respiration by keeping the free
oxygen concentration very low so that nitrogenase activity may not be
inhibited.
The fact that about 50 million tons of nitrogen is manufactured
industrially each year against an estimated 90 million tons fixed by plant
processes, has make the phenomenon of nitrogen fixation tremendously
important and the value of this “free” fertilizer N, can be placed in global
perspective. (Cleyet-marel et al., 1990)
1.10 Inoculation of chickpea with rhizobium
On farmer’s fields, yield of Chickpea is very low as compared to its
potential. The basic reported reasons responsible for its low yield are the
unavailability of high-quality seed, absence of effective rhizobial inoculation
and severe damage by blight and pod borer attack. In those soils lacking
native effective rhizobia artificial seed inoculation is a very useful practice
for the improvement of root nodulation and yield of the chickpea (Rupela
and Dart, 1979; Sharma et al., 1983; Shamim and Ali, 1987; Shah et al.,
1994). Legume inoculation is a means of guarantee that the strain of
Rhizobium appropriate for the cultivar being planted is present at the proper
time in numbers sufficient to assure effective nodulation and nitrogen
fixation (Cleyet-marel et al., 1990).
It has been reported that the soils of Pakistan are generally deficient
in nitrogen which is an essential element in the plants metabolism and
protein synthesis. The deficiency of nitrogen is one of the basic reasons of
7
the low crop yield. In order to stimulate early growth of leguminous crops
and to induce the activity of nitrogen fixing bacteria a starter dose of
fertilizer nitrogen is frequently used in most legumes (Ali et al., 1998; Jefing
et al., 1992).
It is important that agricultural scientists learn to manipulate this
symbiotic relationship in agronomic practice, employing selected
combinations of bacteria and legumes in specific situations to obtain
maximum crop production on land which is of low fertility and frequently
unsuitable for growth of non-legume crops. Nitrogen fixation rates from 75
to 300 kg of N per hectare per year are common in various combinations.
1.11 Nodulation mutants in chickpea
Non-nodulating, ineffectively nodulating and/or super nodulating
mutants have been identified in several species of soybean, chickpea,
peanut, red clover, and alfalfa. Variants in nodulation have been produced
either spontaneously or from induced mutagenesis (Methews at al., 1989).
These altered nodulation mutants play an important role in understanding the
physiological processes and genetic control of nodule development and
function.
1.12 Linkage study in chickpea
By studying inheritance patterns in pedigrees, it is possible to identify,
which genes are near each other on a chromosome. This information is
called linkage, which provides a way to map genes on chromosomes.
Linkage is important when used with other techniques to determine the
8
location of certain genes on chromosomes, especially for genes, which have
not been well studied, and for understanding the mode of transmission for
many genetic disorders. Linkage study between non-marker characters like
nodulation in chickpea and morphological markers like flower color, stem
color etc will help the breeders and biotechnologists to do selection of better
genotypes and to map the locus and gene controlling important characters
(Thomas, 1999; Pundir and Reddy, 1998)
1.13 Molecular study in chickpea
DNA marker analyses are of increasing importance in modern plant
breeding, and, as the methods become more widely adopted, the capacity
for high-throughput analyses at low cost is crucial for its practical use. DNA
marker techniques are non-destructive, and heterozygous individuals may
be identified and maintained more easily than by conventional means
(Helentjaris, 1991). Molecular marker technology is a valuable tool for plant
breeding. A number of techniques [e.g. restriction fragment length
polymorphism, amplified fragment length polymorphism, simple sequence
repeats (SSR), single nucleotide polymorphisms] can be used as DNA
markers linked to characters/traits of interest, directing selection towards
these markers instead of a phenotypic reaction (Edwards and Mogg, 2001).
Important breeding steps can be considerably improved by molecular
marker tools, now available in plant breeding.
Chickpea is an important system for genomics research because of
its small genome size (740 Mb) and high economic importance as a food
crop legume. Molecular markers are the prerequisites for undertaking
molecular breeding activities. However, till now the reasonable number of
9
molecular markers could not be developed in cultivated species of
chickpea. One of the major reasons for this may be the detection tools that
are currently available which can sense a low level of genetic variability in
the cultivated gene pools of these species (Huttle et al., 1999; Winter et al.,
1999). Although through various markers and genomic tools several genetic
linkage maps have become available, but still sequencing efforts and their
use are limited in chickpea genomic research. Among various molecular
markers currently available, microsatellite or SSR markers are often chosen
as the favored markers for a variety of applications in breeding because of
their multi-allelic nature, co-dominance inheritance, relative abundance and
extensive genome coverage (Gupta and Varshney, 2000). As a result
several hundred of SSR markers have been developed in chickpea (Huttle
et al., 1999; Winter et al., 1999).
Due to the extreme importance of nodulation in nitrogen fixation,
restoring soil fertility and increased crop production, Furthermore, owing to
the increasing importance and utilization of molecular study via molecular
markers, this project was planed with the following major objectives:
1. Characterization of chickpea germplasm for morphological markers and
quantitative traits
2. Categorization of chickpea genotypes for nodulation and evaluation of
the effect of rhizobial inoculation on nodules number and seed yield
plant-1
3. To investigate the inheritance of nodulation and genetic linkage
between loci responsible for nodulation and leaf color
4. Molecular Characterization of chickpea genotypes using microsatellite
markers
10
CHAPTER 2
REVIEW OF LITERATURE
Research findings regarding genetic diversity of nodulation, effect of
rhizobial inoculation and other important agronomic and morphological
parameters in chickpea is reported from most parts of the world but such
information are lacking for the germplasm being grown in Pakistan. The
information about genetics and other related studies of nodulation conducted
at the agro-climatic conditions of the country are rarely available in literature.
Since chickpea is marginal areas’ crop in Pakistan and is grown on sandy
soils thus its production is entirely dependent on timely rain fall during its
growing season. Due to high risk of chickpea production because of
uncertain rains, the growers are reluctant to use inputs and thus government
gives very low attention toward research for the improvement of this crop.
Research findings related to nodulation and other important relevant
parameters reported in literature are briefly reviewed below.
2.1 Characterization of chickpea germplasm for morphological markers and other quantitative traits
In chickpea sufficient genetic variability for number of days taken to
flowering, days to maturity, plant height, total dry weight of the plant and
grain yield plant-1 and high heritability for plant height (96.24%) and total dry
weight of the plant (80.26%) has also been reported (Iqbal et al., 1994).
Considerable amount of variations were also reported in characters like plant
color, flower color, dots on seed testa, seed testa texture, days to maturity,
pods per plant, 100-seed weight and plot yield among all the three groups
11
(kabuli, desi and intermediate). However, the Kabuli and Intermediate types
did not differed significantly for seed color and growth habit (Upadhyaya et
al., 2002). Sufficient genetic variability was reported for various quantitative
traits including plant height, number of pods plant-1, 100- seed Weight,
biological yield and seed yield plant-1. Heritability for these characteristics
indicated that selection could be more effective for genetic improvement
(Nawab, 2002). Highly significant differences among genotypes were also
reported for days to flowering, number of secondary branches plant-1,
number of pods plant-1, 100-seed weight seed yield plant-1 (Shahzad et al.,
2002; Shaukat et al., 2003; Arshad et al., 2004), pods plant-1, days to
maturity (Burli et al., 2004), seed color, flower color and plant growth (Afsari
et al., 2004).
Significant differences for yield and yield attributes among genotypes
for high productivity, wide adaptability and multiple resistances can be
achieved simultaneously by using potentially complementary approaches
(Yadav et al., 2004). Extensive amount of genetic diversity was also
observed in grain yield and yield components of chickpea (Imtiaz et.al.,
2004; Bakhsh et al., 1999). Significant amount of genetic variability was
recorded among chickpea genotypes for pods plant-1, 100-seed weight;
biological yield plant-1 and seed yield plant-1 (Jeena et al., 2005).
In chickpea high genetic variability with considerable amount of
heritability was registered for seed yield plant-1 followed by biological yield
plant-1, pods plant-1, 100-seed weight, secondary branches plant-1 plant
height (Sharma et al., 2004) flowering, days to maturity, 100 seed weight,
secondary branches and biological yield (Ghafoor et al., 2004; Burli et al.,
2004). High coefficients of variation (CVs) were recorded in pods branch-1,
12
seeds pod-1, pods plant-1, yield plant-1, seeds plant-1and branches plant-1
(Naghavi and Jahansouz, 2005) 100-seed weight and seed yield kg ha-1
(Hakim et al. 2006) and some other morphological traits (Farshadfar, 2008)
showing low environmental impact for these characters. Highest genotypic
variance was recorded for 1000 seed weight, followed by seed number plant-
1. Minimum (5.47%) broad-sense heritability was reported for days to
flowering while maximum (51.66%) for seed number plant-1 (Derya and
Emin, 2006).
Significant amount of variability were observed for means and
components of variability for yield and various yield components in chickpea.
Lower genotypic and phenotypic coefficients of variation were found for days
to maturity and days to flowering. While moderate PCV and GCV were
observed for seeds pod-1, plant height, branches plant-1, 100 seed weight,
total weight of the plant, pods plant-1 and seed yield plant-1. High heritability
estimates were observed for branches plant-1, pods plant-1, seed yield
(Durga et al., 2007), days to flowering (Saleem et al., 2008), days to maturity,
grain yield plant-1 and secondary branches (Atta et al., 2008). On the other
hand in another report estimates of heritability were moderate for days to
maturity and pods plant-1 (Saleem et al. 2008). This variation has
necessitated the establishment of a core collection of chickpeas in the world.
2.2 Characterization of genotypes for nodulation and effect of rhizobial inoculation on nodulation
According to Rupela (1992) the frequency of Nod- plants ranged from
120 to 490 per million in four genotypes (ICC 435, –4918, –5003 and –4993)
of chickpea. The Nod- selections and their respective parent genotypes
13
were identical in plant growth they only differed in their nodulation trait, and
most Nod- plants yielded likewise to their Nod+ genotypes when supplied
with 50 to 100 kg N ha–1. While in the field with low nitrogen fertilizer or
without N fertilizer, the Nod- plants grew poorly, light green, had small
leaves and leaflets, had short internodal distance and had reddish brown
pigment on margine of leaflets, rachis and sometime branches. In another
report sinorhizobium fredii strains was found to produce nodules and can
fix nitrogen significantly, for symbiosis S.fredii-soybean, compatibility is
must (Vidieria et al., 2001)
Bhatia et al. (2004) examined the Prospects of using the
nodulation mutants in developing grain legume cultivars that combine high
yield with high residual N, within the bioenergetic constraints, for developing
sustainable cropping systems. Nodulation mutants have contributed to the
understanding of plant-microbe symbiotic interactions, nitrogen fixation, and
nodule development. Breeding of genotypes with higher yield and nitrogen
fixation rate becomes possible through nodulation mutants. They found that
after inoculation with specific bacterial strains or a mixture of strains, the
nodulation mutants show either: no nodulation (nod-), few nodules (nod+/-),
ineffective nodulation (fix-), or hyper nodulation (nod++). In most of the
nodulation mutant’s monogenic recessive inheritance has been observed,
however semi-dominant and dominant inheritance was also reported. The
process of autoregulation controlled the nodule number; relaxed
autoregulation have been reported in hypernodulating mutants.
Significant variation has been reported with respect to nodulation
among chickpea genotypes (Yadav et al., 2004; Gallani et al., 2005).
Nodulation also showed high heritability along with significant variation
14
among different genotypes of chickpea (Mensah and Olukoya, 2007). C.
arietinum and its root nodule bacteria should be considered in a separate
cross-inoculation group (Gaur and Sen, 1979). There is a significant
correlation between nodulation and seed yield (Corbin et al., 1977).
Nitrogen fixed by nodules is the most important source supplying nitrogen
to the grain as compare to the other sources like nitrogen fertilization
(Hungria and Neves, 1987).
Symbiotic relationship in chickpea is highly specific, with a unique
group of rhizobia necessary for the formation of nodules and nitrogen
fixation. Absence of appropriate strains, low population numbers,
infectiveness, and poor survival of rhizobia are basic reasons for
nodulation problems. Legume inoculation assures presence of appropriate
rhizobial strain at proper time in sufficient number which confirms nodules
formation and nitrogen fixation (Cleyet-Marel et al., 1990). Numbers of
indigenous rhizobia inversely affect the response of the plant to
inoculation and the competitive success of inoculant rhizobia. The
considerable response to N application, significant increases in nodule
parameters, and more than 50% nodule occupancy by inoculant rhizobia
did not essentially correspond to significant inoculation responses (Thies
et.al., 1991).
Liquid inoculant gave a very uniform coverage of the seeds and yield
of lentil and peas increased upto 29% and 9%, respectively (Hynes et al.,
1995). Significant variation was reported for plant growth in response to
inoculation with Rhizobium strains (Rodríguez-Navarro et al., 1999).
Equally effective establishment of successful symbiosis was reported with
peat as well as granular inoculants in chickpea (Stephen et al., 2002). On
15
the other hand in another study the performance of peat based powder
inoculant was better than the liquid inoculant in terms of seed yield. The
effect of inoculant formulation on nodules number, nitrogen accumulations
etc were in order: granular > peat powder > liquid = un-inoculated
(Clayton et al., 2003).
An increase in 1000 seed weight, seed yield and biological yield in
chickpea was observed with seed inoculation as compared to un-
inoculated seed (Hakoomat et al., 2004). Inoculation also enhanced
nodules formation on the root system of chickpea (Khattak et al., 2006). In
the same way significantly enhanced yield as well as nitrogen uptake was
recorded with rhizobial inoculation in sainfoin over the control (Tufenkci et
al, 2006).
Significant increase in nodules number, nodule fresh weight and
nitrogen uptake along with grain yield was recorded in chickpea with
rhizobium inoculation (Romdhane et al., 2007). The average increase due
to inoculation was 110% over the un-inoculated control. Different
genotypes responded differently to inoculation, the effect of various
rhizobium strains was also diverse (Tellawi et al., 2007). Stover yield also
showed positive response to inoculation along with seed yield, nodule
number and nodule weight in chickpea (Bhuiyan et al., 2008).
Requirement of competitive rhizobium was reported for enhanced
nodulation and yield of chickpea and is economically promising to
increase chickpea production (Romdhane et al., 2008).
16
2.3 Inheritance and linkage study of gene responsible for nodulation in chickpea
Non-nodulation trait is controlled by two tetrasomically inherited
recessive genes (nn1, and nn2) in Alfalfa. At both loci the nulliplex condition
resulted in non-nodulation. The non-nod trait segregates independently of
one another (Peterson and Barnes, 1981). In chickpea nodulation study
through combining ability showed that nodulation was predominantly under
the control of non-additive gene action although considerable additive effect
was also present (Bhapkar and Deshmukh, 1982). In another study
resistance race 1 of Fusarium oxysporum f.sp was found to be controlled by
at least two genes in chickpea. Presence of both genes in homozygous
recessive form is must for complete resistance (Updhyaya, 1983). In
soybean the gene for ineffective nodulation in Kent was dominant over the
gene responsible for normal nodulation in Pecking with the fast-growing
rhizobial strain USDA 205 (Devin, 1984).
Host genetic control of nodulation in the chickpea rhizobium
symbiosis was tested by nodulation mutants PM665, PM679 and PM 233 at
different root temperatures (24°C, 29°C and 34°C). Mutant PM 233 did not
form nodules at any temperature tested while other mutants altered their
nodulation response at different root temperature (Devis et al., 1986).
These mutants of chickpea were characterized by rhizobium strain CC1192.
Genetic studies showed that the Nod– phenotypes in PM233, PM665, and
PM679 were controlled by recessive alleles at three different loci. They
proposed that the symbols rn1, rn2, and rn3 be assigned to the loci
producing the non-nodulated phenotype in mutants PM233, PM665, and
PM679, respectively (Thomas et al., 1986). Similarly in mutants PM405 and
17
PM796 of chickpea ineffective nodulation is controlled by two recessive,
non allelic root nodulation genes. Recessive epitasis was observed in
cross PM405 x PM796 (Devis, 1988).
A new genetic model involving three genes in the inheritance of non-
nodulation was proposed in pea. Nodule formation is controlled by two
genes while the third genes inhibit nodulation only when it is dominant and
the former two genes (that control nodule formation) are in recessive
homozygous condition. They suggested that nodulation intensity appears to
be controlled quantitatively (Dutta and Reddy, 1988).
Non-nodulation in mutant ICC 435 of chickpea is controlled by single
recessive gene. Recessive gene that control non-nodulation in mutant ICC
435 is different from the recessive gene that control non-nodulation in
mutant PM 233 (Singh et al., 1992). In another study monogenic dominant
gene action was reported for nodulation in chickpea genotypes, Annegeri,
Rabat, PM 233 and P 319-9. The recessive gene controlling non-nodulation
of roots in previously identified mutants (PM 233, P319-9 NN, and Anigeri
NN) is different from the one that identified in Rabat NN (Singh and Rupela,
1998). However, in pea, lines UF 487A, PI 262090, and Florunner,
nodulation is controlled by three genes at three independent loci (Gallo-
Meagher et al., 2001).
Nodulation in promiscous (produce functional nodules and green
leaves) type of soybean is controlled by two dominant alleles at two
segregating loci and thus in non-promiscous (no or nonfunctional nodules
and yellow leaves) it is controlled by recessive alleles at each locus (Gwata
et al., 2005).
18
Genetic linkage was reported among gene controlling restricted root
nodulation (Rj1) and gene responsible for fascinated stem (F) in soybean.
The two loci were separated by a distance of 40 ± 2.2 genetic map units
(Dvine et al., 1983). Allelic and linkage associations among five
morphological markers of chickpea showed linkage between allele for white
flower color (w2) and filiform leaf trait (fil). Linkage was also exhibited
between simple leaf trait (slv) and root nodulation gene (rn3). They also
observed a loose linkage between the w2-fil and the rn3-slv (Devis, 1991).
Linkage relationship between principle subtypes of histone (H1) and
the cotyledon protein FG which is soluble in perchloric acids was recorded.
The two groups of genes were found to be linked with a recombination value
ranging from 6.5 to 9.5. The corresponding genes of Pisum sativum (garden
pea) were also found to be linked (Gorel and Berdnikov, 1993). Flower type
(open or closed) and leaf type (small or large) of chickpea were found to be
controlled by single recessive gene. Linkage was reported between these
two valuable traits (Pundir and Reddy, 1998).
Linkage was reported in B. oleracea among loci for genetic male
sterility and seedling markers. Linkage was also observed between male
sterility gene ms-1 of green sprouting broccoli (var. italica) and gene c
(antheocyanin free plant with bright green hypocotyls) of curly kale (var.
acephala) and variegated ornamental kale (Sampson, 1966a). Furthermore,
linkage was recorded between genes po (polycotyledony) and le (leaf
excrescened), among loci gl-3 (glossy) and pg (pale green) and between the
glossy foliage gene gl-y and gl-e3 of the linkages group 1(Sampson, 1967b).
In B. oleracea Linkage was also detected between the genes Fn (fern-leaf)
and c-2 (antheocyanin suppressor), and genes cp-1 (crinkly petal) and A
19
(pigmented overy) (Wills and Smith, 1972). Genes responsible pg-2 (pale
green foliage) and Hr-1 (hairy leaf) (Wills and Smith, 1974), cp-1 (crinkily
petal) and as (anther spot) and gl-el (glossy foliage) also showed linkage in
B. oleracea. Genes fc1 and fc2 (fused cotyledon) were found to be unlinked
(Wills and Smith, 1973). A dominant gene for heavy pubescence, designated
Hr –2, from curly kale (var. acephala) acted in an additive manner with gene
Hr-1 (hairy leaf margins) to produce relatively long hairs on leaves, petioles
and stems. Linkage (group 4) between the two genes was tentatively
proposed (Sampson, 1978).
2.4 Molecular characterization of chickpea germplasm using Microsatellite (SSR) markers
Microsatellite markers were found to be useful in distinguishing
diverse genotypes. The large amount of polymorphisms permits a quick
and efficient detection of barley genotypes (Struss and Plieske, 1998).
High level of interspecific polymorphism was reported with microsattelite
markers as compare to isozymes, RAPDs and conventional RFLPs which
revealed slight or no polymorphism. The amount of variation revealed by
microsattelite had significant positive correlation with the average number
of repeats, showing that replication slippage may be the molecular
mechanism involved in generation of variability at the loci (Udupa et al.,
1999).
Simple sequance repeat (microsatellite) markers were reported to
be efficient for assessing the genetic variability patterns within chickpea
(Winter et al,. 1999). Significant proportion (14.6%) of genetic variation
20
among cultivar was recorded by analysis of molecular variance (AMOVA)
with SSR markers in raygrass (Christine et al., 2001). SSR markers
detected an average of five alleles per locus and had mean polymorphism
information content (PIC) value of 0.67 in rice (Coburn et al., 2002).
Microsatellite markers have great value in the evaluation of
polymorphic information content, diversity index, and probability of identity
in legumes (Jan et al., 2002). With RAPD markers analysis of molecular
variance (AMOVA) showed 18% of the total variation by species, 15% by
populations within species, and 67% by individuals within populations. G.
max and G. soja groups are separated completely by principal component
analyses and cluster analysis (Zenglu and Randall, 2002). Different levels
of variability were recorded with SSR markers while studying bean types.
Lower level of variation was recorded for fine French bean, indicating the
effect of breeder’s intensive selection (Métais et al., 2004)
Simple sequence repeats (SSR) were reported to cause mostly the
modification of the gene with which they are connected. The number of
repeats is responsible for the influence of SSRs on gene regulation,
transcription and protein function. However there are frequent and reversible
mutations that add or subtract repeat units, thus SSRs provide a productive
source of qualitative and quantitative variation. Over the last decade,
researchers have reported that this spontaneous variation has been tapped
by artificial and natural selection to adjust almost every aspect of gene
function. These studies support the hypothesis that SSRs, by asset of their
special mutational and functional qualities, have a most important role in
producing the genetic diversity underlying adaptive evolution (Kashi and
King 2006).
21
Evaluation of chickpea genotypes differing in reaction to ascochyta
blight by simple sequence repeat (SSR) markers linked to quantitative trait
loci (QTL) for resistance, revealed that it is possible to enhance the level of
resistance by crossing moderately resistant parents with distinct genetic
backgrounds at the QTL for resistance to ascochyta blight (Tar’an et al.,
2007). SSR markers are well suited for studies of genetic diversity and
cultivar identification in chickpea because SSR markers are polymerase
chain reaction (PCR)-based markers, extremely polymorphic, and amenable
to high-throughput technologies (Imtiaz et al., 2008).
22
CHAPTER 3
MATERIALS AND METHODS
The research project was conducted in the chickpea growing seasons
of 2006 to 2009. The project consisted of classical breeding (carried out at
Peshawar, Pakistan) and molecular study (accomplished at Faculty of
Agriculture, Ehime University Matsuyama, Japan).
3.1 Procurement of seed
Forty-nine local and exotic genotypes were procured from Nuclear
Institute for Food and Agriculture (NIFA), Peshawar, Grain Research Station
(GRS), Ahmadwala Karak and International Crops Research Institute for the
Semi-Arid Tropics (ICRISAT), India.
Out of 40 genotypes procured from NIFA, two genotypes (NKC-262-
26 and NKC-452-2) did not germinate. Out of remaining 38 genotypes, 22
(NDC-122 to NDC 4-20-7, NIFA 88 to NIFA 2005 and Hassan 2K) were
developed through induced mutation through gamma irradiation of four
genotypes i.e. C-44, Pb-91, 6153 and ILC-195. The remaining 16 genotypes
obtained from NIFA were the selection from hybrids originated at ICRISAT,
India and ICARDA, Syria. Genotypes, NDC 5-S10 and NDC 5-S11 were
developed through hybridization of Desi and Kabuli genotypes at ICRISAT.
Genotypes NKC-10-99 to NKC-5-S24, were developed through hybridization
of Kabuli x Kabuli lines at ICARDA. Five genotypes (Karak 1 to Lawaghar)
procured from ARS were the selection from land races of Pakistan. Four
genotypes (ICC4993 to ICC19181) were obtained directly from ICRISAT, out
of these two genotypes (ICC19183 and ICC19181) were developed at
23
ICRISAT while the other two are land races, one from India (ICC4993) and
one (ICC4918) from Morocco (Detailed description along with pedigree of
these genotypes is presented in Table 3.1.).
3.2 Experimental sites
Field experiment was conducted in department of Plant Breeding and
Genetics (PBG), Khyber Pukhtunkhwa Agricultural University Peshawar
(KPK-AUP) in the season of 2006-07. In this experiment germplasm was
characterized for genetic markers and other quantitative traits.
