genetic regulation of pulmonary progenitor cell

Genetic regulation of pulmonary progenitor cell differentiation

Maria R. Stupnikov

Submitted in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

in the Graduate School of Arts and Sciences

COLUMBIA UNIVERSITY

2019

© 2019

Maria R. Stupnikov

All rights reserved

ABSTRACT

Genetic regulation of pulmonary progenitor cell differentiation

Maria R. Stupnikov

The respiratory system represents a major interface between the body and the

external environment. Its design includes a tree-like network of conducting tubules

(airways) that carries air to millions of alveoli, where gas exchange occurs. The

conducting airways are characterized by their great diversity in epithelial cell types with

multiple populations of secretory, multiciliated, and neuroendocrine cells. How these

different cell types arise and how these populations are balanced are questions still not

well understood. Aberrant patterns of airway epithelial differentiation have been

described in various human pulmonary diseases, chronic bronchitis, asthma,

neuroendocrine hyperplasia of infancy, and others.

The goal of this thesis is to investigate mechanisms of regulation of airway

epithelial cell fate in the developing lung epithelium. More specifically, these studies

focus on Notch signaling and address a long unresolved issue whether the different Notch

ligands (Jagged and Delta) have distinct roles in the epithelial differentiation program of

the extrapulmonary and intrapulmonary airways. Moreover, these studies investigate the

ontogeny of the bHLH transcription factor Ascl1 and identify its targets in the developing

airways as potential regulators of neuroepithelial body (NEB) size and maturation.

My studies provide evidence that the Notch ligand families Jag and Dll are

required for the specification and formation of different cell lineages in the developing

airway epithelia. Jag ligands regulate multiciliated versus secretory (club) cell fates but

also controls abundance of basal cell progenitors in extrapulmonary airways. Dll ligands

regulate pulmonary neuroendocrine versus club cell fates in intrapulmonary airways.

Analysis of mouse mutants showed that loss of Jag ligands has minimal impact on the

size or abundance of NEBs and their associated secretory cells while loss of Dll ligands

results in an expansion of NEB size and associated cells. To gain additional insights into

the potential mechanisms of how neuroendocrine cells develop and undergo aberrant

hyperplasia, I characterized the global transcriptional profile of embryonic lungs from

mice deficient in Ascl1, which lack NEBs and neuroendocrine cells and identified a

number of genes associated with neuroendocrine cell development, maturation, and the

NEB microenvironment. Among these genes, components of the catecholamine

biosynthesis pathway, such as tyrosine hydroxylase (Th), a key enzyme for

catecholamine production, were downregulated in Ascl1 null lungs. Subsequent

functional analysis using a pharmacological inhibitor of this pathway in lung organ

cultures showed expansion of pulmonary neuroendocrine cells and NEB size, an

observation of potential relevance in human diseases in which neuroendocrine cells are

aberrantly expanded.

Together these studies highlight the distinct role of Notch ligands and further

implicate Ascl1 targets, as illustrated by catecholamine pathway components, in

regulating epithelial cell fate. Further examination of these pathways may provide

insights into the pathogenesis and ultimately therapeutic approaches for airway diseases.

i

TABLE OF CONTENTS

List of Figures .....................................................................................................................v

List of Tables ................................................................................................................... vii

List of Abbreviations ..................................................................................................... viii

Acknowledgements ........................................................................................................ xiii

Dedication .........................................................................................................................xv

Chapter One: Embryonic Lung Development and Notch Signaling.............................1

I. Introduction ........................................................................................................1

II. Stages of Murine Lung Development ................................................................2

III. Progenitor Cells of the Developing Epithelium and Differentiation into Cell

Lineages .............................................................................................................4

IV. Overview of Conducting Airway Lineages .......................................................4

1. Secretory Cells .............................................................................................8

A. Club Cells......................................................................................8

B. NEB-associated Club Cells ...........................................................9

C. Goblet Cells ..................................................................................9

D. Ionocytes .....................................................................................11

2. Multiciliated Cells ......................................................................................11

3. Pulmonary Neuroendocrine Cells ..............................................................12

4. Basal Cells .................................................................................................13

5. Tuft/Brush Cells .........................................................................................14

V. Mammalian Notch Signaling ...........................................................................15

1. Notch Signaling in Multiciliated and Club Cells .......................................17

ii

2. Notch Signaling in PNECs and NEB-CCs ................................................19

3. Notch Signaling in Basal Cells ..................................................................20

Chapter Two: Jagged Control of Tracheal Progenitor Cell Differentiation ..............24

I. Abstract ............................................................................................................24

II. Introduction ......................................................................................................25

III. Materials and Methods .....................................................................................27

1. Mouse Models ............................................................................................27

2. In situ Hybridization ..................................................................................27

3. Immunofluorescence and Immunohistochemistry .....................................27

4. Morphometric Analysis .............................................................................28

IV. Results ..............................................................................................................29

1. Jag1 and Jag2 Have Partially Overlapping Functions in Restricting Basal

Cell Expansion ...........................................................................................29

V. Discussion ........................................................................................................33

Chapter Three: Jagged and Delta Ligands Control Distinct Events during Airway

Progenitor Cell Differentiation .......................................................................................34

I. Abstract ............................................................................................................34

II. Introduction ......................................................................................................36


1. Mouse Models ............................................................................................38

2. Ascl1 Lineage Trace ...................................................................................39

3. Immunofluorescence and Immunohistochemistry .....................................39

4. Morphometric Analysis .............................................................................40

iii


6. Quantitative Real-Time PCR .....................................................................42

IV. Results ..............................................................................................................43

1. Jagged Ligands Precede the Appearance of Delta in Differentiating

Airway Progenitors ....................................................................................43

2. Jag1 and Jag2 Regulate the Balance of Different Cell Types in Extra- and

Intrapulmonary Airways ............................................................................47

3. Jag Ligands have Minimal Effects in the Establishment and Regulation of

the NE Microenvironment .........................................................................52

4. Dll Ligands Control the Size of the NEB Microenvironment ...................57

5. Notch Signaling and NEB-associated Club Cells are Preserved in the

Absence of Dll Ligands .............................................................................62

6. Preliminary Postnatal Analysis of Dll-cnull Mutants Demonstrate a Defect

in Alveolarization.......................................................................................66

V. Discussion and Future Directions ....................................................................69

Chapter Four: Identification of Ascl1 Targets in Pulmonary Neuroendocrine Cell

Progenitors of the Developing Lung ...............................................................................78

I. Abstract ............................................................................................................78

II. Introduction ......................................................................................................79


1. RNA Microarray ........................................................................................81

2. Gene Ontology Analysis ............................................................................81


iv

4. Immunohistochemistry ..............................................................................83

5. Lung Organ Culture ...................................................................................83

IV. Results ..............................................................................................................84

1. Genes Differentially Expressed in Ascl1-/- Embryonic Lungs ...................84

2. Gene Ontology Analysis ............................................................................88

3. Localization of Top 15-Downregulated Genes of Interest ........................93

4. Potential Role for Catecholamines in Pulmonary Neuroepithelial Body

Expansion ...................................................................................................99

V. Discussion and Future Directions ..................................................................105

Chapter Five: General Discussion ................................................................................108

References .......................................................................................................................113

v

LIST OF FIGURES

CHAPTER ONE:

Figure 1.1 Stages of lung development

Figure 1.2 Cell types of the conducting airways

Figure 1.3 Schematic of progenitors and cell lineages within the conducting airways

Figure 1.4 Canonical Notch Signaling

CHAPTER TWO:

Figure 2.1 Jag1 and Jag2 have partially overlapping functions in restricting basal cell

expansion

CHAPTER THREE:

Figure 3.1 Wild type expression patterns of Notch ligands during early lung development

Figure 3.2 Loss of Jag-driven Notch signaling results in an excess of multiciliated cells

at the cost of secretory cells

Figure 3.3 Jagged-driven Notch signaling has a minimal impact on PENC and NEB cell

fate specification or maintenance

Figure 3.4 Loss of Dll-driven Notch signaling results in an expansion of the NEB

microenvironment

Figure 3.5 Loss of Delta-driven Notch signaling results in an expansion of the NEB

microenvironment

Figure 3.6 Delta-chet/cnull animals survive past birth but demonstrate significant

morphological defects

vi

Figure 3.7 FACS evolution of GFP+ cells from Ascl1GFP E14.5 mouse lungs

Figure 3.8 Lineage tracing of Ascl1 progenitors is an inadequate method to isolate

PNECs for RNA sequencing

CHAPTER FOUR:

Figure 4.1 Heat map of top 50 significantly downregulated genes of interest in control

and Ascl1-/- E14.5 lungs

Figure 4.2 Heat map of top 50 significantly upregulated genes of interest in control and

Ascl1-/- E14.5 lungs

Figure 4.3 Gene ontology analysis results for all downregulated genes in the array

Figure 4.4 Gene ontology analysis results for all upregulated genes in the array

Figure 4.5 Atf5 expression at E14.5

Figure 4.6 Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray at

E14.5 and E18.5 that colocalized with Ascl1+ PNECs

Figure 4.7 Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray at

E14.5 and E18.5 that were in the NEB microenvironment

Figure 4.8 Catecholamine biosynthesis pathway

Figure 4.9 Expression of Th and Th in the developing airways

Figure 4.10 Inhibition of tyrosine hydroxylase function in lung explant cultures

Figure 4.11 In situ hybridization expression of dopamine receptors 1a and 2 in E14.5

lungs

vii

LIST OF TABLES

CHAPTER THREE:

Table 3.1. Forward and reverse primers used for generation of digoxigenin-labeled UTP

anti-sense RNA probes.

CHAPTER FOUR:

Table 4.1 Forward and reverse primers for top 15 downregulated genes following gene

ontology analysis

Table 4.2 Olfactory receptor genes significantly downregulated in the Ascl1-/- E14.5

microarray from the top 50 downregulated genes

Table 4.3 Top 15-downregulated genes of interest from E14.5 Ascl1-/- mouse lungs

following gene ontology analysis

viii

LIST OF ABBREVIATIONS

ADAM: A disintegrin and metalloprotease

ALI: air-liquid interface

Ascl1: achaete-scute family bHLH transcription factor 1

Atf5: activating transcription factor 5

BADJ: bronchoalveolar duct junction

bHLH: basic helix-loop-helix

bp: base pair(s)

BV: blood vessel

Calca: calcitonin/calcitonin-related polypeptide, alpha

CC10: Clara cells 10 kDa secretory protein

cDNA: complementary DNA

Cgrp: calcitonin gene-related peptide 1

chet: conditional heterozygous

cnull: conditional null

COPD: chronic obstructive pulmonary disease

Ctf1: cardiotrophin 1

Cyp2f2: cytochrome P450, family 2, subfamily f, polypeptide 2

Dβh: dopamine beta-hydroxylase

DAPI: 4’,6-diamidino-2-phenylindole

DAPT: N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester

DBZ: dibenzazepine

Ddc: aromatic L-amino acid decarboxylase

ix

DEPC: diethylpyrocarbonate

DIPNECH: diffuse idiopathic neuroendocrine cell hyperplasia

Dll#: delta-like #

DMSO: dimethylsulfoxide

DNA: deoxyribonucleic acid

Drd1a: dopamine receptor D1a

Drd2: dopamine receptor 2

E#: embryonic day #

E: esophagus

EDTA: ethylenediamine tetraacetic acid

ETS: E26 transformation-specific

FBS: fetal bovine serum

FC: fold change

Fgf10: fibroblast growth factor 10

Fgfr2: fibroblast growth factor receptor 2

Foxj1: forkhead box J1

GABA: gamma-aminobutyric acid

Gabra5: gamma-aminobutyric acid type A receptor Alpha5 subunit

GFP: green fluorescent protein

GO: gene ontology

GOrilla: Gene Ontology enRIchment anaLysis and visualization tool

H&E: hematoxylin and eosin

hALI: human ALI

x

Hand2: heart and neural crest derivatives expressed 2

Hes#: Hairy/enhancer-of-split family bHLH transcription factor #

Hey#: Hairy/enhancer-of-split related with YRPW motif protein #

Hoxd9: homeobox D9

Id2: inhibitor of DNA binding 2

IF: immunofluorescence

IHC: immunohistochemistry

Insm1: insulinoma-associated protein 1

ISH: in situ hybridization

Jag#: jagged #

Krt#: cytokeratin #

L-DOPA: L-3,4-dihydroxyphenylalanine

Lfng: lunatic fringe

Lif: leukemia inhibitory factor

mRNA: messenger ribonucleic acid

Mib1: mindbomb E3 ubiquitin protein ligase 1

MOM: mouse-on-mouse

Muc5AC: mucin-5AC precursor

N#ICD: Notch# intracellular domain

NE: neuroendocrine

NEB: neuroepithelial body

NEB-CC: neuroepithelial body-associated club cell

NECD: Notch extracellular domain

xi

NEHI: neuroendocrine hyperplasia of infancy

Nkx2.1: NK2 homeobox 1

Neurod2: neuronal differentiation 2

Ntrk2: neurotrophic receptor tyrosine kinase 2

OCT: optimal cutting temperature

Olfm3: olfactomedin 3

p63: tumor protein p63

PBS: phosphate buffered saline

PCR: polymerase chain reaction

PGP9.5: protein gene product 9.5

PN#: postnatal day #

PNEC: pulmonary neuroendocrine cell

PNMT: phenylethanolamine N-methyltransferase

Olfr#: olfactory receptor #

OR: olfactory receptor

Phox2b: paired like homeobox 2B

PNEC: pulmonary neuroendocrine cell

Pofut1: protein o-fucosyltransferase 1

qPCR: quantitative polymerase chain reaction

Rbpj: recombination signal binding protein for immunoglobulin kappa J region

Rbpjcnull: abbreviated genotype for Shhcre/+; Rbpjflox/flox

RMA: Robust Multi-array Average

RNA: ribonucleic acid

xii

Scgb1a1: secretoglobin family 1A member 1

Scgb3a2: secretoglobin family 3A member 2

SCLC: small cell lung cancer

SEM: standard error of the mean

Shh: Sonic hedgehog

shRNA: short hairpin RNA

Slc4a10: solute carrier family 4 member 10

SO2: sulfur dioxide

Sox#: SRY-box #

SPC/SFTPC: surfactant protein C

SSEA1: stage-specific embryonic antigen 1

Th: tyrosine hydroxylase

TM: transmembrane

TMX: tamoxifen

TNF-α: tumor necrosis factor alpha

Tomt: transmembrane o-methyltransferase

Tr: trachea

Trp63: transformation related protein 63

Upk3a: uroplakin 3A

xiii

ACKNOWLEDGEMENTS

I would like to thank the following individuals for their support and guidance over

the years as I undertook my dissertation work:

My advisor, Dr. Wellington V. Cardoso, for his outstanding mentorship and

guidance. I have learned so much from him and know I am a better scientist because of

his tutelage. His extraordinarily steadfast support and understanding has been truly

appreciated.

My thesis and defense committee members Drs. Michael Shen, Cathy

Mendelsohn, Amin Ghabrial, and Xin Zhang, for their guidance and for helping me push

my work forward.

Dr. Jining Lü for his scientific feedback and discussions. I thank him for taking

the time to review this dissertation and for all of his constructive criticism and advice.

Past and present members of the Cardoso and Lü labs for their friendship,

camaraderie, and scientific discussions, especially Dr. Munemasa Mori, Dr. Jed

Mahoney, Dr. Hector Marquez, Dr. Ying Yang, Mr. Benjamin van Soldt, Dr. Paul Riccio,

Ms. Jingshu Huang, and Ms. Jun Qian.

The current and former faculty of the Department of Genetics and Development at

Columbia University Irving Medical Center, particularly members of the training

committee and my qualifying committee including Drs. Frank Costantini, Benjamin

Ohlstein, and Lori Sussel.

The current and former faculty at Boston University School of Medicine,

particularly Drs. Vickery Trinkaus-Randall, Andrew Zoeller, Barbara Schreiber, Xingbin

Ai, and Alan Fine.

xiv

The current and former administrative personnel in the Department of Genetics

and Development especially Ms. Stacy Warren.

Mrs. Kathryn Kennedy and Mrs. Rashmi Patel for their administrative support

and for handling all of the crises that have occurred throughout. I thank them for our

chats and their encouragement.

Ms. Elizabeth Roemer for first introducing me to scientific research and teaching

me the importance of scientific integrity.

All of my family and friends for their unwavering support and enthusiasm,

especially Dr. Juliana Barrios, Dr. Margaret Kirkling, Ms. So Jung Lee, Ms. Priya

Zachariah, and Ms. Pryanca Zaman.

My in-laws for their encouragement and support.

My husband, Rob, for his unending love, encouragement, and patience, especially

during these last months of work.

My brother, Matt, for always being there for me and supporting me.

Lastly, I am grateful for my parents who sacrificed so much for me and who

always loved me, inspired me, and pushed me to give my all.

xv

Endeavor (verb)

1. To attempt (something, such as the fulfillment of an obligation) by exertion or effort

Endeavor (noun)

1. Serious determined effort

2. Activity directed toward a goal

I dedicate this endeavor to my parents, who taught me the true meaning of the word.

"endeavor." Merriam-Webster.com. Merriam-Webster, 2019.

