Genetic Manipulation: from sequence to gene function

and beyond

Johann UrschitzInstitute for Biogenesis Research

University of Hawai’i at Manoa

Institute for Biogenesis Research

§ Sperm structure and function

§ Mammalian cloning

§ Transgenesis

§ Gene Editing

Transgenesis

• Passive transgenesis: DNA repair mechanism of oocyte inserts transgene. Rare event.

• Active transgenesis: Enzymes produced by the vector insert the transgene enzymatically into the host genome.

Definitions

Passive transgenesis - relies on oocyte DNA repair mechanism

First Effective Transgenesis Method

Pronuclear microinjection

(Gordon et,al,. 1980)

• Harvest embryos from mice

• Inject DNA into pronuclei

• Transfer embryos to surrogate mothers

• Analyze pups

• Breed

Linear transgene

Pronuclear microinjection

• Integration occurs at a frequency of between 10-30% of cells in which the transgene DNA is delivered to the nucleus.

• Integration occurs at one or, rarely, a few chromosomal sites per nucleus by Non Homologous Recombination.

Main features of randomly integrated exogenous DNA

Problems with PNI

Concatamer formation

• Integrated DNA very often in the form of a concatamer(multicopy array).

• The vast majority of arrays consist of head-to-tail associations.

Increases likelihood of transgene silencing

Concatamer formation

Problems with PNI(And other passive TG methods)

Chimerism

Chimeric a mutation in Cetn1 gene.

ICSI Transgenesis (invented at IBR)

Passive transgenesis-relies on oocyte DNA repair mechanism

Linear transgene is also integrated randomly

+

Preparations for ICSI

In order for ICSI to succeed sperm must be prepared:

Stop the movement of sperm, and make them “sticky” to allow the adhesion of transgene DNA

+

Sperm heads treated with

Tissues beneath plasma membrane are basic in charge (protamines)

Therefore (+ in charge)

This oneA) Fresh, B) Triton X-100, C) Freeze-thawing, D) Freeze-drying

Chromosome Spreads of Oocytes Injected with CTL and F/T

Spermatozoa

Problems with ICSI

Southern blot

Concatamer formation

Lentivirus Mediated Transgenesis(Lois et,al,. 2002)

Paw

Heart

Kidneys

Face

Brain

Liver

Active transgenesis: relies on viral insertion enzymes

• During Lentiviral transgenesis

• 73% of embryos do not make it to term

• However, of the 27% surviving embryos

80% are transgenic

Therefore 23% of oocytes injected

Lentiviral Summary

Efficiencies of Current Types of Transgenesis

Pronuclear Microinjection (passive tg) ~0.1 to 3.4%

ICSI Transgenesis (passive tg) ~2.0 to 4.6%Advantage over pronuclear is the insertion of large transgenes

Lentiviral (active tg) ~23.0%Small transgene size, 9.5kb maximum

Percent of embryos or oocytes injected resulting in transgenic pups

Transposon-mediated trangenesis

• Eukaryotic Transposable Elements (TEs) are ubiquitous and widespread mobile genetic elements (MGEs)

• Approximately 45% of the human genome consists of MGE• Major players in genome evolution and in species

diversification

Active Transgenesis

Class I elements include retrotransposons: copied via an RNA intermediate and inserted elsewhere through enzymes such as integrase.Examples: LINEs and SINEs

Class II elements (transposons): cut from their original location by transposases and then inserted into a new location (cut and paste)

Transposons

Effects of TEs on host genome• Little or no impact on gene function.

• Deleterious effect on host genome results in disease.

• Sixty five diseases caused by TE insertions have been documented

• Retrotransposons are currently still active and would cause reproduction of inserted genes

• Three percent of the human genome consists of DNA transposons which used a cut-and-paste mechanism for mobilization within the genome.

• DNA transposons were active in primate evolution, but they do not currently have mobile activity in the human genome.