In the same season (2006-07), the second experiment was conducted
in pots in the net house facility of Institute of Biotechnology and Genetic
Engineering (IBGE) KP-AUP, to evaluate genotypes for presence or absence
of nodules without rhizobium inoculation as well as with rhizobium
(Rhizobium leguminosarium) inoculation and grouped into nodulated and
non-nodulated genotypes. The germplasm was also characterized for
number of nodules plant-1 (without inoculation) to recognize the highly
nodulated genotypes. In this experiment the effect of inoculation on number
of nodules and seed yield plant-1of diverse chickpea genotypes was also
studied.
In experiment 4 all the 47 genotypes were also characterized at
molecular level for confirmation of groupings (nodulated/non-
nodulated).Also, to study diversity in the germplasm and among nodulated
and non-nodulated genotypes at molecular basis. This experiment was
performed in the Forest Resource Biology (FRB) laboratory and green house
facilities of Ehime University Matsuyama, Japan during March-October 2008
24
Third experiment was consisted of study of inheritance pattern of
nodulation and linkage of gene responsible for nodulation with morphological
marker (leaf color) using selected highly nodulated and non-nodulated
genotypes (experiment 2).
These genotypes were crossed in the experimental fields of the
department of PBG, during growing season of 2007-08. In the subsequent
season (2008-09), the F1 generation was grown in the fields of Nuclear
Institute for Food and Agriculture (NIFA), Peshawar to get the F1 population.
Back crosses were also made. During September-October 2009, F1,
backcross and F2 populations along with concerned parents were evaluated
for presence (+) or absence (-) of nodules and leaf color, in the net house of
the department of PBG, KP-AUP.
25
Table 3.1 Pedigree and origin of genotypes/accessions used in the study Genotype name
Parentage Origin Genotype name
Parentage Origin
NDC-122 C-44 x ILC-195
NIFA, Pakistan
NKC-10-99 Flip98-138c x Sel99th15039
ICARDA/,Syria
NDC-727 C-44/M NIFA, Pakistan
NKC-5-S12 BAHODIR x SEL99TER85530
ICARDA, Syria
NDC-728-5 C-44/M NIFA, Pakistan
NKC-5-S13 SEL99TH15039 x S98008
ICARDA, Syria
NDC-730-2 C-44/M NIFA, Pakistan
NKC-5-S14 SEL99TH15039 x S98008
ICARDA, Syria
NDC-15-1 Pb-91/M NIFA, Pakistan
NKC-5-S15 FLIP98-15C x S98033
ICARDA, Syria
NDC-15-2 Pb-91/M NIFA, Pakistan
NKC-5-S16 S99456 x SEL99TER85314
ICARDA, Syria
NDC-15-3 Pb-91/M NIFA, Pakistan
NKC-5-S17 S99456 x SEL99TER85314
ICARDA, Syria
NDC-15-4 Pb-91/M NIFA, Pakistan
NKC-5-S18 (ILC4291xFLIP98-129C) x S98008
ICARDA, Syria
NDC-4-15-1 C-44/M NIFA, Pakistan
NKC-5-S19 (ILC4291xFLIP98-129C) x S98008
ICARDA, Syria
NDC-4-15-2 C-44/M NIFA, Pakistan
NKC-5-S20 (FLIP98-138C x SEL99TH15039)
ICARDA, Syria
NDC-4-15-3 C-44/M NIFA, Pakistan
NKC-5-S21 GLK95069 x SEL99TER85530
ICARDA, Syria
NDC-4-20-1 C-44/M NIFA, Pakistan
NKC-5-S22 CA9783007 x SEL99TER85534
ICARDA, Syria
NDC-4-20-2 C-44/M NIFA, Pakistan
NKC-5-S23 CA9783007 x SEL99TER85534
ICARDA, Syria
NDC-4-20-3 C-44/M NIFA, Pakistan
NKC-5-S24 CA9783007 x SEL99TER85534
ICARDA, Syria
NDC-4-20-4 C-44/M NIFA, Pakistan
HASSAN-2K ILC-195/M NIFA, Pakistan
NDC-4-20-5 C-44/M NIFA, Pakistan
Karak 1 Local selection Karak, Pakistan
NDC-4-20-6 C-44/M NIFA, Pakistan
Karak 2 Local selection Karak, Pakistan
NDC-4-20-7 C-44/M NIFA, Pakistan
Karak 3 Local selection Karak, Pakistan
NDC-5-S10 JG 74 x ICC 12071.
ICRISAT, India
Sheenghar Local selection Karak, Pakistan
NDC-5-S11 JG 74 x ICC 12071.
ICRISAT, India
Lawaaghar Local selection Karak, Pakistan
NIFA-88 6153/M NIFA, Pakistan
ICC 4993 Rabat Karnataka, India
NIFA-95 6153/M NIFA, Pakistan
ICC 19183 ICC 4993 ICRISAT
NIFA-2005 PB-91/M NIFA Pakistan
ICC 4918 Annigeri Morocco
NKC-262-26 ILC-195/M NIFA/,Pakistan
ICC 19181 ICC 435 ICRISAT
NKC-452-2 (ILC4291 x Flip98-129c) x S98008
ICARDA, Syria
26
3.2. Experiment 1 Characterization of germplasm for various
morphological markers and quantitative traits
This experiment was carried out using a Randomized Complete
Block Design (RCBD) with three replications. Each replication consisted of
forty nine blocks of 4 m2, having a block to block distance of 40 cm. Each
block was divided in three rows, each of which was of 4 m long. Plant-to-
plant spacing between and within rows was kept 30 cm and 10 cm,
respectively.
Morphological or genetic markers
All genotypes were characterized for three morphological markers
i.e. flower color (pink / white), stem color (green / green with purplish
tinge) and seed coat color (brown /dark brown / yellow / white).
Quantitative characteristics
Genotypes were also evaluated for quantitative traits including days
to 50% flowering, days to maturity, plant height, number of leaflets leaf-1,
leaf area, seed yield plant-1,100 seed weight and biological yield.
Procedures for recording observations
Morphological markers
Flower color and stem color were recorded at flowering stage while
seed coat color was noted at pod maturity.
27
Quantitative traits
Ten equally competitive plants were ear marked from each genotype
replication-1 for recording data on the quantitative traits. Days to 50%
flowering were recorded as number of days from the date of sowing to the
date on which at least 50% of the plants had at least one flower. Days to
maturity were counted from the date of sowing to the date on which 90% of
the plants had mature pods. Data on plant height was documented in cm at a
stage when plants turned brown and ceased further growth. Plant height of
the already selected plants was measured from the ground level to the tip of
the plant with the help of a meter rod. Average number of leaflets leaf-1 were
noted for five randomly selected leaves selected from each plant, while Leaf
area of the same leaves was measured in cm using leaf area meter (Licor
model 2000).
After about 175 days, most of the genotypes were mature. Pods from
the already selected plants were harvested and threshed separately. Seeds
of these selected plants genotype-1 were weighed using electric balance and
recorded as Seed yield plant-1. A random sample of 100 seeds from each
genotype was also weighed. Selected plants of all genotypes were carefully
uprooted and sun dried. Total biomass of each selected plant was weighed
and average weight plant-1 (g) was calculated as biological yield plant-1.
Data analysis
Data were analyzed using statistical software SAS (statistical analysis
system) version 9 following the model for a Randomized Complete Block
Design (RCBD). Least significant difference (LSD) test at 5% probability
level was applied for mean differences (James et al., 1997).
28
The genetic parameters (genotypic and phenotypic variances, and
their coefficient of variation) and heritability (broad-sense) were estimated
as suggested by Burton (1952) and Hanson et al. (1956), respectively.
Details of the equations used are as follows
Genotypic Coefficient of Variation
Phenotypic coefficient of variation
Heritability
Where
Vg = Genotypic variance; Vp = Phenotypic variance; Ve = Environmental
variance; MSG = mean squares of genotypes; MSE = mean squares of
error; r= number of replications; Ū= mean value for a particular trait
3.4.1 Experimsnt.2 Characterization of genotypes for nodulation and effect of rhizobial inoculation on nodules number and seed yield plant-1
Treatments and design
To study presence or absence of nodules, the effect of rhizobium
inculcation on nodules number and seed yield plant-1 and to select highly
nodulated and non-nodulated genotypes for further study, a pot
100x(GCV)u
gV 2
100)( xPCVu
Vp
r
MSeMSgVg
Vp
Vg
VeVgVp
29
experiment was carried out in the net house of Institute of Biotechnology
and Genetic Engineering (IBGE), KP Agricultural University, Peshawar
during 2006-07. The inoculum (Rhizobium leguminosarium) for seed
treatment was provided by Soil Microbiology section of Agriculture
Research Institute, Tarnab, Peshawar.
The experiment comprised of two treatments (un-inoculated and
inoculated). Pots were arranged in three replications using Completely
Randomized Design (CRD). Seeds of each genotype were sown in two
pots replication-1 @ 5 seeds pot-1 in each treatment. Pots having a
diameter of 22 cm were filled with 4.5 KG soil. Potting soil was comprised
of 50% clay and 50% sand. All genotypes (Table 3.1) were evaluated for
number of nodules plant-1 genotype-1 in un-inoculated pots as well as in
the pots treated with inoculum. Moreover effect of inoculation on seed
yield plant-1was also recorded.
Inoculant preparation and use
Chickpea inoculation slurry was prepared by adding 40 g of
inoculant in 300 ml of 5% sugar solution. The contents were stirred well.
Sugar solution improves the adhesion of inoculant to the seed. Slurry was
then poured on seed, and mixed in a clean vessel or on a plastic sheet
until all the seeds were uniformly coated. The whole inoculation procedure
was completed in shade as sunlight damages the bacteria. Seed were
then dried in shade for about an hour before sowing in pots.
30
Procedure for data collection
Plants were removed from pot at flowering stage. Soil was washed
out by dipping the plants along with the soil into a tub of clean tap water.
This procedure was repeated three times for each entry in order to remove
soil thoroughly. All genotypes were checked for presence or absence of
root nodules. Number of nodules plant-1 was also recorded for inoculated
and un-inoculated treatments. Seed yield plant -1 was recorded in g, after
harvest by weighing seeds of each plant pot -1 for all genotypes in both
treatments.
Figure 3.1 Washing Procedure of roots to check nodules
31
Data analysis
Data of number of nodules plant-1 was analyzes by SAS (statistical
analysis system version 9). Genotypic and phenotypic variances, their
coefficient of variation and heritability (broad-sense) were estimated as
suggested by Burton (1952) and Hanson et al. (1956), respectively
(formulas are given in experiment 1)
The effect of rhizobium inoculation on the number of nodules plant-1
and seed yield plant-1 of chickpea and difference among treatments (un-
inoculated and inoculated) were analyzed using analysis of variance
procedures (SAS, statistical analysis system version 9) for two factorial
design by using PROC GLM. The differences among the treatments
mean, genotypes mean and interaction of treatment and genotype were
compared, using least significant difference (LSD) test at 5% probability
level.
Percent change (Percent increase or decrease) in number of
nodules plant-1 and seed yield plant-1 after rhizobium inoculation of each
genotype was obtained by the following formula
% change = Mean of inoculated – Mean of un-inoculated X 100 Mean of un-inoculated
On the basis of presence or absence of nodules (with rhizobium
inoculation and without inoculation) in each genotype the germplasm was
divided into nodulated and non-nodulated groups. Among nodulated
genotypes highly nodulated genotypes were selected, for studying
inheritance and linkage study of nodulation.
32
3.5 Experiment.3 Inheritance and linkage study of nodulation
Three chickpea genotypes viz., NDC 5-S-10 (nod+), NDC 4-20-4
(nod+) and ICC 19181, (nod-) selected in experiment 2. Selection was
based on high nodulated and non-nodulated genotypes.
Hybridization of Nod+ with Nod- chickpea genotypes
These genotypes were crossed in the following two combinations
during 2007-08 in the field of PBG, AUP.
Production of F1 and backcross seeds
The hybrid seeds obtained from both cross combinations were
grown during 2008-09 in the field of Nuclear Institute for Food and
Agriculture (NIFA), Peshawar. The parents and F1 generation (seeds of
hybrid A and hybrid B) were raised in separate rows as follows:
Row 1: Male parent of hybrid A (NDC 5 S 10)
Row 2: Hybrid A seeds (ICC19181 x NDC 5-S-10)
Row 3: Female parent of hybrids A and B (ICC 19181)
Row 4: Hybrid B seeds (ICC19181 x NDC 4-20-4)
Row 5: Male parent of hybrid B (NDC 4-20-4)
F1 plants of both cross combinations (hybrid A and hybrid B) were
backcrossed to their respective female as well as male parents in order to
S.No Cross combination Hybrid Name
1 ICC19181♀ x NDC 5-S-10♂ Hybrid A
2 ICC19181 ♀x NDC 4-20-4♂ Hybrid B
33
produce backcrossed population (BC11F1, BC12F1) for assessing the
inheritance pattern of nodules.
Seeds from the F1 plants (including backcross seeds as well as F1
seeds) were collected separately.
Segregating population
In the season of 2009, the following populations were tested for
presence/absence of nodulation in the screen house of the Department of
Plant Breeding and Genetics, KP Agricultural University Peshawar.
Parents (ICC 19181, NDC 5-S-10 and NDC 4-20-4)
F1 (of hybrids A and B),
Backcross, BC11F1a (hybrid A X ♀ parent),
Backcross, BC12F1a (hybrid A X ♂ parent)
Backcross, BC13F1b (hybrid B X ♀ parent),
Backcross, BC14F1b (hybrid B X ♂ parent)}
F2 (of hybrids A and B)
Data was recorded for the presence/absence of nodules on 120
plants of parents (40 plant parent-1), 57 plants of F1 (27 plants of hybrid A
and 30 plants of hybrids B), 270 backcross plants (84 plants of BC11F1a, 48
of BC12F1a and 79 of BC11F1b, 59 BC12F1b) and 226 F2 plants (109 from
hybrid A and 117 from hybrid B). Three seeds were sown pot-1 [22 cm-
diameter pots filled with 4.5 KG soil (50% sand + 50% clay)]. Seeds were
inoculated at the time of sowing with rhizobium leguminosarium strain. Pots
of each entry were placed in eleven separate rows as per following details:
34
Row 1: 14 pots (40 plants) of ICC 19181 (♀ parent of both hybrid A and B)
Row 2: 14 pots (40 plants) of NDC 5 S 10 (♂ parent of hybrid A)
Row 3: 14 pots (40 plants) of NDC 4-20-4 (♂ parent of hybrid B)
Row 4: 9 pots (27 plants) of hybrid A (ICC19181 x NDC 5-S-10)
Row 5: 10 pots (30 plants) of hybrid B (ICC19181 x NDC 4-20-4)
Row 6: 28 pots (84 plants) of Backcross BC11F1a (Hybrid A x ICC 19181)
Row 7: 16 pots (48 plants) of Backcross BC12F1a (Hybrid A x NDC 5-S-10)
Row 8: 27 pots (79 plants) of Backcross BC11F1b (Hybrid B x ICC 1918)
Row 9: 20 pots (59 plants) of Backcross BC12F1b (Hybrid B x NDC 4-20-4)
Row 10: 37 pots (109 plants) of F2 population of hybrid A
Row 11: 40 pots (117 plants) of F2 population of hybrid B
Plants were evaluated after six weeks of sowing for the presence or
absence of nodules (Singh and Rupela, 1998)
Data collection
Data leaf color was also recorded six weeks after sowing (used for
linkage study in experiment 3 part 2) for all populations. Plants along with
soil were removed from pots by holding pots upside down (to study the
presence or absence of nodules). The soil was washed out thoroughly
(washing procedure is same as presented in section 3.4). All plants were
carefully scored for leaf color and presence or absence of root nodules.
Data analysis
The Chi-square (χ2) test using Yates correction factor to adjust small
population size was used to test the goodness of fit for appropriate genetic
hypotheses (Steel et al., 1980). Data on presence or absence of nodulation
35
in F2 and backcross populations were tested based on the hypothesis that
it will fit to the expected ratios of 3:1, 1:1, respectively. The test statistics
was calculated as described by Yates (1934).
Where:
χ2 Yates= test statistic that asymptotically approaches a χ2 distribution
with yates correction factor.
Oi = observed frequency
Ei = expected (theoretical) frequency, asserted by the null hypothesis
N = number of distinct event
For linkage study between gene responsible for nodulation and leaf
color, the data recorded in F1 and F2 generations was analyzed through
Linkage 1 computer program (Sulter et al., 1983).
3.6 Experiment 4 Molecular characterization of chickpea germplasm using microsatellite markers
Molecular analysis of chickpea germplasm was performed in Forest
Resource Biology Laboratory at Faculty of Agriculture, Ehime University
Matsuyama, Japan.
DNA Extraction
Seeds of chickpea were sown in 27 cm diameter pots containing 7.5
Kg of sandy soil with 5 seeds per pot in a green house. DNA was extracted
36
separately from fresh leaves of 2 to 5 week old plants for each genotype
using modified CTAB method described by Doyle and Doyle (1990). Details
of the method are given below:
1. 0.5 g of leaves were weighed and placed into a pestle. Liquid
nitrogen was poured on leaves and grinded with a mortar to convert
them into powder form. Then 10 ml Cold isolation Buffer I (CIBI) was
added and further grinded.
2. The material was filtrated with cheese cloth.
3. The solution was transferred to 15 ml spits tube, and centrifuged at
3,500 rpm for 10 min. Then the upper solution was discarded.
4. 2.5 ml of Cold isolation Buffer (CIB) II was added and kept in
refrigerator for 10 min.
5. 2.5 ml of 2 x CTAB (cetytriammoniumbromide) was added. Mixed
well and kept in water bath at 60°C for 30 min.
6. Equal volume (5 ml) of CIA (Chloroform: L isoamylalchohol, 24:1)
was added. Shacked for 15 min on shaker.
7. Centrifuged at 3,500 rpm for 10 min.
8. The supernatant was transferred to a new 15 ml spits tube. The
debris was discarded to a determined container.
9. 2/3 vol. of ice-cold isopropanol was added and mixed gently. DNA
appeared (Isopro-precipitation).
10. Isopro-precipitation was centrifuged at 3,500 rpm for 10 min and the
upper solution was discarded carefully, not to lose the precipitation
(DNA).
37
11. Alcohol was removed completely. 250µl of TE (10 mM TrisCl PH8.0,
1mM EDTA PH8.0) was added to dissolve DNA. DNA solution was
transferred into a new 1.5 mL Eppendorf tube.
12. 0.5 µl of RNase (10mg/mL) was added and incubated at 37°C for 30
min in a water bath.
13. Equal volume (250 µl) of Tris-EDTA saturated phenol was added.
Mixed well for 5 min.
14. Centrifuged at 10,000 rpm for 10 min. The supernatant was
transferred to a new 1.5 mL Eppendorf tube.
15. 1/10 volume (18 µl) of 3M sodium acetate was added; mixed well
and then 2.5 volumes (500 µl) of 100% ethanol was added. Mixture
was kept in a freezer at -20°C for at least 30 min. Mixed gently and
DNA precipitation were appeared (this step is called “ethanol
precipitation”).
16. Mixture was centrifuged at 12,000 rpm for 10 min. The upper
solution was discarded with care so that not to lose DNA.
17. 70% ethanol was added gently on top of DNA (rinsing). Kept at
room temperature for 5 min without mixing.
18. DNA along with 70% ethanol was centrifuged at 12,000 rpm for 10.
The upper solution was discarded. Kept at room temperature with
the tube lid open (air dry).
19. 100µl of TE (10 mM TrisCl PH8.0, 1mM EDTA PH 8.0) was added to
dissolve DNA. Then kept in refrigerator.
38
Amplification of DNA
Ten SSR (microsatellite) markers including 5 dinucleotide and 5
trinucleotide repeats were used for genotyping. Eight markers were screened
from C. arietinum BAC libraries (Lichtenzveig et al., 2005) and 2 were Cicer
arietinum sequence-tagged microsatellite site (CaSTMS) markers screened
from a genomic library of the same species (Hüttle et al., 1999). Primers were
labeled with FAM, HEX, and NED fluorescent dyes (Applied Biosystems, Foster
City, USA). Sequences of the primer pairs for each marker are listed in Table
3.2. The reaction mixture for amplification of markers contained 8.4 µl of distilled
water, 1.25 µl of 10× PCR buffer, 1.25 µl of 2 mM deoxynucleotide mix, 0.5 µM
forward and reverse primers, 0.1 U of Taq DNA polymerase (Blend Taq,
Toyobo, Osaka, Japan) and 5 ng of genomic DNA in a total volume of 12.5 µl.
Microsatellite amplification was carried out using the following cycling
parameters: preheating for 3 min at 95°C followed by 25 cycles of denaturing at
94°C for 30 sec, annealing at primer specific temperatures of 48–60°C for 30 sec
(Table 3. 2), and extension for 1 min at 72°C. Reactions were completed by
incubation at 72°C for 1 min and holding at 4°C. The PCR products were
denatured for 2 min at 95°C and separated by capillary electrophoresis on an
ABI Prism 310 Genetic Analyzer (Applied Biosystems). GeneMapper software
(Applied Biosystems) was used for sizing and genotyping microsatellite
alleles.
39
Table 3.2 Details of primers sequencing
Locus Sequence Annealing
temperature Motif Repeats
H1116f GACATGAAATTCGGTGCATT 52°C GA 20
H1116r AACGCCCTAAACCTCTTGGT
H1F17f GGGGAGGAAGAAGATGGAA 48°C TA 27
H1F17r GCGTTATGGGTGGAAATGGTA
H3C06f AATTTCGTGAATCATTAAAAATAGAGG 55°C TAA 23
H3C06r CACATGACTATCTAGACATTTTATTTATC
H3A10f TTTAAGGCTTCAGGTATTGATTTCT 55°C TTA 24
H3A10r TCACACATGCCAACTTAAAATAAAA
H3A07f GCGACACCTATTCCTCTTTTCTA 58°C TTA 20
H3A07r TCATTTTTGGAATATTTTAGTGACAA
H2J09f AACGAAAAACAAGGGAGAAAAA 52°C GA 18
H2J09r TATTTCTTTGACTCCCCCTAACTT
H1B11f GCAGCTGTTGACATCTAATTTTG 60°C TAA 20
H1B11r ACCGAAAACACTTGTGATTGTTA
H6G07f TCTATCAGAGATATTAAGTTGAACG 60°C TAA 23
H6G07r CGTGACAGAATTAGCCTCTTGT
CaSTMS19f TGAAGCTGGGGGTTCCTTG 50°C AT 15
CaSTMS19r TCAATTGAGTCGCGACGAGAG
CaSTMS25f TACACTACTGCTATTGATATGTGGT 50°C CT 19
CaSTMS25r GACAATGCCTTTTTCCTT
40
Microsatellite data analysis
Genetic diversity parameters were computed using GenAlEx 6
software (Peakall and Smouse, 2006). The following statistics were
estimated: average number of alleles (Na), and effective number of alleles
(Ne). Polymorphic information content (PIC) of each microsatellite locus was
determined as described by Weir (1996):
PIC 1 pi2
where pi is the frequency of the ith allele in the examined test lines. The
estimation of genetic differentiation was performed using AMOVA and
Principal coordinate analysis (PCoA) implimented in GenAlex 6. Random
permutation test with 999 shuffles was performed under the assumption of
stepwise mutation model (Slatkin, 1995). Phylogenetic analysis was
completed using UPGMA and ME method using MEGA4 software (Tamura
et al., 2007) based on the genetic distance matrix constructed by the method
of Smouse and Peakall (1999).
41
Chapter 4 Results and Discussions
Experiment.1. Characterization of chickpea germplasm for various morphological markers and quantitative traits
4.1.1 Introduction
The assemblage of germplasm with a wide range of genetic
variability is preliminary and prerequisite step to initiate a successful
breeding program. The efficacy of a germplasm collection would be
enhanced if the distinctive features of each accession were to be
described and recorded, so that researcher could choose those
accessions from the collection, which have the desired genetic
characteristics for the specific objectives of a program.
The characterization of diversity in germplasm collections is
important to plant breeders for crop improvement and to gene bank
curators for efficient and effective management of collection (Updhaya,
2003). The presence of genetic variability is of utmost importance for any
breeding program and for that reason the plant breeders have recognized
the evaluation and characterization of germplasm for the improvement of
crop yield (Virmani et al., 1983; Bakhsh et al., 1992) as well as for
selection of core collection for utilization in breeding programs. Thus the
evaluation of germplasm is not only useful in selection of core collection
but also for its utilization in breeding programmes.