1

CHAPTER ONE

Embryonic Lung Development and Notch Signaling

I. Introduction

The mammalian respiratory system has evolved into a highly specialized organ to

allow efficient gas exchange to meet the metabolic demands as species transitioned from

water to air breathing organisms. The overall design is of a tree-like network of

conducting tubules (airways) responsible for carrying air to millions of alveoli, where gas

exchange occurs.

The conducting airways are formed by multiple generations of branched tubules

lined with epithelial cells responsible for humidifying and cleaning the air from

environmental particles and biological agents.

Development of the respiratory system relies on complex morphogenetic events

that pattern the airways into proximal (bronchi) and distal (bronchioles) conduits and

generate the alveoli. The respiratory epithelium is populated by numerous specified cell

types, and this diversity is particularly striking in the conducting airways where different

populations of secretory, multiciliated, and neuroendocrine cells have been described.

How these different cell types arise from airway progenitors has been studied

extensively, however many questions about the regulation of differentiation of these cells

remain unresolved. There is accumulated evidence of a mechanistic link between chronic

pulmonary disease and aberrant patterns of airway epithelial differentiation.

Understanding how differentiation is regulated can lead to further comprehension of

mechanisms of lung diseases.

2

This thesis focuses on the regulation of airway epithelial cell fate in the

developing lung epithelium. More specifically it investigates Notch signaling and

addresses a long unresolved question whether different ligands (Jagged and Delta) have

distinct roles in the epithelial differentiation program of extrapulmonary and

intrapulmonary airways. Moreover, these studies include analysis of the bHLH

transcription factor Ascl1 and its targets as potential regulators of neuroepithelial body

(NEB) size and maturation in the developing airways.

I summarize below the key events in embryonic development and differentiation

of conducting airway epithelial cell types as well as Notch signaling and its role in the

developing murine airways.

II. Stages of Murine Lung Development

Development of the lung begins around embryonic day (E) 9.0 in the mouse when

respiratory progenitors are specified from the anterior foregut endoderm and recognized

by local expression of Nkx2.1. Traditionally, five stages of lung development have been

described, mostly based on morphological criteria (Burri, 1984; Figure 1.1). An early

embryonic lung bud stage occurs from E9.5-E10.5 and is marked by the formation of the

primary lung buds and the tracheal primordium followed by separation of the trachea

from the esophagus through ventral-dorsal patterning of the foregut (Que et al., 2006).

The pseudoglandular stage (E11.5-E16.5) is marked by the process of branching

morphogenesis and initiation of airway epithelial differentiation. Branching

morphogenesis is crucial for formation of the highly arborized airway tree.

3

The following canalicular (E16.5-E17.5) and saccular (E18.5-birth) stages of

development results in close approximation of the developing vascular and epithelial

compartments, and formation of the distal saccules for gas exchange. Postnatally these

saccules undergo a process of septation that incurs the surface area of gas exchange and

form the definitive alveoli (birth-PN14) (Morrisey and Hogan, 2010; Rock and Hogan,

2011; Rackley and Stripp, 2012; Herriges and Morrisey, 2014).

Figure 1.1. Stages of lung development in mice (blue) and humans (red). Adapted from

Rackley and Stripp, 2012.

4

III. Progenitor Cells of the Developing Epithelium and Differentiation into Cell

Lineages

As airways grow and branch, the Nkx2.1+ lung epithelium is specified into two

broad domains along the proximal-distal axis. The proximal domain is marked by

expression of Sox2 and gives rise to conducting airway cell types. The distal domain is

marked by Sox9 and Id2 and gives rise to alveolar epithelial cell types.

Lineage tracing studies show that during branching morphogenesis, distal tips

contain multipotent epithelial progenitor cells that contribute to both airway and alveolar

epithelial lineages (Rawlins et al., 2009). As branching occurs, tip cells leave this distal

position to become more proximal stalk cells, lose their Sox9 and Id2 expression, begin to

express Sox2, and give rise to all different cell types of the conducting airways.

IV. Overview of Conducting Airway Lineages

The conducting airways are comprised of the trachea and primary bronchi, which

are extrapulmonary (outside of the lung lobes), as well as smaller bronchi and

bronchioles (Figure 1.2). The distal gas exchange airways are comprised of alveoli.

Within the conducting airways exists several types of epithelia. The trachea and

extrapulmonary bronchi are pseudostratified and are composed of predominantly basal,

multiciliated, goblet, and club cells, with some pulmonary neuroendocrine cells (PNECs)

in the bronchi, but not trachea as well as rare ionocytes and tuft cells. Intrapulmonary

bronchi are comprised of multiciliated, club, PNECs and clusters of PNECs known as

neuroepithelial bodies (NEBs), and a subset of club cells associated with NEBs that we

refer to as NEB-associated club cells or NEB-CCs (Figure 1.2).

5

Figure 1.2. Cell types of the conducting airways. The respiratory system is composed of

conducting airways, which includes the trachea, primary bronchi and smaller bronchi;

and the distal alveoli or exchange surface, where gas exchange occurs. The

extrapulmonary epithelial are composed of multiciliated, club, goblet, and basal cells,

PNECs, ionocytes, and tuft cells (upper right). Intrapulmonary bronchi are composed of

multiciliated, club, NEB-CCs, PNECs, and NEBs (lower right).

6

Briefly, basal cells function as progenitors derived from proximal progenitors that

can give rise to other basal cells, club cells, PNECs, ionocytes, and tuft cells. Club cells

can give rise to other club cells, goblet cells, as well as multiciliated cells, and

multiciliated cells are terminally differentiated cells that do not proliferate (Figure 1.3).

7

Figure 1.3 Schematic of progenitors and cell lineages within the conducting airways.

Nkx2.1+ lung endoderm progenitors give rise to proximal (Sox2+) or distal (Sox9+ Id2+;

not shown) progenitors. These proximal progenitors then give rise to basal cells, which

can self-renew or differentiate into club, PNECs, ionocytes, and tuft cells. Club cells can

also self-renew but can give rise to multiciliated and goblet cells.

8

1. Secretory Cells

Three main subpopulations of secretory cells are currently known; club cells (also

known as Clara cells), neuroepithelial body-associated club cells (NEB-CCs), and goblet

cells.

A. Club Cells

Club cells are secretory cells responsible for concentrating and metabolizing

endogenous or xenobiotic compounds and for secretion of surfactants and other proteins

into the airway lining fluid. In the mouse these cells are abundant and line the conducting

airways in numbers nearly equal to that of multiciliated cells. In humans and non-human

primates, however, these cells are more rare (Coppens et al., 2007). Studies in the adult

mouse lung using naphthalene have identified two subpopulations of cells in the

intrapulmonary airways. Those that are considered mature and express cytochrome P450

(hereafter referred to simply as “club cells”) which undergo apoptosis following exposure

to naphthalene and those lacking this enzyme, which are immature and surround the

pulmonary neuroepithelial bodies (NEBs), referred to as NEB-associated club cells

(NEB-CCs) which can repopulate the airways following injury and will be discussed in

the following section (Reynolds et al., 2000a; Hong et al., 2001).

There exists a heterogeneity of club cells throughout the airways, with varying

expression of genes depending on location during development. In the proximal airways

club cells are enriched for Reg3g, Chad, Gabrp, and Lrrc26, while distal club cells are

enriched for Hp (Guha et al. 2014). Immature club cells express Scgb3a2 and are

observed as early as E13.5, while more mature club cells express Scgb1a1 and are seen

9

around E16.5 in the developing airways. Recently, Nfia was identified as a transcription

factor enriched in club cells (Montoro et al., 2018).

B. NEB-associated Club Cells

Neuroepithelial body-associated club cells (NEB-CCs) are first detected by the

presence of Scgb3a2 adjacent to regions where Ascl1+ clusters are present at E14.5

(Guha et al., 2012). In the adult these cells are enriched around NEBs and near

bronchoalveolar duct junctions (BADJs) and lack Cyp2f2, the gene encoding cytochrome

P450 and therefore can survive naphthalene injury (Hong et al., 2001; Reynolds et al.,

2000a, 2000b; Giangreco et al., 2002; Giangreco et al., 2009; Volckaert et al., 2011).

These cells express all three Notch receptors as well as Upk3a, a gene specific to this cell

type (Morimoto et al., 2012; Guha et al., 2012; Guha et al., 2014). There is evidence that

in wild type conditions these cells can give rise to club and multiciliated cells (Guha et

al., 2012; Guha et al., 2017). Additionally, following bleomycin injury these cells can

generate alveolar type I and II cells (Guha et al., 2017).

C. Goblet Cells

Mucus-producing goblet cells are a specialized subtype of secretory cell that helps

to maintain tissue homeostasis by secreting a variety of substances including mucins and

trefoil factors, which contribute to the protective mucus layer covering the epithelium.

Muc5AC and Muc5B are the predominant mucins produced by goblet cells in the airway

epithelium.

10

These cells are abundantly found in the human airway epithelia but are rarely

found in the airways of adult mice living in pathogen-free environments. When the

airways are injured, however, the abundance of goblet cells increases in both human and

mouse models of lung disease resulting in an excess of mucus and therefore airway

obstruction.

A recent scRNA-seq study determined there were three subsets of goblet cells;

immature goblet, goblet-1, and goblet-2, with each enriched for different sets of genes.

Goblet-1 cells were enriched for genes encoding mucosal proteins Tff1, Tff2, and Muc5b

and secretory regulators such as LmanIl and P2rx4, while goblet-2 cells were enriched for

Lipf, a secreted gastric lipase that hydrolyses triglycerides and Dcpp1, Dcpp2, and Dcpp3

which are orthologues of ZG16B that encodes for a lectin-like secreted protein that

aggregates bacteria (Montoro et al., 2018).

Spdef, an ETS domain transcription factor, was found to be critical for goblet cell

fate. Genetic deletion of Spdef in mice results in an inhibition of goblet cell formation in

airway injury models and overexpression of Spdef in a subset of club cells was found to

result in their conversion to goblet cells (Park et al., 2007; Chen et al., 2009).

Interestingly, Notch signaling was found to occur upstream of Spdef in mouse airways

and demonstrated to regulate the abundance of goblet cells in the airways (Guseh et al.,

2009; Rock et al., 2011). Pharmacological inhibition of Notch results in a reduction in the

number of goblet cells while transgenically activated Notch in the embryonic airway in

vivo results in an expansion of goblet cells at the cost of multiciliated cells (Guseh et al.,

2009). Additionally, conditional inactivation of Rpbj or Pofut1 in airway epithelial cells

in vivo results in goblet cell metaplasia in the adult mouse airways (Tsao et al., 2011).

11

Notch2 has been demonstrated to promote goblet cells, while inhibition of Notch2 via

antibodies was shown to prevent IL-13 and allergen-driven goblet cell metaplasia

(Danahay et al., 2015; Lafkas et al., 2015).

D. Ionocytes

Recently, two groups individually discovered a novel airway cell type, known as

the pulmonary ionocyte. These cells are found in mouse submucosal glands and the nasal

and olfactory epithelia. Ionocytes express Foxi1 and genes encoding subunits of proton-

secreting V-ATPase, Atp6v1c2 and Atp6v0d2. This cell type was also found to derive

from basal progenitor cells and is a major source of Cftr in the mouse and CFTR in the

human, a gene whose mutations are known to cause cystic fibrosis (Montoro et al., 2018;

Plasschaert et al., 2018). While it is possible that ionocytes are the main cells responsible

cystic fibrosis, additional studies are needed to further characterize this cell type and

explore its role in disease. Notch signaling has also been implicated in regulating

ionocyte numbers; cultures of human airway epithelial cells with the DAPT γ-secretase

inhibitor or antibodies against individual Notch receptors resulted in a reduction in the

number of ionocytes (Plasschaert et al., 2018).

2. Multiciliated Cells

Multiciliated cells have multiple apical motile cilia and with secretory cells are

responsible for mucociliary clearance, a mechanism used for keeping airways clear of

microorganisms and environmental particulates. Commitment to the multiciliated cell

program occurs around E14.5. At this stage multiciliated precursors can be identified in

12

proximal airways by expression of Foxj1, a forkhead transcription factor required for

anchoring of basal bodies to the cytoskeleton to allow for generation of cilia (Chen et al.,

1998; Brody et al., 2000; Gomperts et al., 2004; Rawlins et al., 2007).

Multiciliated cells are derived from airway basal and club cells, are considered as

terminally differentiated, and do not proliferate or transdifferentiate in response to lung

injury (Rawlins et al., 2007; Rawlins and Hogan, 2008; Pardo-Saganta et al., 2013). In

the absence of Notch signaling, airway progenitors in the developing lung default into a

program of differentiation that results in an excess of multiciliated cells at the cost of club

cells (Tsao et al., 2009; Morimoto et al., 2010).

3. Pulmonary Neuroendocrine Cells

Pulmonary neuroendocrine cells (PNEC) are one of the lesser known types of

differentiated airway epithelial cells found in the lung; their exact function has only

become clearer in recent years. These cells are present as solitary cells or in clusters

known as neuroepithelial bodies (NEBs). These cells are thought to function as airway

chemosensory cells, recognizing signals from their environment and signaling through

paracrine, endocrine, or autocrine mechanisms (Lauweryns et al., 1973; Cutz et al., 1993,

Linnoila et al., 2006; Gu et al., 2014). PNECs have also been demonstrated to function as

progenitor cells of the airways to maintain the neuroepithelial (NEB) microenvironment,

which acts as a niche for a distinct subset of club cells (Reynolds et al., 2000a; Guha et

al., 2012; Song et al., 2012; Yao et al., 2018). Postnatally, PNECs have been

demonstrated to regulate mucus overproduction in models of allergic inflammation by

GABA hypersecretion (Barrios et al., 2017; Barrios et al., 2018; Sui et al., 2018).

13

Ascl1, a basic helix-loop-helix transcription factor, is a master regulator of PNECs

(Borges et al., 1997). Systemic knockout of Ascl1 results in animals lacking PNECs

without affecting differentiation of the other epithelial lineages in intrapulmonary

airways. A recent study determined that epithelial-specific deletion of Ascl1 suppresses

type 2 immune responses, confirming a previously proposed role for PNECs in innate

immunity (Branchfield et al., 2016; Sui et al., 2018).

Ascl1 is first detected in the developing murine airways at E12.5. At subsequent

stages neuroendocrine precursors acquire markers such as PGP9.5 and Cgrp at around

E15.5. Recent studies suggest there are three phases of NEB development: PNEC

selection (E12.5 E13.5), cluster formation (E13.5 E15.5), and finally differentiation

(E15.5 onward) (Kuo and Krasnow, 2015). Additionally, the formation of NEBs at

branch points in airways has been suggested to result from directed migration, through a

process of “slithering” of solitary PNECs regulated by Slit-Robo signaling (Kuo and

Krasnow, 2015; Noguchi et al., 2015; Branchfield et al., 2016).

4. Basal Cells

Basal cells function as stem cells of the developing and adult respiratory systems

(Rock et al., 2009). In mice, these cells express the transcription factor p63 and

cytokeratins such as Krt5 and Krt14 and are observed in the trachea as early as E10.5

(Evans et al., 2001; Daniely et al., 2004; Que et al., 2007). In humans, basal cells are

present from the trachea throughout the intrapulmonary conducting airways. p63 is

required for basal cell specification, as p63-/- mice lack basal cells (Daniely et al., 2004).

Basal p63+ cells arising from the lung primordium are initially multipotent progenitors

14

that give rise to both airway and alveolar lineages, however they later become lineage-

restricted proximally to create the adult tracheal stem cell pool (Yang et al., 2018).

There is evidence that basal cells give rise to undifferentiated progenitors known

as suprabasal (or parabasal) cells which are Krt8+ p63- and are able to differentiate into

club and multiciliated cells. Notch has been demonstrated to be active in suprabasal but

not basal cells (Rock et al., 2011; Mori et al. 2015).

5. Tuft/Brush Cells

Another rare cell type in the airway epithelium is the tuft cell (also known as

brush cell) characterized by the presence of a tuft of microvilli on the apical surface. This

cell comprises only 1% of the airway epithelium and is believed to play a chemosensory

role, similar to PNECs, where bioactive substances are released in response to external

stimuli to control local immune and epithelial cell functions (Reid et al., 2005; Krasteva

et al., 2011; Tizzano et al., 2011; Krasteva et al., 2012; Huang et al., 2018). Tuft cells

express Skn-1a/Pou2f3, a transcription factor that is required for their generation

(Yamashita et al., 2017). Other transcription factor lineage markers of tuft cells include

SOX9, GFI1B, and ASCL2 (Bjerknes, et al., 2012; Gerbe et al., 2016; Yan et al., 2017).

A recent scRNA-seq study determined there were three subsets of tuft cells;

immature tuft, tuft-1, and tuft-2 cells, with each enriched for different sets of genes. Tuft-

1 cells were enriched for genes associated with taste transduction and Pou2f3, while tuft-

2 cells were enriched for genes that mediate leukotriene biosynthesis such as Alox5ap, as

well as immune cell associated Ptrprc and transcription factors Gfi1b, Spib, and Sox9

(Montero et al., 2018).

15

V. Mammalian Notch Signaling

Notch signaling has been shown to play critical roles in regulating lung epithelial

cell differentiation and proliferation (Tsao et al., 2008; Tsao et al., 2009; Guseh et al.,

2009; Morimoto et al., 2010; Morimoto et al., 2012; and others).

