Genetic Engineering

What is Genetic Engineering?

Genetic Engineering – technology of altering the genes of an organism to produce a desired change.

Types of Genetic Engineering

1. Selective Breeding – when animals with desired characteristics are bred to pass on only desired traits.- Ex: dogs, cats, farm animals, crop plants

2. Biotechnology – adding to or causing changes in DNA (genes) to affect changes in an organism.

Process of Biotechnology

a. DNA is spliced (cut) from cells.- This is done by special enzymes

called Restriction Enzymes.

b. The spliced pieces of DNA are separated by the process of Gel Electrophoresis.- The pieces separate based on size. (Remember chromatography)

The pieces of DNA are placed on a gel and move towards the positive end.

The smaller pieces of DNA reach the end first.

A photograph of the DNA is then taken.

3. Recombinant DNA – taking a gene from one organism and putting it into the DNA of another organism.

- combining DNA from different sources.

Human genes, spliced (cut) by restriction enzymes, are inserted into the DNA of a bacteria.

Bacteria asexually reproduce and make lots of human genes, which code for human proteins.

Review Picture of Recombinant DNA

4. Clone – an organism or cell that is genetically identical to its parent.

- commonly results from asexual reproduction and mitosis in single-celled organisms.

Cloning in Multicellular Organisms?

1997 – Ian Wilmut cloned a sheep named “Dolly”.

1. Took body cell from a sheep udder.2. Fused (mixed) it with an egg cell from a

female sheep in a test tube.3. Fused egg cell embryo.4. Embryo placed into female sheep’s

uterus.

Crime Scene DNA

GTCGACCGGTGACAGCTGGCCACT

GTCGACC GGTGA CAGCTGG CCACT