Chickpea has high variation for various qualitative and quantative
traits i.e. grain color and shape, color of flower, podding, seed coat color,
earliness, insect pests resistance, like any other crop of different
ecological zones, that can help breeders to release better and superior
42
lines and varieties (Dasgupta et al., 1987; Singh, 1997). For maintenance
and efficient utilization of germplasm, it is important to investigate the
extent of genetic variability and its magnitude for the determination of the
success of a breeding program (Smith et al., 1991).
An initial step in a breeding program is the assembly of germplasm
with a wide range of genetic variability. The utility of a germplasm
collection would be enhanced if the unique features of each genotype
were to be described and recorded, so that the researcher could choose
those genotypes in the collection, which have the genetic characteristics,
desired for his specific objectives (Shah, 1999).
Evaluation and characterization of chickpea germplasm has received
attention of plant breeders due to increased recognition and its
importance (Virmani et al., 1983; Bakhsh et al., 1992). Thus due to utmost
importance of genetic diversity, the present study was planned with
following objectives
1. Characterization of genotypes for various genetic markers
2. Characterization of genotypes for other quantitative characters
3. To estimate heritability of different important traits
4.1.2 Materials and Methods
Forty nine local/exotic genotypes obtained from NIFA, Peshawar;
GRS, Ahmedwala Karak and ICRISAT, India were evaluated in the field of
Plant Breeding and Genetics department, Agricultural University
Peshawar, during the season of 2006-07. The material was planted in
randomized complete block design (RCBD) with three replications. Out of
49 genotypes two genotypes failed to germinate therefore data were
43
collected on 47 genotypes (Table 4.1.7). Detailed materials and methods
including data collection, data analyses etc of this experiment are
presented in chapter 3 section 3.3.
4.1.3 Results
4.1.3.1 Characterization for morphological markers
Characterization for flower, stem and seed coat color of all
genotypes is presented in Table 4.1.1. Significant variation in color of
three traits among genotypes was observed. Out of 47 genotypes, 29
genotypes including 23 from NIFA, four from Karak and two from
ICRISAT, India (Table 4.1.7) produced pink flowers, green with a purplish
tinge stem and light brown to dark brown or yellowish seed coat color
(Table 4.1.1). These markers are typical for Desi type chickpea. Rest 18
genotypes including 15 from NIFA, one from Karak and two from ICRISAT
(Table 4.1.7) produced white flowers with green stem and white seed coat
(Table 4.1.1). These characters are distinctive for Kabuli type chickpea.
These markers play a vital role in identification of land races and
estimation of out-crossing percentage in chickpea.
4.3.2 Characterization for quantitative characters
All genotypes were also evaluated for days to flowering, days to
maturity, plant height, leaflets leaf-1, leaf area, seed yield plant-1, 100-seed
weight, and biological yield. Analysis of variance (Table 4.1.1 and 4.1.2)
and mean values (Table 4.1.3 and 4.1.4) for each trait showed highly
significant differences and broad range of variation for various traits for
44
genotypes, which is amenable for genetic improvement of chickpea
through selection. Flowering in genotype ICC19183 was earlier (90 days),
while in NDC-4-20-6 was late (122). Genotype ICC19181 matured earlier
(163 days) while genotype Sheenghar matured later (178 days). Plants of
the accession NDC 5-S11 were the shortest (47 cm) whilst those of NKC-
5-S15 were the tallest (94 cm). Leaf area of accession NKC-5-S18 was
the largest (10.92 cm) whereas of genotype ICC4918 was the smallest
(1.73 cm). Genotypes NDC-730-2 and NDC-4-20-2 produced the
maximum number of leaflets leaf-1 (16.33) while genotype NDC-5-S11
produced the minimum (11.66) leaflets leaf-1. On average seed yield of
Karak 3 was the maximum (28.9 g) while of NDC-15-2 was the lowest (4.1
g). Weight of 100 seed of NKC-5-S18 was the maximum (39 g) whereas of
NDC-4-20-1 was the minimum (13 g). NIFA-2005 produced the highest
biological yield (68 g) whilst NKC-5-S19 yielded the lowest (14.3 g).
Heritability estimates (Table 4.1.6) were high for days to 50%
flowering (93%), biological yield plant-1 (89%), plant height (88%), 100
seed weight (82%), seed yield plant-1 (77%) and number of leaflets leaf-1
(75%). Moderate heritability was recorded for days to maturity (68%) and
leaf area (51%). All traits revealed higher phenotypic coefficient of
variation (PCV) as compare to genotypic coefficient of variation (GCV)
(Table 4.1.6). However, differences among PCV and GCV were low for
days to 50% flowering (7.1 and 6.9), days to maturity (2.3 and 1.9), plant
height (14.5 and 13.4), leaflets leaf-1(13.4 and 11.l6), 100 seed weight
(23.3 and 21.1) and biological yield plant-1 (36.4 and 34.5) while only leaf
area (29.91 and 21.2) and seed yield plant-1 (49.9 and 43.6) revealed
comparatively more difference among PCV and GCV. Majority of traits
45
revealed high heritability and low level of differences among PCV and
GCV which indicate less environmental influence on these traits and
showed that genotypes had more influential role in the expression of these
traits. This suggests a great chance of genetic improvements of these
traits in chickpea.
46
Table 4.1.1 Flower color, stem color and seed coat color of evaluated chickpea germplasm Genotype Name Flower color Stem color Seed coat color NDC-122 Pink Green with purplish tinge light brown NDC-727 " " dark brown NDC-728-5 " " dark brown NDC-730-2 " " dark brown NDC-15-1 " " " NDC-15-2 " " " NDC-15-3 " " " NDC-15-4 " " " NDC-4-15-1 " " " NDC-4-15-2 " " " NDC-4-15-3 " " " NDC-4-20-1 " " " NDC-4-20-2 " " " NDC-4-20-3 " " " NDC-4-20-4 " " " NDC-4-20-5 " " " NDC-4-20-6 " " " NDC-4-20-7 " " " NDC-5-S10 " " dark brown NDC-5-S11 " " yellowish NIFA-88 " " brown NIFA-95 " " brown NIFA-2005 " " yellowish NKC-10-99 white Green white NKC-5-S12 " " " NKC-5-S13 " " " NKC-5-S14 " " " NKC-5-S15 " " " NKC-5-S16 " " " NKC-5-S17 " " " NKC-5-S18 " " " NKC-5-S19 " " " NKC-5-S20 " " " NKC-5-S21 " " " NKC-5-S22 " " " NKC-5-S23 " " " NKC-5-S24 " " " HASSAN-2K " " " Karak 1 Pink Green with purplish tinge brown Karak 2 " " " Karak 3 " " " Sheenghar " " " Lawaghar white Green white ICC4993 " " " ICC 19183 " " " ICC4918 Pink Green with purplish tinge brown ICC19181 Pink “ brown
47
Table 4.1.2. Mean square for days to 50% flowering, days to maturity, plant height and number of leaflets leaf-1 of chickpea germplasm
Mean square values Source of variation
Degrees of freedom Days to 50%
flowering Days to maturity
Plant height
Number of leaflets leaf-1
Replication 2 25.45 12.27 0.900 0.57
Genotype 46 186.64** 38.4** 260.05** 8.61**
Error 92 4.36 5.75 60.42 0.84
Table 4.1.3. Mean square for leaf area, seed yield plant-1, 100 seed weight and biological yield plant-1 of chickpea germplasm
Mean Square values Source of variation
Degrees of
freedom Leaf area Seed yield plant-1
100 seed weight
Biological yield plant-1
Replication 2 0.45 3.64 1.75 10.82
Genotype 46 9.09** 70.75** 88.02** 359.36**
Error 92 2.23 6.58 5.93 13.5
48
Table 4.1.4: Mean values of days to 50% flowering, days to maturity, plant height and leaflets leaf-1 in chickpea germplasm
Genotype Days to 50%
Flowering Days to maturity Plant height No of Leaflets
leaf-1
NDC-122 116 173 70 16 NDC-727 118 167 66 12.6 NDC-728-5 118 168 77 15.6 NDC-730-2 114 166 73 16.3 NDC-15-1 118 171 66 15.0 NDC-15-2 118 175 76 15.6 NDC-15-3 118 169 62 16.0 NDC-15-4 118 168 67 15.6 NDC-4-15-1 115 173 64 16.0 NDC-4-15-2 116 171 50 16.0 NDC-4-15-3 118 172 58 15.3 NDC-4-20-1 116 169 70 15.3 NDC-4-20-2 119 170 67 16.3 NDC-4-20-3 118 172 65 14.6 NDC-4-20-4 117 173 67 16.0 NDC-4-20-5 115 170 67 16.0 NDC-4-20-6 122 173 63 14.0 NDC-4-20-7 116 172 67 15.6 NDC-5-S10 105 177 51 12.0 NDC-5-S11 104 176 47 11.6 NIFA-88 116 175 73 12.0 NIFA-95 115 174 67 12.0 NIFA-2005 113 171 64 13.0 NKC-10-99 116 175 88 12.0 NKC-5-S12 112 176 69 12.3 NKC-5-S13 113 176 72 12.3 NKC-5-S14 111 175 66 12.0 NKC-5-S15 113 175 94 12.0 NKC-5-S16 97 174 60 16.0 NKC-5-S17 110 176 57 14.0 NKC-5-S18 99 175 62 12.0 NKC-5-S19 120 172 65 12.3 NKC-5-S20 101 175 72 13.0 NKC-5-S21 112 176 60 14.0 NKC-5-S22 107 175 64 13.3 NKC-5-S23 107 174 73 13.3 NKC-5-S24 110 173 73 11.6 HASSAN-2K 116 174 68 15.6 Karak 1 115 175 69 12.0 Karak 2 117 174 67 12.6 Karak 3 114 172 67 13.0 Sheenghar 120 178 70 14.3 Lawaghar 118 176 60 14.0 Rabat 97 165 88 12.3 ICC 90 164 89 11.0 Annigeri 96 168 59 12.3 ICC19181 92 163 60 12.3
LSD (0.05) 3.38 3.89 2.42 1.49
49
Table 4.1.5: Mean values of chickpea germplasm leaf area, seed yield plant-1, 100 sed weight and biological yield-1 in chickpea germplasm.
Genotype Leaf area Seed yield plant -1 100-seed weight
Biological yield plant-1
NDC-122
8.3
10.0
27.0
39.7
NDC-727 6.2 7.0 20.7 32.0 NDC-728-5 9.5 7.8 21.7 30.4 NDC-730-2 8.2 7.4 20.9 36.0 NDC-15-1 7.1 15.0 23.0 39.6 NDC-15-2 7.6 4.1 21.1 20.4 NDC-15-3 8.0 5.0 20.3 23.1 NDC-15-4 7.8 9.0 25.0 22.2 NDC-4-15-1 7.7 5.3 20.1 24.0 NDC-4-15-2 9.9 7.0 23.0 18.2 NDC-4-15-3 6.5 5.4 23.0 24.1 NDC-4-20-1 6.5 18.0 13.0 56.7 NDC-4-20-2 8.3 6.2 21.3 29.0 NDC-4-20-3 8.8 5.3 22.3 22.0 NDC-4-20-4 8.0 5.0 20.6 24.3 NDC-4-20-5 6.8 6.0 21.7 28.0 NDC-4-20-6 7.5 15.6 25.0 65.7 NDC-4-20-7 7.7 5.2 21.5 47.4 NDC-5-S10 5.7 9.1 27.0 24.4 NDC-5-S11 5.4 9.0 27.0 23.0 NIFA-88 7.1 7.5 14.6 20.1 NIFA-95 4.4 7.0 14.1 19.7 NIFA-2005 7.2 14.7 22.0 68.0 NKC-10-99 8.3 7.2 33.0 43.9 NKC-5-S12 5.2 13.6 23.0 34.6 NKC-5-S13 8.3 15.5 35.0 39.6 NKC-5-S14 7.0 14.5 29.0 32.3 NKC-5-S15 9.0 13.1 32.0 36.7 NKC-5-S16 8.5 12.0 25.0 30.0 NKC-5-S17 9.8 13.3 34.0 34.4 NKC-5-S18 10.2 13.2 39.0 32.1 NKC-5-S19 7.1 10.0 26.0 14.3 NKC-5-S20 6.4 13.1 29.0 27.4 NKC-5-S21 5.6 12.0 25.0 27.1 NKC-5-S22 6.4 9.2 25.0 26.4 NKC-5-S23 7.1 12.5 28.0 31..0 NKC-5-S24 6.7 15.0 33.0 36.2 HASSAN-2K 5.0 13.2 23.0 26.3 Karak 1 7.2 18.2 22.0 31.3 Karak 2 8.1 16.9 24.0 28.5 Karak 3 6.3 28.9 25.0 27.6 Sheenghar 7.5 14 22.0 33.4 Lawaghar 7.5 13.7 36.0 25.3 Rabat 3.6 7 21.0 28.7 ICC 3.8 6 22.0 24.6 Annigeri 1.7 8.4 28.0 25.1 ICC19181 4.6 5.9 26.0 27.7
LSD (0.05) 6.18 4.16 4.44 5.95
50
Table 4.1.6: Estimates of genotypic variance (Vg), phenotypic variance (vp), genotypic coefficient of variability (PCV), phenotypic coefficient of variability (GCV) and heritability ( h2
(bs) ) for various agronomic traits
Traits
Vg
Vp
GCV
PCV
%h2
(bs)
Days to 50% flowering
60.76
65.06
6.9
7.18
93
Days to maturity
10.88 15.93 1.9 2.3 68
Plant height 81.84 96.37 13.41 14.56 88
Leaflets leaf-1
2.58
3.43
11.66
13.42
75
Leaf area
2.28 4.519 21.26 29.91 51
Grain yield plant-1
21.3 27.9 43.6 49.9 77
100 seed weight
27.34
33.34
21.16
23.37
82
Biological yield plant-1 115.28 128.78 34.51 36.47 89
51
Table 4.1.7 Description of chickpea genotypes used in present study
No. Entry Phenotype Genotype ParentageA Origin HB
1 NDC-122 Desi Nod+ C-44 × ILC-195 NIFA 02 NDC-727 Desi Nod+ C-44/M NIFA 0.253 NDC-728-5 Desi Nod+ C-44/M NIFA 0.3754 NDC-730-2 Desi Nod+ C-44/M NIFA 0.1255 NDC-15-1 Desi Nod+ Pb-91/M NIFA 06 NDC-15-2 Desi Nod+ Pb-91/M NIFA 07 NDC-15-3 Desi Nod+ Pb-91/M NIFA 08 NDC-15-4 Desi Nod+ Pb-91/M NIFA 09 NDC-4-15-1 Desi Nod+ C-44/M NIFA 010 NDC-4-15-2 Desi Nod+ C-44/M NIFA 011 NDC-4-15-3 Desi Nod+ C-44/M NIFA 012 NDC-4-20-1 Desi Nod+ C-44/M NIFA 013 NDC-4-20-2 Desi Nod+ C-44/M NIFA 0.37514 NDC-4-20-3 Desi Nod+ C-44/M NIFA 015 NDC-4-20-4 Desi Nod+ C-44/M NIFA 0.516 NDC-4-20-5 Desi Nod+ C-44/M NIFA 0.12517 NDC-4-20-6 Desi Nod+ C-44/M NIFA 018 NDC-4-20-7 Desi Nod+ C-44/M NIFA 0.12519 NDC-5-S10 Desi Nod+ JG74 × ICC12071 ICARDA 020 NDC-5-S11 Desi Nod+ JG74 × ICC12071 ICARDA 0.37521 NIFA-88 Desi Nod+ 6153 NIFA 022 NIFA-95 Desi Nod+ 6153/M NIFA 0.12523 NIFA-2005 Desi Nod+ Pb-91/M NIFA 0
24 NKC-10-99 Kabuli Nod+ FlIP98-138C × SEL99TH15039
ICARDA 0
25 NKC-5-S12 Kabuli Nod+ BAHODIR × SEL99TER85530
ICARDA 0
26 NKC-5-S13 Kabuli Nod+ SEL99TH15039 × S98008 ICARDA 0.2527 NKC-5-S14 Kabuli Nod+ SEL99TH15039 × S98008 ICARDA 0.12528 NKC-5-S15 Kabuli Nod+ FLIP98-15C × S98033 ICARDA 0.375
29 NKC-5-S16 Kabuli Nod+ S99456 × SEL99TER85314
ICARDA 0.625
30 NKC-5-S17 Kabuli Nod+ S99456 × SEL99TER85314
ICARDA 0
31 NKC-5-S18 Kabuli Nod+ (ILC4291 × FLIP98-129C) × S98008
ICARDA 0.375
32 NKC-5-S19 Kabuli Nod+ (ILC4291 × FLIP98-129C) × S98008
ICARDA 0
33 NKC-5-S20 Kabuli Nod+ FLIP98-138C × SEL99TH15039
ICARDA 0
34 NKC-5-S21 Kabuli Nod+ GLK95069 × SEL99TER85530
ICARDA 0
35 NKC-5-S22 Kabuli Nod+ CA9783007 × SEL99TER85534
ICARDA 0
36 NKC-5-S23 Kabuli Nod+ CA9783007 × SEL99TER85534
ICARDA 0
37 NKC-5-S24 Kabuli Nod+ CA9783007 × SEL99TER85534
ICARDA 0
38 HASSAN-2K Kabuli Nod+ ILC-195/M NIFA 039 Karak 1 Desi Nod+ Local selection Karak 040 Karak 2 Desi Nod+ Local selection Karak 041 Karak 3 Desi Nod+ Local selection Karak 042 Sheenghar Desi Nod+ Local selection Karak 043 Lawaaghar Kabuli Nod+ Local selection Karak 0 44 ICC 4993 Kabuli Nod– Rabat Morocco 045 ICC 19183 Kabuli Nod– ICC 4993NN ICRISAT 046 ICC4918 NN Desi Nod– Annigeri India 047 ICC19181NN Desi Nod– ICC 435NN ICRISAT 0
AThe lines indicated by /M is mutation induction lines. BHeterozygosity.
52
4.1.4 Discussion
Characterization based on flower, stem and seed coat color clearly
differentiated chickpea germplasm in two types i.e. desi and kabuli.
Genotypes with pink flowers, green with purplish tinge stem and dark brown
to light brown seed coat were Desi type. Kabuli type had white flowers, green
stem and white seed coat. Upadhyaya et al. (2002) found significant
variation in core collection of chickpea for flower and plant color (stem color).
In their collection dots on seed testa were also present. Variation in flower
and seed color is also reported by Farshadfar and Farshadfar (2008) while
evaluating 360 chickpea land races. Variability in seed coat and flower color
was also observed by Afsari et al (2004) in chickpea germplasm.
Plant growth duration (flowering and maturity) plays important role in
increasing seed yield of chickpea. Variation in climatic factors like
temperature and photoperiod in different environments affect maturity of
genotypes and so the overall yield. The variability in days to 50% flowering
and days to maturity were significant among all the genotypes. Other studies
have confirmed significant variation in days to 50% flowering and days to
maturity in Chickpea (Atta et al., 2008; Saleem et al., 2008; Hakim et al.,
2006; Shaukat et al., 2003) and soybean (Muhammad et al., 2007).
Plant height is desirable trait to reduced lodging in crops; similarly,
higher seed weight, leaf area and more leaflets leaf-1 contribute to higher
seed yield. In the present study an adequate variability for plant height and
other yield contributing traits among various genotypes was found. Earlier
reports in chickpea by Atta et al. (2008), Hakim et al. (2006), Arshad et al.
(2004), Nawab et al. (2002) and Raza and Mahdi (1992) and in soybean by
Muhamad et al. (2007) also confirm these results.
53
Biomass (total dry weight) plant-1 gives significant information about
chickpea and other crops. Significant variation in biomass/biological yield
plant-1 was found among genotypes in the collected germplasm for the
current project. Similarly Jeena et al. (2005) and Arshad et al. (2004) also
reported significant differences in biological yield plant-1 among their
chickpea collection.
Components of variance for entire studied parameters are depicted in
table 4.1.6. Phenotypic coefficient of variation as well as the genotypic
coefficient of variation was found lower for days to flowering and days to
maturity. Moderate values of PCV and GCV were observed for 100 seed
weight, leaf area, leaflets leaf-1 and plant height and their range were high for
grain yield plant-1 and biological yield. Saleem et al. (2008), Atta et al.
(2008), Hakim et al. (2006) and Burli et al. (2004) also reported low PCV and
GCV for days to flowering and days to maturity in chickpea. Similar results
were registered by saleem at al. (2008) and Atta et al. (2008) for seed yield
plant-1, plant height, 100 seed weight and biological yield of chickpea, while
Hakim et al. (2006) observed high values of PCV and GCV in chickpea for
100 seed weight and seed yield plant-1 but lower for plant height. Burli et al.
(2004) also observed high PCV and GCV values for seed yield plant-1 but he
registered low values for 100 seed weight in chickpea. The difference in
result for 100 seed weight could be attributed to difference in environment.
Phenotypic coefficient of variability was greater than genotypic
coefficient of variability for all the parameters but the difference is less in all
the cases except leaf area and seed yield plant-1. All traits showed high
heritability except days to maturity and leaf area which exhibited moderate
heritability. High heritability of all the traits was also reflected by the minor
54
difference in magnitudes of PCV and GCV. High estimates of heritability of
the traits under study could be due to the greater genetic variability of the
germplasm. Saleem et al. (2008), Durga et al. (2007), Hakim et al. (2006),
Ghafoor et al. (2004), Noor et al. (2003), Sable et al. (2003), Arrora et al.
(2001) and Raza and Mehdi (1992) found similar results and observed high
heritability in chickpea for days to flowering, plant height, 100-seed weight,
seed yield plant-1 and biological yield plant-1.
The present study concluded that there is a great amount of genetic
diversity in the germplasm under study. High values of heritability indicate
that these parameters are less influenced by the environment and have
greater chance of transmission to the next generation. Therefore this
variability could be utilized successfully in different breeding programs for the
betterment of existing genotypes and for the development of new more
desirable genotypes through hybridization and other modern breeding
techniques.
55
Experiment 2. Characterization for nodulation and effect of rhizobium inoculation on nodules number and seed yield plant-1
4.2.1 Introduction
Grain legumes have an important characteristic of fixing atmospheric
nitrogen to ammonium nitrogen that can be used by the plant. In agro-
ecosystem biological nitrogen fixation (BNF) is a vital component of nitrogen
cycle. Traditionally legumes were grown as manure crop, to restore soil
fertility.
Root nodules are formed in most of the legumes when they are infected
by suitable rhizobium strain and they become able to fix atmospheric
nitrogen. However, either spontaneously or through mutagenesis non-
nodulated mutants have been reported from different species that generally
produce nodules including soybean (Glycine max L.), wild pea (Pisum spp.),
common bean (Phaseolus vulgaris L.), sweetclover (Melilotus alba Desr.),
chickpea (Cicer spp), red clover (Trifolium pratense L.) alfalfa (Medicago
sativa L.) and peanut (Arachis hypogaea L.) (Gallo-Meagher., 2001). Non-
nodulating (Nod–) lines are an important reference for estimating the amount
of biologically fixed N2 in a legume (Rupela, 1991).
Chickpea plants have a strong taproot system, grows 1.5-2.0 m deep with
3 or 4 rows of lateral roots (Cubero, 1987). Chickpea roots bear rhizobium
nodules. They are branched with laterally flattened ramifications,
occasionally forming a fanlike lobe (Corby, 1981). Nodulated mutants are
important for basic studies of plant-microbe symbiotic interactions, nitrogen
fixation and breeding of cultivars with higher yield and nitrogen fixation rate
(Bhatia et al., 2004).
56
Chickpea has the capacity to fix sufficient atmospheric nitrogen to
replace the nitrogen removed in harvested grains (Schwenke et al., 1998).
It has highly specific symbiotic association, with a unique group of rhizobia
necessary for formation of nodules and nitrogen fixation. (Cleyet-marel et
al., 1990). Absence of suitable strains, small population size and poor
survival of rhizobia cause problems in nodules formation. Legumes
Inoculation assures the presence of some appropriate strain of rhizobium
compatible with cultivar, at proper time and in sufficient numbers that
guarantee effective nodulation and nitrogen fixation (Cleyet-Marel et al.,
1990).
Appropriate nodule forming bacteria presence in the soil is essential for
management and utilization of atmospheric nitrogen. If the nodulated crop
has not been sown in recent past and grown for the first time then seed
inoculation is essential before sowing. Further to avoid uncertainty about
natural inoculation, the seed should be inoculated every time (Richard and
Henery, 1967)
Nitrogen fixing potential of chickpea genotypes can be increased
significantly by inoculation (Hussain, 1983) and grain yield of chickpea
increased significantly with rhizobial application (Khattak et al., 2006).