Four Notch transmembrane receptors (Notch1-4) and five ligands (Jagged1 and 2

(Jag1 and 2) and Delta-like 1, 3 and 4 (Dll1, 3, and 4)) have been reported in the

developing lung. All ligands except Dll3 activate Notch signaling via cell-cell

interactions. Upon ligand-receptor binding the Notch extracellular domain (NECD)

undergoes S2 cleavage from the transmembrane-Notch intracellular domain (TM-NICD)

complex by TNF-α ADAM metalloprotease converting enzyme. The cleaved NECD

remains bound to the ligand and undergoes endocytosis in the signal-sending cell for

recycling. In the signal-receiving cell, the TM-NICD complex undergoes secondary

cleavage via the γ-secretase complex of PSEN1, nicastrin, APH-1, and PEN-2 to release

the NICD from the TM. This results in nuclear translocation of the NICD where it

associates with the RBPJ-activator complex for subsequent activation of downstream

Notch target genes, such as HEY- and HES-family members (Figure 1.4) (Radtke and

Raj, 2003; Bray, 2006).

16

Figure 1.4. Canonical Notch signaling. A signal-sending cell expressing Jagged or Delta

ligand(s) binds to a signal-receiving cell’s Notch receptor, resulting in two cleavages and

transcription of downstream targets. Adapted from Bray, 2006.

17

1. Notch Signaling in Multiciliated and Club Cells

Notch signaling regulates the balance of multiciliated and club cells in the

airways. Loss of Pofut1, an O-fucosyltransferase that mediates a posttranslational

modification of Notch essential for Notch-ligand binding, or Rbpjk specifically in the

airway epithelium during development prevents formation of club cells and expands the

ciliate cell population. However, Notch is not required for ciliated cell fate as confirmed

in FOXJ1-Cre, RBPjκflox/flox mouse embryos in which Rbpj was specifically deleted in

multiciliated cells (Morimoto et al., 2010). Additionally, experiments in which

multiciliated cells were ablated in FOXJ1-creER; LSL-DTA adult mice demonstrated no

effect on basal or club cell populations suggesting the lack of a feedback mechanism to

restore multiciliated cells following injury (Pardo-Saganta et al., 2015b).

Rather, Notch is essential to activate the secretory cell fate program. Analysis of

CCSP-rtTA, (tetO)7-Cre, RBPjκflox/flox mouse mutants in which Rbpj was specifically

deleted in club cells of the embryonic lung determined that club cells do not require

constant Notch activation for their cell fates (Morimoto et al., 2010). Nevertheless, there

is evidence that club cells in the adult lung require sustained Notch activation to prevent

them from differentiating into ciliated cells (Pardo-Saganta et al., 2015b).

Ciliated cells express Jagged1 which activates Notch in neighboring cells (Tsao et

al., 2009; Xu et al., 2010). This expression is seen in rare epithelial cells as early as E13.5

and begins to be strongly expressed at E16.5 in ciliated cells of the airway (Zhang et al.,

2013). Analysis of Jag1flox/flox; Spc-rtTA; Tet-O-Cre transgenic mice showed that loss of

Jag1 in lung epithelial progenitors results in an excess of ciliated cells at the cost of club

cells (Zhang et al., 2013).

18

Ciliated cells do not express Notch receptors or undergo Notch activation. Notch2

was found to have a dominant contribution in club cell fate differentiation whereas

Notch1 and Notch3 contribute only minimally to this process (Morimoto et al., 2012).

Loss of all three Notch receptors led to a major loss of club cells and an increase in

ciliated cells, however, did not result in the same increase in ciliated cells observed in

Rbpjcnull mice. The reason for the difference between Rbpjcnull and Notch triple KO mice

is unclear.

Overexpression of the Notch1 intracellular domain in lung epithelial progenitors

of SPC-Cre; Rosa-NotchIC-IRES-GFP mice during embryonic development resulted in

an excess of mucus-producing secretory cells and a reduction in ciliated cells in proximal

airways of the developing lungs. Mouse embryonic tracheal explant assays and adult

human airway epithelial cultures confirmed that Notch overactivation via addition of

recombinant Dll4 results in an excess of mucous-producing cells with no effect on club

cells. Conversely, Notch inhibition via the DBZ γ-secretase inhibitor in these cultures

demonstrated an increase in ciliated cells, decrease in mucus-producing cells, and no

change in club cells (Guseh et al., 2009). Overexpression of other Notch receptors has not

been investigated.

Overall these reports describe a system where multiciliated cells provide ligands

to neighboring club cells, which undergo Notch activation for initiation of secretory cell

fate and that requires constant Notch to maintain secretory (club) cell phenotype.

Multiciliated cells do not require Notch and are, in fact, restricted by Notch, as

demonstrated by Notch inhibition studies where loss of Notch results in an excess of

multiciliated cells.

19

2. Notch Signaling in PNECs and NEB-CCs

In ShhCre; Rpbjflox/flox and ShhCre; Pofut1flox/flox mice there is a small but

significant excess of PNECs as compared with controls, due to disruption of Notch

signaling and its presumed target Hes1. Hes1 has been previously demonstrated to restrict

PNEC fate and NEB size (Ito et al., 2000; Tsao et al., 2009; Morimoto et al., 2010). In

vitro treatment of lung progenitor cells derived from human embryonic stem cells with

DAPT can generate PNECs (Chen et al., 2019). Overexpression of the Notch1

intracellular domain in the lung epithelium of SPC-Cre; Rosa-NotchIC-IRES-GFP mice

resulted in a loss of PNECs presumably due to overactivation of Notch leading to

increased Hes1 expression (Guseh et al., 2009). These studies suggest PNECs do not

require Notch for cell fate but NEB size is affected by activation of Notch in neighboring

cells.

PNECs are known to express Dll1 and Dll4 and have recently been demonstrated

to express Dll3, a non-Notch-activating ligand (Ito et al., 2000; Post et al., 2000; Tsao et

al., 2009; Verckist et al., 2017). It is believed that Ascl1 regulates expression of Dll1

which can then activate Notch in neighboring NEB-CCs. In airways in which Jag1 has

been specifically removed from the epithelium a slight increase in the number of NEBs

was observed, however NEB size remained the same. It was reported this slight increase

may be due to the downregulation of Hes1 in these mutants (Zhang et al., 2013). Ongoing

studies in our lab, however, have found that the number of PNECs is not affected by loss

of Jag1 (unpublished). Essentially, it is believed the derepression of Hes1 can lead to

excess PNEC. A study examining Insm1 found that Insm1-dependent Hes1 is required for

differentiation but not specification of PNECs (Jia et al., 2015).

20

Loss of all three Notch receptors in the developing airway epithelium resulted in

an increase in PNECs and NEB size as opposed to Rbpjcnull airways where there was only

a modest increase in the number of PNECs as well as a loss of NEB-CCs (Tsao et al.,

2009; Morimoto et al., 2010; Morimoto et al., 2012). PNECs do not express N1ICD and

activate Notch in neighboring cells (Morimoto et al., 2012). However, artificial

introduction of N1ICD into PNECs was found to promote transdifferentiation of PNECs

following airway injury with naphthalene. This transdifferentiation was lost when Rbpj or

Pofut1 was specifically deleted from PNECs (Yao et al., 2018). Additionally, loss of

Notch1 in epithelial cells reduces the ability of NEB-CCs to repopulate the airways

following naphthalene injury (Xing et al., 2012).

In summary, these results suggest NEB size is restricted by Hes1 expressed in

neighboring NEB-CCs and that PNEC fate is not dependent on Notch activation.

However, there exists a feedback mechanism between PNECs and NEB-CCs where

PNECs provide ligands to NEB-CC which then activate Hes1 to restrict NEB size. When

this feedback is disrupted, NEBs expand in size due to loss of Ascl1 suppression.

3. Notch Signaling in Basal Cells

Through SO2 injury studies, two non-overlapping subpopulations of basal cells

have been identified, a c-myb+ subpopulation which differentiates into multiciliated cells

and a N2ICD+ (Notch2 intracellular domain) subpopulation which activates canonical

Notch signaling and differentiates into club cells (Pardo-Saganta et al., 2015a).

In mouse air-liquid-interface (ALI) cultures Notch3 has been shown to be

selectively active in an undifferentiated layer of suprabasal progenitor cells (Mori et al.,

21

2015). Disruption of Notch signaling using gamma secretase inhibitors (DAPT, DBZ) in

culture expands the population of basal cells suggesting that Notch is important for

restricting proliferation of basal cells (Mori et al., 2015). These findings were further

confirmed in vivo using Shhcre; Rbpjflox/flox mice in which Rbpj was specifically deleted

from the airway epithelium. Notch’s role as a negative regulator of basal cell proliferation

was further confirmed in gamma secretase inhibitor-treated human airway basal cells

which had an increase in basal cells versus control (Gomi et al., 2015). Interestingly, in

these cultures Notch fostered expansion at the cost of differentiation; there was reduction

in the number of both secretory and multiciliated cell phenotypes.

Mice in which basal cells were deficient in Mib1, a gene required for

ubiquitination and endocytosis of Notch ligands, further demonstrated that Notch

signaling is required for luminal differentiation of basal cells. Since Mib1 is required

specifically in ligand-expressing cells, it was suggested that basal cells are significant

sources of Notch ligands (Rock et al., 2011). In fact, Jag1 and Jag2 are both expressed in

murine tracheal basal cells (Rock et al., 2011; Mori et al., 2015). Experiments using real-

time PCR determined Dll1 is expressed in basal cells at levels higher than luminal cells

although this has not be confirmed by immunostaining (Rock et al., 2011). Separate

studies determined Dll1 and Jag2 are expressed in basal cells with Jag2 being the most

abundant ligand (Pardo-Saganta et al., 2015b). Expression of DLL1, DLL4, JAG1, JAG2,

and all four Notch receptors was observed in basal cells of human airways as well as

downstream effectors RBPJK, HES1, HES2, HES4, HES5, HES6, HEY1, HEY2, and

HEYL (Gomi et al., 2015; Gomi et al., 2016). It is unclear why there are conflicting

22

reports of which ligands are expressed in basal cells. It could be due to techniques used to

detect ligands or how basal cells were defined in human versus mouse studies.

A number of studies have determined that overexpression of activated Notch in

basal cells results in an increased differentiation into club cell lineages. Forced

expression of N1ICD in Krt5+ basal cells resulted in differentiation into club cell lineages

(Rock et al., 2011). Overexpression of N1ICD or N3ICD in human airway ALI resulted

in increased club cells and decreased numbers of TRP63+ basal cells and multiciliated

cells whereas overexpression of N2ICD or N4ICD had no significant change in basal,

club, or multiciliated cell populations (Gomi et al., 2015). Conversely, global Notch3-/-

mice had an expansion of basal in the tracheal epithelium by E14.5 similar to Rbpjcnull

tracheas where Rbpj was specifically deleted from the endoderm and airway epithelium

(Shhcre/+; Rbpjflox/flox mice hereafter referred to as Rbpjcnull). It was found that Notch3 was

found to be responsible for controlling the pool of basal cells available for differentiation

(Mori et al., 2015).

Overexpression of the downstream target of Notch signaling Hes1 in human

primary lung basal cells had a similar effect as N1ICD overexpression in murine basal

cells; resulting in differentiation into secretory cells (Rock et al., 2011).

Overexpression of JAG1 in human ALI (hALI) cultures resulted in a significant

increase in club cells at the expense of basal cells with no change in multiciliated cells

suggesting that JAG1-driven Notch signaling promotes differentiation of basal cells into

club cells (Gomi et al., 2016). Knockdown of JAG1 in hALI using shRNA demonstrated

a decrease in expression of club cell markers with no change in TP63 or multiciliated cell

markers (Gomi et al., 2016). These data contradict findings in mice, in which loss of Jag1

23

resulted in excess multiciliated cells (Zhang et al., 2013). Knockdown of Jag2 in mALI

by shRNA resulted in a decreased number of club cells and an increased number of

multiciliated cells. Selective loss of Jag2 in basal cells in Krt5cre; Jag2flox/flox mice

phenocopied the effects of shRNA and also caused a decrease in N2ICD+ parabasal cells

with no change in p63+ cells (Pardo-Saganta et al., 2015b). It remains unclear, however,

the effect of deficiency in Jagged ligands.

Overall these studies demonstrate Notch is required to restrict proliferation of

basal cells and their differentiation into club and multiciliated cell lineages.

24

CHAPTER TWO

Jagged Control of Tracheal Progenitor Cell Differentiation

Part of this chapter has been published in:

Mori, M., Mahoney, J. E., Stupnikov, M. R., Paez-Cortez, J. R., Szymaniak, A. D.,

Varelas, X., Herrick, D. B., Schwob, J., Zhang, H. and Cardoso, W. V. (2015). Notch3-

Jagged signaling controls the pool of undifferentiated airway progenitors. Development

142, 258-267. doi:10.1242/dev.116855

I. Abstract

Basal cells are multipotent airway progenitors that generate distinct epithelial cell

phenotypes crucial for homeostasis and repair of the conducting airways. Little is known

about how these progenitor cells expand and transition to differentiation to form the

pseudostratified airway epithelium in the developing adult lung.

My role in this work was to investigate whether Jag-driven Notch signaling plays

a role in the balance of parabasal-basal stem cell compartments. I generated the Shhcre/+;

Jag1flox/flox and Shhcre/+; Jag2flox/flox knock-in lines, performed microdissection of

embryonic lungs and tracheas and performed histological and marker analyses of tissues

by immunofluorescence and confocal microscopy. Results from this analysis showed that

loss of Jag1 or Jag2 results in an excess of basal cells and reduction of parabasal cells

and subsequent differentiation. I demonstrate that Jag2 has a predominant role in

restricting basal cells in the proximal trachea while Jag1 has a predominant role in

25

regulating basal cells in the distal trachea. This differential spatial regulation continues

into the intrapulmonary airways which will be discussed in a subsequent chapter.

II. Introduction

Basal cells are multipotent epithelial progenitors recognized largely by expression

of p63 and intermediate filament keratins, such as Krt5 and Krt14 in multiple organs,

including the skin, upper digestive, respiratory, and urinary tracts (Yang and McKeon,

2000; Rock and Hogan, 2011; Hegab et al., 2011; Pignon et al., 2013; Fuchs, 2008;

Kurita et al., 2004). In the adult human lung, these cells are seen throughout the airway

epithelium from the trachea to the distal bronchioles; in mice, basal cells are found

predominantly in the trachea, submucosal glands and extrapulmonary airways (Rock and

Hogan, 2011; Hegab et al., 2011). Lineage studies have shown that these cells self-renew

and generate secretory and multiciliated epithelial cell phenotypes crucial for homeostasis

of the conducting airways. Still, little is known about how basal cells transition from the

proliferative uncommitted state to differentiation in the developing and the adult airway

epithelium. Studies in different tissues, including the human lung, have identified a non-

basal intermediate cell with some ultrastructural features of basal cells but no defined

features of the typically differentiated cellular phenotypes of the airway epithelium

(Donnelly et al., 1982; Mercer et al., 1994; Breuer and Zajicek, 1990). The topographic

nuclear position in between the basal and luminal cell led them to be named as suprabasal

or parabasal cells. These cells have also been shown to have limited proliferative capacity

and were identified as early progenitors of the airway epithelium. The process that gives

rise to these cells resembles that described during the generation of the epidermis and is

26

strongly dependent on Notch signaling. In the skin, Notch is required for repression of

basal cell genes and commitment of basal to the suprabasal cell phenotype early in

epidermal development, initiating a genetic program of differentiation (Blanpain et al.,

2006). In the adult lung, Notch signaling has been shown to promote the transition of

basal cells into a population of early epithelial progenitors and later to drive

differentiation to secretory cell fate (Rock et al., 2011). Although these studies clearly

implicate Notch in the process, they raise multiple questions about how these events

occur as the epithelial progenitors undergo differentiation. Are these regulated by a single

Notch signal acting through different thresholds that determine initially suprabasal cell

fate and later secretory differentiation? Are parabasal cells progenitor cells but

presumably already committed precursors to a particular cell fate? Is there more than one

Notch signaling event regulating the stepwise transition of the basal cells to the

differentiated airway epithelium? If so, what specific Notch receptors and ligands are

differentially involved?

In this paper (Mori et al., 2015) we demonstrated that endogenous activation of

Notch3 signaling selectively controls the pool of undifferentiated progenitors of upper

airways available for differentiation. This mechanism depends on the availability of Jag1

and Jag2, and is key to generating a population of parabasal cells that later activates

Notch1 and Notch2 for secretory-multiciliated cell fate selection. For the purposes of this

thesis I am focusing solely on data related to the Notch ligands Jag1 and Jag2 and their

role in controlling the pool of undifferentiated progenitors. Please see the final

manuscript for all data relating to Notch3 mutants and pharmacological experiments

related to the function of Notch3 (Mori et al., 2015).

27

III. Materials and Methods

1. Mouse Models

Jag1flox/flox mice were kindly provided by Dr. Julian Lewis (Brooker et al., 2006).

Jag1cnull mice were generated by crossing Jag1flox/flox females with Jag1flox/+; Shhcre/+

males. Jag2flox/flox mice were kindly provided by Dr. Thomas Gridley (Xu et al., 2010).