Effects of TEs on host genome

TRE TRE

Cut and

Paste

Transposase

Class II transposons

Transposition

ATGCAGCTAGATTAATCTTTTCTTAC

Transposition

ATGCAGCTAGATTAATCTTTTCTTAC

Transposition

ATGCAGCTAGATTAATCTTTTCTTAC

Transgene integration

Helper-independent self inactivating pmGENIE-3 vector

TTAA TTAA

piggyBac inserts into TTAAregions in host cell DNA

AA TT

AA TT

piggyBac transposase leaves no footprint when excised from the site of insertion

AA AATT TTTRE TRE

• te-Pronuclear microinjection (active tg) ~ 50%

• Pronuclear microinjection (passive tg) ~0.1 to 5.0%

Embryos injected/Transgenic animals

Efficiencies of pronuclear and te-pronuclear microinjection

DBD-directed transposition to CCR5

TALE

TALE recognition seq

TTAA

PB

5'TRE

CMV

GIN

3'TRE

CCR5

Transposase fusions

DBD

6

A Revolutionary Genetic Tool

Cre-lox system

Natural part of P1 bacteriophage viral life cycle

Viral DNA injected into bacteria, circularized using Cre-lox, and replicated for development of new viruses

Cre

Cre-Lox System

A Simple, Two Component System Cre recombinase

Site-specific enzyme, catalyzes recombination between two LoxP sites

loxP site 34 base pair DNA sequence

Location and orientation determines recombination result: o Deletion o Inversion o Translocation

Reviewed in: Nagy A. 2000. Genesis 26(2):99-109. PMID:10686599

ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT

Abundant possibilities for genome manipulation!

Cre

9

Cre-Lox System

Mechanism: Cre-lox Deletion Floxed target gene

Knockout allele

X

GeneX

LoxP

GeneX

LoxP LoxP GeneX

LoxP

Cre excision

10

Cre-Lox System

Tissue-Specific Knockout Breeding

JAX® Mice |

13

Alb cre

GeneX loxP loxP

GeneX

Cre-lox mouse: Heterozygous for knockout (1st generation)

Alb cre

GeneX

GeneX

Liver-specific Cre B6.Cg-Tg(Alb-cre)21Mgn/J 003574

x Homozygous floxed

GeneX loxP loxP

GeneX loxP loxP

Cre-Lox System

x Homozygous floxed

GeneX loxP loxP

GeneX loxP loxP

Tissue-Specific Knockout Breeding

15

25% homozygous for knockout (2nd generation)

Alb cre

GeneX loxP loxP

GeneX loxP loxP

Alb cre

GeneX loxP loxP

GeneX

Hemizygous Alb-cre Heterozygous floxed

Cre-Lox System

Endonucleases-based gene editing

• Introduce double/single stranded breaks at specific sequences

• Offer much more control over the integration site than viral vectors

• Utilize endogenous eukaryotic DSB repair mechanism:– Non-Homologous End-Joining (NHEJ)– Homology Directed Repair (HDR)

genomic DNA 5’3’

3’5’

DSB repair mechanisms

Non-Homologous End-Joining (NHEJ) Homology Directed Repair (HDR) efficient but error prone high-fidelity repairin dividing and non-dividing cells only in dividing cells

NHEJ HDR

Non-Homologous End-Joining (NHEJ)

Homology Directed Repair (HDR)

Zinc finger nucleases• Consists of an array (3-6) of zink finger proteins and

FokI nuclease• Zinc fingers common in eukaryotes – for trx regulation• Highly specific DNA binding (each Zf recognizes 3bp

sequence)• FokI dimerizes and cuts DNA upon binding of 2 ZFN

monomers• Difficult to engineer – architecture dependent • Off-target mutagenesis (10%)

Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing technologies

Transcription activator-like effector nucleases

• Largely similar in composition (33-35aa) except for positions 12 and 13

• 1:1 binding affinity: each TALE has specific domains for either A,C,T or G

• Consists of tandem arrays of TALE proteins and FokInuclease

• TALENs are easier to design and fewer constraints on site selection

• TALENs are large (>3kb) compared to ZFNs (1kb) • Off-target mutagenesis, but less than ZFNs

Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing technologies

CRISPR/Cas9• Clustered regularly interspaced short

palindromic repeat• Part of the bacterial defense system• consists two components: • a guide RNA (gRNA or sgRNA): a

short RNA composed of a scaffold sequence necessary for Cas-binding and a target-specific ∼20 nucleotide spacer that specifies the genomic target

• Cas protein introduces double strand break 3-4 nucleotides upstream of PAM

CRISPR/Cas9• The CRISPR array and the

tracrRNA are transcribed into a long pre-crRNA and tracrRNA.

• These two RNAs hybridize via complementary sequences and are processed to shorter forms by Cas9 and RNase III.

• Cas9 protein and the gRNA form a ribonucleoprotein complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves on Cas9.

CRISPR/Cas9

• gRNA recognizes and hybridizes to target site

• Cas9 undergoes a conformational change upon gRNA binding -> shift from inactive, non-DNA binding conformation into an active DNA-binding conformation

• Cas binds to PAM

CRISPR/Cas9• Once the Cas9-gRNA complex

binds, the seed sequence anneals to the target. Next, non-seed will anneal

• Cas9 will only cleave if the gRNA spacer sequence shares sufficient homology with target

• Cas9 contains two domains, HNH and RuvC, which cleave, respectively, the com-plementary and non-complementary strands

• Creates blunt ends 3-4 ntupstream of PAM

PAM Sequence• The PAM sequence is essential for target

binding, but the exact sequence depends on Cas used

NHEJ by Cas• The most active repair mechanism

• Most often gives rise to small indels that result in deletions, insertions, or frameshift mutations leading to premature stop codons

• The ideal end result is a loss-of-function mutation within the targeted gene.

• Randomness of NHEJ-mediated repair has important practical implications, because a population of cells expressing Cas9 and a gRNA will result in a diverse array of mutations

HDR by Cas• DNA repair template must be delivered

with gRNA(s) and Cas. • Must contain additional homologous

sequence (homology arms) • Repair template may be a ss oligo, ds

oligo, or a plasmid.

• Low efficiency (<10%)• However: efficiency of Cas9 cleavage is

relatively high but efficiency of HDR is relatively low

• ->large portion of DSBs will be repaired via NHEJ. ->the resulting population of cells will contain some combination of wild-type alleles, NHEJ-repaired alleles, and/or t desired HDR-edited allele.

CRISPR/Cas9

• a D10A mutant of SpCas9, retains one nuclease domain and generates a DNA nick rather than a DSB.

• two nickases targeting opposite DNA strands are required to generate a DSB within the target DNA

• dramatically increases target specificity

Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing

Cas9 nickase

High fidelity Cas9

• eSpCas9(1.1) contains alanine substitutions that weaken the interactions between Cas9 and the non-target DNA strand, preventing strand separation

• SpCas9-HF1 lowers off-target editing through alanine substitutions that disrupt Cas9's interactions with the DNA phosphate backbone.

• HypaCas9, contains mutations in the REC3 domain that increase Cas9 proofreading and target discrimination.

CRISPR/Cas9 genome editing can result in unwanted changes at non-target sites

Dead Cas9• RuvC and HNH nuclease domains can be rendered inactive

by point mutations (D10A and H840A in SpCas9)

• resulting dead Cas9 (dCas9) molecule that cannot cleave target DNA

• retains the ability to bind to target DNA based on the gRNA targeting sequence

flexible tool for genome manipulation

Dead Cas9

• dCas9 fused directly to a single transcriptional activator (V64 of KRAB)

• epitope-tagged dCas9 and antibody-activator effector proteins (e.g. SunTag)

• fusion to several different activation domains

• additional RNA-binding helper activators

Activation or Repression of Target Genes

Reversible manipulation

Dead Cas9

• Fusion to epigenetic modifiers like p300 and TET1

Advantage: persistence and inheritance epigenetic marks may be more frequently inherited by daughter cells.