Nodulation chickpea yield can also be enhanced by inoculation with
competitive rhizobia and is especially economical promising to increase
chickpea production (Romdhane et al., 2008). In the light of above and
existing situation, the said research work was planned to:
1. categories the genotypes for the presence or absence of nodules
57
2. identify highly nodulated genotypes on the basis of number of
nodules plant-1
3. study the influence of seed inoculation with rhizobium on the number
of nodules plant-1 in all the genotypes.
4. evaluate the change in seed yield plant-1 genotype-1 due to rhizobium
inoculation
5. select suitable parents for inheritance and linkage studies of
nodulation in chickpea.
4.2.2 Materials and Methods
The experiment was carried out in pots in the net house facility of
Institute of Biotechnology and Genetic Engineering (IBGE) with
completely randomized design (CRD) during 2006-07. The experiment
was comprised of two treatments (inoculated and un-inoculated) each
consisted of three replications. Procedure for data collection, data
analyses etc of the experiment are presented in chapter 3 section 3.4.
4.2.3 Results
4.2.3.1 Characterization of genotypes for the presence or absence of nodules
Genotypes were examined without rhizobium inoculation as well as
with rhizobium inoculation for the presence or absence of nodules (Table
4.2.1). Results (both un-inoculated and inoculated) showed that genotypes
procured from NIFA Peshawar and GRS Ahmedwala Karak were nodulated
(produce nodules) while genotypes received from ICRISAT India failed to
produce any nodule (non-nodulated). Two groups were formed on the basis
of nodulation i.e. nodulated and non-nodulated. The nodulated group
58
consisted forty three genotypes i.e., from NDC 122 to Lawaghar (Table 5.1)
while non-nodulated group contained four genotypes (ICC4993, ICC19183,
ICC4918 and ICC19181).
4.2.3.2 Number of nodules plant-1 genotype-1
Analysis of variance revealed highly significant differences for
nodules number plant-1 among genotypes (un-inoculated) shown in table
4.2.1. Mean values of the genotypes for number plant-1 of nodules are
given in table 4.2.2., while components of variance and heritability
percentage for number of nodules plant-1 are presented in table 4.2.3.
The highest and lowest values for nodules plant-1 revealed wide range of
variation and showed highly significant differences among the genotypes
(Table 4.2.1). Maximum numbers of nodules plant-1 (14.53) were produced
by NDC-5-S10 followed by NDC 4-20-4 (12.53) whereas Lawaghar showed
minimum number of nodules plant-1 (2.43).
Components of variance for number of nodules plant-1 (Table 5.3)
revealed moderate phenotypic coefficient of variation (PCV) and genotypic
coefficient of variation (GCV) i.e. 32.88 and 24.08 respectively, while
heritability percentage was high i.e. 53.64%.
Figure 5.1: Nodulated Root Figure 5.2 Non-nodulated: Root
59
4.2.3.3 Effect of rhizobial inoculation on number of nodules plant-1
Among 47 genotypes 43 were nodulated while four genotypes were
recorded as non-nodulated. The non-nodulated genotypes were excluded
from the analysis. According to analysis of variance (Table 4.2.4) the
interaction means of genotypes with two treatments (un-inoculated and
inoculated) were highly significant. The genotype means as well as
treatment means also showed significant differences (Table 4.2.4). In
genotypes versus treatment interaction (Table 4.2.5), the maximum
nodules plant-1 (16.66) was exhibited by genotype NDC 4-20-1 followed by
genotype NDC 4-20-7 and NDC 15-4 with 16.5 and 16.4 nodules plant-1
respectively. The minimum number of nodules plant-1 was produced by
genotype Lawaghar (2.433) followed by genotype NKC 5-S-18 (3.100). In
genotype means, the genotype NDC 5-S10 showed best performance
followed by NDC 4-20-4 with 14.8 and 13.6 nodules plant-1 respectively.
Genotype Lawaghar showed poor performance with 4.8 nodules plant-1 in
genotype means. The treatment means were greater for inoculated
treatment (10.8 nodules palnt-1) than that of un-inoculated treatment which
showed 7.8 nodules palnt-1.
Among genotypes different levels of percent increase (Table 4.2.5)
were observed for number of nodules plant-1.With rhizobium application,
above 100% increase in nodules plant-1 was noticed in 3 genotypes (NKC 5-
S20, NKC 5-S23 and Lawaghar), 50 – 100% in 10 genotypes (NDC 727,
NDC 15-1,NDC 15-2, NDC 15-4, NDC4-15-2, NDC 4-20-7, NIFA 88, NKC
10-99, Karak 3 and Sheenghar) while less then 50% in 28 genotypes (NDC
60
122, NDC 728-5, NDC-730-2, NDC-15-3, NDC-4-15-, NDC-4-15-3, NDC-4-
20-1to NDC 4-20-6, NDC-5-S10, NDC 5-S11, NIFA 95, NIFA 2005, NKC-5-
S112 to NKC-5-S18, NKC-5-S21, Hassan 2K to Karak 2). Two genotypes
(NKC-5-S22, NKC-5-S24) did not show any positive response to rhizobium
inoculation, even a small decrease was observed in their number of nodules
plant-1. The greatest response to seed inoculation was recorded for genotype
Lawaghir (196%) whilst lowest by genotype NIFA 2005 (2.1%). The
treatment means showed that the inoculated genotypes produced 38.1%
more nodules plant-1 over the un-inoculated.
4.2.3.4 Effect of rhizobium inoculation on seed yield plant-1
Rhizobium inoculation also had extremely significant effect on seed yield
plant1 as observed in analysis of variance (Table 4.2.6). Highly significant
differences were recorded in interaction means of genotypes with two
treatments (control and inoculated); genotype means and in treatment
means (Table 4.2.6). In the interaction means of genotypes with treatments
as well as in the genotype means Karak 3 was reported as genotype with
highest seed yield plant-1 (33 and 30.4 g seed yield plant-1 ), respectively.
Genotype sheenghar stood second to Karak 3 in seed yield plant-1 (30.2 and
21.8 g). The genotype NDC 15-2 was recorded as a low yielding genotype in
the interaction means of genotypes with treatments followed genotype NDC
4-20-4 with 3.6 and 4.3 g seed yield plant-1 respectively. NDC 15-2 also
remained a poor yielder in genotype means with 3.8 g seed yield plant-
1.Treatment mean for seed yield plant-1 was 10.0 g for un-inoculated and
15.1 g for inoculated treatments.
61
Like nodulation, varied increase for seed yield plant-1 amongst genotypes
was also observed after seed inoculation with rhizobium. Seven genotypes
(NDC-727, NDC-15-4, NDC 4-15-1, NDC-5-S11, NKC-5-S13, NKC-5-S21,
NKC-5-S24, and Sheenghar) were in a position to have more than 100%
increase in seed yield plant-1, Six genotypes (NDC 4-20-3, NDC-4-20-5,
NIFA 95, NKC-5-S15, NKC-5-S20 and NKC-5-S23) provided 50 to 100%
greater seed yield plant-1, twenty five genotypes (NDC 122, NDC 728-5 to
NDC 15-3, NDC 4-15-2 to NDC 4-20-1, NDC 4-20-4, NDC 4-20-6 to NDC 5-
S10, NIFA 88 to NKC 5-S12, NKC 5-S16, NKC 5-S17, NKC 5-S19, NKC 5-
S22, Hassan 2K, Karak 2, karak 3 AND Lawaghar) produced less than
50% seed yield plant-1 after inoculation. Four genotypes (NDC-4-20-2,
NKC-5-S14, NKC-5-S18, and Karak 1) were observed with no response to
seed inoculation and there was even somewhat decrease in their seed
yield plant-1. Maximum response of 195.3% increase in seed yield plant-1 to
inoculation was recorded for genotype NKC 5-S13 while genotype NIFA
2005 revealed minimum percent increase (2.1) followed by Karak 1 (2.4) for
seed yield plant-1. The overall increase in seed yield plant-1 of inoculated
treatment over the un-inoculated treatment was 50.5%.
Table 4.2.1 Mean square for number of nodules plant-1 of chickpea germplasm
Source of variation Degrees of freedom Mean square values
Genotype 42 13.64**
Error 86 3.1
62
Table 4.2.2: Presence or absence of nodules and number of nodules plant-1 (without inoculation) in chickpea genotypes
Genotype name Nodules Present/absent
No of Nodules plant-1
(uninoculated) NDC-122 Present 8.0 NDC-727 Present 7.8 NDC-728-5 Present 7.2 NDC-730-2 Present 7.9 NDC-15-1 Present 8.1 NDC-15-2 Present 7.3 NDC-15-3 Present 9.3 NDC-15-4 Present 9.9 NDC-4-15-1 Present 8.1 NDC-4-15-2 Present 8.8 NDC-4-15-3 Present 8.7 NDC-4-20-1 Present 11.0 NDC-4-20-2 Present 12.0 NDC-4-20-3 Present 10.4 NDC-4-20-4 Present 12.5 NDC-4-20-5 Present 9.2 NDC-4-20-6 Present 8.8 NDC-4-20-7 Present 9.0 NDC-5-S10 Present 14.5 NDC-5-S11 Present 9.6 NIFA-88 Present 6.4 NIFA-95 Present 6.7 NIFA-2005 Present 9.1 NKC-10-99 Present 7.2 NKC-5-S12 Present 6.6 NKC-5-S13 Present 6.9 NKC-5-S14 Present 6.9 NKC-5-S15 Present 7.7 NKC-5-S16 Present 4.7 NKC-5-S17 Present 9.6 NKC-5-S18 Present 3.1 NKC-5-S19 Present 6.8 NKC-5-S20 Present 4.0 NKC-5-S21 Present 5.1 NKC-5-S22 Present 7.4 NKC-5-S23 Present 4.9 NKC-5-S24 Present 4.9 HASSAN-2K Present 7.8 Karak 1 Present 8.1 Karak 2 Present 7.9 Karak 3 Present 6.7 Sheenghar Present 5.8 Lawaghar Present 2.4 ICC 4993 (Rabat) Absent 0 ICC 19183 Absent 0 ICC 4918 (Annigeri) Absent 0 ICC19181 Absent 0 LSD (0.05%) 2.8
63
Table 4.2.4. Mean square for inoculation effect on nodules plant-1 and seed yield plant-1
Mean squares
Source of variance Degrees of freedom Nodules plant-1 Seed yield plant-1
Treatment 1 648.3** 1104.01**
Genotype 42 28.6** 201.59**
Treatment X Genotype 42 8.0** 28.72**
Error 172 2.19 11.86
Table 4.2.3. Estimates of variability parameters of number of nodules plant-1 in various chickpea genotypes Variability parameters
Number of nodules plant-1
Genotypic variance
3.51
Phenotypic variance
6.62
Genotypic coefficient of variation
17.48
Phenotypic coefficient of variation
32.85
Heritability (broad sense)%
53.2
64
Table 4.2.5. Effect of control and rhizobial inoculation on nodules plant-1 in chickpea gengotypes
Genotype name Un-inoculated Inoculated Genotype mean % change NDC-122 8.0 9.0 8.5 12.5 NDC-727 7.8 14.9 11.4 90.0 NDC-728-5 7.2 8.0 7.6 11.1 NDC-730-2 7.9 11.0 9.4 39.2 NDC-15-1 8.1 13.1 10.6 61.7 NDC-15-2 7.3 12.6 10.0 72.6 NDC-15-3 9.3 12.3 10.8 32.2 NDC-15-4 9.9 16.4 13.2 65.6 NDC-4-15-1 8.1 11.2 9.6 38.2 NDC-4-15-2 8.8 14.9 11.9 69.3 NDC-4-15-3 8.7 10.6 9.6 21.8 NDC-4-20-1 11 16 13.5 45.4 NDC-4-20-2 12 15 13.5 25.0 NDC-4-20-3 10.4 12.4 11.4 19.2 NDC-4-20-4 12.5 14.8 13.65 18.4 NDC-4-20-5 9.2 11.2 10.2 21.7 NDC-4-20-6 8.8 12.4 10.6 40.9 NDC-4-20-7 9.0 16.5 12.7 83.3 NDC-5-S10 14.5 15.1 14.8 4.1 NDC-5-S11 9.4 12.9 11.1 37.7 NIFA-88 6.4 9.9 8.1 54.6 NIFA-95 6.7 9.9 8.3 47.7 NIFA-2005 9.2 9.4 9.3 2.1 NKC-10-99 7.2 10.8 9.0 50.0 NKC-5-S12 6.6 9.0 7.8 36.3 NKC-5-S13 6.9 9.6 8.3 39.1 NKC-5-S14 6.9 7.2 7.1 4.3 NKC-5-S15 7.7 10.9 9.3 41.5 NKC-5-S16 4.7 6.9 5.8 46.8 NKC-5-S17 9.6 11.7 10.6 21.8 NKC-5-S18 3.1 7.5 5.3 141.9 NKC-5-S19 6.8 8.4 7.6 23.5 NKC-5-S20 4.0 10.0 7.0 150 NKC-5-S21 5.1 5.8 5.5 13.7 NKC-5-S22 7.4 5.4 6.4 -27.0 NKC-5-S23 4.9 12.5 8.7 155.1 NKC-5-S24 8.2 7.5 7.8 -8.5 HASSAN-2K 7.8 8.4 8.1 7.7 Karak 1 8.1 8.3 8.2 2.4 Karak 2 7.9 9.0 8.5 13.9 Karak 3 6.7 10.5 8.6 56.7 Sheenghar 5.8 11.0 8.4 89.6 Lawaghar 2.4 7.1 4.8 196.0 ICC 4993 0 0 0 0 ICC 19183 0 0 0 0 ICC 4918 0 0 0 0 ICC19181 0 0 0 0 Treatment mean
7.86 10.86 38.1
LSD(0.05) values Interaction LSD = 1.81; Genotype means = 1.34; Treatment means = 0.36
65
Table 4.2.6. Effect of control and rhizobial inoculation on seed yield plant-1 in chickpea genotypes
Genotype Name Un-inoculated Inoculated Genotype means % change
NDC-122 9.4 14 11.7 48.0 NDC-727 6.4 15 10.7 134.0 NDC-728-5 6.8 8 7.4 17.6 NDC-730-2 6.8 10 8.4 47.0 NDC-15-1 14.8 14.2 14.5 4.0 NDC-15-2 3.6 4.1 3.85 13.8 NDC-15-3 4.7 7 5.85 48.9 NDC-15-4 8.8 18.2 13.5 106.8 NDC-4-15-1 4.9 14.1 12.0 187.7 NDC-4-15-2 6.8 12 9.4 76.4 NDC-4-15-3 4.5 8 6.25 77.7 NDC-4-20-1 17.9 22.2 20.0 24.0 NDC-4-20-2 5.6 5 5.3 -10.7 NDC-4-20-3 4.5 7.2 5.8 60.0 NDC-4-20-4 4.3 6.2 5.2 44.1 NDC-4-20-5 5.3 10.1 7.7 90.5 NDC-4-20-6 14.8 24 19.4 62.1 NDC-4-20-7 4.4 6.16 5.2 40.0 NDC-5-S10 8.3 11.2 9.7 34.9 NDC-5-S11 8.6 18.1 13.3 110.4 NIFA-88 6.7 6.2 6.4 7.4 NIFA-95 6.0 9.06 7.5 51.0 NIFA-2005 13.8 25 19.4 81.1 NKC-10-99 6.8 11.1 8.9 63.2 NKC-5-S12 12.7 20.2 16.4 59.0 NKC-5-S13 6.5 19.2 12.8 195.3 NKC-5-S14 13.7 13.1 13.4 -4.3 NKC-5-S15 12.3 23 17.6 86.9 NKC-5-S16 11.4 12 11.7 5.2 NKC-5-S17 12.5 18.2 15.3 45.6 NKC-5-S18 12.6 12.1 12.3 -3.9 NKC-5-S19 9.3 13 11.1 39.7 NKC-5-S20 12.4 24 18.2 93.5 NKC-5-S21 11.1 22.2 16.6 100.0 NKC-5-S22 9.5 13.1 11.3 37.8 NKC-5-S23 11.3 18 14.6 59.2 NKC-5-S24 14.1 29.1 20.1 106.0 HASSAN-2K 12.1 14 13.0 15.7 Karak 1 17.1 17 17.0 0.0 Karak 2 15.5 17.1 16.3 10.3 Karak 3 27.8 33 30.4 18.7 Sheenghar 13.4 30.2 21.8 125.3 Lawaghar 12.6 16.3 14.4 29.3
Treatment means 10.0 15.1 50.5
LSD (0.05) values Interaction = 1.11; Treatment mean = 0.84; Genotypes mean = 3.93
66
4.2.4 Discussion
There was no report about non-nodulated chickpea earlier than 1985
(Thomas et al., 1985). Rupela and Sudarahana (1986) observed the
genetics of non-nodulation in a spontaneous mutant ICC 435M in chickpea.
The frequency of natural occurrence of non-nodulation in chickpea was
studied by Rupela (1992) he observed a low number of non-nodulated plants
in genotype ICC 435. The non-nodulated chickpea genotypes may originate
through spontaneous or induced mutations (Thomas et al., 1985). In the
present study the nodulation of genotypes in the un-inoculated pots showed
that there are native (local) rhizobia in the soil used in the pots which
produced nodules in chickpea genotypes.
Significant differences were recorded in the number of nodules plant-1
among the genotypes. This confirmed that these genotypes showed different
response to rhizobia. The reason of this difference is the bacteria-plant
genotype interaction or compatibility of bacteria (rhizobium leguminosarum)
and genotype of plant. The variation in nodulation among chickpea
genotypes have also been reported by Tellawi et al. (2007), Mensah and
olukoya, (2007), Gallani et al. (2005), and Rodriguez-Navarro (1999).
Values of both phenotypic coefficient of variability (PCV) and
genotypic coefficient of variability (GCV) were moderate but PCV was rather
greater than GCV. Moderate heritability indicated that genetic improvement
of number of nodules plant-1 in chickpea can be achieved successfully.
Rhizobium leguminosarium was used to test the 47 genotypes for
their nodulation expression. All genotypes developed normal nitrogen fixing
nodules except four procured from ICRSAT, India which didn’t produce any
67
nodule in control as well as inoculated treatments. Results revealed that 42
genotypes were nodulated and only four were found non-nodulated.
In un-inoculated pots majority of genotypes showed nodulation which
confirming the presence of existing indigenous rhizobia in the soil. The
nitrogen fertilizer was not applied to the pots, however the plants didn’t show
any nitrogen deficiency symptoms which confirmed the role of indigenous
rhizobia appeared to fix atmospheric nitrogen at reasonable levels. Still the
level of indigenous rhizobia might be less than 10 rhizobia g-1 of soil because
rhizobium inoculation significantly increased the nodules number and seed
yield plant-1. Thies et al. (1991) observed that once the soil holds more than
10 rhizobia g-1 of soil then the response to rhizobium inoculation become
negligible in many soils. Tufenkci et al. (2006) observed that inoculation had
not significantly influenced any of the parameters measured as the soil
already contained sufficient and an efficient native rhizobial population.
The seed inoculation with rhizobium significantly increased the
nodules and seed yield plant-1. After inoculation, the nodules plant-1 and seed
yield plant-1 increased at the rate of 38.1% and 50.5 % respectively, over the
un-inoculated chickpea genotypes. The possible reason for significant
increase in the nodules plant-1 was the increased rhizobial population in g-1
of soil. Due to increased rhizobia in the soil, the nodules plant-1 increased
which result in greater nitrogen fixation and eventually the yield was
influenced positively and resulted in significant increase in the seed yield
plant-1. A similar promotive effect of inoculation on nodules and seed yield
plant-1 in chickpea was also observed by Bhuiyan et al. (2008), Romdhane et
al. (2008), Tellawi et al. (2007), Khattak et al. (2006), Stephan et al. (2002)
and Cleyet-marel et al. (1990). However, the findings of McKenzie et al.
68
(1992) were contradictory and observed no-positive effect of rhizobial seed
inoculation on the seed yield of chickpea. The contradiction might be due to
different genotypes and climatic condition, soil fertility levels and existing
rhizobial population in soil.
The effect of inoculation on nodules number and seed yield plant-1
was different in different genotypes; in some genotypes it was very high
(more than 100%). Many genotypes were recorded with medium to high (50
to 100%) response. A large number of genotypes showed low to medium
(less than 49%) increase and at the same time a small number of genotypes
were observed with no response or somewhat decrease in nodules and seed
yield plant-1 when seed was inoculated with rhizobium. The possible
explanation of differences in response of miscellaneous genotypes to
rhizobium inoculation could be the compatibility and interaction between
rhizobium and genotypes. Romdhan et al. (2007) also found variable
response to inoculation in different chickpea cultivars. Rodríguez-Navarro et
al. (1999) findings on bean also showed significant effect of strain x cultivar
interaction for number of nodules and seed yield. They concluded that the
performance of rhizobia strain is significantly modified by the plant genotype,
the strain which was highly effective in one cultivar and could be rated
moderately or less efficient in other cultivar. Hungría and Neves (1987) also
detected significant rhizobia × plant cultivar interaction for symbiotic
parameters and plant growth in Phaseolus vulgaris. The reports of Videria et
al. (2001) in soybean also authenticated the results of this study by reporting
that nodulation was not related to rhizobium species but influenced by
interaction among rhizobium and cultivar. Otieno et al. (2009) also indicated
the variable influence of inoculation on grain legumes that depends on
69
specie, parameter being measured and other environmental factors. The
above mentioned observations identified the importance of considering both
symbiotic partners while attempting to improve different plant parameters.
The results of genotype means showed partial correlation of
nodulation with yield (Tables 4.2.5 and 4.2.6). One possible explanation may
be the complexity of yield character which is the product of several other
traits. The results are also in line with those of Bhuiyan et al. (2008) who
didn’t observe any significant correlation between seed yield plant-1 and
nodules plant-1in chickpea. Videira et al. (2001) also reported that the
increase in number of nodules was not directly reflected in soybean yield.
They suggested that the reason for such response of yield to nodules
number might be that induction of more nodules may provoke a diversion of
carbohydrate to maintain the metabolic activities of a larger mass of nodules.
Three genotypes (two highly nodulated i.e. NDC 5-S-10 and NDC 4-
20-4, and one non-nodulated genotypes, ICC1918) were selected on the
basis of current evaluation. ICC19181 was selected because most of the
non-nodulated mutants like PM 665 and PM 679 were reported to have
produced normal root nodules at a temperature of 2°C. Mutants ICC19181
(ICC 435M) when grown on at ICRISAT, India, under ambient temperature
varying between 3 and 32°C during the first 60 days after sowing, did not
produce root nodules (Singh et. al., 1992). This confirmed the stability in
resistance of this mutant to a mixture of rhizobium strains that probably
occurred in the fields.
The results suggested that nodulation and seed yield of chickpea
can be improved by inoculation with compatible rhizobia which could be
70
economically feasible to increase chickpea production. It is concluded
from the current findings that breeding efforts are needed to develop
chickpea genotypes that nodulate consistently across a wide range of
chickpea growing regions in Pakistan to overcome nitrogen deficiency
facing during growing this crop.
71
Expt. 3 Inheritance and linkage studies of nodulation in
chickpea
4.3.1 Introduction
Low availability of nitrogen is responsible for limited growth of
agricultural crops. Synthetic fertilizers like ammonia, nitrate, or urea met at
least 50% of the global requirement. However, there is great need to exploit
biological nitrogen fixation which is one of the most important sources of
nitrogen for agriculture. The primary source of biological nitrogen fixation are
rhizobium or rhizobia specie and the actinobacterium Frankia spp, Biological
nitrogen fixation through the endosymbiotic association reduces the need for
expensive nitrogen fertilizers in legume crops and is an important feature of
sustainable agriculture. Crops of family leguminocea, like chickpea do not
respond to high doses of nitrogen fertilizer as they mainly depend upon
atmospheric nitrogen. During selection of genotypes having high nitrogen
fixation efficiency was given due consideration when an attempt was being
made for breeding high yielding genotypes in legumes crops (Bhapkar and
Deshmukh, 1982)
In several legumes, genes controlling the formation and function of
nodules have been identified (Nutman, 1981). An independent single
recessive gene, determining the non-nodulation characteristic of chickpea
mutants PM233, PM665, and PM 679, has also been reported (Devis et al.,
1985; Rupela and Sudarshana, 1986). A genetic locus characterized by
Mendelian segregation with a major phenotypic effect on nodulation was
found to govern the nodulation response of soybeans (Devine, 1984).