Jag2cnull mice were generated by crossing Jag2flox/flox females with Jag2flox/+; Shhcre/+

males. Embryos were harvested at E14.5 and E18.5, where 0.5 was counted as the

morning when a vaginal plug was found. All experiments involving animals were

performed in accordance with the protocols approved by Columbia University Medical

Center IACUC.

2. In situ Hybridization

In situ hybridization was performed in frozen sections (5-7 μm) using

digoxigenin-UTP-labeled Jag1 or Jag2 riboprobes, as previously described (Tsao et al.,

2008, 2009, 2011). Sections were briefly postfixed and immunohistochemistry was

performed on the same sections as for colocalization studies.

3. Immunofluorescence and Immunohistochemistry

Immunohistochemistry was carried out in 5 μm paraffin wax-embedded sections

from wild-type, or mutant mice at various developmental stages using ABC or MOM kit

(Vector Laboratories) according to the manufacturer’s protocol. When necessary, antigen

retrieval was performed using Unmasking Solution (Vector Laboratories #H-3300) and

microwave or Tris-EDTA buffer (1 mM EDTA/Tris-HCl at pH8.3) for 15 min at 110°C

28

in a pressure cooker. Antibodies used were: anti-Scgb3a2 (a gift from Dr S. Kimura,

NIH, Bethesda, MD, USA; 1:1000), anti-Krt5 (Covance, #PRB-160P, 1:500), anti-Foxj1

(eBioscience, #2A, 1:100), antiacetylated α-tubulin (Abcam, ab125356, 1:1000), anti-

acetylated α-tubulin (Sigma, T7451, 1:2000), antiacetylated β-tubulin IV (Abcam,

ab11315, 1:500), anti-p63 (Santa Cruz, #4E4, 1:100), anti-p63 (H-137) (Santa Cruz, sc-

8343, 1:100), anti-Krt8 (Abcam, ab107115, 1:2000), anti-Scgb1a1 goat (Santa Cruz, sc-

9772, 1:500), Jag1 Rb mAb (Cell Signaling, #2155, 1:50), Jag2 Rb mAb (Cell Signaling,

#2210, 1:50), Nuclei were visualized by NucBlue Fixed Cell ReadyProbes Reagent (Life

Tech, R37606). Images were acquired using a Nikon Labophot 2 microscope equipped

with a Nikon Digital Sight DS-Ri1 charge-coupled device camera or on a Zeiss LSM700

confocal laser scanning microscope.

4. Morphometric Analysis

Morphometric analysis of immunohistochemistry in E14.5-E18.5 lungs was

performed similarly. The percentage of epithelial cells labeled with each antibody was

determined by counting cells in equivalent regions (within the anterior-posterior axis) of

the trachea from control and mutants animals. To minimize variability, only regions

associated with cartilage rings and at roughly equivalent levels along the anterior-

proximal axis of the trachea were analyzed (based on distance from the carina; three or

four regions/trachea, n=3 per group). Data are represented as mean ± SEM; Student’s t-

test, differences are significant if P<0.05.

29

IV. Results

1. Jag1 and Jag2 Have Partially Overlapping Functions in Restricting Basal

Cell Expansion

Preferential Notch ligand-receptor binding depends on multiple factors, including

biological context and cell type (D’Souza et al., 2008; Kopan and Ilagan, 2009). We

reasoned that p63+ airway progenitors were a source of Notch ligands activating Notch3

signaling in neighbor cells, ultimately controlling expansion of the p63 basal cell

population to initiate differentiation. A relationship between Notch3 and Jagged1 (Jag1)

has been reported in the context of cancer cell survival and growth (Konishi et al., 2007;

Sansone et al., 2007). To gain insights into this relationship in our system, we

investigated expression of Jag ligands in the airway epithelium in regions associated with

p63 during development and in adult progenitors cultured under ALI conditions. In situ

hybridization analysis of Jag1 showed epithelial signals in E14.5 luminal and basal-

located cells enriched in p63+ cells. Around this stage Jag2 signals were stronger and

more clearly associated with basal cells (Figure 2.1A). Later, expression of both ligands

extended to intrapulmonary airways in basal and multiciliated cells. In adult airways,

Jag2 has been reported as the most differentially expressed ligand in basal cells (Rock et

al., 2011). Our immunofluorescent analysis of adult airway progenitors in culture showed

that both Jag1 and Jag2 are strongly expressed in the cell surface of p63+ cells (Figure

2.1B). We could not detect expression of Dll ligands other than in neuroendocrine cells

using in situ hybridization (Guha et al., 2012). I asked whether these Jag ligands

contributed equally to mediate the Notch effects in restricting the pool of the p63+ cell

population. Thus, first I investigated the effect of inactivating Jag1 independently in the

30

airway epithelium using mice carrying Jag1 floxed alleles and the ShhCre line. My

approach differed from that of a previously reported Jag1f/f; Sftpc-rtTA;Tet-O-Cre

transgenic mice (Zhang et al., 2013); here, ShhCre induces recombination much earlier, at

the onset of lung development (Harris et al., 2006). Analysis of Jag1cnull mutants

confirmed the imbalance between secretory and multiciliated cells previously seen in

other Notch-deficient models (Tsao et al., 2009, 2011; Morimoto et al., 2010; Zhang et

al., 2013). Moreover, I found increased number of p63+ cells in trachea and

extrapulmonary airways already at E14.5, a phenotype not reported in the Jag1f/f; Sftpc-

rtTA;Tet-O-Cre mice (Figure 2.1C). Interestingly, the expansion in p63+ cells was no

longer seen in E18.5 Jag1cnull but was clearly present at E18.5 in Jag2cnull mice (Jag2f/f;

ShhCre). This expansion occurred predominantly in the upper trachea (Figure 2.1D) and at

the expense of luminal cells, as suggested by the reduced thickness of the Krt8-labeled

cell layer in Jag2cnull airways (Figure 2.1E). Jag2cnull mice also showed the imbalance

between secretory and multiciliated cells seen in Jag1cnull (Figure 2.1F). Overall, these

data suggested that Jag2 contributes more prominently than Jag1 to restrict the expansion

of p63+ cells mediated by Notch signaling in vivo. During development, this function

appears to be regulated in a temporally and regionally distinct fashion, with Jag1 being

less important than Jag2 at later stages and Jag2 being more relevant in upper trachea.

32

Figure 2.1 Jag1 and Jag2 have partially overlapping functions in restricting basal

cell expansion. (A) Expression pattern of Jag1 and Jag2 by in situ hybridization and p63

by immunohistochemistry in developing airways. Stronger signals for Jag2 compared

with Jag1 in E14.5-E15.5 proximal airways initially in all epithelial cells and then

overlapping with p63 at E15.5 (double in situ hybridization/immunohistochemistry; aw,

airway; bv, blood vessels). Diagram summarizes temporal-spatial patterns from the

panels above and data not shown. Proximal-distal domains of expression in trachea (Tr),

extrapulmonary and intrapulmonary proximal airways of the lung (Lu). Solid and dotted

bars represent strong and weak signals, respectively, as revealed by in situ hybridization

or immunohistochemistry. (B) Jag1 and Jag2 are expressed in adult p63+ airway

progenitors in culture (ALI day 2). (C) p63 immunofluorescence and morphometric

analysis (% labeling) showing expansion of basal cells in the E14.5 trachea and

extrapulmonary airways of Jag1cnull mice. (D) Double p63-Scgb1a1 immunofluorescence

in E18.5 wild-type, Jag1cnull and Jag2cnull tracheas showing local (squares) expansion of

p63+ cells in Jag2cnull mice (arrows) not present in wild type or Jag1cnull. (E) In E18.5

Jag2cnull airways, expansion of p63+ cells was accompanied by reduced thickness of the

luminal Krt8-labeled cell layer, and (F) suppression of the secretory (Scgb3a2+)

phenotype with expansion of multiciliated cell population (β-tubulin+). Data are mean ±

SEM of the percentage of p63+ cells/total cells, n=3 per group; **P<0.01, Student’s t-

test. Scale bars: 10 μm in A-C,E,F; 100 μm in D. From Mori et al., 2015.

33

V. Discussion

In this chapter I described the role of Jag1 and Jag2 in restricting the basal cell

population during development of the trachea. The expression pattern of Jag ligands and

the expansion of p63+ cells in Jag1cnull and Jag2cnull airways strongly suggested that these

ligands activate endogenous Notch3 in the basal cell compartment. How this mechanism

initiates is unclear. I propose that p63+ airway progenitors are largely Jag-expressing

cells and, in the absence of Notch signaling, have uninhibited proliferation. As basal cells

expand, extensive cell-cell communication triggers a bias that leads to the appearance of

Notch3-expresssing cells and activation of Notch signaling. This ultimately leads to

suppression of p63 and acquisition of a Notch3-expressing parabasal cell phenotype

primed for further differentiation. P63-negative-Notch3-positive cells maintain Jag

expression in p63-positive basal cells. This balance is maintained until activation of other

Notch receptors is initiated to trigger differentiation.

Mechanisms controlling the balance of p63 and Notch3-expressing cell

populations could presumably be relevant in maintaining homeostasis of the

pseudostratified epithelium. Our results are consistent with those reported in the

mammary gland and bladder in which growth of p63+ cells is inhibited by Notch

signaling (Bouras et al., 2008). Aberrant expansion of stem/progenitor cell populations

contribute to tumorigenesis (Chiche et al., 2013; Lim et al., 2009). Thus, failure of

mechanisms that prevent abnormal expression of p63+ basal cells in the airway

epithelium could also play a role in lung cancer.

34

CHAPTER THREE

Jagged and Delta Ligands Control Distinct Events during Airway Progenitor Cell

Differentiation

I. Abstract

Notch signaling regulates cell fate selection during development in multiple

organs including the lung. Previous studies addressing the role of Notch in the lung

focused on central components of this pathway (Rbpj, Pofut1) or on Notch receptor-

specific functions. It is unclear, however, whether individual ligand families (Delta and

Jagged) or specific ligands (Dll1, Dll4, Jag1, and Jag2) influence distinct aspects of

differentiation of airway epithelial progenitors. Expression analysis of these ligands

showed partially overlapping, but also distinct domains, suggestive of different functions

during development. To understand the contribution of these ligands to Notch signaling

and their role in lung epithelial cell fate I used knock-in mice carrying floxed alleles of

Notch ligands and Shhcre/+ and examined the impact of inactivating these genes

individually or in combinations in the developing airway epithelium. Analysis of these

mutants showed that although overall airway growth and branching were not affected,

there were notable ligand family-selective changes in epithelial differentiation.

Inactivation of Jag ligands had a major impact in balancing the populations of club and

multiciliated cells. Interestingly, a specific population of secretory cell precursors labeled

by Upk3a, SSEA1, and Scgb3a2 in the pulmonary neuroendocrine cell (PNEC)

microenvironment were not affected by Jag ligand deletion. Jag1; Jag2 compound null

mutants maintained strong nuclear N1ICD in NEB-associated club cells (also known as

35

NEB-CCs) suggesting that Dll signals from adjacent PNECs were sufficient to promote

and maintain the fate of this cell population in the absence of Jag ligands. Remarkably,

inactivation of Dll1 alone or in combination with Dll4 in early lung epithelial progenitors

resulted in marked expansion of neuroepithelial bodies (NEBs). This expansion did not

involve changes in the cell proliferation and appear to have resulted from aberrant

recruitment of neighboring cells to the PNEC fate program. Thus, my data suggest that

Notch ligands regulate specific aspects of the cell fate specification program that

establishes the normal balance of differentiated phenotypes in the airway epithelium.

36

II. Introduction

Notch signaling has been demonstrated to play important roles in stem cell

maintenance and cell fate decisions across species. It has been shown that central core

components of the Notch pathway, such as its transcriptional effector Rbpj and Pofut1

(protein o-fucosyltransferase 1), have been shown to be crucial in regulating cell fate of

epithelial progenitors in the developing airways (Tsao et al., 2008; Tsao et al., 2009;

Morimoto et al., 2010; Tsao et al., 2016). Genetic inactivation of these core components

leading to loss of Notch signaling results in excessive formation of multiciliated and

pulmonary neuroendocrine cells (PNECs) and an inability to form secretory cells.

Notch receptors have also been described as playing specific roles in epithelial

cell fate (Morimoto et al., 2012). Notch2 was found to have a more predominant

contribution in mediating secretory versus multiciliated cell fate decision, while Notch1

and Notch3 had a lesser role. However, all three Notch receptors were found to contribute

in an additive fashion to control the abundance of PNEC populations and the sizes of

neuroepithelial bodies (NEBs).

The roles of individual Notch ligands in epithelial progenitors in extrapulmonary

and intrapulmonary airways of the developing lung, however, have not been fully

elucidated. Dll1 and Dll4 have been previously shown to be expressed in PNECs, while

Jag1 and Jag2 are expressed in multiciliated and basal cell precursors (Tsao et al., 2009;

Zhang et al., 2013; Mori et al., 2015). Previous studies supported a key role for Jag1 in

cell fate selection of intrapulmonary airways, but the roles of Jag1, Dll1, and Dll4 have

not been systematically investigated (Zhang et al., 2013).

37

Here I use mouse genetic models in which the Delta-like and Jag family of genes

have been inactivated in lung progenitors. I show overlapping and distinct effects of Jag

and Dll ligands in intra- and extrapulmonary airways. I find that deficiency in Jag ligands

have little effect on the NEB microenvironment, however loss of Dll ligands results in a

remarkable expansion of the NEB microenvironment.

38


1. Mouse Models

Dll1flox/flox and Jag1flox/flox mice were kindly provided by Dr. Julian Lewis

(Brooker et al., 2006). Dll1cnull mice were generated by crossing Dll1flox/flox female mice

with Dll1flox/+; Shhcre/+ males (Harfe et al., 2004). Dll4flox/flox mice were kindly provided

by Dr. Freddy Radtke (Koch et al., 2008). Dll4cnull mice were generated by crossing

Dll4flox/flox female mice with Dll4flox/+; Shhcre/+ males. Dll1cnull; Dll4cnull mice were

generated by crossing Dll1flox/flox; Dll4flox/flox females with Dll1flox/+; Dll4flox/+; Shhcre/+

males. Jag1cnull mice were generated by crossing Jag1flox/flox females with Jag1flox/+;

Shhcre/+ males. Jag2flox/flox mice were kindly provided by Dr. Thomas Gridley (Xu et al.,

2010). Jag2cnull mice were generated by crossing Jag2flox/flox females with Jag2flox/+;

ShhCre/+ males. Jag1cnull; Jag2cnull mice were generated by crossing Jag1flox/flox; Jag2flox/flox

females with Jag1flox/+; Jag2flox/+; Shhcre/+ males. Embryos were harvested at E14.5 and

E18.5, where day 0.5 was counted as the morning when a vaginal plug was found. All

experiments involving animals were performed in accordance with the protocols

approved by Columbia University Medical Center IACUC.

Ascl1GFP mice were bred and maintained at Dr. Jane Johnson’s laboratory at UT

Southwestern (Leung et al., 2007). All experiments utilizing these mice were performed

at that institution by Ms. Trisha Savage.

Ascl1creERT2/+ animals were purchased from Jackson Labs (Kim et al., 2011) and

crossed with Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (R26tdTomato) mice to label Ascl1-

expressing cells and progeny (Madisen et al., 2010).

39

Wild type (WT) sections were obtained from timed pregnancy embryos from CD1

mice (Charles River Laboratories).

2. Ascl1 Lineage Traces

Ascl1creERT2/+ mice were crossed with R26tdTomato/+ or R26tdTomato/tdTomato animals to

generate tdTomato labeled Ascl1+ cells and lineage. Pregnant mothers were injected

intraperitoneally with 2 mg or 4 mg tamoxifen (Millipore Sigma #T5648) diluted in

sunflower oil when embryos were at E9.5 or E12.5 and sacrificed at E14.5. Lungs and

brains were dissected out and frozen embedded in OCT.

3. Immunofluorescence and Immunohistochemistry

Whole lung and trachea were harvested from mice at E14.5 and E18.5 and fixed

in 4% paraformaldehyde at 4 °C overnight. Samples then underwent PBS washes and

15% and 30% sucrose washes before embedding in OCT. 7 μm frozen sections were then

cut from tissue blocks. Samples were incubated with primary antibodies (overnight at 4

°C) and secondary antibodies conjugated with Alexa488, 568, or 647 (1:300) with

NucBlue Fixed Cell ReadyProbes Reagent (DAPI) (Thermo Fisher #R37606) for 45 min.

After washing, samples were mounted with ProLong Gold antifade reagent for analysis.

When necessary, heat-induced epitope retrieval was performed using citric acid-based

antigen unmasking solution (Vector Laboratories #H-3300). Ascl1 and N1ICD staining

required tyramide amplification (Perkin Elmer #SAT704A001EA) used with horse radish

peroxidase conjugation (species-specific ImmPRESS kit, Vector Laboratories).

Antibodies used were: anti-Ascl1 (Thermo Fisher #14-5794-82, 1:100), anti-CC10 (Santa

40

Cruz sc9772, 1:150), anti-Cgrp (Sigma Aldrich #C8198, 1:2500), anti-Foxj1 (Thermo

Fisher #14-9965-80, 1:50), anti-N1ICD (Cell Signaling #4147, 1:100), anti-Scgb3a2

(R&D Systems #AF3465, 1:100), anti-SSEA1 (EMD Millipore #MAB4301, 1:300).