Epigenetic Modifications

Other CRISPR/Cas9 Applications

• DNA base editors: fuse Cas9 to a cytidine deaminase like APOBEC1

• RNA base editors: converts adenosine to inosine (inosine is functionally equivalent to guanosine ->A->G)

• forward genetic screening

• …..

CRISPR/Cas9

• Nickase (Cas9D10A)• dCas9• CRISPRi• CRISPRa• CRISPR-Cpf1

Adapted from: LaFountaine et al.: Delivery and therapeutic applications of gene editing

Gene therapy

Gene therapy

Transgene Delivery Strategies• Ex vivo• In vivo• Viral• Non-viral

https://www.ncbi.nlm.nih.gov/

Viral delivery

Viruses are gene delivery machines• Viral vectors Commonly used in clinical trials:

– Adenoviral vectors (large cargo, no integration)

– Retroviral vectors (poor titer, integration into promoters)

– Adeno-associated virus (AAV) vectors (infect dividing and non-dividing cells, small cargo)

– Lentiviral vectors (integrate preferentially into introns of transcriptionally active genes in dividing and non-dividing cells

Summary virus-based approaches• High transduction efficiency• Natural mechanism for nuclear import of

genes• Immune response• Loss of transgene expression• Complications in its construction and

production• Random integration may cause insertional

mutagenesis • Limited cargo capacity

Non-viral vectors

• Do not elicit immune response and are less cytotoxic

• Large cargo size (100+kb)• Ease of synthesis and quality control• Can be modified to improve nuclear

import, endosomal escape and target specificity

• Limited in vivo transfection efficiency

• Endonucleases

• Transposases

Non-viral vectors

Maternal Nutritional Imbalance

• Maternal obesity• Fetal growth restriction and IUGR• Effects on fetal development• Effects on long-term health of the offspring • Underlying molecular mechanisms

Placenta• Important for health of mother and fetus during pregnancy

• But also lifelong health of both

• Unique agent of human symbiosis

• Interface between the fetal and maternal circulation

• Key function: supply nutrients to the fetus

• Other functions: fetal renal, respiratory, hepatic, endocrine and immune system

The Placenta

ExtravillousSpace

MVM(maternal)

Amino Acids

BM(fetal)

Fatty AcidsGlucose

GLUTs

LATs

FATPsFABPs

SNATs

Fetal Capillary

Syncytium

Transfer of glucose, amino acids and fatty acids• microvillous membrane (MVM)• basal plasma membrane (BM) of synctytiotrophoblast

Chorionic villi

IntervillousSpace:Filled with maternal blood

Synctytiotrophoblast

Source: Gaccioli and Lager (2016). Placental Nutrient Transport and Intrauterine Growth Restriction.

Options For Intervention

Blood flowNutrient concentration gradient

Placental consumption Transporters or receptors

Maternal-fetal flux

Questions

• Can we modulate placental nutrient transport in vivo?

• Will the modulation attenuate abnormal fetal growth and the subsequent development of metabolic syndrome in the offspring?

Maternal Overweight & ObesityObesity USA: 40% of Adults, even higher in NHPI and Native Alaskans

Consequences of Maternal Overweight & Obesity

• increased risk of GDM and preeclampsia• associations with abnormal intrauterine growth• development of adult obesity and metabolic syndrome

Maternal Obesity

Fetal-Neonatal Obesity

Childhood Obesity

Adult Obesity

• no fetal gluconeogenesis: maternal circulation is only source for fetoplacental glucose

• transporter-mediated facilitated diffusion down the maternal – fetal plasma concentration gradient