72
Selection of plants with desirable characters is the basic step of plant
breeding. However, problems arise in selection of traits, evaluation of which
is difficult and have to be selected indirectly. That difficulty might be
overcome by the identification of markers closely linked to the desired traits;
indirect selection then becomes possible, if location of the desired gene in
relation to the other is known. Moreover, linkage map of various organisms
can be constructed with the help of linkage study.
Two genes said to be linked if they are located on the same
chromosome. Different chromosomes segregate independently during
meiosis. Therefore, for two genes located at different chromosomes, we may
assume that their alleles also segregate independently. The chance that an
allele at one locus co-inherits with an allele at another locus of the same
parental origin is 50% and such genes are unlinked.
Major component of genetic characterization of agronomic crops is
the evaluation of genetic linkage relationship among agronomically important
genes. More than sixty mendellian genes controlling morphological
characteristics such as the shape, color and the size of leaves, flower, fruits,
and other organs (reviewed by Muehlbauer and Singh, 1987), and the
formation and function of root nodules (Davis et al.,1986; Devis, 1988) have
been reported. The unclear allelic relationship among genes described, and
the inconsistent genetic terminology used by different workers, makes it
difficult to ascertain how many different linkage groups actually have been
identified in chickpea (Muehlbauer and Singh, 1987).
Polymorphic monogenic traits were some of the earliest genetic
markers used in scientific studies and they may still be best for genetic,
breeding and plant germplasm management. Although morphological
73
markers are limited in nature but their evaluation neither require complicated
equipment nor difficult procedures (Singh and Singh, 1992). Morphological
markers (Monogenic or oligenic) are usually simple, fast and cheap to score
(Ghafoor, 1999). Some of these traits may serve as genetic markers
appropriate for plant germplasm management (Stanton et al., 1994). The
information provided by markers based approach depend on the type and
number of markers and their linkage relationship (Singh and Singh, 1992)
Nodulation is an imperative character of legumes due to which
leguminous plants are capable of growing under nitrogen-limiting conditions.
Due to the utmost importance of biological nitrogen fixation and high cost of
synthetic fertilizers, breeding for an efficient nodulation in legume crops is an
important trait. Information on the inheritance of nodulation would facilitate to
incorporate this important character in a high yielding and well adapted
genotypes. Moreover, nodulation can’t be evaluated until plants are
uprooted, though, this problem can be solved by the identification of a
marker traits linked to nodulation. In the light of above mentioned facts the
present experiment was designed with the following objectives
1. To understand the mode of inheritance of nodulation in chickpea.
2. To know the inheritance pattern of leaf color in chick pea.
3. To identify linkage among loci controlling nodulation and leaf color.
4.3.2 Materials and Methods
The selected chickpea genotypes i.e. ICC19181 (non-nodulated with
dark green leaf color), NDC 5-S10 (nodulated with light green leaf color) and
NDC 4-20-4 (nodulated with light green leaf color) were hybridized during the
74
chickpea growing season of 2007-08 at PBG department, AUP. In 2008-09
the F1 generation was raised at NIFA, Peshawar to produce F1,, BC1 (P1)
and BC1 (P2) seed as per following details:
Parents, F1, F2 and backcross generations were raised in the net
house of the department of Plant Breeding and Genetics during September
2009. Data for leaf color and nodulation was recorded after six weeks of
planting. The distribution of phenotypic classes was tested for goodness-of-
fit through Chi square test. Detailed materials and methods including
procedure for data collection, data analysis etc has been mentioned in
chapter 3.
Figure 4.3.1 Chickpea crossed flower; Figure 4.3.2 Roots of nodulated (left) and non- nodulated plants (right)
S.No Cross combination Cross designation
1 ICC19181 x NDC 5-S-10 Hybrid A (F11)
2 ICC19181 x NDC 4-20-4 Hybrid B (F12)
3 (ICC19181 x NDC 5-S-10) x ICC19181 BC11(P1)
4 (ICC19181 x NDC 5-S-10) x NDC 5-S-10 BC12(P2)
5 (ICC19181 x NDC 4-20-4) x ICC19181 BC13(P1)
6 (ICC19181 x NDC 4-20-4) x NDC 4-20-4 BC14(P2)
75
4.3.3 Results
4.3.3.1 Inheritance of nodulation
The results presented in table 4.3.1 for hybrid A (ICC 19181 x NDC 5-
S10) and Table 4.3.2 for hybrid B (ICC19181 x NDC 4-20-4) revealed that all
F1 plants of both hybrids produced normal nodules (Table 4.3.1) indicating
dominant gene effect for nodulation in chickpea..
The segregation in F2 population for nodulated and non-nodulated
phenotypes was in the ratio of 3:1 in hybrid A (Table 4.3.2) indicated
monogenic inheritance of nodulation. The distribution of nodulated and non-
nodulated phenotypes in the backcross progenies (Table 4.3.2) further
confirmed this result which showed a good fit as 1 Nod+: 1 Nod- the same as
expected for single gene inheritance. The chi-square values for F2 data of
cross ICC 19181 x NDC 5-S10 had probability between 68 - 70%, which
authenticate the presence of single dominant gene for nodulation or
monogenic inheritance of nodulation in genotype NDC 5-S10.
In hybrid B, F2 segregation for nodulation fit well to the ratio of 15
nodulated: 1 non-nodulated (Table 4.3.3). This segregation pattern was
supported by the backcross progenies in which the ratio for nodulated and
non-nodulated phenotypes showed a good fit to the expected ratio of 3 Nod+:
1 Nod- (Table 4.3.3). Thus in hybrid B, the nodulation in genotype NDC 4-20-
4 is controlled by two alleles at two independent loci with dominant gene
action. Normal nodules production in the F1 generations, and segregation of
backcross and F2 progenies for nodulated and non-nodulated phenotypes
confirmed that nodulation in genotype NDC 4-20-4 is controlled by duplicate
dominant genes. The probability of chi-square values for F2 data of cross
76
ICC19181 x NDC 4-20-4 was between 15 - 20% which strongly supports the
duplicate gene action of nodulation in genotype NDC 4-20-4.
4.3.3.2 Inheritance of leaf color
F1 population of both the crosses (ICC19181 x NDC 5-S10 and
ICC19181 x NDC 4-20-4) showed light green color (Table 4.3.1). The F2
populations segregated for leaf color as light green and dark green.
Segregating ratios (Table 4.3.4 and 4.3.5) of both F2 populations were in
good agreement with a Medelian dominant genic model and fit to 3:1 ratio.
The backcross progenies of both crosses also verified the result of F2
segregating population by showing a good fit to the ratio of 1 light green: 1
dark green. Thus it is concluded that the leaf color in chickpea is controlled
by a single dominant gene. F2 data showed high level of probability for chi
square values which confirmed the monogenic inheritance of leaf color in
chickpea.
4.3.3.3 Leaf color Vs nodulation
Results of both the crosses (ICC19181 x NDC 5-S10 and ICC19181 x
NDC 4-20-4) presented in table 4.3.6 revealed that there is a close linkage
between nodulation and leaf color traits. The recombination value between
genes for leaf color and root nodulation in ICC19181 x NDC 5-S10 cross was
observed to be 0.1575 + 0.0928 (Table 4.3.6). This showed that the distance
between two genes is about 15 centi Morgan (cM). On the other hand cross
ICC19181 x NDC 4-20-4 showed recombination value of 0.264 + 0.084
among genes responsible for nodulation and leaf color. This suggests that
the space between genes controlling nodulation and leaf color in genotype
77
NDC 4-20-4 is 26 cM. From the present study results it is concluded that
both genes controlling nodulation in genotype NDC 4-20-4 are present on
the same chromosome and the space between these two genes (responsible
for nodulation) is 11cM.
Table 4.3.1: Morphological markers of parents and their F1 used in linkage studies of Chickpea
Parents/Hybrids Leaf Color Nodulation
ICC 19181 l rn
NDC 5-S10 L RN
NDC 4-20-4 L RN
ICC 19181 x NDC 5-S10 (F1)
L RN
ICC 19181 x NDC 4-20-4 (F1)
L RN
L = Light green; l = Dark green; RN + Nodulated; rn = Non-nodulated
Table 4.3.2: Nodulation response of non-nodulated (Nod-) and nodulated (Nod+) parents, F1, F2, and backcross progenies of ICC 19181 X NDC 5-S10 cross to rhizobial inoculation.
Plants
Generation
Parent or Cross Nod+ Nod-
Expected ratio
χ2
<P <
Parent (P1) ICC 19181 0 40 -
Parent (P2) NDC 5-S10 40 0 -
F1 P1 X P2 27 0 -
F2 P1 X P2 84 25 3:1 0.14 0.70-0.68
BC1(P1) F1 X P1 45 39 1:1 0.29 0.70-0.50
BC1(P2) F1 X P2 48 0 -
Nod+:=Nodulated; Nod-= Non-nodulated; χ2= Chi Square; <P <= Probability
78
Table 4.3.3: Nodulation response of non-nodulated (Nod-) and nodulated (Nod+) parents, F1, F2, and backcross progenies of ICC19181 X NDC 4-20-4 cross to rhizobial inoculation
Plants
Generation
Parent or Cross
Nod+ Nod-
Expected ratio
χ2
<P <
Parent (P1) ICC 19181 0 40 -
Parent (P2) NDC 4-20-4 40 0 -
F1 P1 X P2 30 0 -
F2 P1 X P2 105 12 15:1 2.55 0.20-0.15
BC1(P1) F1 X P1 53 26 3:1 2.22 0.20-0.15
BC1(P2) F1 X P2 59 0 -
Nod+:=Nodulaed; Nod-= Non-nodulated; χ2= Chi Square; <P <= Probability
Table 4.3.4: Inheritance of leaf color in light green and dark green leaf colored parents, F1,
F2, and backcross progenies of cross ICC 19181 X NDC 5-S10
Plants
Generation
Parent or Cross Light
green Dark green
Expected ratio
χ2
<P <
Parent (P1) ICC 19181 0 40 -
Parent (P2) NDC 5-S10 40 0 -
F1 P1 X P2 27 0 -
F2 P1 X P2 78 31 3:1 0.49 0.50
BC1(P1) F1 X P1 47 37 1:1 0.96 0.50 – 0.30
BC1(P2) F1 X P2 48 0 -
χ2= Chi Square; <P <= Probability
79
Table 4.3.5: Inheritance of leaf color in light green and dark green leaf colored parents, F1 F2, F2,and backcross progenies of ICC19181 X NDC 4-20-4 cross
Plants
Generation
Parent or Cross Light green
Dark green
Expected ratio
χ2
<P <
Parent (P1) ICC 19181 0 40 -
Parent (P2) NDC 4-20-4 40 0 -
F1 P1 X P2 30 0 -
F2 P1 X P2 88 29 3:1 0.45 0.50
BC1(P1) F1 X P1 46 33 1:1 1.82 0.30
BC1(P2) F1 X P2 59 0 -
χ2= Chi Square; <P <= Probability
Table 4.3.6: Joint segregation for markers of chickpea F2 population for Leaf color and nodulation
Crosses Gene A- B- A- bb aa B- aa bb Sum χ2 P R+SE
ICC 19181 x NDC 5-S10
L: N 73 5 11 20 109 42.37 0.00 0.1575+0.092
ICC 19181 x NDC 4-20-4
L: N 85 3 20 9 117 18.084 0.00 0.264+0.084
χ2: Chi square tests for assuming ratio 9:3:3:1; P: probability of a greater chi square; SE: Stander error; R:
Recombination value
80
4.3.4 Discussion
The results of hybrid A in this study fit to the monohybrid Mendalian
ratio 3 nodulated: 1 non-nodulated which indicates that nodulation in
genotype NDC 5-S10 was controlled by a single dominant gene. In chickpea,
monogenic inheritance in a cross of Annigeri and Rabat genotypes is also
reported by Singh and Rupela (1998). In another study Devis (1988) got
similar results from crosses of PM405 and PM 769 (non nodulated mutants
with ineffective nodulation) with P502 (produce effective nodules), he also
recorded monogenic inheritance of nodulation in chickpea, fit to monohybrid
expected ratio of 3 (effective nodules): 1(ineffective nodules). In a cross of
ICC435M (non-nodulated mutant) with its normal nodulated parent Singh et
al. (1992) found the same single gene inheritance pattern of nodulation in
chickpea. In addition to chickpeas, it was found that the nodulation in
soybeans is also govern by Mendelian segregation with a major phenotypic
effect in a cross of Kent and Peking with using the fast-growing rhizobial
strain USDA 205 (Devin, 1984). The F1BC1 data and the highest probability
level (68-70%) of chi square values also provided strong evidence to support
the monogenic inheritance of nodulation in genotype NDC 5-S10.
Results of second cross (hybrid B) revealed normal nodulation of the
parents, F1 and backcross progenies, and the F2 segregation ( 15 Nod+: 1
Nod-) for nodulated and non-nodulated phenotypes showed that nodulation
in genotype NDC 4-20-4 of chickpea is controlled by two independent
dominant genes. In chickpea, this is the first report about duplicate gene
action controlling nodulation. Data of backcross progenies (distributed into 1
Nod+: 1Nod-) strengthened the result of F2 segregating population. Moreover
the probability level of chi square values of segregating data as well as of
81
backcross data was between 15–20% which strongly support the control of
nodulation by duplicate gene action in genotype NDC 4-20-4.
The digenic inheritance behaviour of nodulation in chickpea in the cross
ICC19181 x NDC 4-20-4 is also confirmed by the molecular characterization
of genotypes under study in experiment 4. Molecular investigations through
Simple Sequence Repeats (SSR) or microsatellite markers revealed that the
two genotypes NDC 5-S10 and NDC 4-20-4 fall into distinct groups in the
cluster analysis or phylogenetic tree constructed by UPGMA (unweighted
paired-group method) and by ME (minimum evolution) methods. Principal
coordinate analysis (PCoA) based on microsatellite allele frequencies also
showed these two genotypes in completely separate classes. Thus the
molecular investigations also confirmed the high level genetic diversity
among these two nodulated genotypes. Therefore it provides evidence of
different genetic control for nodulation in two chickpea genotypes i.e., NDC
5-S10 and NDC 4-20-4 in this study and probably other genotypes (may be
reported by some other investigators in future endeavors). However, in
chickpea the presence of two genes for certain other traits like resistance to
wilt and ascochyta blight and leaf type have been reported. Duplicate gene
action (Updhyaya et al., 1983) for the inheritance of resistance to Race 1 of
Fusarium oxysporum f.sp. ciceris and control of leaf type by two genes
(Danehloueipoueet et al., 2008) in chickpea further strengthens the results of
the present project.
In other crops like pigeon peas, Gallo-Meagher et al. (2001) proposed
a three gene model for nodulation and suggested that three genes control
nodulation at three independent loci, with nodulation being a product of two
genes and inhibited by a third gene when it is dominant and the others are
82
homozygous recessive. In Soybean two dominant alleles were observed to
control promiscuous nodulation (Gwata et al., 2005). Two duplicate
recessive genes were also reported by Nigam et al. (1982) that control non-
nodulation in groundnut. Dutta and Reddy (1988) also reported duplicate
genes action as well as single recessive gene controlled non-nodulation in
Peanut. They stated that duplicate genes action as well as single recessive
gene controlled non-nodulation in Peanuts.
In the present study leaf color of chickpea showed monogenic
inheritance in both cross combinations. Previous studies also reported single
gene inheritance for morphological markers including characteristics of leaf
(other than color) in chickpea. Davis (1991) reported monogenic inheritance
for simple leave, filform leave, ineffective nodulation and white color flower
traits in chickpea similarly Pundir and Reddy (1998) observed single gene
inheritance for chickpea’s small leaf size and open flower characteristics.
Results of this study revealed that both the qualitative characters
(nodulation and leaf color) deviated from the expected Mendelian
segregating ratio of 9:3:3:1. Monogenic markers are useful in estimating the
rate of out crossing in predominantly self pollinating crops. They also help in
identification of F1 hybrids in the breeding programs. In case of complete
dominance, detection of heterozygotes for morphological markers is not
possible (Arshad et al. 2005).
Rare linkage study has been reported among genes controlling
nodulation with other morphological markers in chickpea. The first report on
genetic linkage of a locus controlling nodulation in the higher plants was
reported by Thomas et al. (1983) who observed linkage between Rj1 locus
(controlling restricted nodulation) and the F locus (controlling fasciated stem)
83
in soybean (Glycine max L.). Gwata et al. (2005) studied the inheritance of
nodulation with the help of leaf color in soybean, they found that yellow leaf
color with non-promiscous nodulation (which forms no or nonfunctional
nodules) is dominant over green leaf color with promiscuous nodulation
(which form functional nodules). From plant breeding stand point, such
method of identifying nodulated genotypes is most rapid, less expensive and
effective. The present study is the first effort to report linkage between genes
for nodulation and leaf color in chickpea. In 1991, Davis reported linkage
between genes for simple leave (slv) and root nodulation (rn3) as well as
among genes controlling filform leave and open flower (fil and w2) traits of
chickpea. He also detected loose linkage between w2-fil and slv-rn3 linkage
groups. Pundir and Reddy (1998) found that two traits i.e. open flower and
small leaf size in chickpea have monogenic recessive inheritance and both
the traits have showed some linkage, while flower color and flower type
revealed no linkage. Linkage was also reported by other scientists between
characteristics of leaf and nodulation in legumes. Sarker (1999) reported
linkage of early flowering gene (Sn) with seed coat pattern gene (Scp) and
tendrilled leaf (Tnl) with colored stem (Gs) in linkage group 1 of lentil
genome.
It is concluded from the current study that nodulation in chickpea is
controlled by a single dominant gene or two dominant genes, depending on
the nature of germplasm. Leaf color in chickpea also has monogenic
inheritance. Moreover, the It is concluded from the current study that
nodulation in chickpea is controlled by a single dominant gene or two
duplicate dominant genes, depending on the nature of germplasm. It is
concluded from the current study that nodulation in chickpea is controlled by
84
a single dominant gene or two duplicate dominant genes, depending on the
nature of germplasm. Presence of linkage between genes for nodulation and
leaf color is of great importance, it could be used efficiently in plant breeding
programs for rapid- screening method of effective nodulation.
85
Experiment 4 Molecular Characterization of Chickpea Germplasm using microsatellite markers
4.4.1 Introduction
Over recent decades, molecular marker technology has developed into
a valuable tool for plant breeding. A number of techniques (e.g. RFLP,
RAPD, AFLP, SSR) can be used as DNA markers linked to traits of interest,
directing selection towards these markers instead of selecting for a
phenotype (Edwards and Mogg, 2001). The small genome size (740 Mb),
and high economic importance as a food crop legume make chickpea an
important species for genomics research. Molecular markers and linkage
maps are the prerequisites for undertaking molecular breeding activities.
However, the progress towards development of a reasonable number of
molecular markers has been very slow in cultivated varieties of chickpea.
One of the main reasons for this may be attributed to the low level of genetic
diversity present in the cultivated gene pools of this species, at least with the
detection tools that are currently available (Sharma et al., 1995, Rajesh et al,
2002). Although several genetic linkage maps using various markers and
genomic tools have become available, sequencing efforts and use of
available resources have been limited in chickpea genomic research. Among
various molecular markers currently available, SSR or microsatellite markers
are often chosen as the preferred markers for a variety of applications in
breeding because of their multi-allelic nature, co-dominant inheritance,
relative abundance and extensive genome coverage (Gupta and Varshney,
2000). As a result, several hundred SSR markers have been developed and
are available in chickpea (Hüttle et al., 1999; Winter et al., 1999). By
86
examining the vast collection of chickpeas covering a broad geographic
range, a sufficient amount of genetic variation has been reported (Serret et
al., 1997; Udupa et al., 1999; Imtiaz et al., 2008; Upadhyaya et al., 2008).
Together with availability of high density linkage map (Winter et al., 2000),
highly polymorphic marker system like SSR would be of great value in QTL
mapping and marker assisted selection for various important traits (Singh et
al., 2008).
Genetic variation not only provides crop varieties with the capacity to
adapt to various environments, and resistant pests and diseases, but is also
a necessary resource for improving yield and quality required for food. In
order to enhance the genetic diversity of cultivars, it is necessary to utilize
exotic and diverse germplasm in breeding programs. Genetically diverse
lines provide ample opportunity to create favorable gene combinations, and
the probability of producing a unique genotype increases in proportion to the
number of genes by which the parents differ.
The objective of the study was to explore the genetic diversity of all the
composite genotypes of chickpea and also to examine desi and kabuli
morphs in comparison with each other for their genetic variability. Due to the
utmost importance of nodulation in nitrogen fixation, restoring soil fertility and
increased crop production it is important to study the genetics of nodulation
at molecular level in chickpea also just like other crops (Soybean,
Medicago). The present study was planned with the following objectives:
1. To investigate the genetic diversity in the composite genotypes of
chickpea
87
2. To evaluate genetic variability among desi and kabuli morphs of
chickpea
3. To check the grouping pattern of nodulated and non-nodulated
genotypes of chickpea.
4.4.2 Materials and Methods
A total of 47 genotypes of chickpea were used for this study (Table
4.4.1). They included 29 Desi and 18 Kabuli genotypes. Seeds of chickpea
were sown in 27 cm diameter pots containing 7.5 Kg of sandy soil with five
seeds per pot in a green house. DNA was extracted separately from fresh
leaves of two-five week-old plants for each genotype using modified CTAB
method described by Doyle and Doyle (1990). Ten SSR (microsatellite)
markers including five dinucleotide and five trinucleotide repeats were used
for genotyping. Primers were labeled with FAM, HEX, and NED fluorescent
dyes (Applied Biosystems, Foster City, USA). Details’ regarding reaction
mixture for amplification of markers, cycling parameters for markers
amplification, capillary electrophoresis and data analysis has been given in
chapter 3.
4.4.3 Results
4.4.3.1 Genetic variation
All the primer pairs generated reproducible and easily readable
microsatellite patterns. Eight of the ten primer pairs generated more than two
alleles (polymorphic), whilst two SSR primer pairs (H1B11 and H6G07)
amplified only one allele (monomorphic). These two monomorphic loci were
88
excluded from the analysis. A total of 58 alleles were detected in the 47
genotypes of chickpea (Table 4.4.3). The number of alleles per locus ranged
from 2 (CaSTMS19) to 16 (H3A10), with the average of 7.4 per locus. The
effective number of alleles (Ne) ranged from 1.29 (CaSTMS25) to 8.06
(H3A10) with an average of 3.66. Between Desi and Kabuli morphs, 46
alleles were found in Desi, and 42 alleles were found in the Kabuli, whilst 30
alleles were shared by both. A total of 28 private alleles (16 in Desi and 12 in
Kabuli) were detected. The average numbers of allele per locus in Desi and
Kabuli morphs were 5.87 and 5.25, respectively, while their mean effective
numbers were 2.78 and 3.40, respectively (Table 4.4.3). Across all the
polymorphic loci, 6 alleles (0.3%) of the 58 alleles were classified as rare
(present at a frequency of <1%), whereas 36 alleles (70.1%) were common
alleles (1–20%) and 16 alleles (27.6%) were frequent alleles (> 20%).
The PIC values ranged from 0.227 (CaSTMS25) to 0.876 (H3A10), with
an average of 0.636 (Table 4.4.3). Both CaSTMS markers showed relatively
low PIC values. The average PIC was 0.582 in Desi and 0.577 in Kabuli, and
these values were very similar. AMOVA was used to partition the genetic
variation between morphs, between individual genotypes within each morph
and within individuals (Table 4.4.4). Significant differentiation (RST = 0.239, P
≤ 0.001) was obtained between the two morphs.
Segregating loci were detected in 14 of our composite chickpea
genotypes, ranging from 1 to 5 loci per genotype with an average
heterozygosity from 0.125 to 0.625 (Table 4.4.1). This resulted in an overall
mean heterozygosity of 0.088.
89
4.4.3.2 Genetic relationship among genotypes
The UPGMA tree based on the genetic distance (Fig. 1a) shows
that all the genotypes were divided into 6 monophyletic groups (A, B, C, D, E
and F) and 2 outliers (genotype ICC19183 and ICC19181). Group A consists
of 3 Desi (genotypes NDC-122, Karak 1 and Sheenghar) and 1 Kabuli
(Hassan 2K) genotype. Genotypes Karak 3 and Sheenghar were the local
collections of Karak, Pakistan. Groups B (7 genotypes) and C (10 genotypes)
both consist of only Desi lines. Among Group B genotypes, NDC-727, NDC
4-15-1, NDC 4-15-3, NDC 4-20-3 and NDC 4-20-4 were derived from the
same induced mutation line (C-44), while NDC 15-3 and NDC 15-4 were
from another induced mutation line (Pb-91). Nine genotypes (NDC 728-5,
NDC 730-2, NDC 15-1, NDC 15-2, NDC 4-15-2, NDC 4-20-1, NDC 4-20-2,
NDC 4-20-5, NDC 4-20-6, and 2NIFA 2005) in Group C had the same
parentage of C-44, with genotype NIFA 2005 located in the basal position.