Standard hematoxylin and eosin (H&E) staining was performed on postnatal

sections of control and Delta-cnull mutant lung sections.

Images were acquired using a Leica DMi8 microscope or Zeiss LSM710 confocal

laser scanning microscope.

4. Morphometric Analysis

To determine the percentage of Foxj1+ multiciliated cells in control and Jag-cnull

mutant intrapulmonary airways E18.5 coronal sections of whole lungs were stained with

Foxj1 and DAPI. Two sections from two separate embryos for each genotype were used

for counting. DAPI+ epithelial cells were counted in intrapulmonary airways and were

compared to the number of Foxj1+ cells to determine Foxj1+ percentages.

To determine the percentage of Foxj1+ multiciliated cells in control and Jag-cnull

mutant tracheas E18.5 coronal sections of whole tracheas were stained with Foxj1 and

DAPI. Two sections of whole trachea from one embryo for each genotype were used for

counting. DAPI+ epithelial cells were counted in one side of the trachea and were

compared to the number of Foxj1+ cells to determine Foxj1+ percentages.

Analysis of neuroendocrine cells and neuroepithelial bodies (NEBs) was

performed on E14.5 Delta-cnull mutants. Sections were stained with Ascl1 and DAPI.

Three sections from three separate embryos for each genotype were used for counting.

For each section the number of intrapulmonary airways was counted, as well as the

41

number of NEBs and solitary neuroendocrine cells. The ratios of NEBs/airway and

solitary neuroendocrine cells/airway were calculated. Additionally, NEB size was

examined. In each section, NEB size was determined by counting the number of

neuroendocrine cells in contact with each other, where an NEB was determined to be a

group of three or more cells.

5. In Situ Hybridization

In situ hybridization (ISH) was performed as previously described using

digoxigenin-labeled UTP anti-sense RNA probes. Frozen sections of E14.5 and E18.5

embryonic lungs (control and mutant) were used. Primer sequences used to generate

probes are listed in Table 3.1. T7 or T3 sequences were included in forward or reverse

primers, respectively. Probes were ordered from Integrated DNA Technologies at 25nM

with standard desalting and stored as 100 μM stocks in DEPC-treated water.

Gene Forward (5’ 3’) Reverse (5’ 3’)

Dll1 AATTAACCCTCACTAAAGGGAGA

CTGCTGAGAGAGGAAGGGAG

TAATACGACTCACTATAGGGAGA

AGACCCGAAGTGCCTTTGTA

Dll4 AATTAACCCTCACTAAAGGGAGA

CTACTCAGACACCCAGCTCC


ATCCTTTGCAAGCCTCCTCT

Jag1 AATTAACCCTCACTAAAGGGAGA

CGCCATAGGTAGAGTTTGAGG


TAGTTGCTGTGGTTCTGAGC

Jag2 AATTAACCCTCACTAAAGGGAGA

TGGCACCCAGAACCCTTG


ATACTCCGTTGTTTTCCGCC

Ascl1 AATTAACCCTCACTAAAGGGTCG

TCCTCTCCGGAACTGAT

TAATACGACTCACTATAGGGAG

AAGAAGCAAAGACCGTGGGAG

Upk3a AATTAACCCTCACTAAAGGGGTG

GCTGGACTGTGAACCTC

TAATACGACTCACTATAGGGTT

GCCCACCCTGACTAGGTA

Table 3.1. Forward and reverse primers used for generation of digoxigenin-labeled UTP

anti-sense RNA probes.

42

6. Quantitative Real-Time PCR

Quantitate real-time PCR was performed as previously described (Tsao et al.,

2009). RNA was extracted using the RNeasy kit (Qiagen) and reverse transcribed using

Oligo(DT) primers (SuperScript III or IV kits, Thermo Fisher). The following primers

(Thermo Fisher) were used: Ascl1 (Mm03058063_m1), Cgrp (Mm00801463_g1), Foxj1

(Mm01267279_m1), Scgb1a1/CC10 (Mm00442046_m1), Scgb3a2 (Mm00504412_m1),

Upk3a (Mm00452321_m1). Reactions were performed using Taq-Man Advanced Master

Mix (Thermo Fisher #4444556) using β-actin as internal control and a Step-One Plus

Instrument (Applied Biosystems). ΔΔCT method was used to calculate changes in

expression levels.

43

IV. Results

1. Jagged Ligands Precede the Appearance of Delta in Differentiating Airway

Progenitors

Although the expression patterns of Jag and Dll have been reported in the

developing respiratory tract, specific information about their onset of expression and

regional distribution in the epithelial compartment at early stages of differentiation has

been scattered and not well integrated into functional studies. To gain further insights into

the impact of Notch signaling in the establishment of cell fate we revisited the spatial and

temporal pattern of expression of Notch ligands when epithelial cells are initiating

commitment to different cell fates in developing airways. The presence of these ligands

in both epithelial and mesenchymal layers of the developing lung precluded their

assessment of gene expression in whole lung homogenates.

None of these ligands were detectable by ISH in the airway epithelium prior to or

at E11.5 (not shown). However, a day later low levels of Jag2 in the developing trachea

and extrapulmonary airways made it the first of all Notch ligands to be induced in the

differentiation program of airways (Figure 3.1A). This contrasted with the strong Jag2

signals present in the esophageal epithelium and in neighboring vascular structures.

Notably, the Jag2 detection in E12.5 tracheal epithelial progenitors coincided with the

previously reported onset of Notch activation and appearance of Scgb3a2 locally. This

supports the idea of a Jag2-Notch program giving rise to secretory cell precursors as one

of the earliest events initiating differentiation in airways, potentially even preceding the

appearance of PNECs. Indeed, Ascl1, which marks PNEC progenitors, was expressed

44

diffusely in relatively broad domains in the airway epithelium suggesting that Ascl1 fate

was still undergoing restriction through a classically described lateral inhibition.

By E13.5 strong Jag2 epithelial signals could be detected throughout the trachea

and main bronchi, in great contrast to Jag1, which was present only at background levels

in the airway epithelium (Figure 3.1B). At this time NEBs and PNECs were sharply

demarcated by Ascl1, and Dll1 and Dll4transcripts were first detected in NEBs. This

coincided with the appearance of clusters of adjacent cells collectively labeled by Upk3a,

SSEA1, Scgb3a2, with low levels of Cyp2f2 and CC10, consistent with the initiation of a

Notch-dependent program of secretory cells in the NEB microenvironment (Guha et al.,

2012, Figure 3.1C).

Thus, Jag and Dll ligands seem to appear in different domains and in a sequential

proximal-distal fashion during the establishment of cell fate in airway progenitors,

initiating with Jag2 in the trachea, Jag1, and lastly Dll1 and Dll4 once NEBs form in

intrapulmonary airways.

46

Figure 3.1 Wild type expression patterns of Notch ligands during early lung

development. (A) E12.5 wild type sections demonstrating Jag2 is the first ligand

expressed and is observed in the developing trachea (Tr), esophagus (E), and blood

vessels (BV). Early disperse expression of Ascl1 is also seen (right panel). (B) E13.5 WT

sections demonstrating early expression of Jag2 in the trachea and proximal

extrapulmonary airways and Jag1 expression only in blood vessels. At this point Ascl1

becomes clustered as NEBs form. Dll1 and Dll4 are also seen in PNECs at this point. (C)

The earliest expression of Scgb3a2 is seen at E13.5 in regions surrounding NEBs

(arrows). This expression becomes more disperse as development continues through

E16.5.

47

2. Jag1 and Jag2 Regulate the Balance of Different Cell Types in Extra- and

Intrapulmonary Airways

Given the distinct timing and spatial distribution of Jag ligands described above, I

reasoned that common but also non-overlapping functions were likely to exist in the

distinct domains of the respiratory tract. Inactivation of Jag1 in epithelial progenitors of

intrapulmonary airways undergoing branching morphogenesis using a Sftpc-tet-O system

has been shown to disrupt differentiation, confirming the previously reported role of

Notch signaling in this process (Zhang et al., 2013). This targeting strategy, however,

could not provide information about a more global role of Notch ligands in the

respiratory tract epithelia encompassing extrapulmonary airways (trachea, main bronchi)

and early stages at these sites. Moreover, little is known about how Jag2 influences lung

development and whether there is potential functional overlap with Jag1 in exerting these

functions. Jag2 system knockout animals die at birth (Jiang et al., 1998). Lastly, no

information has been available whether other putative Notch ligands could compensate

for Jag during epithelial differentiation.

Thus, I used the Shh-cre line to inactivate Jag1 and Jag2 individually or in

combination in epithelial progenitors of both extrapulmonary and intrapulmonary airways

at the onset of lung development (Harfe, et al. 2004). Jag1flox/flox; Shhcre/+ (Jag1cnull),

Jag2flox/flox; Shhcre/+ (Jag2cnull) and double (Jag1cnull; Jag2cnull) null mutants were analyzed

early (E14.5) and late (E18.5) stages of airway differentiation. Gross analysis of these

lungs showed no notable macroscopic difference in size or shape between the various

genotypes at these stages (not shown). I compared the effects of Jag1 and Jag2 in

48

multiciliated-secretory cell fate selection at E18.5, once differentiated cell profiles were

largely established in extrapulmonary (trachea) and intrapulmonary (lung) airways.

qPCR analysis of E18.5 lung homogenates showed significant changes in markers

of epithelial differentiation in all mutants (Figure 3.2A). Notably, intrapulmonary airways

were more severely affected in Jag1cnull mutants compared to Jag2cnull mutants.

Expression of the secretory markers Scgb3a2 and Scgb1a1 (encoding CC10) were

reduced by 86.2% (P = 5 x 10-12) and 85.6% (P = 0.0001), respectively in Jag1cnull

mutants, but only by 25.9% (P = 0.015) and 34.4% (P = 0.019), respectively in Jag2cnull

mutants. These changes were accompanied by a significant increase in Foxj1 expression

in Jag1cnull (183% increase, P = 0.0006) but not in Jag2cnull (13% reduction, P = 0.501)

mutants. Double Jag1cnull; Jag2cnull mutants showed Scgb3a2 and Scgb1a1 nearly

abolished and an increase in Foxj1 that reproduced results found in Jag1cnull. The

predominant contribution of Jag1 to the program of secretory cell fate as represented by

these markers could be clearly seen in double Jag1cnull; Jag2cnull mutants. The double null

mutants also showed that airway progenitors are largely dependent on Jag ligands to

execute the program of secretory cell differentiation.

Immunofluorescence of Foxj1 and CC10 in E18.5 lung sections confirmed the

changes in gene expression in intrapulmonary airways revealed by qPCR and showed

secretory cells less abundant in Jag1cnull compared to Jag2cnull mutants (Figure 3.2B).

Interestingly, multiciliated cell fate appeared to be minimally affected in Jag2cnull

airways. Morphometric analysis showed no significant change in the number of Foxj1+

cells in Jag2cnull airways relative to control (P = 0.164), in contrast to the ~2.5-fold

increase in these cells in Jag1cnull mutants (P = 4.17 x 10-7) (Figure 3.2C).

49

In the E18.5 trachea loss of Jag2 resulted in an increase in the number of basal

cells but had no significant impact in multiciliated cells population (Mori et al., 2015 and

Figures 2.1, 3.2D). The excess of basal cells in Jag2cnull tracheas is accompanied by a

decrease in the population of club cells. A similar pattern was observed in Jag1cnull;

Jag2cnull tracheas where the percentage of p63+ cells was greater than in control tracheas.

Interestingly, similar to Jag1cnull tracheas, Jag1cnull; Jag2cnull tracheas had an increased

number of multiciliated cells versus controls. Together these data suggest that Jag2

regulates the basal versus club cell fate in the developing trachea and that Jag1 regulates

the multiciliated versus club cell fate in the developing trachea. This could possibly be

ascribed to the regional differences in distribution of secretory versus multiciliated cells

and Jag1 versus Jag2 ligands along the respiratory tract epithelium. Multiciliated cells

are known to be less abundant in bronchioles, which comprise most of the

intrapulmonary airway sites where Jag1 is the predominant Notch ligand, as opposed to

Jag2 which is more abundant proximally in extrapulmonary airways. I propose that Jag1-

Notch mediated signaling compensates for the loss of Jag2, preserving most of the

secretory cell population in these mutants.

51

Figure 3.2. Loss of Jag-driven Notch signaling results in an excess of multiciliated

cells at the cost of secretory cells. (A) qPCR analysis of multiciliated cell marker Foxj1

and secretory cell markers Scgb3a2 and Scgb1a1 in mutant and respective control lung

homogenates (n=4 Jag1 control, n=3 Jag1cnull; n=4 Jag2 control; n=4 Jag2cnull; n=4

Jag1/Jag2 control; n=4 Jag1cnull; Jag2cnull). Error bars represent SEM. (B)

Immunofluorescence of multiciliated cell marker Foxj1 (red) and mature secretory cell

marker CC10 (green) in control and mutant airways. (C) Morphometric analysis of

Foxj1+ multiciliated cells in control and mutant intrapulmonary airways. Error bars

represent standard deviation. (D) Loss of Jag ligands in the embryonic E18.5 trachea

results in an increase in imbalance of epithelial cell types. Top left panel: IF analysis of

control and Jag-cnull tracheas for multiciliated (Foxj1, green) and basal (p63, red) cell

types. Lower left graph: morphometric analysis of p63+ cells in control and Jag-cnull

tracheas. Lower right graph: morphometric analysis of Foxj1+ cells in control and Jag-

cnull tracheas. Right panel: IF analysis of control and Jag-cnull tracheas for basal (Krt5,

green), multiciliated (β-tub, red), and luminal (Krt8, blue) cells. * P < 0.05; n.s. = not

significant. Error bars represent standard deviation.

52

3. Jag Ligands have Minimal Effects in the Establishment and Regulation of

the NE Microenvironment

Next I investigated whether Jag ligands could influence cell fate events that

ultimately regulate the PNEC pool in intrapulmonary airways, regardless of its

organization as NEBs or as solitary cells. Thus, I compared levels of Ascl1 expression in

homogenates of Jag-cnull mutant lungs at E18.5, when NEBs are already widely

distributed at branch point and internodal locations. qPCR analysis showed no difference

in Ascl1 expression between controls and mutants in any of the Jag-deficient airways

(Figure 3.3). Consistent with this, immunofluorescence for Cgrp, another established

marker of PNEC fate, did not reveal differences in its pattern of distribution suggestive of

alterations in the size of NEBS (~8-10 PNECs per NEB control, Jag1cnull, Jag2cnull, and

double Jag1cnull; Jag2cnull) or frequency in intrapulmonary airways of mutants compared

to controls (Figure 3.3B-D). Since in my mutants Jag is deleted well before epithelial

progenitors differentiate, we concluded that Jag-mediated Notch signaling is unlikely to

be involved in the mechanisms that initiate or restrict the domains of NEB or PNEC fate.

Neither NEBs nor PNECs were identified in extrapulmonary airways of mutants or

control animals.

I then examined the effect of Jag deletion in the population of secretory

progenitors known to be tightly associated with the developing NEBs. Previous studies

have shown that they arise around E14.5 immediately adjacent to Ascl1-expressing cell

clusters, being distinguished from other secretory precursors collectively by their

expression of Upk3a, SSEA1, Scgb3a2, and low levels of Cyp2f2 and CC10 (Guha et al.,

2012; Morimoto et al., 2012). Immunofluorescence of E18.5 lung sections triple-labeled

53

with SSEA1, Scgb3a2, and Cgrp identified the typical SSEA1+ Scgb3a2+ cells around

Cgrp+ clusters similarly preserved in intrapulmonary airways of Jag1cnull and Jag2cnull

mutants (Figure 3.3B-D). This contrasted with the marked difference in expression of

these markers outside the NEB microenvironment in Jag mutants (Figure 3.3 and

described above). Remarkably, in double Jag1cnull; Jag2cnull airways the only population

of cells expressing secretory markers was that associated with NEBs (Figure 3.3C, D).

As in the controls, this population was heterogeneous in labeling even in the same

airway (Figure 3.3C) and showed no evidence that it was expanded or reduced in size

relative to NEBs. Given that these cells are crucially dependent on Notch signaling and

that the only potential source of ligand should be Dll1 and/or Dll4 from PNECs, I

examined the status of local Notch activation. N1ICD immunofluorescence showed

strong labeling selectively in SSEA1+ NEB-associated cell populations of mutants,

indistinguishable from controls (Figure 3.3D). Lastly, qPCR analysis of Upk3a, another

secretory marker highly enriched in cells in the PNEC microenvironment but also present

in scattered secretory cells of intrapulmonary airways showed markedly decreased levels

of expression in double Jag1cnull; Jag2cnull lungs (Figure 3.3E). ISH of Upk3a in these

mutants showed signals restricted to branch points in proximal regions of intrapulmonary

airways associated with Ascl1-expressing NEBs (Figure 3.3F).

Together these results suggested that Jag ligands have overlapping but also

distinct roles in the cell fate specification of respiratory lineages in extrapulmonary and

intrapulmonary airways. These ligands, however, appear to be dispensable for activation

of Notch and induction of NEB-associated secretory cells, which have available Dll

54

ligands. Moreover, my data show no evidence that Jag ligands have any impact in

regulating size or frequency of NEBs.