• GLUT 1 is the predominant isoforms expressed in the human term placenta

• Glut1 in the placenta has been shown to be upregulated in maternal obesity

Glucose

Current Options For In Vivo Gene Modulation Of The Placenta

• Whole-body gene manipulations - transgenic mice via PNI or ICSI

• Placenta-specific gene manipulations via Cre-lox P

• Lentiviral transduction of blastocysts

Plasmid Design

• piggyBac-based vector (hypmGENIE3)

• Docycycline (Dox) inducible Transgene Expression

• CYP19I.1: Promoter for trophoblast specific gene expression

• Luciferase reporter gene

• Glut1 knockdown via shRNAmir

Glut1 KD Cassette CYP19I.15’TRE 3’TREpB pB cont.

transposon

TRE3G---GL3---shRNAmir---CYP19I.1---rtTA3

Trophoblast-specific KDLu

cife

rase

leve

ls

0100000200000300000400000500000600000

Cyp -501

Cyp -795

NTCADA - 501 CYP -795 CYP NTC

Cyp19-GL3 expression, NTC level set to 0.

N=33T3BeWo

00.20.40.60.8

11.2

328

331

403

405

719 M Sc

NTCmR

NA

leve

ls

normalized to b-actin, level of M = 1

* *

shRNAmir constructs match Glut1 transcript 100% at the Specificity-Defining Region

Glut1 protein knockdown Clone 403

Glut1& b(Ac+n&

M& SC&SI& SI& SC&M&

M=mock transfection, Sc=transfection with scrambled shRNA

BeWo

BeWo

NIH 3T3

Dox - Dox + Dox - Dox +

Sonoporation or UTMD is the use of ultrasound and ultrasound contrast agent to modifying the permeability of the cell membrane for the transfer of DNA

• Microbubbles (MB) are positively charged, gas-filled lipid shells

• Coupled electrostatically to negatively charged pDNA

Sonoporation

• Ultrasound close to MB resonance frequency introduces MB oscillation and cavitation

• Induces microjets, fluid streams, and shock waves,

• Produce localized plasma membrane pores and generates prolonged intercellular gaps

Source:: Delalande et al. 2013 Sonoporation: Mechanistic insights and ongoing challenges for gene transfer

Sonoporation

Sonoporation

• Mice were injected with microbubble/pDNA solution

• US was applied along one side of uterine horn

• At 24h, luciferase expression was visualized by IVIS

• Mice with positive Luc signal were sacrificed, dissected and imaged again

US + + + + -

Mb/pDNA/Dox

Dox-induced Transgene Expression

Uterine hornIVIS luminescence assay

GL3+/Dox+/24h

Glut1 KD mouse

Heart, liver & kidney

ovaryuterine horn

heartliver

kidneys

Dox-induce Transgene Expression

US/Mb/pDNA/Dox+ US/Mb/pDNA/Dox+

Reduction of Glut1 (preliminary)After 24h: overall ~ 20% • basal membrane ~ 40% • microvillous membrane ~ 10%

Conclusion

• We developed an alternative approach for in vivo gene modulation in the placenta

• Has the potential to be used in humans• Achieved placenta specific expression of the transgene• Placenta specific knock-down of Glut1

• Next steps will include:– Complete evaluation of:

• Transgene expression distribution• Extent of Glut1 KD

– Move to model of maternal obesity

Acknowledgements

University of HawaiiMarlee ElstonHaide RazavyKainalu MathewsLance Nunes

Stefan MoisyadiSteve Ward

Funding: NIGMS 5P20GM103457

University of ColoradoFredrick RosarioThomas Jansson

The End

shRNAmir

• shRNA expressed from a miR-30 context.

• Allows for pol II promoter usage

• Processing via endogenous miRNA biosynthetic pathway

• U6 promoter: sequences immediately upstream of U6 are critical for precise TX initiation (starts precisely at first A/G within −1 to +2).

mir-30 loopmir-30 context

Graphs from Thermo Scientific