Group D includes 12 genotypes containing six Desi (NDC 4-20-7, NDC 5-
S10 to NIFA 95) and eight Kabuli (NKC 10-99 to NKC 5-S13, NKC 5-S15 to
NKC 5-S19) genotypes. Lines NKC 5-S15 and NKC 5-S16 had the same
parental origin. Group E is composed of seven Kabuli lines (genotypes NKC
5-S14, NKC 5-S20 to NKC 5-S24 and ICC4993) with genotype ICC4993
(local collection from Morocco) in the basal position. All the genotypes
included in the Group F are the local collections from Karak, Pakistan, and
this group consists of two Desi (Karak 1 and Karak 2) and one Kabuli
(Lawaghar) genotype. The genotypes ICC19183 and ICC19181 are basal in
the tree. The UPGMA tree locates the root at the middle point of the branch
connecting genotype 47; however, the branching associations among the
groups are ambiguous because they are connected with very short
90
branches. Bootstrap values for all these branches are very low (less than
50%).
An ME tree was constructed and is shown in Fig. 1b. In this tree, six
monophyletic groups (A', B', C', D', E' and F') were recognized. Genotype
NDC-727 was a sister to the cluster of Groups A' and B'. These groupings
are mostly the same as the grouping of the UPGMA tree (Group A in
UPGMA corresponds to A' in ME, and so on) with some minor differences.
Genotype ICC4993 in Group E of the UPGMA tree was displaced to Group
A' in the ME tree. Genotype ICC19181 was included in Group B' in the ME
tree. The composition of Group C' in the ME tree is the same as for Group C
in the UPGMA tree. Genotype NKC 5-S16, which was in Group D of the
UPGMA tree, was included in Group F' in the ME tree. Genotype NKC 5-
S12, which was in Group E' of the ME tree was in Group D in the UPGMA.
Branching associations among the groups in the ME tree were very different
from that of the UPGMA tree, reflecting ambiguous associations among the
groups. Non-nodulating lines (genotypes ICC4993, ICC19183, ICC4918 and
ICC19181) were not closely related in either of the trees.
The genetic relationships among 47 chickpea genotypes were also
determined using PCoA of GD estimates and are presented in figure 3. The
first (PC 1) and the second (PC 2) principal coordinate axes accounted for
28.12% and 42.70% of the total variation, respectively. So the first two
components of the PCoA between chickpea genotypes represented 70.82 %(
71%) of the variance, therefore PCoA was useful for graphical
representation, as it adequately summarize the microsatellite data. The two
axes separated the chickpea genotypes into 6 groups, with three outliers,
line number 31, 46 and 49(fig 3). Grouping of PCoA was same to that of
91
cluster analysis. Group A'' include three Desi and one Kabuli genotypes. The
genotypes of group B in cluster analysis were distributed into two
groups in PCoA that is group B'' and B'''. Group C'' of PCoA is
comparable to the group C of cluster analysis (UPGMA tree) containing ten
desi genotypes. There were 13 genotypes in group D'', this group was also
identical to group D of cluster analysis. Group E'' consisted of eight
genotypes, identical to cluster analysis only genotypes NKC 5-S15 (30)
which was in group A in cluster analysis fell into group E'' in PCoA, may be
due to some statistical error. Group F'' of PCoA was indistinguishable from
group F of cluster analysis. The non-nodulated lines 46, 49 and the
nodulated genotype 31 remains as an out liar in PCoA, this is also
comparable with UPGMA which showed genotype 49 as an out liars.
4.4.3.3 Grouping of chickpea genotypes based on morphological traits Means of the 4 morphological traits in Desi and Kabuli genotypes are
shown in Table 4.4.5 with their standard errors. ANOVA showed that there
were significant difference in the number of leaflets and nodules per plant.
Both were larger in Desi genotypes. Correlations among the 4 morphological
traits (number of nodules per plant, seed weight, number of leaflets per leaf,
and leaf area) are summarized in Table 6. Nodulation was significantly
positively correlated with the leaf area and the leaflet number (P ≤ 0.01 for
both). The correlation between leaf area and leaflet number was also highly
significant (P ≤ 0.01). The seed weight did not show any significant
correlation with any of the other traits. PCA was performed based on the
covariance matrix. PCA based on the 4 morphological traits allocated 72.1%
92
and 16.4% of the variance to Principal component 1 (PC1) and PC2,
respectively, accounting for 88.5% of the total variance (Table 7). Nodule
number showed the largest eigenvector for PC1. Similarly, leaf area and
leaflet number were the first and second largest eigenvectors for PC2,
respectively. Using PC1 and PC2 as X and Y axes, respectively, chickpea
genotypes were clustered graphically as shown in Fig. 2. This clearly
differentiates the Nod– genotypes as an isolated group from the Nod+
genotypes. Among the Nod+ genotypes, Desi and Kabuli genotypes formed
overlapping groups, but their center was clearly distinguished.
93
Fig.4.4.1
Figure 4.4.1. (a) UPGMA tree showing phylogenetic relationship between 47 chickpea
genotypes. (b) ME tree showing phylogenetic relationship between 47 chickpea genotypes.
In both trees branch length is proportional to the genetic distance.
94
Fig. 4.4.2
Figure 4.4.2. Scatter plot of principal component analysis based on
morphological data. PC1: principal component 1; PC2: principal component
2. Dotted line and dashed line circles show the 90% density ellipse of Nod+-
Desi and Nod+-Kabuli genotypes, respectively. The genotypes with asterisk
show Nod- genotypes with 90% density ellipse of solid line.
95
Figure 4.4.3
Principal Coordinates
as1
as2
as3as4
as5
as6
as7
as8as9
as10
as11
as12
as13
as14
as15
as16
as17
as18
as19
as20
as21as22
as23
as26
as27
as28
as29
as30
as31
as32
as33as34
as35as36
as37
as38
as39
as40
as41as42
as43
as44
as45 as46
as47
as48
as49
PC 1
PC
2
A''
B''
B'���''
C'' D''
E''F''
Figure 4.4.3: Scatter plot of principal coordinate analysis based on
microsatellite allele frequencies. PC1: principal coordinate 1; PC2: principal
coordinate 2. Circles show the clusters shown by alphabets. A=3 Desi & 1
Kabuli, B= 4 Desi, B’= 3 Desi, C=10 Desi, D= 6 Desi & 7 Kabuli, E= 8 Desi,
and F=2 Desi & 1 kabuli
96
Table 4.4.1 Description of chickpea genotypes used in this study
No. Entry Phenotype Genotype ParentageA Origin HB
1 NDC-122 Desi Nod+ C-44 × ILC-195 NIFA 02 NDC-727 Desi Nod+ C-44/M NIFA 0.253 NDC-728-5 Desi Nod+ C-44/M NIFA 0.3754 NDC-730-2 Desi Nod+ C-44/M NIFA 0.1255 NDC-15-1 Desi Nod+ Pb-91/M NIFA 06 NDC-15-2 Desi Nod+ Pb-91/M NIFA 07 NDC-15-3 Desi Nod+ Pb-91/M NIFA 08 NDC-15-4 Desi Nod+ Pb-91/M NIFA 09 NDC-4-15-1 Desi Nod+ C-44/M NIFA 010 NDC-4-15-2 Desi Nod+ C-44/M NIFA 011 NDC-4-15-3 Desi Nod+ C-44/M NIFA 012 NDC-4-20-1 Desi Nod+ C-44/M NIFA 013 NDC-4-20-2 Desi Nod+ C-44/M NIFA 0.37514 NDC-4-20-3 Desi Nod+ C-44/M NIFA 015 NDC-4-20-4 Desi Nod+ C-44/M NIFA 0.516 NDC-4-20-5 Desi Nod+ C-44/M NIFA 0.12517 NDC-4-20-6 Desi Nod+ C-44/M NIFA 018 NDC-4-20-7 Desi Nod+ C-44/M NIFA 0.12519 NDC-5-S10 Desi Nod+ JG74 × ICC12071 ICARDA 020 NDC-5-S11 Desi Nod+ JG74 × ICC12071 ICARDA 0.37521 NIFA-88 Desi Nod+ 6153 NIFA 022 NIFA-95 Desi Nod+ 6153/M NIFA 0.12523 NIFA-2005 Desi Nod+ Pb-91/M NIFA 0
24 NKC-10-99 Kabuli Nod+ FlIP98-138C × SEL99TH15039
ICARDA 0
25 NKC-5-S12 Kabuli Nod+ BAHODIR × SEL99TER85530 ICARDA 0
26 NKC-5-S13 Kabuli Nod+ SEL99TH15039 × S98008 ICARDA 0.2527 NKC-5-S14 Kabuli Nod+ SEL99TH15039 × S98008 ICARDA 0.12528 NKC-5-S15 Kabuli Nod+ FLIP98-15C × S98033 ICARDA 0.375
29 NKC-5-S16 Kabuli Nod+ S99456 × SEL99TER85314
ICARDA 0.625
30 NKC-5-S17 Kabuli Nod+ S99456 × SEL99TER85314
ICARDA 0
31 NKC-5-S18 Kabuli Nod+ (ILC4291 × FLIP98-129C) × S98008
ICARDA 0.375
32 NKC-5-S19 Kabuli Nod+ (ILC4291 × FLIP98-129C) × S98008
ICARDA 0
33 NKC-5-S20 Kabuli Nod+ FLIP98-138C × SEL99TH15039 ICARDA 0
34 NKC-5-S21 Kabuli Nod+ GLK95069 × SEL99TER85530
ICARDA 0
35 NKC-5-S22 Kabuli Nod+ CA9783007 × SEL99TER85534
ICARDA 0
36 NKC-5-S23 Kabuli Nod+ CA9783007 × SEL99TER85534
ICARDA 0
37 NKC-5-S24 Kabuli Nod+ CA9783007 × SEL99TER85534
ICARDA 0
38 HASSAN-2K Kabuli Nod+ ILC-195/M NIFA 039 Karak 1 Desi Nod+ Local selection Karak 040 Karak 2 Desi Nod+ Local selection Karak 041 Karak 3 Desi Nod+ Local selection Karak 042 Sheenghar Desi Nod+ Local selection Karak 043 Lawaaghar Kabuli Nod+ Local selection Karak 0 44 ICC 4993 Kabuli Nod– Rabat Morocco 045 ICC 19183 Kabuli Nod– ICC 4993NN ICRISAT 046 ICC4918 NN Desi Nod– Annigeri India 047 ICC19181NN Desi Nod– ICC 435NN ICRISAT 0
AThe lines indicated by /M is mutation induction lines. BHeterozygosity.
97
Table 4.4.2 Primers used for amplifying chickpea microsatellite regions
Locus Primer Sequence (5'-3') Annealing temp.
Motif Repeat
H1116 F GACATGAAATTCGGTGCATT 52°C GA 20
R AACGCCCTAAACCTCTTGGT
H1F17 F GGGGAGGAAGAAGATGGAA 48°C TA 27
R GCGTTATGGGTGGAAATGGTA
H3C06 F AATTTCGTGAATCATTAAAAATAGAGG 55°C TAA 23
R CACATGACTATCTAGACATTTTATTTATC
H3A10 F TTTAAGGCTTCAGGTATTGATTTCT 55°C TTA 24
R TCACACATGCCAACTTAAAATAAAA
H3A07 F GCGACACCTATTCCTCTTTTCTA 58°C TTA 20
R TCATTTTTGGAATATTTTAGTGACAA
H2J09 F AACGAAAAACAAGGGAGAAAAA 52°C GA 18
R TATTTCTTTGACTCCCCCTAACTT
H1B11 F GCAGCTGTTGACATCTAATTTTG 60°C TAA 20
R ACCGAAAACACTTGTGATTGTTA
H6G07 F TCTATCAGAGATATTAAGTTGAACG 60°C TAA 23
R CGTGACAGAATTAGCCTCTTGT
CaSTMS19 F TGAAGCTGGGGGTTCCTTG 50°C AT 15
R TCAATTGAGTCGCGACGAGAG
CaSTMS25 F TACACTACTGCTATTGATATGTGGT 50°C CT 19
R GACAATGCCTTTTTCCTT
98
Table 4.4.3 Genetic diversity statistics of chickpea genotypes
Locus
Paramet
ersA H1116 H1F17 H3C06 H3A10 H3A07 H2J09 CaSTMS19 CaSTMS25 Mean
All Genotypes
N 47 47 47 47 47 47 47 47 47
Na 5 7 12 16 6 7 2 3 7.37
Ne 3.261 3.648 5.381 8.062 3.344 2.543 1.641 1.294 3.66
PIC 0.693 0.726 0.814 0.876 0.701 0.607 0.39 0.227 0.636
Kabuli vs Desi
Desi N 29 29 29 29 29 29 29 29 29
Na 4 7 10 10 5 6 2 2 5.87
Ne 2.346 3.228 3.526 5.021 2.339 2.507 1.859 1.312 2.78
PIC 0.574 0.69 0.716 0.801 0.573 0.601 0.462 0.238 0.592
Kabu
li N
18 18 18 18 18 18 18 18 18
Na 3 5 8 12 5 4 2 3 5.25
Ne 2.418 2.582 2.838 7.714 3.682 2.445 1.246 1.256 3.40
PIC 0.586 0.613 0.829 0.87 0.728 0.591 0.198 0.204 0.577
AN, no. genotypes examined; Na, actual number of alleles; Ne, effective
number of alleles; PIC, polymorphic information content.
99
Table 4.4.4 AMOVA analysis of microsatellite data of chickpea genotypes
SourceA d.f. SSB MSC Est. Var.D %
Among morphs 1 7087.7 7087.7 140.7*** 24%
Among genotypes 45 37647.6 836.6 389.3*** 66%
Within genotypes 47 2725.5 58.0 58.0*** 10%
Total 93 47460.9 588.0 100%
*** Significant at P ≤ 0.001.
AMorphs are Desi and Kubuli. BSum of square. CExpected mean square. DEstimated variance.
Table 4.4.5 ANOVA for the 4 morphological traits of chickpea genotypesA
*** P ≤ 0.001
ANon-nodulated lines are excluded from the analysis of nodulation. BThe values are mean ± standard error. CF-ratio testing the difference of Desi and Kabuli genotypes. The numbers in parenthesis are the degree of freedom.
MeanB
Leaf area (cm2) Leaflet/plant Seed weight (g)
Nodule/plant
Desi 7.14 ± 0.159 14.3 ± 0.098 0.719 ± 0.0165
8.89 ± 0.414
Kabuli 7.06 ± 0.202 12.9 ± 0.125 0.747 ± 0.0209 6.04 ± 0.538
F-ratioC 0.0878 (1, 45) 74.14 (1, 45)*** 1.116 (1, 45) 17.60 (1, 41)***
100
Table 4.4.6 Correlation among four morphological traits of chickpea
genotypes
Leaflet Seed weight Nodulation
Leaf area 0.3971** 0.0532 0.4365**
Leaflet 0.0024 0.4307**
Seed weight –0.0699
** P ≤ 0.01
Table 4.4.7 Principal component analysis on four morphological traits of
chickpea genotypes
PC1 PC2 PC3 PC4
Eigenvalue 11.5216 2.6242 1.7774 0.0614
Percent 72.0793 16.4170 11.1196 0.3841
Cum. Percent 72.0793 88.4963 99.6159 100.0000
Eigenvector
Leaf 0.29749 0.68135 –0.66861 0.01471
Leaflet 0.28387 0.60556 0.74345 –0.00211
Seed weight –0.00377 0.01524 –0.00814 0.99984
Nodulation 0.91154 –0.41088 –0.01335 0.00959
101
4.4.4 Discussion
A collection of chickpea experimental lines for breeding programs
was evaluated for their genetic variation, especially between Desi and Kabuli
genotypes. All the SSR markers examined were selected randomly from
previously published data. In this study, 8 out of the 10 selected SSR
markers showed polymorphism in our 47 chickpea genotypes. The allele
number per locus ranged from 2 to 16, averaging 7.32, and with PIC values
of 0.227–0.876, averaging 0.636. These values are lower than those
observed by Udupa et al. (1999), who reported an average number of alleles
of 14.1 per locus and an average PIC of 0.86 for 12 SSR loci in 78 genotypes
of chickpea including 72 landraces, 4 cultivars and 2 wild species of the
primary gene pool (i.e. C. reticulatum and C. echinospermum). Similarly,
Imtiaz et al. (2008), who evaluated 48 genotypes of chickpea comprising
cultigens, landraces, and wild relatives using 21 SSR loci, detected an
average of 16.9 alleles per locus and an average PIC value of 0.82. In a
more comprehensive study, Upadhyaya et al. (2008) examined 2915
genotypes from a vast collection of chickpea germplasm maintained in two
gene banks in ICRISAT and ICARDA using 48 SSR markers. They reported
that the number alleles per locus ranged from 14 to 67, with an average of
35, and PIC values from 0.467 to 0.974, averaging 0.854. In comparable
soybean studies, Narvel et al. (2001) reported an average of 10.2 alleles per
locus among 79 genotypes including 39 elite genotypes (Elites) and 40 plant
introductions (PIs) using 74 SSR loci. Average marker diversity among the
PIs was 0.56 and that of the Elites was 0.50. Likewise Wang et al. (2006)
calculated an average of 12.2 alleles per locus for 129 Chinese soybean
genotypes using 60 SSR loci and the PIC among genotypes varied from 0.5
102
to 0.92 with a mean of 0.78. Although allele number is very much dependent
on sample size, the possible explanation for the lower observed PIC value in
our study could be that most of the genotypes were advanced-generation
laboratory stocks derived from a limited number of parental lines or hybrids,
whereas many of the studies cited above used a larger number of genotypes
from geographically diverse areas including landraces and wild relatives.
However, the materials used here still reveal a considerable amount of
genetic variation. PIC values for the induced mutation lines derived from C-
44 was 0.443 and from Pb-91 was 0.422. These contain about 50% of the
variation that resides in the world collections of chickpea (Upadhyaya et al.,
2008), and the SSR markers could effectively discriminate the lines derived
from a same parental line. Thus the microsatellite technique proved to be a
useful system for managing our experimental lines. Our result also showed
the average heterozygosity of 0.088, which is rather high compared with
reported range between 0 and 1% in chickpea natural cross-pollination
(Singh, 1987). In this study, extensive care was taken to avoid inadvertent
seed mixture and a single plant from each genotype was selected and used
for DNA extraction and analysis. Probably in some lines, especially in the
lines of hybrid origin, genetic materials are still segregating.
Desi and Kabuli genotypes showed clear morphological difference
especially in the leaflet number and nodule number (Table 5, and Fig. 2).
The average PIC values for Desi and Kabuli morphs were 0.582 0.061 and
0.577 0.090, respectively, which are not significantly different from each
other. Although significant differentiation in their allele frequency constitution
was shown by AMOVA (Table 4), Desi and Kabuli groups were not clearly
divided in UPGMA and ME phylogenetic trees (Figs. 1a and 1b). Some
103
genotypes formed monophyletic groups in phylogenetic tree such as in
Group B and Group C for Desi genotypes and Group E for Kabuli genotypes
in UPGMA tree, but others are paraphyletic (Fig. 1a). Apparently in our
study, some genotypes were derived from hybrids between Desi and Kabuli
lines (such as genotypes 1, 19, and 20), so that they made a group of
mixture with both types. In the study of Upadhyaya et al. (2008) with 2915
genotypes including 1668 Desi and 1167 Kabuli groups, Desi and Kubuli
genotypes are largely separated but include some paraphyletic members.
This probably shows that these two groups have not been completely
isolated and occasional hybridization between the two morphs might have
occurred.
AMOVA also showed significant differentiation between Nod+ and Nod–
genotypes (RST = 0.270, P ≤ 0.01); however, Nod– genotypes are not
monophyletic in either the UPGMA, ME trees or PCoA (Figs. 1a, 1b and 3).
Probably mutations causing non-nodulation had occurred independently in
different genetic backgrounds. Rupela (1992) reported that the frequency of
Nod– plants in 4 Nod+ genotypes ranged from 120 to 490 per million. He also
reported that Nod– selections were indistinguishable from their respective
parents for plant growth except for nodulation, and yielded similarly to their
Nod+ genotypes when supplied with 50 to 100 Kg N/ha, but on a low-N field,
the Nod– plants were light green and grew poorly. Singh et al. (1992)
reported that a new Nod– mutation that occurred in 1 genotype (ICC435) was
inherited in Mendelian recessive manner, but was non-allelic to the formerly
reported mutants, and suggested that there are at least 6 loci controlling
nodulation. This verifies the high mutation rate observed for this character.
104
The high level of variability observed in microsatellite markers makes
them suitable for application in identification of germplasm of local varieties,
cultigens and cultivars (Udupa et al., 1999). Here, we have shown that all,
but 3 pairs (genotypes 5 and 10, genotypes 11 and 14, and genotypes 21
and 26, Figs. 1a and 1b), could be readily distinguished with these
microsatellite markers. Since the number of markers we used was very
limited, using a larger number of markers in even more closely related lines
could certainly improve resolution. Thus, this method is extremely useful for
breeding programs that utilize induced mutation lines and lines of hybrid
origin.
105
SUMMARY
Total of 49 genotypes of Chickpea (Cicer arietinum L) were procured
from various organizations for Genetic and Molecular Analysis of Nodulation.
Two accessions failed to germinate and evaluation was made on 47
genotypes. Out of 47 genotypes, 36 were from Institute for Food and
Agriculture (NIFA), Peshawar, five from Gram Research Station (GRS),
Ahmedwala Karak, and four from International Crops Research Institute for
Semi-Arid Tropics (ICRISAT), India.
Characterization of genotypes for quantitative and qualitative traits,
and inheritance and linkage study of nodulation were carried out at the KPK
Agricultural University Peshawar and NIFA, Peshawar. These genotypes
were also characterized at molecular level, in the Forest Resource Biology
laboratory Ehime University, Matsuyama, Japan.
All genotypes were characterized under field conditions using
Randomized Complete Block Design (RCBD) with three replications for
morphological markers (i.e. anthocyanin pigmentation on stem, flower and
seed coat color) and for quantitative traits (i.e., days to 50% flowering, days
to maturity, leaf area, number of leaflets leaf,-1 plant height, biological yield,
seed yield plant-1and 100 seed weight). The experiment was also conducted
in pots using Complete Randomized Design (CRD) with three replications
with two treatments (with and without rhizobium inoculation), to evaluate
genotypes for nodulation, number of nodules plant-1 and to study the effect of
rhizobium leguminosarum inoculation on nodules plant-1 and seed yield
plant-1.
106
Based on morphological markers, the germplasm was grouped as
desi (pink flower, green with purplish tings stem and colored seed coat) and
kabuli type genotypes (white flower, green stem and white seed coat). The
germplasm showed significant variation and high broad sense heritability for
all quantitative traits. Genotypes from NIFA, and GRS produced nodules
while accessions from ICRISAT did not produce nodules. Two genotypes
NDC 5-S10 and NDC 4-20-4 produced the maximum number of nodules
plant-1 and were selected for inheritance and linage study along with
genotype ICC 19181 (non-nodulated).
Inheritance of nodulation and its linkage with leaf color in chickpea was
thoroughly studied using F1, F2, backcross-I (BC11) and backcross-2 (BC12)
using two cross combinations i.e., ICC 19181(Nod- and dark green leaves) x
NDC 5-S10 (Nod+ and light green leaves) - Hybrid A and ICC 19181 x NDC
4-20-4 (Nod+ and light green leaves) - Hybrid B. The hybrid A showed
dominant monogenic inheritance for nodulation, while hybrid B showed
duplicate gene action nodulation. This clearly shows that the nodulated
genotypes of both crosses have different genetic background for nodule
formation; molecular analysis also placed these genotypes in separate
clusters. Both hybrid A and hybrid B revealed single gene dominant
inheritance for light green leaf color. Linkage was detected between the loci
for nodulation and leaf color in the F2 population of both the crosses.