56

Figure 3.3 Jagged-driven Notch signaling has a minimal impact on PNEC and NEB

cell fate specification or maintenance. (A) qPCR analysis of PNEC marker Ascl1 in

control or Jag-cnull mutants. There were no significant differences between control and

mutant lungs. (n=4 Jag1 control, n=3 Jag1cnull; n=4 Jag2 control; n=4 Jag2cnull; n=4

Jag1/Jag2 control; n=4 Jag1cnull; Jag2cnull). Error bars represent SEM. (B)

Immunofluorescence of secretory (Scgb3a2, green), NEB-associated secretory (SSEA1,

red), and PNEC (Cgrp, cyan) markers in control and mutants. (C) Immunofluorescence

demonstrating the undisturbed presence of the NEB microenvironment. Mature secretory

cells (CC10, green) are present throughout the airway in control lungs but there are only

low levels of CC10 surrounding NEBs (Cgrp, blue) in Jag1cnull; Jag2cnull double mutants.

NEB-associated secretory cells are labeled by SSEA1 (red). (D) Immunofluorescence

demonstrating the presence of the NEB microenvironment. NEB (Cgrp, red) and NEB-

associated secretory cells (SSEA1, green) are undisturbed in double cnull airways and

phenocopy control NEB microenvironments (inset). NEB-associated club cells (SSEA1,

red) undergo Notch1 activation (N1ICD, green) in control and double cnull mutants

(upper and lower right panels). (E) qPCR analysis of Upk3a in control and double cnull

mutants. There is almost a complete abolishment of Upk3a mRNA in double cnull

mutants. (n=3 control; n=3 double cnull). *** P<0.0005. Error bars represent SEM. (F)

Expression of Upk3a via ISH. In control airways Upk3a is predominantly surrounding

putative NEBs and is scattered throughout the airways. In double cnull mutants Upk3a

becomes restricted to the NEB microenvironment, only surrounding NEBs.

57

4. Dll Ligands Control the Size of the NEB Microenvironment

My analysis of Jag1cnull; Jag2cnull mutants identified self-contained units

comprised of Dll-expressing NEBs and immediately adjacent cells able to activate and

maintain robust Jag-independent Notch signaling for local secretory differentiation.

Previous studies in Ascl1-/- mice showed that these units were strictly dependent on

presence of NEBs (Guha et al., 2012). Questions remained whether preventing NEBs

from expressing Dll ligands would have any impact on the NEB microenvironment or

elsewhere if Jag ligands were still expressed. Unlike Jag1 and Jag2, found in largely

non-overlapping spatial and temporal patterns, Dll1 and Dll4 are collectively expressed in

a very restricted fashion to PNEC/NEB. Given the high probability of functional overlap,

we generated mouse mutants in which both Dll ligands were deleted conditionally in the

developing lung epithelium. Double deletion (Dll1cnull; Dll4cnull) was achieved from early

stages using a similar targeting strategy with a Shhcre/+ line.

Analysis of E14.5 lungs from control mice showed distinct small clusters of

Ascl1+ cells in the epithelium of proximal intrapulmonary airways consistent with the

emerging NEBs. By contrast, Dll1cnull; Dll4cnull E14.5 showed a striking expansion in the

population of Ascl1+ cells (Figure 3.4). Although individual clusters could still be

identified throughout the epithelium of main bronchi, they seem to coalesce in large

patches to form a continuous layer of Ascl1+ cells. In spite of the distribution in wider

domains in proximal airways, these cells were not seen ectopically in extrapulmonary

airways or distally in airways undergoing branching morphogenesis. These large patches

of Ascl1+ cells were identified at branch points in E18.5 lungs and by then co-expressed

Cgrp, indicating their identity as NEBs. Thus, loss of Dll ligands expanded the Ascl1+

58

pool of PNEC precursors but did not prevent them from initiating differentiation.

Interestingly, Ki67 staining showed no difference in labeling between control and double

mutants, suggesting that the NEB expansion did not result from an increase in

proliferation.

To assess the contribution of each of these ligands to the Dll1cnull; Dll4cnull

phenotype, I examined Dll1cnull and Dll4cnull individual mutants. E18.5 lungs were

isolated from single and double mutants and changes in expression of Ascl1 and Cgrp

were analyzed by qPCR in homogenates (Figure 3.4C). Double cnull mutants showed a

significant increase in these transcripts compared with control (Ascl1 P = 1.1 x 10-6;

Cgrp P = 5.9 x 10-5), consistent with the PNEC expansion. However, Cgrp mRNA was

not altered in Dll1cnull or Dll4cnull individual mutants and Ascl1 was only slightly

increased in Dll1cnull mutants. The marked difference in response of the lung in Dll1cnull;

Dll4cnull compared to single mutants suggested functional redundancy between Dll1 and

Dll4 in controlling NEB or PNEC-associated events.

To understand more precisely what these events were, I performed morphometric

analysis in E14.5 lungs to determine the impact of Dll in the size and frequency of NEBs

and PNECs (Figure 3.4D). Quantitation of the number of solitary PNECs in the airway

epithelium showed no difference between controls and any of the single or double

mutants, suggesting that Dll disruption affected primarily the NEB microenvironment.

The frequency of NEBs per airway (%) was largely unaffected, although a small

difference in Dll4 mutants reached statistical significance. However, the number of

PNECs per NEB was significantly increased in both the Dll1cnull; Dll4cnull and single

59

Dll4cnull airways, suggestive that the size of NEBs was dramatically altered in these

mutants.

These data were consistent with the idea that the mechanisms that restrict PNEC

fate and limit expansion of NEB were severely disrupted in Dll mutants.

61

Figure 3.4. Loss of Dll-driven Notch signaling results in an expansion of the NEB

microenvironment. (A) Immunofluorescence of PNEC (Ascl1, green) in control and

double null mutants at E14.5. There is a vast expansion of the size of NEBs in

intrapulmonary airways in mutant versus control. (B) Immunofluorescence demonstrating

the expansion of NEB size at E18.5. PNECs (Ascl1, green and Cgrp, red in top two rows)

are abundant in mutant versus control airways. The great increase in PNECs is not due to

proliferation (Ki67, red, lower two rows). (C) qPCR analysis of PNEC markers Ascl1 and

Cgrp at E18.5. Both are significantly upregulated in double null mutants as compared

with control (n=3 Dll1 control, n=5 Dll1cnull for Ascl1 and n=4 Dll1 control, n=6 Dll1cnull

for Cgrp; n=3 Dll4 control n=6 Dll4cnull for Ascl1 and Cgrp; n=3 Dll1/Dll4 control; n=3

Dll1cnull; Dll4cnull for Ascl1 and Cgrp). Error bars represent SEM. ***P<0.0005; n.s., not

significant. (D) Morphometric analysis of PNECs and NEBs in E14.5 control and mutant

lungs. Left panel: NEB size as determined by number of PNECs per NEB. Center panel:

solitary PNEC per airway. Right panel: number of NEBs per airway. *P<0.05;

**P<0.005; *** P<0.0005; n.s., not significant.

62

5. Notch Signaling and NEB-associated Club Cells are Preserved in the Absence

of Dll Ligands

The strikingly preserved integrity of the NEB microenvironment seen in double

Jag-cnull mutants led me to hypothesize that Dll1 and Dll4 were not only necessary and

sufficient to activate local Notch signaling but also endowed the unique features of the

NEB-associated club cells that distinguish them from club cells elsewhere. The absence

of the Dll ligands in the expanded population of NEB of double Dll mutants provided an

opportunity to examine this issue. First, I asked whether the robust activation of Notch

signaling observed in NEB-associated club cells of Jag-cnull double mutants was also

present in this same population of Dll1cnull; Dll4cnull.

Double immunofluorescence for Ascl1 and N1ICD in E18.5 lung sections showed

distinctive non-overlapping nuclear labeling in NEBs and NEB-associated cells,

respectively. N1ICD signals were equally strong in control and mutant airways. The

identity of each of these cell populations as components of the NEB microenvironment

was further confirmed by immunostaining with SSEA1 and Cgrp (Figure 3.5A, B).

Notably, the extended PNEC domain in the airway epithelium of these mutants was

accompanied by an expanded population of NEB-associated secretory cells. This was

already supported by the extended domain of expression of SSEA1 and N1ICD in E18.5

Dll1cnull; Dll4cnull compared to control. In addition, qPCR analysis showed that even in

lung homogenates, the increase in expression of markers of PNEC fate (Ascl1, Cgrp) was

accompanied by a significant increase in the NEB-associated secretory marker Upk3a.

Importantly, neither Scgb1a1, nor Foxj1, which mark predominantly non-NEB associated

secretory and multiciliated cells, respectively, was significantly altered in Dll1cnull;

63

Dll4cnull airways (Figure 3.5B). I performed double ISH/IHC to further examine how the

increase in Upk3a expression correlated spatially with the expansion of NEBs. Analysis

of E18.5 lungs showed large groups of cells labeled with Upk3a. These large cell clusters

were limited to the areas immediately adjacent to the Ascl1-expressing NEBs but not

outside this microenvironment and, as in controls, had variable levels of Upk3a (Figure

3.5C).

Together the data strongly suggested that, in spite of the inability to express Dll1

and Dll4, key known features of the NEB microenvironment are preserved in these

mutants likely by Jag ligand activation of Notch signaling. Thus, the preserved Jag-

Notch signaling in intrapulmonary areas of Dll1cnull; Dll4cnull mutants establishes the

normal balance of multiciliated-secretory differentiation. However, intriguingly, neither

the loss of Dll nor the activation of Jag-Notch prevent the appearance of the distinct

features of NEB-associated secretory cells.

65

Figure 3.5. Loss of Delta-driven Notch signaling results in an expansion of the NEB

microenvironment. (A) Immunofluorescence analysis demonstrating that the NEB

microenvironment is maintained in Dll1cnull; Dll4cnull mutants. Top row: NEB-associated

secretory cells adjacent to PNECs (Ascl1, green) express N1ICD (red) in both control and

double cnull mutants, demonstrating that these cells undergo Notch activation. Middle

row: SSEA1+ (green) NEB-associated secretory cells undergo Notch activation (N1ICD,

red) in control and double mutant airways. Bottom row: the NEB microenvironment is

expanded in double cnull mutants. PNECs (Cgrp, red); NEB-associated secretory cells

(SSEA1, green). (B) qPCR analysis of NEB-associated secretory cell marker Upk3a,

mature club cell marker Scgb1a1, and multiciliated cell marker Foxj1 in control and

double cnull mutants (n=3 for controls and double cnull mutants) * P<0.05. Error bars

represent SEM. (C) Double ISH-IHC against Upk3a (purple) and Ascl1 (brown)

demonstrating an expansion in the size of the NEB microenvironment in double cnull

mutants.

66

6. Preliminary Postnatal Analysis of Dll-cnull Mutants Demonstrate a Defect in

Alveolarization

Although my studies focused on embryonic development, I allowed several litters

from Dll1flox/flox; Dll4flox/flox females bred with Dll1flox/+; Dll4flox/+; Shhcre/+ males to be

born. Most Dll1cnull; Dll4cnull mice died in utero (at or before E18.5) or at birth therefore

we were unable to perform a systematic analysis of the postnatal events in these mutants.

However, in the rare mutants that survived to adulthood, I found important morphological

differences compared to controls (Figure 3.6). Dll1flox/flox; Dll4flox/+; Shhcre/+ (Dll1cnull;

Dll4chet) or Dll1flox/+; Dll4flox/flox; Shhcre/+ (Dll1chet; Dll4cnull) mice were overall

significantly smaller in body size than their control littermates and possessed craniofacial

malformations (Figure 3.6A). This phenotype was more severe in mutants with

homozygous deletion of Dll1 and heterozygous deletion of Dll4. At PN21 their lungs

were smaller proportionally to their body size (Figure 3.6B). Histological analysis

showed enlarged alveolar airspaces and overall simplification of the distal architecture

suggestive of a defect in alveolar formation. The abnormal alveolar enlargement is

reminiscent of findings reported in Pofut1flox/flox; Shhcre/+ and Notch2flox/flox; Shhcre/+

mutants (Tsao et al., 2016). It is possible that Delta-driven Notch signaling plays a role in

postnatal morphogenesis of the alveolar compartment of the lungs. Further studies are

needed to determine how this occurs but these are beyond the scope of my thesis.

68

Figure 3.6 Delta-chet/cnull animals survive past birth but demonstrate significant

morphological defects. (A) Delta-cnull animals are smaller than littermates and show

cranial malformations. Littermates at age PN21. Left: Dll1flox/+; Dll4flox/flox; Shh+/+ control

littermate. Center: Dll1chet; Dll4cnull mutant. Right: Dll1cnull; Dll4chet mutant. Mutants are

smaller than control littermates and possess craniofacial malformations. (B) Control (left)

and Dll1cnull; Dll4chet (right) lungs. Mutant lungs were smaller than control but were

proportionate to their observed body size. (C) Control (left) and Dll1cnull; Dll4chet mutant

(right) lung sections showing alveolar airspace enlargement in mutant lungs.

69

V. Discussion and Future Directions

The results from this study provide evidence for distinct roles of Notch ligand

families in airway progenitor cell differentiation during development. Jagged-driven

Notch signaling was found to be essential for regulating multiciliated versus club cell fate

with minimal effect on PNECs or the NEB microenvironment. In double Jag-cnull

airways the epithelium was overpopulated with multiciliated cells at the cost of club cells

except those surrounding NEBs. The data also showed that Delta-driven Notch signaling

preferentially regulates NEB size and PNEC versus club cell fate; double Delta-cnull

mouse airways had excess PNECs and NEB-CCs. NEB-CCs can have their Notch

receptors activated by either Jagged or Delta ligands but ultimately require Notch for

their cell fate.

Attempts to generate quadruple Jag; Dll knockouts were made but after

unsuccessful trials this goal was abandoned. Both Dll4 and Jag1 are located on

Chromosome 2 thereby making recombination events rare and difficult to attain. I predict

the phenotype of a quadruple knockout will recapitulate results previously reported in

Rbpjflox/flox; Shhcre/+ mice.

NEB-CCs were present in both double Jag-cnull and double Dll-cnull mice, thus

these cells can have their Notch receptors activated by either ligand family. It is unclear,

however, whether there is a preference for one ligand family over the other. Lfng has

been reported to be present in PNECs and it is known to promote Delta-driven Notch

activation (Xu et al., 2010). A recent study in post-mitotic secretory cells of the upper

crypt of the intestinal epithelium found that LFNG promotes DLL surface expression in

ligand-presenting cells and promotes Notch activation in neighboring cells (Kadur

70

Lakshminarasimha Murthy et al., 2018). It is possible that in wild type conditions there is

a preference for activation of Notch in NEB-CCs by Dll expressed in neighboring NEBs,

but in double Dll-cnull this preference is lost and cells could instead be Notch-activated

by Jag from multiciliated cells.

An alternative hypothesis is that there is a currently unidentified signal inherently

present in PNECs which has the ability to activate or modulate Notch signaling in NEB-

CCs to confer their unique features. It has been reported that Rbpjflox/flox; Shhcre/+ mice

have increased numbers of PNECs and a loss of all secretory cells, suggesting NEB-CCs

require Notch to be specified (Tsao et al., 2009). Additionally, the inability of Ascl1-/-

mice to form PNECs and NEB-CCs suggest that NEB-CCs require the presence of

PNECs (Borges et al., 1997; Guha et al., 2012). These reports, along with my results that

loss of both Dll ligand members does not abolish the NEB-CCs or their unique features

suggests that there may exist a signal in PNECs that can activate Notch in NEB-CCs. It is

tempting to speculate that a candidate signal could be the CCN family member Nov.

There is evidence that Nov is a diffusible short-range signal that can act as a Notch ligand

or co-activator activating or modulating Notch signaling (Sakamoto et al., 2002; Wang,

2011). Preliminary studies in my lab identified Nov strongly expressed in NEBs of the

developing lung epithelium. Analysis of Rbpjcnull (Rbpjflox/flox; Shhcre/+) mice showed

increased Nov expression consistent with the expansion of NEBs seen in these mutants.

Studies were designed to identify these putative signals by sorting PNECs from

Ascl1GFP lungs at E14.5 and E18.5 to characterize their transcriptional profile. However,

E14.5 cell yields (obtained via collaboration with Ms. Trisha Savage of the Jane Johnson

Laboratory at UT Southwestern) were insufficient due to a much weaker reporter

71

expression in the developing lung compared to the brain (Leung et al., 2007; Figure 3.7).

Thus these experiments could not be performed.

73

Figure 3.7. FACS evolution of GFP+ cells from Ascl1GFP E14.5 mouse lungs. Sufficient

numbers of GFP+ cells could not be attained for transcriptional analysis. (A-D) FACS

plots from four different lungs. DsRED served as negative control. (E) Table showing the

amount of GFP+ and GFP- cells from each lung.