Nodulation and light green leaf color were dominant over Nod- and dark
green leaf color in F1. In F2 population this segregation was diverted from the
normal ratio of 9:3:3:1, which is an indication of linkage between these two
loci. The recombination values (0.15 and 0.26) shows that the loci of
nodulation and leaf color are residing on the same chromosome in genotype
107
NDC 5-S10 and NDC 4-20-4. In genotype NDC 5-S10 genes of nodulation
and leaf color are at the distance of 15 cM, while In NDC 4-20-4 both genes
of nodulation and gene of leaf color looks like to be on one chromosome one
nodulation gene is at the distance of 15 cM and other at 26 cM from the gene
of leaf color.
Molecular characterization (with 10 SSR markers) revealed high level
of polymorphism in 47 accessions of chickpea. Rreproducible and easily
readable microsatellite patterns were recorded for all the primer pairs. Eight
primers were polymorphic (more than two alleles), whilst two primer pairs
(H1B11 and H6G07) were monomorphic (amplified only one allele). These
two monomorphic loci were not included in the analysis. The number of
alleles locus-1 ranged from 2 (CaSTMS19) to 16 (H3A10), with the average
of 7.4 locus-1. The effective number of alleles (Ne) ranged from 1.29
(CaSTMS25) to 8.06 (H3A10) with an average of 3.66 locus-1. A total of 46
alleles were found for desi, and 42 alleles for kabuli, whilst 30 alleles were
shared by both. The average number of alleles locus-1 were 5.87 in desi
types in which 2.78 were effective on average basis. In kabuli morphs, the
average was 5.25 alleles locus-1in which mean effective number of alleles
was 3.40. The Polymorphic Information Content (PIC) values ranged from
0.227 (CaSTMS25) to 0.876 (H3A10), with an average of 0.636. Among
chickpea accessions, 14 showed segregating loci ranging from 1 to 5 loci
genotype-1 with an average heterozygosity from 0.125 to 0.625. Thus the
overall mean heterozygosity was 0.088.
Genetic relationship among accessions was checked by Unweighted
Pair-Group Method using Arithmetic averages (UPGMA), the Minimum-
Evolution method (ME) and Principal Coordinate Analysis (PCoA). The
108
cluster analysis through these three methods revealed same grouping as
were determined through molecular characterization with negligible
deviations. Branching associations between groups in the UPGMA tree were
very different from that of the ME tree, reflecting ambiguous associations
among the groups. Non-nodulating lines ICC4993, ICC19183, ICC 4918 and
ICC19181 were not closely related in either of the trees. PCoA also revealed
almost same grouping of genotypes as UPGMA and ME analysis. Significant
variations between nodulated (Nod+) and non-nodulated (Nod–) accessions
were also reported in AMOVA (RST = 0.270, P ≤ 0.01); however, Nod–
accessions are not monophyletic in either the UPGMA or ME trees. Thus
non-nodulated genotype ICC 19181 and two nodulated genotypes NDC 5-
S10 and NDC 4-20-4 were selected for hybridization to study the inheritance
of nodulation in chickpea
109
Conclusions
The following conclusions have been drawn from the present investigations
1. Chickpea genotypes showed considerable variability for various
morphological markers, number of nodules plant-1 and quantitative
traits. Most of the traits revealed high heritability estimates.
2. Number of nodules and seed yield plant-1 increased extensively with
rhizobium inoculation.
3. Cluster analysis showed monophyletic as well as paraphylatic groups,
revealing that desi and kabuli genotypes are not separated
completely. Although AMOVA revealed significant differentiation in
their allele frequency constitution.
4. Nodulated and non-nodulated genotypes showed significant
differences; yet non-nodulated genotypes are not monophyletic in
either cluster analysis. Perhaps mutations causing non-nodulation
had occurred independently in different genetic backgrounds.
5. In chickpea nodulation is controlled by a single dominant gene
(monogenic) or two dominant genes (duplicate gene action),
depending on the nature of genotype.
6. Genes responsible for nodulation are located on the same
chromosome and are linked to the gene that controls leaf color in
chickpea.
110
RECOMMENDATIONS
1. Genetic diversity recorded among genotypes could be utilized
effectively for further investigations regarding genetic background of
various traits including nodulation parameters and in crop
improvement programs
2. Hybridization among the two groups (desi and kabuli) of chickpea
could be used successfully for development of the crop in terms of
high production, nitrogen fixation etc
3. Leaf color of chickpea can be used as an indicator marker for
presence/absence of nodules. It can further enhance use of other
morphological markers in construction of more linkage groups in
chickpea.
4. The genotypes used in inheritance study and the results obtained
could be useful in conducting further studies on nodulation in
chickpea.
111
BIBLIOGRAPHY
Achmad, S. 2005. Characterization of hyacinth bean (Lablab purpureus (L.) sweet) seeds from Indonesia and their protein isolate. Food chem. 95 (1): 65-70.
Afsari, S. Q., A. Shoukat, A. Bakhsh, M. Ardhad, and A. Ghafoor. 2004. An assessment of variability traits in chickpea (Cicer arietinum L.). Pak. J. Bot. 36 (4): 779-785.
Akkaya, M. S., A. A. Bhagwat, and P. B. Cregan. 1992. Length Polymorphisms of Simple Sequence Repeat DNA in Soybean. Genetics 132: 1131-1139
Al Khanjari, S., K. Hammer, A. Buerkert, and M. S. Röder. 2007. Molecular diversity of Omani wheat revealed by microsatellites: II. Hexaploid landraces. Gene. Res. Crop Evol. 54 (7): 1407-1417.
Ali, A., M. S. Zia, Rahmatullah, A. Shah, and M.Yasin. 1998. Nodulation in Sesbania bispinosa as affected by nitrogen application. Pak. J. Soil Sci. 15: 183-185.
Arora, P. P., and A. S. Jeena. 2001. Role of variability for improvement in chickpea. Leg. Res. 24 (2): 50-51.
Arshad, M., A. Bakhsh, M. Zubair, and A. Ghafoor. 2003. Genetic variability and correlation studies in chickpea (Cicer arietinum L.). Pak. J. Bot. 35 (4): 605-611
Arshad, M., A. Ghafoor, and S. Q. Afsari. 2005. Inheritance of qualitative trats and their linkage in blackgram (Vigna mungo (L.) Hepper). Pak. J. Bot. 37 (1): 41-45.
Arshad, M., A. S. Qureshi, A. Shaukat, A. Bakhsh, and A. Ghafoor. 2004. An assessment of variability for economically important traits in chickpea (Cicer arietinum l.). Pak. J. Bot. 36 (4): 779-785.
Ashrar, M. Z. 2008. Pulse production in Pakistan current situation. Available at htt://www.ndma.gov.pk.
Atta, B. M., M. A. Haq, and T. M. Shah. 2008. Variation and inter-relationships of quantitative traits in chickpea ((Cicer arietinum L.). Pak. J. Bot. 40 (2): 637-647.
Bakhsh, A., A. Ghafoor, and B. A. Malik.1992. Evaluation of lentil germplasm. Pak. J. Agic. Res. 12 (4): 245-251.
Bakhsh, A., T. Gull, A. Sharif, M. Arshad, and B. A. Malik. 1999. Genetic variability and character correlation in pure lines, F1 and F2 progenies of chickpea (Cicer arietinum L.). Pak. J. Bot. 31 (1): 41-53.
112
Bhapkar, D. G., and R. B. Deshmukh. 1982. Genetics of nodulation in chickpea (Cicer arietinum L.). Genetica 59: 89-92.
Bhatia, C. R., K. Nichterlein, and M. Maluszynski. 2004. Mutations affecting nodulation in grain legumes and their potential in sustainable cropping systems. Euphytica 120 (3): 415-432.
Bhuiyan, M. A. H., D. Khanam, M. F. Hossain, and M. S. Ahmed. 2008. Effect of rhizobium inoculation on nodulation and yield of chickpea in Calcareous soil. Bangladesh J. Agril. Res. 33 (4): 549-554
Bowcock, A. M., A. Ruiz-Linares, J. Tomfohrde, E. Minch, J. R. Kidd, and L. L. Cavalli Sforza. 1994. High resolution of human evolutionary trees with polymorphic microsatellites. Nature 368: 455-457.
Burli, A. V., S. M. More, B. N. Gare, and S. S. Dodake. 2004. Genetic variability and heritability in chickpea under residual soil moisture condition. J. Maharashtra Agric. Uni. 29 (3): 353-354.
Burton, G. W. 1952. Quantitative inheritance in grasses. Proc. 6th Int. Grassland Cong. 1: 277-283.
Cavalli Sforza, L. L. 1994. High resolution of human evolutionary trees with polymorphic microsatellites. Nature. 368: 455-457.
Chowdhry, K. A., K. S. Saraswat, S. N. Hassan, and R. C. Gaur. 1971. 4000-3500 year old barley, rice and pulses from Atranjikhera. Sci. and Cult. 37: 531-532.
Christine, K., M. Sawkins, W. A. Meyer, and B. S. Gaut. 2001. Genetic Diversity in Seven Perennial Ryegrass (Lolium perenne L.) Cultivars Based on SSR Markers. Crop Sci. 41:1565-1572
Christodoulou, V., V. A. Bampidis, B. Hucko, K. Ploumi, C. Iliadis, P. H. Robinson, and Mudrik Z. 2005. Nutritional value of chickpeas in relations of lactating ewes and growing lambs. Anim. Feed Sci. Technol. 118: 229-241.
Clayton, G., W. A. Rice, N. Z. Lupwayi, A. M. Johnston, G. P. Lafond, C. A. Grant, and F. Walley. 2003. Inoculant formulation and fertilizer nitrogen effects on field pea: Crop yield and seed quality. Can. J. Plant. Sci. 84: 89-96.
Cleyet-Marel, J. C., R. D. Bontto, and D. P. Beck. 1990. Chickpea and its root-nodule bacteria: implications of their relationships for legume inoculation and biological nitrogen fixation. Option Mediterranean’s series seminar: 101-106
Coburn, J. R., S. V. Temnykh, E. M. Paul, and S. R. McCouch .2002. Design and Application of Microsatellite Marker Panels for Semiautomated Genotyping of Rice (Oryza sativa L.) Crop Sci. 42: 2092-2099.
113
Corbin, E. J., J. Brockwell, and R.R. Gault. 1977. Nodulation studies on chickpea (Cicer arietinum L). Australian J. Exp. Agri. and Animal Husbandry 17(84): 126 - 134
Corby, R. 1981. Seeds of Leguminosae. Advances In legumes systemics. Part 2 (Polhill, R.M., and Raven, P.H., eds.). Kew, UK: Royal Botanic Gardens: 913-915
Cubero, J. I. 1987. Morphology of chickpea. p. 35-66. In: M.C. Saxena and K.B. Singh (eds.). The chickpea. CAB. International, Wallingford, Oxon, UK.
Cubero, J. I. 1975. The research on chickpea (Cicer arietinum) in Spain. Pages 117-122 in Proceedings of the International Workshop on Grain Legumes, 13-16 Jan 1975, ICRISAT, Hyderabad, India: International Crops Research Institute for the Semi-Arid Tropics.
Danehloueipour, N., H. J. Clarke, G. Yan, T. N. Khan, and K. H. M. Siddique. 2008. Leaf type is not associated with ascochyta blight disease in chickpea ( Cicer arietinum L.). Euphytica 162 (2): 281-289.
Dasgupta, T., M. O. Islam, P. Gayen, and K. K. Sarkak, 1987. Genetic divergence in chickpea(Cicer arietinum L.). Exp. Genet. 3: 15-21.
Davis, T. M. 1991. Linkage relationships of genes for leaf morphology, flower color, and root nodulation in chickpea. Euphytica 54 (1): 117-123.
Davis, T. M., K. W. Foster, and D. A. Phillips. 1985. Nodulation mutant in chickpea. Crop Sci. 25: 345-348.
Davis, T. M., K. W. Foster, and D. A. Phillips. 1986. Inheritance and expression of three genes controlling root nodule formation in chickpea. Crop Sci. 26: 719-723.
Derya, Z. Y., and A. Emin. 2006. Genetic variability, correlation and path analysis of yield, and yield components in chickpea (Cicer arietinum L.) Turk J. Agric. 30 (1): 183-188.
Devine, T. E.1984. Inheritance of soybean nodulation response with a fast-growing strain of Rhizobium. Heredity 75 (5): 359-361
Devis, T. M. 1988. Two genes that confer ineffective nodulation in chickpea (Cicer arietinum L.). J. heredity 79 (6): 476-478.
Doyle, J. J., and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19:11-15.
Doyle, J. J., and J. L. Doyle. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15.
114
Duke, J. A. 1981. Handbook of legumes of world economic importance. 2nd
Ed. Plenum Press New York: 52-57.
Durga, K. K., S. S. N. Muthy, Y. K. Rao, and M. V. Reddy. 2007. Genetic studies on yield and yield components of chickpea. Indian J. Agric. 27 (3):61-79.
Duschak, M. 1871. Zur Botanik des Talmud. I. Neuer, Pest: 105-106
Dutta, M., and L. J. Reddy. 1988. Further Studies on Genetics of Nonnodulation in Peanut. Crop Sci. 28:60-62
Edwards, K. J., and R. Mogg. 2001. Plant genotyping by analysis of single nucleotide polymorphisms. In: Henry RJ (ed) Plant Genotyping: The DNA Fingerprinting of Plants. CABI Publishing, Wallingford, UK.
Farshadfar, M., and E. Farshadfar. 2008. Genetic Variability and Path Analysis of Chickpea (Cicer arientinum L.) Landraces and Lines. J. Appl. Sci. 8 (21):3951-3956
FAO. 2004. Food and Agriculture Organization of the United Nations, (FAOSTAT). FAO Statistical Databases. Available at http://faostat.fao.org/ default.aspx.
Gallani, R., J. M. Dighe, R. A Sharma, and P. K Sharma. 2005. Relative performance of different chickpea (Cicer arietinum L.) genotypes grown on vertisols. J. Res. Crops. 6(2):211-213.
Gallo-Meagher, M., K. E. Dashiell, and D. W. Gorbet .2001. Parental Effects in the Inheritance of Nonnodulation in Peanut. J. Heredity 92 (1): 86-89
Gaur, P. M., and V. K. Gour. 2003. Broad-few-leaflets and outwardly curved wings: & nbsp; two new mutants of chickpea. Plant Breed. 122: 192-194.
Gaur, Y. D., and A. N. Sen. 1979. Cross inoculation group specificity in cicer-rhizobium symbiosis. New Phytologist 83:745-754
Geervani, P., 1991. Utilization of chickpea in India and scope for novel and alternative uses. p. 47-54. In: Uses of Tropical Grain Legumes: Proceedings of Consultants' Meeting, 27-30 March 1989. ICRISAT Center, Patancheru, Andhra Pradesh, India.
Ghafoor, A., A. S. Qureshi, and M. Zahoor. 1999. Crossing techniques in black gram (Vigna mungo ). Pak. J. Arid Agric. 2 (1):25-31.
Ghafoor, A., M. Arshad, and A. Bakhsh. 2004. Path coefficient analysis in chickpea (Cicer arietinum L.) under rainfed conditions. Pak. J. Bot. 36 (1):75-81.
Gorel, F.L., and V. A. Berdnikov. 1993. Linkage of loci encoding H1 histone and a cotyledon protein in lentil. Heredity 93 (1):342-346
115
Gupta, P. K., and R. K. Varshney. 2000. The development and use of microsatellite markers for genetic analysis and plant breeding with emphasis on bred wheat. Euphytica 113:163-185.
Gwata, E. T., D. S. Wofford, K. J. Boote, and P. L. Pfahle. 2005. Inheritance of promiscous nodulation in soybean. Crop Sci. 45:635-638
Hakim, K., S. Q. Ahmad, F. Ahmad, M. S. Khan, and N. Iqbal. 2006. Genetic variability and correlation among quantitative traits in gram. Sarhad J. Agric. 22 (1):55-59.
Hakoomat, A., M. A. Khan and S. A. Randhawa. 2004. Interactive effect of seed inoculation and phosphorus application on growth and yield of chickpea ( Cicer arietinum L.). Int. J. Agri. Biol., 6 (1):110-112.
Hamanda, H., and T. Kakunaga. 1982: Potential Z-DNA forming sequences are highly dispersed in the human genome. Nature 298:396-398.
Hanson, C. H., H. F. Robinson, and R. E. Comstock. 1956. Biometrical studies of yield in segregating populations of Korean lespedeza. Agron. J. 48 (6):268-272.
Hartl, D.L., and A.G. Clark. 1997. Principles of population genetics. 3rd edition. Sunderland (MA): Sinauer Associates.
Hawtin, G. C., and k. B. Singh (1981) Prospects and potential of winter sowing of chickpeas in Mediterranean region. In: Saxena MC, Singh KB (eds) Proceedings of Workshop on Ascochyta Blight and Winter Sowing of Chickpeas (International Center for Agricultural Research in the Dry Areas), Aleppo, Syria, May 1981. Martinus Nijhoff/Dr. W. Junk Publishers, The Hague, Netherland.
Helbaek, H. 1959. Domestication of food plants in the old world: Joint efforts by botanists and archeologists illuminate the obscure history of plant domestication. Science 130:365–372.
Hulse, J. H. 1991. Composition and utilization of grain legumes. In: Uses of tropical Legumes: Proceedings of a Consultants' Meeting, 27-30 March 1989, ICRISAT Center, India. Nature 11-27.
Hungría, M., and M. C. P. Neves, 1987. Partitioning of nitrogen from biological fixation and fertilizer in Phaseolus vulgaris. Physiol. Plant 69:55–63.
Hussain, A. 1983. Isolation and identification of effective root nodule bacteria for important grain legumes of Pakistan. Project report. Department of Soil Science, University of Agriculture, Faisalabad. P-73.
Hüttel, B., P. Winter, K. Weising, W. Choumane, F. Weigand, and G. Kahl. 1999. Sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.). Genome 42:210–217.
116
Hynes, R. K., K. A. Craig, D. Covert, R. S. Smith, and R. J. Rennie. 1995. Liquid rhizobial inoculants for lentil and field pea. J. Prod. Agric. 8:547-552.
ICRISAT. 1987. Agronomic practices to optimize yield of chickpea (Bengal gram) in peninsular India. Legumes program, ICRISAT Center, India. Patancheru, A.P. 502 324, India.
Imtiaz, M., M. Materne, K. Hobson, M. van Ginkel, and R. S. Malhotra . 2008. Molecular genetic diversity and linked resistance to ascochyta blight in Australian chickpea breeding materials and their wild relatives. Aust. J. Agri. Res. 59 (6):554–560.
Imtiaz, M., M. Materne, K. Hobson, M. van Ginkel, and R. S. Malhotra. 2008. Molecular genetic diversity and linked resistance to ascochyta blight in Australian chickpea breeding materials and their wild relatives. Aust. J Agric. Res. 59:554–560.
Imtiaz, A. K., S. Imtiaz, and B. A. Malik. 1990. Selection of diverse parents of chickpea (Cicer arietinum L.) by multivariate analysis and the degree of heterosis of their F1 hybrids. Euphytica 51(3):227-233
Iqbal, A., I. A. Khalil, N. Ateeq and M. S. Khan. 2006. Nutritional quality of important food legumes. Food Chem. 97:331-335.
Iqbal, J., M. Saleem, A. Khan and M. Anwar. 1994. Genetic variability and correlation studies in chickpea. J. of Animal & Pl. Sci. 4 (2):35-36.
James,T. M., H. D. Frank, and S. Terry. 1997. Statistics. 7th ed. pp. 429-43. Prentice-Hall International Inc. Co. New Jersey
Jeena, A. S., P. P. Arora, and O. P. Ojha. 2005. Variability and correlation studies for yield and its components in chickpea. Legume Res. 28 (2):146-148.
Jefing, Y., D. F. Herridge, M. B. Peoples and B. Rerkasem. 1992. Effects of N fertilization on N2 fixation and N balance of soybean grain after lowland rice. Plant and Soil 147:235-24
Johansen, C., B. Baldev, J. B. Brouwer, W. Erskine, W. A. Jermyn, L. Li-Juan, B. A. Malik, A. A. Miah, and S. N. Silim. 1994. Biotic and abiotic stresses constraining productivity of cool season food legumes in Asia, Africa and Oceania. p. 175-194. In: F.J. Muehlbauer and W.J. Kaiser (eds.). Expanding the production and use of cool season food legumes. Kluwer Academic Publishers. Dordrecht, The Netherlands.
Kaiser, W. J. 1992. Epidemiology of Ascochyta rabiei. In: K.B. Singh and M.C. Saxena (eds.). Disease resistance breeding in chickpea. ICARDA, Aleppo, Syria: 117-134
117
Kaish., and D. G. King. 2006. Simple sequence repeats as advantageous mutators in evolution. Trends Genet. 22 (5):253-9.
Kazan, K., F. J. Muehlbauer, N. F. Weeden, and Ladizinsky. 1993. Inheritance and linkage relationships of morphological and isozyme loci in chickpea (Cicer arietinum L). Theor. Appl. Genet. 86:417-126
Khattak, S., D. F. Khan, S. H. Shah, M. S. Madani and T. Khan. 2006. Role of Rhizobial inoculation in the production of chickpea crop. Soil & Environ. 25(2): 143-145.
Ladizinsky, G. 1975. A new Cicer from Turkey. Notes from the Royal Botanic Gardens, Edinburgh 34:201-202
Ladyzinsky, G., and A. Alder. 1976. The origin of chickpea (Cicer arietinum L). Euphytica 25:211-217.
Levinsen, G., and G. A. Gutman. 1987: Slipped-strand mispairing: a major mechanism for DNA evolution. Mol. Biol. Evol. 4:203-221.
Lichtenzveig, J., C. Scheuring, J. Dodge, S. Abbo, and H. B. Zhan. 2005. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea (Cicer arietinum L). Theor Appl Genet. 110:492–510.
Litt, M., and J. A. Luty. 1989: A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle action gene. Am. J. Hum. Genet. 44:397- 401
Malhotra, R. S., R. P. S. Pundir, and A. E. Slinkard. 1987. Genetic resources of chickpea. In: M.C. Saxena and K.B. Singh (ed.), The Chickpea. C.A.B. International Cambrian News Ltd, Aberystwyth, UK: 67-81.
Mauro, P., J. Kipe-Nolt, L. Frustiante, and L. Monti. 1993. Common bean (Phaseolus vulgaris L.) mutants defective in root nodule formation II genetic analysis. J. of exp. Bot. 44 (6):1007-1014.
Mayer, M., A. Gland, S. Ceccarelli, and H. H. Geiger. 1995. Comparison of doubled haploid lines and F2 bulks for the improvement of barley in the dry areas of North Syria. Plant Breed. 114:45-49.
McKenzie, B. A., M. Andrews, A. Z. Ayalsc, and J. R. Stokes. 1992. Leaf growth and canopy development in chickpea. Proc. Annual Conference. Agronomy Society of New Zealand 22:121-125.
Mensah, J. K., and R. T. Olukoya. 2007. Performance of mungbean (vigna mungo l. hepper) grown in mid-west Nigeria. American-eurasian J. Agric. & Env. Sci. 2 (6):696-701.
Métais, B. Hamon, R. Jalouzot & D. Peltier. 2004. Structure and level of genetic diversity in various bean types evidenced with microsatellite
118
markers isolated from a genomic enriched library. Theo. & Appl. Gen. 104 (8):1346-1352
Methews, A., B. J. Caroll, and P. M.Gresshoff. 1989. A new nonnodulation gene in Soybean. Heredity 80 (5):357-360.
MINFAL, 2007-2008. Agricultural statistics of Pakistan. Ministry of food, agriculture and livestock. Economic wing, Islamabad.
Moreno, M, T., and J. I. Cubero. 1978. Variation in Cicer arietinum L. Euphytica 27:465–485.
Moreno, M. T. 1985. Variabilidad intraespesifica in Cicer arietinum L. Unpublished thesis doctoral, University of Cordoba, Spain.
Muehlbauer, F. J., and K. B. Singh. 1987. Genetics of chickpea. In: M.C. Saxena and K.B. Singh (eds.), The Chickpea. CAB. International, Wallingford, Oxon, OX10 8DE, UK:99-125.
Muehlbauer, F. J., R.W. Short, and W. J. Kaiser. 1982. Description and culture of garbanzo beans. Coop. Ext. Publ. EB 1112, Washington State Univ., Pullman.
Muhamad, F., A. Malik, M. Ashraf, A. S. Qureshi, and A. Ghafoor. 2007. Assessment of genetic variability, correlation and path analysis for yield and its components in Soybean. Pak. J. Bot. 39 (2):405-413
Naghavi, M, R., and M. R. Jahansouz. 2005. Variation in the agronomic and morphological traits of Iranian chickpea genotypes. J. Integrative Plt. Bio. 47: 375-379.
Narvel, J. M., W. R. Fehr, W. C. Chu, D. Grant, and R. C. Shoemaker. 2000. Simple sequence repeats diversity among soybean plant introductions and elite genotypes. Crop Sci 40:1452–1458.
Nawab, N. B. 2002. Estimation of variability parameters and correlations for quantitative traits in Cicer arietinum L. Sarhad J. Agric. 27 (1):30-99.
Nguyen, T., T. Taylor, P.W.J, Redden, and R. J, Ford. 2008. Genetic diversity estimates in Cicer using AFLP analysis. Plt. Breed. 123:173-179.
Nigam, S. N., P. T. C. Nambiar, S. L. Dwivedi, R. W. Gibbons, and P. J. Dart. 1982. Genetics of nonnodulation in groundnut (Arachis hypogaea L.). Studies with single and mixed Rhizobium strains. Euphytica 31 (3):691-693.
Noor, F., M. Arshad, and A. Ghafoor. 2003. Path analysis and relationship among quantitative traits in chickpea (Cicer arietinum L). Pak. J. of Bio. Science. 6 (6):551-555.
119
Nutman, P. S. 1981. Hereditary factors affecting nodulation and nitrogen fixation. In A.H. Gibson and W. E. Newton (ed) Current perspective in nitrogen fixation. Aust. Acad. Sci., Canberra 194-204.
Oldroyd, G., and J. A. Downie. 2004. Calcium, kinases and nodulation signaling in legumes. Nat. Rev. Mol. Cell Biol. 5:566–576.
Otieno, P. E., J. W. Muthomi, G. N. Chemning’wa, and J. H. Nderitu. 2009. Rhizobia inoculation, Farm yard manure and nitrogen fertilizer on nodulation and yield of food grain legumes. J. Bio. Sci.: 9 (4):326-332.
Parmar, N., and K.R. Dadarwal. 1999. Stimulation of nitrogen fixation and induction of flavonoid-like compounds by rhizobacteria. J. Appl. Microb. 86:36-44.
Peakall, R., and R. E. Smouse. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295.
Peterson, M. A., and D. K. Barnes. 1981. Inheritance of Ineffective Nodulation and Non-nodulation Traits in Alfalfa. Crop Sci. 21:611-616
Powell, W., M. Morgante, C. Andre, M. Hanafey, J. Vogel, S. Tingey, and A. Rafalski. 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 2:225-238.
Pundir, R. P. S., and G. V. Reddy. 1998. Two new traits - open flower and small leaf in chickpea (Cicer arietinum L.). Euphytica 102 (3):357-361.
Rajesh, P. N., V. J. Sant, V. S. Gupta, F. J. Muehlbauer, and P. K. Ranjekar. 2002. Genetic relationships among annual and perennial wild species of Cicer using inter simple sequence repeat (ISSR) polymorphism. Euphytica 129:15–23.
Rathnaparkh, M. B., D. K. Santra, A. Tullu, and F. J. Muehlbauer. 1996. Inheritance of inter-simple sequence-repeat polymorphism’s and linkage with the fusarium wilt resistance in chickpea. Theor. Appl. Genet. 96:348-353.
Raza, S. M., and S. S. Mehdi. 1992. Genetic variations of yield and yield components of chickpea (Cicer arietinum L.) grown in two diverse environments. Pak. Agric. Sci. 2 (1):47-48.
Rent, R. S., and O. O. Kohire. 1991. Phosphorus response in chickpea (Cicer arietinum L) with rhizobium inoculation. Legume Res.14:78-82.
120
Richard, J. D., and L. Henery. 1967. In: Crop production (3rd Ed). Prentice Hall Inc. Eagle Wood Cliffs., N.J.:392.
Rodríguez-Navarro, D. N., C. Santamaríaa, F. Tempranoa, and E. O. Leidib. 1999. Interaction effects between Rhizobium strain and bean cultivar on nodulation, plant growth, biomass partitioning and xylem sap composition. Eur. J. Agron. 11 (2):131-143.
Romdhane, S. B., M. E. Aouani , M. Trabelsi , P. de Lajudie, and R. Mhamdi. 2008. Selection of High Nitrogen-Fixing Rhizobia Nodulating Chickpea (Cicer arietinum) for Semi-Arid Tunisia. J. Agron. & Crop Sci. 194 (6):413 – 420
Romdhane, S. B., F. Tajini, M. Trabelsi, M. E. Aouani, and R. Mhamdi. 2007. Competition for nodule formation between introduced strains of Mesorhizobium cicer and the native populations of rhizobia nodulating chickpea (Cicer arietinum L.) in Tunsia. World J. Microb. Biotech. 23:1195-1201.
Rupela, O. P. 1992. Natural Occurance and Salient Characters of Nonnodulating Chickpea Plants. Crop Sci. 32:349-352
Rupela, O. P., and P. J. Dart. 1979. Research on symbiotic nitrogen fixation by chickpea at ICRISAT. In: Proc. International Workshop on chickpea Improvement, Feb. 8 to March 2, Hyderabad, India 162-167.
Rupela, O.P., and M. R. Sudarshana. 1986. Identification of a non-nodulating spontaneous mutant chickpea. Int. chickpea Newsl. 15:13-14.
Sabaghpour, S. H., J. Kumar, and T. N. Rao. 2003. Inheritance of growth vigor and its association with other characters in chickpea. Plt. Breed. 122: 542-544.
Sabhyata. 2008. Development and utilization of DNA-based molecular markers in chickpea. Available at http://www.nipgr.res. In/ research1/Dr_S_Bhatia.htm
Sable, N. H., M. N. Narkhede, M. M. Wakode, and G. K. Lande.2003. Genetic parameters and selection indices in chickpea. Indian J. of Pulses Res. 16 (1):10-11.
Saiki, R. K., S. Scharf, F. A. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim. 1985. Enzymatic amplification of f1-globin sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354.
Salam, M. A., and R. K. Downey. 1978. Inheritance of the morphological and quality characteristics in the progeny of interspecific cross between Brassica napus and B. campestris. Bangladesh J. Sci. Ind. Res. 13:23-28.
121
Saleem, M., M. Arshad, and M. Ahsan. 2008. Genetic variability and interrelationship for grain yield and its various components in chickpea (Cicer arietinum l.). J. Agric. Res. 46 (2):109-116.
Sampson, D.R. 1978. A second gene for gairs in B. olerracea and its tentative locantion in linkage group 4. Can. J. Genet. Cytol. 20:101-109.
Sampson, R. D. 1966. Linkage of genetic male sterility with a seedling markers and its used in producing F1 hybrid seed of B. oleracea (Cabbage, Broccoli, Kali, etc.). Can . J. Plant. Sci. 46:703.
Saraladevi, M., S. Kanagarajan, and S. Ponnusamy. 2008. Efficiency of RAPD and ISSR markerssystem in accessing genetic variation of rice bean (Vigna umbellata) landraces. Elec.J. Biotech. 11(3):1-10.
Sarker, A., W. Erskine, B. Sharma, and M. C. Tyagi. 1999. Days to flowering an d morphological loci in Lentil (Lens culnaris medikus subsp. Culnaris). The Am. Genet. Soc. 90:270-275.
Savithri, R. 1976. Studies in Archaeobotany together with in bearing upon socio-economy and environment of India protohistoric cultures. Ph.D. Thesis, University of Lucknao, India.
Saxena, N. P., M. C. Saxena, C. Johansen, S. M Virmani, and H. Harris. 1996. Future research priorities for chickpea in WANA and SAT. In: Saxena, N.P., Saxena, M.C., Johansen, C., Virmani, S.M., Harris, H. (Eds.), Adaptation of Chickpea in the West Asia and North Africa Region. ICARDA, Aleppo, Syria: 257–263.
Schwenke, G.. D., M. B. Peoples, G.. L. Turner, and D. F. Herridge. 1998. Does nitrogen fixation of commercial, dryland chickea and faba beancrops in North-west New South Wales maintain or enhance soil nitrogen. Australian J. Exp. Agric. 38:61-70.
Serret, M. D., S. M. Udupa, F. Weigand. 1997. Assessment of genetic diversity of cultivated chickpea using microsatellite-derived RFLP markers: implications for origin. Plt. Breed. 116:573–578
Shah, G. S. 1999. Assessment of Genetic Variation, and heritability of yield components in Mungbean (Vigna radiata (L.) Wilczek),and Mode of Inheritance of Resistance to mymv in this crop. Thesis, submitted to the Institute of Pure and Applied Biology, Bahauddin Zakariya University, Multan, Pakistan.
Shah, S. H., D. F. Khan, and M. S. Madani. 1994. Effect of different Rhizobial strains on the performance of two chickpea cultivars under field conditions. Sarhad J. Agri. 10 (1):103-107.
Shahzad, K., M. Saleem, M. Javid, and A. R. Shehzad. (2002). Heritability estimates. for grain yield and quality characters in chickpea (Cicer arietinum). Int. J. Agric. and Bio. 4 (2):275-276.
122
Shamim, M., and N. Ali. 1987. Effect of seed inoculation with Rhizobium and NP fertilizer levels on the yield of gram. Pak. J. Agr. Res. 8 (4):383-386.
Sharma, L. C., S. Saxena, R. K. Jain, J. Prasad, and B. N. Reddy. 1983. Survey of nodulation in gram in Rajastan. Int. chickpea. Newsl. 9:24-25.
Sharma, M. K., P. P. Arora, and A. S. Jecna. 2004. Variability, heritability and genetic advance in chickpea. Agric. & bio. Res. 20 (2):160-181.
Sharma, P. C., P. Winter, T. Bünger, B. Hüttel, F. Weigand, K. Weising, and G. Kahl. 1995. Abundance and polymorphism of di-, tri- and tetra-nucleotide tandem repeats in chickpea (Cicer arietinum L.). Theor. Appl. Genet. 90:90–96.
Shaukat A., A. Baksh, M. Wahid, A. Rashid, and M. A. Zahid. 2003. Evaluation of chickpea germplasm for semi arid zones of Balochistan. 36 (2):113–116.
Singh, D. P., and B. B. singh. 1992. Inheritance of morphological characters in chickpea (Cicer arietinum L.). Indian. J. Genet. 52 (1):55-57.
Singh, K. B., 1997. Chickpea (Cicer arietinum L.). Field crop Res. 53:161-170.
Singh, K.B. 1987. Chickpea breeding. In: Saxena MC, Singh KB (eds) The Chickpea. CAB International, Willingford, UK.
Singh, O., and O.P. Rupela. 1998. A new gene that controls root nodulation in chickpea. Crop Sci. 38:360-362.
Singh, O., H. A. Van Rheenen, and O. P. rupela. 1992. Inheritance of a new nonnodulation gene in chickpea. Crop Sci. 32:41-43.
Singh, R. K., and B. D. Chaudhry. 1979. Biometrical methods in quantitative genetic analysis. 2nd Ed. Kalyani Pub. Ludhiana and New Delhi India: 303.
Singh, R., P. Sharma, R. K. Varshney, S. K. Sharma, and N. K. Singh. 2008. Chickpea Improvement role of wild species and genetic markers. Biotech. Genet. Eng. Rev. 25:267-314.
Slatkin, M. 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:453-462.
Smith, S. E., K. B. Sing, and R. S. Malhotra.1991. Morphological and agronomic variation in North Africa and Arabian alfalfa. Crop Sci., 31:1150-1163.
Smithson, J. B., J. A. Thompson, and R. J. Summerfield. 1985. Chickpea (Cicer arietinum L.). In: R.J. Summerfield and E.H. Roberts (eds.). Grain legume crops. Collins, London, UK: 312-390.
123
Smouse, P. E., R. Peakall. 1999. Spatial autocorrelation analysis of individual multiallele and multilocus genetic structure. Heredity 82:561–573.
Sneath, P., and R. Sokal. 1973. Numerical Taxonomy. W. H. Freeman, San Francisco: 887.
Stallknecht, G., K. M. Gilberston, G. R. Carlson, J. L. Eckhoff, G. D. Kushnak, J. R. Sims, M. P. Wescott, and D. M. Wichman. 1995. Production of chickpeas in Montana. Montana Agr. Res. 12:46–50.
Stanton, M. A., J. M. Steward, H. E. Percival, and J. F. Wendel. 1994. Morphological diversity and relationships in the A-genome cotton,Gossypium arborum and Gossypium herbaceum. Crop Sci. 34:519-527
Steel, R. G. D., J. H. Torrie, and D. A. Dickey. 1980. Principles and Procedures of Statistics: A Biometrical Approach. McGraw-Hill, New York. Taylor, C.B. 1997. Comprehending cosuppression. Plant Cell. 9:1245–1249.
Stephen, K. B., E. A. Slinkard, and L. F. Walley. 2002. Evaluation of Rhizobial Inoculation Methods for Chickpea. Agron. J. 94:851-859.
Struss, D., and J. Plieske. 1998. The use of microsatellite markers for detection of genetic diversity in barley populations. Theo. & Appl. Gene. 19 (1-2):308-315
Suiter, K. A., J. F. Wendel, and J. Stephens. 1983. LIKAGE-1: a PASCAL compute program for the detection and analysis of genetic link age. Heredity 74:203-204
Tamura, K., J. Dudley, M. Nei, and S, Kumar. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596–1599
Tar’an. , T. Warkentin, A. Tullu, and A. Vandenberg.2007. Genetic relationships among Chickpea (Cicer arietinum L.) genotypes based on the SSRs at the quantitative trait Loci for resistance to Ascochyta Blight. Eur. J. Plt. Path. 119 (1):39-51
Tautz, D., M. Trick, and G. Dover. 1986: Cryptic simplicity in DNA is a major source of genetic variation. Nature 322:652-653.
Tekeoglu, M., D. Santra, V. J. Sant, P. N. Rajesh, G. Kahl, and F. J. Muehlbauer. 2000. A linkage map of the chickpea (Cicer arietinum L.) genome based on recombinant inbred lines from a C arietinum x C. reiculantum cross; localization of resistance genes for fusarium wilt races 4 and 5. Theo. Appl. Genet. 101:1155-63.
124
Tellawi, A., N. Haddad, and B. Hattar. 2007. Effect of several Rhizobium strains on nodulation, nitrogen uptake and yield of chickpeas (Cicer arietinum L.). J. plt. Nut. & Soil Sci. 149 (3):314-322
Thies, J. E., P. W. Singleton, and B. B. Bohlool. 1991. Influence of the size of indigenous rhizobial population on establishment and symbiotic performance of introduced rhizobia on field grown legumes. Appl. Environ. Microbiol. 57:19-28
Thomas, E. D., G. Reid, G. Palmer, and R. I. Buzzell. 1983. Analysis of genetic linkage in the soybean. J. Heridity 74 (6):457-460.
Thomas, M., K. Devis, W. Foster, and D. A. Phillips. 1985. Nodulation mutants in chickpea. Crop sci. 25:345-348.
Thomas, M., K. Devis, W. Foster, and D.A.Phillips.1986.Inheritance and Expression of three genes controlling root nodule formation in chickpea. Crop Sci. 26:719-723.
Tufenkci, S., M. Erman, and F. Sonmez. 2006. Effect of nitrogen application and rhizobium inoculation on the yield and nutrient uptake in lucerne (Medicago sativa). New Zealand J. of Agri. Res. 49 (1):101-105
Udupa, S. M., and M. Baum. 2003. Genetic dissection of pathotypespecific resistance to ascochyta blight disease in chickpea (Cicer arietinum L.) using microsatellite markers. Theor. Appl. Genet. 106:1196–1202
Udupa, S. M., and M. Baum. 2001. High mutation rate and mutational bias at (TAA)n microsatellite loci of chickpea (Cicer arietinum L.). Mol. Genet. Genomics 265:1097–1103.
Udupa, S. M., L. D. Robertson, F. Weigand, M. Baum, and G. Kahl .1999. Allelic variation at (TAA)n microsatellite loci in a world collection of chickpea (Cicer arietinum L.) germplasm. Mol. Gen. Genet. Mar. 261 (2):354-63
Upadhyaya H. D., O. Rodomiro, B. Paula J, and S. Sube. 2002. Phenotypic diversity for morphological and agronomic characteristics in chickpea core collection. Euphytica 123: 333-342.
Upadhyaya, H. D., J. B. Smithson, M. P. Haware, and J. Kumar. 1983. Resistance to wilt in chickpea. II. Further evidence for two genes for resistance to race 1. Euphytica 32: 749-754.
Upadhyaya, H. D., P. M. Gaur, C. L. L. Gowda, S. Chandra, S. M. Udupa, B. J. Furman, and M. Baum. 2003. Completing genotyping of composite set of chickpea, available at www.icarda.org/generationcp/cp-1-chickpea.htm.
Upadhyaya, H. D., S. L. Dwivedi, M. Baum, R. K. Varshney, S. M. Udupa, C. L. L. Gowda, D. A. Hoisington, and S. Singh. 2008. Genetic structure,
125
diversity, and allelic richness in composite collection and reference set in chickpea (Cicer arietinum L.). BMC Plt. Biol. 8:106-117
Upadhyaya, H. D. 2003. Geographical patterns of variation for morphological and agronomic characteristics in the chickpea germplasm collection. Euphytica 132 (3):343-352
Van der Maesen, L. J. G. 1987. Origin, history and taxonomy of chickpea. In: M. C. Sexena and K. B. Singh (eds.). The chickpea. CAB. International Cambrian News Ltd, Aberystwyth, UK: 11-34.
Van der Measen, L. J. G. 1972. Cicer L. A monograph on the genus with special reference to the chickpea (Cicer arietinum L.), its ecology and cultivation. PhD diss. Agricultural University Wageningen, Wageningen, Netherlands.
Videira, L. B., G. N. Pastorine, and P. A. Balatto. 2001. Incompatibility may not be the rule in sinorhizobium fredii-soygean interaction. Soil Bio. & biochem. 33:837-840
Virmani, S. S., K. B. Singh, K. Singh, and R. S. Malhotra. 1983. Evaluation of mungbean germplasm. Indian j. Genet. 43:54-58.
Wang, L, Guan R, Liu Z, Chang R, Qiu L (2006) Genetic diversity of Chinese cultivated soybean revealed by SSR markers. Crop Sci 46:1032–1038.
Weber, J., and P. E. May. 1989. Abundant class of human DNA polymorphism, which can be typed using the polymerase chain reaction. Am. J. Genet. 44:388-396.
Weir, B. 1996. Genetic Data Analysis II. Sinauer Associates, Sunderland, MA.
Wikipedia. 2010. Rhizobia. Available at http://en.wikipedia. org/ wiki/Rhizobia
Williams, P. C., R. S. Bhatty, S. S. Deshpande, L. A. Hussein, and G. P. Savage. 1994. Improving nutritional quality of cool season food legumes. p. 113-129. In: F.J. Muehlbauer and W.J. Kaiser (eds.), Expanding the Production and Use of Cool Season Food Legumes. Kluwer Academic Publishers, Dordrecht, the Netherlands.
Wills, A. B., and P. Smith. 1972 Genetics of B. oleracea. Ann. Rep., Scottish Hortic. Res. Inst., 41-42.
Wills, A. B., and P. Smith. 1973. Genetics and cytology of B.oleracea. Ann. Rep., Scottish Hortic. Res. Inst., 43-44.
Wills, A. B., and P. Smith. 1974. Brassicas: genetics and cytology of B.oleracea. Ann. Rep., Scottish Hortic. Res. Inst., 46-47
Winter, P. 1999. Development and use of molecular markers for chickpea improvement. In: Udupa SM, Weigand F (eds) DNA markers and
126
breeding for resistance to ascochyta blight in chickpea. Proc Symposium on “Application of DNA finger printing for crop improvement: marker assisted selection of chickpea for sustainable agriculture in the dry area”, ICARDA, Aleppo, Syria: 153-174.
Winter, P., T. Pfaff, S. M. Udupa, B. Hüttel, P. C. Sharma, S. Sahi, R. A. Espinoza, F. Weigand, F. J. Muehlbauer, and G.Kahl. 1999. Characterization and mapping of sequence tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol. Gen. Genet. 262:90–101.
Winter, P., A. M. Banko-Iseppon, B. Huttel, M. Ratnaparkh, A. Tullu, G. Sonnante, T. Pfaff, M. Tekeoglu, D.K. Santra, V.J. Sant, P.N. Rajesh, G. Kahl, and F.J. Muehlbauer. 2000. A linkage map of chickpea (Cicer arietinum L.) genome based on recombinant inbred lines from a C. arietinum x C reticulatum cross:localization of resistance gene for fusarium wilt races 4 and 5. Theor Appl Genet. 101:1155-1163.
Winter, P., T. Pfaff, S. M. Udupa, B. Huettel, P. C. Sharma, S. Sahi, R. Arreguin-Espinoza, F. Weigand, F.J. Muehlbauer, and G. Kahl. 1999. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol. Gen. Genet. 262:90–101
Yadav, S. S., J. Kumar, N. C. Turner, J. Berger, R. Redden, D. McNeil, M. Materne, E. J. Knights, and P. N. Bahl. 2004. Breeding for improved productivity, multiple resistance and wide adaptation in chickpea (Cicer arietinum L.). Plt. Genetic Res. 2:81-187.
Yates, F. (1934). Contingency table involving small numbers and the χ2 test. Supplement to the Journal of the Royal Statistical Society, 1(2):217-235
Yiwu, C., and R. L. Nelson. 2005. Relationship between Origin and Genetic Diversity in Chinese Soybean Germplasm. Crop Sci 45:1645-1652.
Zenglu, L., and R. L. Nelson. 2002. RAPD marker diversity among Cultivated and Wild Soybean Genotypes from Four Chinese Provinces. Crop Sci. 42:1737-1744.
127
APPENDICES
ANALYSIS OF VARIANCE TABLES
Table A1: Days to 50% flowering
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Replication 2 50.90 25.45 5.83 0.0041 Genotype 46 8585.74 186.64 42.53 0.0001** Error 92 401.75 4.36 Coefficient of Variation: 1. 9%
Table A2: Days to Maturity
Source of Degree of Sum of Mean F.value Probability
variance freedom square square
Replication 2 24.55 12.27 2.13 0.12 Genotype 46 1766.55 38.40 6.67 0.0001** Error 92 529.44 5.75
Coefficient of Variation: 1.4%
Table A3: Plant height
Source of Degree of Sum of Mean F.value Probability
variance freedom square square
Replication 2 1.80 0.900 0.06 0.94 Genotype 46 11962.46 260.05 60.42 0.0001** Error 92 1337.53 14.53 Coefficient of Variation: 5.7 %
128
Table A4: Leaf lets leaf-1
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Replication 2 1.1489362 0.5744681 0.68 0.5112 Genotype 46 396.49 8.61 10.14 0.0001 Error 92 78.1843972 0.8498304 Coefficient of Variation: 6.67%
Table A5: Leaf area
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Replication 2 0.91 0.45 0.20 0.81 Genotype 46 418.48 9.09 4.07 0.0001 Error 92 205.51 2.23 Coefficient of Variation: 21%
Table A7: Seed yield plant-1
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Replication 2 7.29 3.64 0.55 0.57 Genotype 46 3254.87 70.75 10.74 0.0001 Error 92 606.26 6.58 Coefficient of Variation: 24.2 %
129
Table A6: 100 Seed weight
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Replication 2 3.50 1.75 0.29 0.74 Genotype 46 4049.16 88.02 120.17 0.0001 Error 92 546.44 5.93 Coefficient of Variation: 23%
Table A8: Biological yield plant-1
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Replication 2 21.64 10.82 0.80 0.45 Genotype 46 16530.73 359.36 447.09 0.0001 Error 92 1242.56 13.50 Coefficient of Variation: 12 %
Table A9: Number of nodules plant-1
Source of Degree of Sum of Mean F.value Probability variance freedom square square
Genotype 42 573,20 13.64 4.38 0.0001 Error 86 268.12 3.11 Coefficient of Variation: 22.54%
130
Table A9: Rhizobium effect on number of nodules plant-1
Source of Degree of Sum of Mean F.value Probability
variance freedom square square
A 1 648.37 648.37 295.45 0.0001
B 42 1202.94 28.64 13.05 0.0001
A*B 42 336.64 8.01 3.65 0.0001
Error 172 337.46 2.19
Coefficient of Variation: 15.73%
Table A10: Rhizobium effect on seed yield plant-1
Source of Degree of Sum of Mean F.value Probability
variance freedom square square
A 1 1104.01 1104.01 92.81 0.0001
B 42 8466.90 201.59 16.95 0.0001
A*B 42 1206.32 28.72 2.41 0.0001
Error 172 2046.06 11.89
Coefficient of Variation: 26.5.%