74

Because reporter expression was weak in Ascl1GFP mice, I reasoned that it may be

possible to isolate PNECs from an alternative mouse model. A knock-in mouse strain,

Ascl1tm1.1(Cre/ERT2)Jejo had been recently reported with targeted integration of CreERTT2

into the Ascl1 locus (Kim et al., 2011). I generated Ascl1creERT2/+; R26tdTomato mice and

intraperitoneally administered tamoxifen to pregnant mothers at E9.5 or E12.5. Embryos

were analyzed at E14.5, a stage when Ascl1 expression is broader in forming NEBs as

compared to later stages. Immunofluorescence showed tdTomato labeling in the E14.5

brain and lungs (Figure 3.8A, B). Interestingly, while signals could be identified in

PNECs, tdTomato also labeled the neural tissue associated with the intrapulmonary

airways (innervation) (Figure 3.8B, C). Because nerves were also labeled, I deemed this

approach inadequate for PNEC isolation studies, since a pure population of PNECs

would not be obtained if cells were sorted out for tdTomato. A subsequent experiment

injecting TMX at E12.5 and sacrificing mice at E14.5 revealed off-target labeling in the

mesenchyme (left panel) and low efficiency of labeling Ascl1+ cells in NEBs (right

panel) (Figure 3.8D). Thus, this mouse model proved to be not suitable to accomplish this

goal.

Further studies in our lab are being carried out by a colleague using single cell

RNA sequencing of E14.5 lungs which may yield information about signaling pathways

expressed in PNECs and their potential role in maintaining the NEB microenvironment.

76

Figure 3.8. Lineage tracing of Ascl1 progenitors is an inadequate method to isolate

PNECs for RNA sequencing. (A-C) Ascl1creERT2/+; R26tdTomato embryos injected at E9.5

and sacrificed at E14.5. (A) Brain (control) demonstrating tdTomato labeling of Ascl1+

neurons and descendants. (B) Whole lung image demonstrating tdTomato labeling in

intrapulmonary nerves (white boxes), making this method ineffective for RNA

sequencing of a pure population. (C) Sections of extrapulmonary and intrapulmonary

airways showing some but not all Ascl1 (green) expressing cells double labeled with

tdTomato (D) Ascl1creERT2/+; R26tdTomato lung from an embryo injected at E12.5 and

sacrificed at E14.5. Whole lung sections (left) demonstrating off-target labeling. Right

panel demonstrates lineage labeling in some PNECs (arrow).

77

In summary, studies in this section determined that NEB-CCs are minimally

affected by Jag ligands and require Dll ligands to restrict the size of the NEB

microenvironment. Future studies may yield insight into postnatal effects of ligand loss

and relevance to human disease.

78

CHAPTER FOUR

Identification of Ascl1 Targets in Pulmonary Neuroendocrine Cell Progenitors of

the Developing Lung

I. Abstract

Ascl1 is widely known as a master regulator of neuroendocrine fate across

species. Mice deficient in Ascl1 lack neuroendocrine cells in multiple organs including

the lung. Conversely, there exists a number of human diseases related to aberrant

formation, differentiation, and proliferation of pulmonary neuroendocrine cells (PNECs).

Understanding normal homeostatic development of PNECs is crucial in order to

recognize what goes wrong during disease.

To better understand the role of Ascl1 and related genes I analyzed microarray

data from Ascl1-/- embryonic mutant lungs that lack PNECs and found a number of genes

that may be relevant in neuroendocrine cell development and formation of the

neuroepithelial body microenvironment. Two main groups of genes were found, those

that colocalized with Ascl1 expression and those that colocalized with the NEB

microenvironment. Of particular interest is tyrosine hydroxylase (Th), a member of the

catecholamine biosynthesis pathway, which I demonstrate to be expressed in PNECs at

both E14.5 and E18.5. Pharmacological interruption of this enzyme in embryonic lung

cultures via metyrosine administration resulted in an expansion of PNECs and therefore

larger neuroepithelial bodies (NEBs). Future studies are needed to confirm this effect and

understand the role that catecholamines may play in NEB size regulation and any role in

disease.

79

II. Introduction

Pulmonary neuroendocrine cells (PNECs) are a rare endoderm-derived airway

epithelial cell that comprise approximately 1% of the airway epithelium (Kuo and

Krasnow, 2015; Noguchi et al., 2015). PNECs can be found as solitary cells or in

clusters, known as neuroepithelial bodies (NEBs) that are innervated by both afferent and

efferent neurons (Brouns et al., 2009). NEBs are involved in multiple human conditions,

including cancer. Aberrant formation, differentiation, and proliferation of PNECs has

been associated with rare conditions such as Neuroendocrine Hyperplasia of Infancy

(NEHI), a pediatric disorder where there is an increase in the size and number of NEBs

and abnormal presence of solitary PNECs in distal airways and Diffuse Idiopathic

Pulmonary Neuroendocrine Cell Hyperplasia (DIPNECH), an adult disorder where there

is an increase in PNEC hyperplasia; as well as common disorders such as

bronchopulmonary dysplasia, asthma, chronic obstructive pulmonary disorder (COPD),

and small cell lung cancer (SCLC), amongst others (Gould et al., 1983; DeLellis, 2001;

Deterding 2005; Brody and Crotty, 2006; Davies et al., 2007; Glasser et al., 2010; Young

2011; Koliakos et al., 2017; Garg et al., 2019).Therefore understanding the ontogeny and

maturation of PNECs is of high significance.

Neuroendocrine fate is dependent on the expression of Ascl1. Homozygous

disruption of Ascl1 was demonstrated to prevent formation of neuroendocrine cells in

multiple organs, including the thyroid, adrenal medulla, the glandular stomach, and the

lung (Borges et al., 1997; Lanigan et al., 1997; Huber et al., 2002; Kameda et al., 2007;

Kokubu et al., 2008). Thus, investigating the gene network controlled by Ascl1 can

provide insights about mechanisms that control expansion and maturation of PNECs in

80

the developing lung. Additionally, there is a possibility of discovering new markers of

neuroendocrine cells by exploring genes that are differentially up- or downregulated in

Ascl1-/- developing lungs. An RNA microarray analysis of E14.5 from WT and Ascl1-/-

mice previously generated in my lab was used for this study. This developmental stage

was chosen due to the larger proportion of nascent Ascl1+ PNECs in the airways

compared to later stages. Also, in spite of its expression in broader domains at E14.5,

Ascl1 at this stage is still largely restricted to the most proximal generation of airways.

Thus, differences in gene expression resulting from the deletion of Ascl1 could be more

easily detected.

81


1. RNA Microarray

The Affymetrix GeneChip Mouse Gene 1.0 ST array, which measures mRNA and

covers 26,166 RefSeq transcripts and 21,041 Entrez genes, was used for comparison of

control and Ascl1-/- E14.5 dissected lungs (n=3 each) (Guillemot et al., 1993). Ascl1-/-

mice lack the protein-coding sequence of Ascl1, located in a single exon (Guillemot et al.,

1993). The Ascl1-/- mice were generated and lungs dissected, and the microarray

performed by Dr. Arjun Guha, a former member of the Cardoso laboratory. I then

analyzed these microarray data and generated a heat map for the top 50 downregulated or

upregulated genes using relative gene values as signified by RMA (Babicki et al., 2016).

2. Gene Ontology Analysis

Gene ontology analysis was performed using Gene Ontology enRIchment anaLysis

and visuaLizAtion (GOrilla) software (Eden et al., 2007; Eden et al., 2009). To analyze the

gene list for ontology analysis, I used the background of all genes that were analyzed in

the microarray versus all genes that were downregulated or upregulated. This then

generated a set of GO processes that were enriched in our gene set as compared to the

background list of all genes.

3. In Situ Hybridization

In situ hybridization (ISH) was performed as previously described in prior

sections of this thesis using digoxigenin-labeled UTP anti-sense RNA probes. Sections of

WT E14.5 and E18.5 embryonic lungs were used to map the spatial and temporal pattern

82

of expression of the selected genes differentially expressed in Ascl1-/- versus WT lungs.

Primer sequences used to generate probes are in table 4.1. T7 or T3 sequences were

added to forward or reverse primers, respectively.

Gene Forward Reverse

Ascl1 TCGTCCTCTCCGGAACTGAT AGAAGCAAAGACCGTGGGAG

Atf5 TAGGCTTCCCCTCTGCCTAA TCCCCCTACACCCAACTAGG

Ctf1 CCATCTGTCTCCCTGTGATCC CAGCCTAGGGCGGTATGAAA

Gabra5 TAGGAAACCCCACTCCCACA CTGTTGGCTGGGAAAAACCG

Hand2 CCTGGAGCTCAAGCAGTGAA AGAATGACGGGGGTCCCTTA

Hoxd9 GCAGCGACTCGGACTTTCTT CCTTGAGCAGCTGAGTTGGA

Insm1 GAACTGTGCCTTCACTCGGA GTCCAAAGGAGTCACAGCGA

Lif CTCTCTGGCACCCCCTAGAT AGCTTCCATGCTGGTCGAAA

Neurod2 GACCTGGGAACAGCCTTACC AAAATTGCGTGTGTGGGGTG

Ntrk2 GCCAGCAGTACCTGGCATTA GGTCAATTGGCCATCCCTCT

Olfm3 GTATGCTTGCGGTTGGGTTG AAGGTAGCAATCTGGGCGTC

Phox2b GGTTTTGGTCTTGCGAACCC GTTGCGCTAATGGCGAGATG

Slc4a10 ACAAGGGTTGCTTCCCGAAT ACAGTTGGAGACCTGTTGGT

Th TCTTGAAGGAACGGACTGGC CACCGGCTGGTAGGTTTGAT

Tomt ATGGCATAGCCCAACTCACC GCCTCTTGCTTCCAGTTCCT

Table 4.1. Forward and reverse primers for top 15 downregulated genes following gene

ontology analysis. These primers were used to generate anti-sense RNA ISH probes.

83

4. Immunohistochemistry

Sections that underwent in situ hybridization were double stained for an antibody

against Ascl1 (BD #556604) using standard immunohistochemistry methods previously

described.

Organ culture samples underwent fixation with 4% paraformaldehyde in 1X PBS

overnight at 4 °C and were frozen embedded in OCT following incubation in 15%

sucrose in 1X PBS and 30% sucrose in 1X PBS for 4 hours and overnight, respectively.

Following embedding, 7 μm thick sections were cut and samples were processed for

immunofluorescence following previously described methods in this thesis for Ascl1 or

Ki67 (Cell Signaling #9129S).

5. Lung Organ Culture

E12.5 lungs isolated from CD1 WT mice were cultured for 48 hours on transwells

with BGJb media containing 1% FBS, 1% Penicillin/Streptomycin, and 25% w/v of

ascorbic acid. Organ cultures were treated for 48 hours with DMSO (vehicle control) or

0.5 mM metyrosine diluted in DMSO (Sigma #1443205).

84

IV. Results

1. Genes Differentially Expressed in Ascl1-/- Embryonic Lungs

As an initial step in the analysis of the microarray dataset, the top 50

downregulated or upregulated genes were identified in control versus Ascl1-/- lungs.

Genes were selected based on statistical significance and P values greater than 0.05 were

excluded from the analysis. The ranking was then performed based on the log2 fold

change among the list of genes with P < 0.05. The top 50 downregulated genes are shown

in the heat map in Figure 4.1 and the top 50 upregulated genes are shown in the heat map

in Figure 4.2.

Ascl1 was significantly downregulated in the array (log2 FC = -0.43, P = 0.046)

thus confirming the accuracy of the microarray approach to identify Ascl1 targets.

Moreover, Scgb3a2 was highly downregulated in this microarray (log2 FC = -0.58, P =

0.047). Scgb3a2 is a known marker of airway club cells, which along with PNECs,

comprise the NEB microenvironment. Downregulation of this gene is consistent with the

requirement of Ascl1 for specification and maintenance of the NEB and its

microenvironment. Thus, this array analysis will also provide the opportunity to identify

genes relevant to development of NEB-associated club cells.

85

Figure 4.1. Heat map of top 50 significantly downregulated genes of interest in control

(Control (1), Control (2), Control (3)) and Ascl1-/- (Ascl1-/- (1), Ascl1-/- (2), Ascl1-/- (3))

E14.5 lungs. Red signifies lower levels whereas green signifies higher levels of

expression.

86

Figure 4.2. Heat map of top 50 significantly upregulated genes of interest in control

(Control (1), Control (2), Control (3)) and Ascl1-/- (Ascl1-/- (1), Ascl1-/- (2), Ascl1-/- (3))

E14.5 lungs. Red signifies lower levels whereas green signifies higher levels of

expression.

87

A number of olfactory receptor (OR) genes were found to be downregulated in

the Ascl1-/- lungs. ORs can detect environmental odorants (volatile and non-volatile) and

are highly expressed in a variety of cancers including non-small-cell lung cancer (Kalbe,

et al., 2017; Maßberg and Hatt, 2018). In PNECs ORs have been demonstrated to

influence serotonin release; stimulation by odorants results in decreased serotonin levels

which leads to release of Cgrp and local stimulation of neighboring basal cells and airway

smooth muscles (Gu et al., 2013; Gu et al., 2014). Of the top 30 downregulated genes

identified by our array, seven were ORs. Overall 61 OR genes were downregulated in

Ascl1-/- lungs (not shown). Gene names and human orthologues of the top seven

downregulated OR family genes are presented in Table 4.2. A study in airway epithelial

cells from human lungs or in primary cell culture also identified members of the OR

family expressed in PNECs (Gu et al., 2014). This study showed that PNECs expressed

OR2W1 (Olfr263/Olfr1369-ps1) and a subset of PNECs expressed OR2F1

(Olfr38/Olfr452/Olfr453). The olfactory receptors I identified in our array may label

subsets of PNECs responsible for chemosensory function.

88

Mouse gene Human orthologue log2 FC

Olfr503 OR52N4 -0.67

Olfr1062 OR8J3, OR8J1 -0.63

Olfr1029 OR5M11 -0.61

Olfr707 OR2D3 -0.56

Olfr1128 OR5W1P -0.55

Olfr1152 OR5W2 -0.48

Olfr394 OR1E1*, OR1E2* -0.47

Olfr1356 OR7C2* -0.41

Olfr160 OR8A1 -0.40

Olfr1282 OR4F17 -0.37

Olfr229 OR8G2P -0.37

Table 4.2. Olfactory receptor genes significantly downregulated in the Ascl1-/- E14.5

microarray from the top 50 downregulated genes. (*) Asterisk depicts olfactory receptor

gene also identified in human airway epithelia (Gu et al., 2014).

2. Gene Ontology Analysis

Gene ontology analysis identified a number of biological processes enriched for

in the gene sets differentially expressed in Ascl1-/- and WT lungs (Figures 4.3 and 4.4).

Of particular interest among the downregulated genes were those related to “neuron

development,” “noradrenergic neuron development,” “adrenal chromaffin cell

differentiation,” and “peripheral nervous system neuron development.” While adrenal

chromaffin cells derive from the neural crest and PNEC derive from the endoderm, they

both rely on Ascl1 for cell fate (Borges et al., 1997; Huber et al., 2002; Kuo and

Krasnow, 2015). The importance of Ascl1 in neuron development raised the possibility

that genes downregulated in our array could be relevant here. The top 15 genes related to

these GO processes are listed in Table 4.3.

Upregulated genes in Ascl1-/- lungs were related to actin filament-based processes

including movement; cell-cell adhesion mediated by cadherin; and osteoclast

89

differentiation (Figure 4.4). For the purpose of this thesis I focused on the genes that were

downregulated in mutants since they showed fold changes statistically higher than those

upregulated. Analysis of upregulated genes in Ascl1-/- lungs shall be pursued in the future.

90

Figure 4.3. Gene ontology analysis results for all downregulated genes in the array. Of

particular interest are terms highlighted in yellow and orange as these were the enriched

biological processes terms.

91

Figure 4.4. Gene ontology analysis results for all upregulated genes in the array. Of

particular interest are terms highlighted in yellow as these were the enriched biological

processes terms.

92

Name Description p value log2 FC

Hoxd9A,D Homeobox D9 0.007 -0.50

Ascl1A,B,C Achaete-scute complex homolog 1 (Drosophila) 0.046 -0.43

LifA Leukemia inhibitory factor 0.018 -0.35

ThA Tyrosine hydroxylase 0.043 -0.32

Insm1A,B,C Insulinoma-associated 1 0.007 -0.28

Atf5A Activating transcription factor 5 0.015 -0.25

Ctf1A Cardiotrophin 1 0.045 -0.23

Olfm3A Olfactomedin 3 0.001 -0.23

Hand2A,D Heart and neural crest derivatives expressed transcript 2 0.010 -0.21

Slc4a10A Solute carrier family 4, sodium bicarbonate cotransporter-

like, member 10

0.015 -0.18

Ntrk2A,D Neurotrophic tyrosine kinase, receptor, type 2 0.013 -0.15

Gabra5A Gamma-aminobutyric acid (GABA) A receptor, subunit

alpha 5

0.049 -0.11

Neurod2A Neurogenic differentiation 2 0.017 -0.11

TomtA Transmembrane O-methyltransferase 4.11E-05 -0.10

Phox2bA,B Paired-like homeobox 2b 0.026 -0.07

Table 4.3. Top 15-downregulated genes in E14.5 Ascl1-/- mouse lungs following gene

ontology analysis. ANeuron development, BNoradranergic neuron development, cAdrenal

chromaffin cell differentiation, DPeripheral nervous system neuron development.

93

3. Localization of Top 15-Downregulated Genes of Interest

To identify the sites of expression of the top 15 downregulated genes and

determine their relation to PNECs I generated RNA antisense probes for each of these

genes and performed in situ hybridization in E14.5 and E18.5 sections (Figure 4.6).

Several of these genes were found in PNECs (Atf5, Ctf1, Hand2, Insm1, Neurod2, and

Phox2b) (Figure 4.6). Others were in the region immediately adjacent, presumably under

the influence of Ascl1+ cells, in the NEB microenvironment (Gabra5, Hoxd9, Lif,

Slc4a10, Tomt) (Figure 4.7). Olfm3 and Ntrk2 were not detected in the airway epithelium

(not shown). Th expression will be described in the next section.

A recent study showed that PNECs require Insm1 not for their specification but

for their differentiation and that loss of Insm1 upregulates Hes1 and interferes with PNEC

differentiation (Jia et al., 2015). Thus, an Insm1-dependent Hes1 repression appears to be

required for proper PNEC development. INSM1 was also found to be a marker for

neuroendocrine and neuroepithelial neoplasms (Rosenbaum et al., 2015).

Hand2, Neurod2, and Phox2b have also been shown to play important roles in

neuroendocrine development in other organ systems (Huber et al., 2002; McCormick et

al., 1996; Huang et al., 2002; Huber et al., 2005).

Interestingly, Ascl1, Phox2b, Insm1, Hand2, and Th are components of a pathway

critical for noradrenergic neuron development (Kameda, 2014). All except Th are

transcription factors. Phox2b has been demonstrated to be critical in regulating

expression of Dβh and Th, members of the catecholamine biosynthesis pathway, as well

as maintaining expression of Ascl1 and Hand2 (Pattyn et al., 1999).

94

Ctf1 is expressed in pancreatic beta cells and has been shown to have an anti-

apoptotic effect in these cells in WT conditions while having a stimulatory effect on

insulin secretion in the presence of glucose (Jiménez-González et al., 2013).

Atf5 shows a pattern of expression similar to that of Ascl1 (Figures 4.5 and 4.6).

The expression levels of Ascl1 are not affected in the Atf5-/- olfactory, suggesting that

Atf5 is not upstream of Ascl1 however there is no information whether Atf5 regulates

PNEC development (Wang et al., 2012).

Figure 4.5. Atf5 expression at E14.5

95

Some of the genes found to be strongly expressed at E14.5 showed only weak or

no signals in E18.5 lung suggesting a potential role as early markers or regulators of NEB

development. This was the case for Atf5, Gabra5, Neurod2, Phox2b, and Tomt. It would

be of interest to examine expression patterns at the onset of Ascl1 expression (E12.5) and

explore the possibility that genes identified in this screen may also be involved in

regulatory loops during PNEC cell fate selection.

96

Figure 4.6. Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray at E14.5

and E18.5 that colocalized with Ascl1+ PNECs. All sections were co-labeled with an antibody

against Ascl1.

98

Figure 4.7. Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray

at E14.5 and E18.5 that were in the NEB microenvironment. All sections were co-labeled

with an antibody against Ascl1.

99

4. Potential Role for Catecholamines in Pulmonary Neuroepithelial Body

Expansion

Tyrosine hydroxylase (Th) was selected here to illustrate how genes identified in

this screen can be further explored functionally in NEB development. This protein is a

member of the catecholamine biosynthesis pathway and is responsible for converting

tyrosine to L-DOPA to allow for subsequent production by dopamine decarboxylase and

ultimately generate epinephrine (Figure 4.8) (Kuhar et al., 1999). In our array, Th

(P = 0.043), Ddc (P = 0.033), and Dβh (P = 0.042) were significantly downregulated in

Ascl1-/- lungs.

Figure 4.8. Catecholamine biosynthesis pathway. Metyrosine blocks the function of

tyrosine hydroxylase and thus production of L-DOPA.

Previous studies have demonstrated the ability of PNEC to express Ddc and

therefore produce dopamine, thus I was especially interested if there exists a role for Th

in PNEC maintenance or NEB expansion (Lauweryns and van Ranst, 1988). I first

examined the wild type expression patterns of Th in the lung (Figure 4.9). An antisense

RNA probe was generated to assess Th mRNA distribution by ISH. At E14.5, Th was

predominantly seen in the epithelium of the airways overlapping with PNECs, but was

also detected in non-NE epithelial cells in airways (Figure 4.9A, B). This pattern

100

persisted at E18.5 (Figure 4.9C). To determine if Th protein was present

immunofluorescence was also performed in developing airways. The Th antibody labeled

a subpopulation of the Th mRNA-expressing epithelial cells, suggesting that this protein

may be already active at least in some of these epithelial progenitors (Figure 4.9D-F).

101

Figure 4.9. Expression of Th and Th in the developing airways. In situ hybridization

using antisense probes against Th (positive regions in purple) at E14.5 (A) and co-

staining with an antibody against Ascl1 (brown) at E14.5 (B) and E18.5 (C).

Immunofluorescence of Th protein (green) in an airway of E14.5 lungs (D-F).

102

Metyrosine is a known inhibitor of tyrosine hydroxylase function (Weissman and

Koe, 1965). To investigate the role of tyrosine hydroxylase in PNEC development

embryonic lungs were isolated from E12.5 WT CD1 mice and cultured in control

(DMSO) or 0.5 mM metyrosine-containing media for 48 hours (Galloway et al, 1982).

Analysis of these explants did not reveal any consistent effect in the overall morphology

or pattern of branching (Figure 4.10A). However, when stained with Ascl1 antibody,

metyrosine cultures showed large clusters with a significant increase in the number of

Ascl1-expressing cells compared to controls (P = 0.0009, Figure 4.10C). This suggested

either an increase in proliferation of PNECs or a change in cell fate specification.

Immunostaining for Ki67 in serial sections indicated that PNECs are not proliferating

following treatment with metyrosine thereby suggesting a change in progenitor cell fate

specification or transdifferentiation (Figure 4.10B).

104

Figure 4.10. Inhibition of tyrosine hydroxylase function in lung explant cultures. (A)

Freshly isolated left lung explant (top) at 0h (E12.5) and after 48h of culture (bottom). No

significnat morphological differences between control and treated lungs were observed.

(B) Immunofluorsence of Ascl1 and Ki67 in sections of 48h cultures. Increase in the

number of Ascl1+ cells in 0.5mM metyrosine treated samples but similar Ki67 labeling

in control and treated lungs. (C) Morphometric analysis confirms a significant increase in

Ascl1+ cells suggesting an increase in the PNEC popultion in metyrosine treated cultures.

105

V. Discussion and Future Directions

Previous studies in the pituitary gland demonstrated that mouse mutants lacking

the D2 dopamine receptor undergo lactotroph (pituitary neuroendocrine cell) hyperplasia

which ultimately results in production of tumors. The same study concluded that there

was an antiproliferative role of dopamine in neuroendocrine cells (Saiardi et al., 1997). It

is intriguing that an expansion in the PNEC population was also obtained with

pharmacological inhibition of Th function, however without the effect in proliferation

reported in the pituitary gland. It is also of interest that Th is expressed relatively early in

the airways, when NEBs are still forming and potentially even at the onset of NEB

formation. It is possible that the PNECs secrete dopamine as a means of self-regulation to

prevent NEB size from becoming too large.

Future studies will determine if the addition of dopamine (using a

pharmacological agonist) alters the number of PNECs per NEB, implicating dopamine in

PNEC development. Moreover, further examination of the spatial distribution of

dopamine receptors may yield insight into the populations potentially affected by

production of dopamine by PNECs. To my knowledge there are no published studies

demonstrating a role for dopamine in the lung, however there are in situ hybridization

data suggesting these receptors are expressed in the lung (Figure 4.11).

106

Figure 4.11. In situ hybridization expression of dopamine receptors 1a (left), and 2

(right) in E14.5 lungs. Images from EurExpress Database.

Both Drd1aflox/flox and Drd2flox/flox mice are available which could then be crossed

with Shhcre/+ mice or with an Ascl1CreERT2/+ mouse line to delete receptors in the lung

epithelium or in neuroendocrine cells only, respectively. Should these receptors be

expressed in another specific subset of airway epithelial cells, there are a variety of cre-

driving lines which could be used to specifically delete the receptors in those cells. The

functional consequences of dopamine-producing neuroendocrine cells could then be

examined more closely.

Hand2 is another gene of interest identified in Ascl1-/- mutants. Hand2 has been

shown to regulate differentiation of Th+ neurons and thus production of catecholamines

(Lucas et al., 2006; Morikawa et al., 2007). In our array, Hand2 was significantly down-

regulated, which could explain why Th, Ddc, and Dβh expression levels were

significantly down-regulated in Ascl1-/- animals. Previous studies have determined the

importance of Hand2 in chromaffin cell development, the neuroendocrine cells of the

107

adrenal medulla (Huber et al. 2002). It is possible that Hand2 acts downstream of Ascl1

to regulate Th expression in PNECs. Since my preliminary study showed that inhibition

of tyrosine hydroxylase expands PNECs, it is possible that Hand2 regulates PNEC

expansion through Th. To explore this possibility, spatial and temporal expression of

Hand2 should be investigated at both early (E12.5) and later (E14.5, E18.5) time points.

If Hand2 protein is in fact expressed by PNECs, as suggested by in situ hybridization data

(Figure 4.6), functional studies can be conducted in Hand2flox/flox mice crossed with

Shhcre/+ mice to examine its role in the developing airways.

In summary, the microarray analysis of the Ascl1 targets in the developing lung

has identified a number of genes that label PNECs or the NEB microenvironment. Some

of these are likely to be early PNEC markers while others, such as Th, may have a

regulator function as suggested by the experiments in which Th-dopamine signaling was

shown to control NEB size. Future studies are required to better understand how these

genes may play roles in PNEC specification, differentiation, and maintenance of the NEB

microenvironment.

108

CHAPTER FIVE

General Discussion

The work presented here provides novel evidence of distinct roles for Notch

ligands in regulating various functions during development of the conducting airway

epithelium (Chapters Two and Three). It also identifies targets of Ascl1 as potentially

early markers of NEB development or regulators of this process, as suggested by the

observations on the role of catecholamine signaling in controlling NEB size (Chapter

Four).

Interestingly, in systems such as the mouse inner ear, Dll and Jag family members

can act synergistically but also by exerting contrasting functions (Brooker et al., 2006).

For example, a number of studies have shown a role for Notch signaling in differentiation

of the hair cells and supporting cells of the developing cochlea. However, while

conditional deletion of Dll1 results in an over-abundance of auditory hair cells, Jag1

deficiency leads to a major reduction in the number of these cells (Brooker et al., 2006).

By contrast, in the same organ, Dll1 and Jag2 exert a synergistic role in regulating the

number of hair cells of the cochlea, likely by signaling through Notch1 (Kiernan et al.,

2005).

A more dramatic example of Dll-Jag contrasting effects has been reported in

endothelial sprouting during retinal angiogenesis. In this process activation of Notch

signaling by Dll4 in tip endothelial cells inhibits sprouting by reducing Vegf signaling

receptor expression. However, Jag1 antagonizes Dll4-Notch to stimulate angiogenesis in

109

cells expressing Fringe glycosyltransferases, enhancing Vegf signaling (Benedito et al.,

2009).

Here I have demonstrated a role for Jagged-driven Notch signaling in regulating

basal cell populations in the developing trachea (Figures 2.1 and 3.2) as well as

multiciliated cell populations in the developing conducting airways (Figure 3.2). My

studies differ from previously published functional studies that utilized temporally and

spatially more restricted Cre drivers to disrupt ligand expression (Zhang et al., 2013) or

focused on adult airways (Lafkas et al., 2015). I determined that Jag2 is the earliest

expressed Notch ligand in the developing trachea at E12.5, when branching

morphogenesis is still in its initial stages. I also confirmed that Jag1 is the predominant

ligand in the developing intrapulmonary airways, controlling multiciliated versus

secretory cell fate.

My studies also demonstrated that Delta-driven Notch signaling regulates

neuroendocrine versus club cell fate in the developing conducting airways and also is

critical in regulating neuroepithelial body size (Figures 3.4 and 3.5). Notch-dependent

events associated with the pulmonary neuroendocrine microenvironment were

determined to be regulated predominantly by Delta-driven Notch signaling, whereas

Jagged-driven Notch signaling played a lesser role. Future studies exploring how these

signaling pathways regulate the NEB microenvironment should be considered.

It is possible that Jag-driven and Dll-driven Notch signaling result in the

activation of different target genes, contributing to the differences in phenotype observed.

It would be of interest to misexpress these ligands in cells where they are not

typically present, for example expressing Jag1 and/or Jag2 in pulmonary neuroendocrine

110

cells may rescue the phenotype observed in the Dll1cnull; Dll4cnull double knockouts,

where there is an expansion in the size of neuroepithelial bodies and the NEB

microenvironment. Conversely, if Dll1 and/or Dll4 were forcibly expressed in

multiciliated cells there might not be a loss of non-NEB-associated club cells in the

Jag1cnull; Jag2cnull double knockout. Should these findings be true, it would reject the

possibility that there is ligand-specific functions and instead suggest that the differences

observed in Jag double knockouts versus Dll double knockouts were actually due to the

spatial distribution of these ligands.

Additionally, results found here may be relevant to other organ systems. For

example, in the intestinal epithelium, there is a known role of Dll1 and Dll4 in regulating

goblet cell numbers (Pellegrinet et al., 2011). Dll1 and Dll4 are key ligands mediating the

effects of Notch signaling in differentiation. Gut-specific conditional deletion of Dll4

ligand using a Villin-Cre line shows no intestinal abnormalities in Dll4 mutants and only

a moderate increase in the number of mucous-secreting intestinal cells without noticeable

effects in expansion of the progenitor pool. The data suggest a functional redundancy

among Dll1 and Dll4 although Dll1 is not fully compensated for by Dll4 based on the

phenotype. By contrast, double Dll1; Dll4 conditional deletion resulted in a massive

conversion of proliferating progenitors into mucous-secreting cells (Pellegrinet et al.,

2011).

Interestingly, intestinal loss of Dll1 and Dll4 results in an increase in goblet cells,

just as loss of Dll1 and Dll4 in our system resulted in an increase in pulmonary

neuroendocrine cells (Akiyama et al., 2010; Pellegrinet et al., 2011). Further study of Dll-

111

driven Notch activation may have relevance in both the developing airway epithelium

and the developing intestinal epithelium.

My findings from the Dll1cnull; Dll4cnull double knockout system may be relevant

in studying diseases where there is aberrant differentiation of pulmonary neuroendocrine

cells, such as Neuroendocrine Hyperplasia of Infancy (NEHI) and Diffuse Idiopathic

Pulmonary Neuroendocrine Cell Hyperplasia (DIPNECH), rare pediatric and adult

disorders, respectively, where patients present with excess PNECs.

It would be of interest to examine samples from diseased patients to determine if

there are mutations in the Dll1 and/or Dll4 genes of these individuals, which may suggest

a mechanism of action relevant to disease onset since the cause(s) of these diseases

currently remain unknown.

In this thesis I have also presented partial evidence that catecholamine signaling

may play a role in PNEC fate (Figures 4.9 and 4.10). Organ cultures treated with a

tyrosine hydroxylase inhibitor, metyrosine, had increased numbers of PNECs compared

with control cultures without changes in cell proliferation, suggesting a change in cell

fate or transdifferentiation event (Figure 4.10). Future studies involving the introduction

of agonists of tyrosine hydroxylase or dopamine to organ cultures should result in the

restriction of NEB size. It would be interesting to identify which cells express dopamine

receptors as it may yield information on how catecholamines regulate NEB size. Notably,

there is evidence that addition of epinephrine, the end product of the catecholamine

biosynthesis pathway, to in vitro cultures significantly increased the self-renewal of

pancreatic cancer stem cells by increasing Notch Signaling (Xu et al., 2017). Specifically,

epinephrine was found to increase expression of the activated forms of presenilin1 (of the

112

γ-secretase complex) and N1ICD, thus suggesting an interaction between catecholamines

and Notch signaling.

In the developing pancreas, there is evidence that the catecholamine pathway may

be required for normal development of beta cells. Analysis of embryos lacking tyrosine

hydroxylase demonstrated reduction of beta cells with increased expression of Hes1, a

known transcriptional repressor of Ascl1 and downstream target of Notch signaling.

Dopamine was also found to be a pro-beta cell stimulus (Vázquez et al., 2014). These

data further suggest a connection between catecholamine signaling and Notch signaling

and a non-neural role of tyrosine hydroxylase in cell fate specification.

It may be possible that by blocking tyrosine hydroxylase with metyrosine, in the

experiments described in Chapter Four, epinephrine levels were reduced, thereby

blocking Notch signaling and allowing for expansion of NEBs. Future studies would

allow for full investigation of this potential mechanism.

In conclusion, this work has used basic developmental and cell biology

techniques, genetic tools, and a variety of other approaches to investigate the role of

Notch ligands in airway development and how pulmonary neuroendocrine cells

differentiate.

113

References

Akiyama, J., Okamoto, R., Iwasaki, M., Zheng, X., Yui, S., Tsuchiya, K., Nakamura, T.

and Watanabe, M. (2010). Delta-like 1 expression promotes goblet cell differentiation in

Notch-inactivated human colonic epithelial cells. Biochem. Biophys. Res. Commun. 393,

662-667.

Babicki, S., Arndt, D., Marcu, A., Liang, Y., Grant, J. R., Maciejewski, A. and Wishart,

D. S. (2016). Heatmapper: web-enabled heat mapping for all. Nucleic Acid Res. 44,

W147-W153.

Benedito, R., Roca, C., Sörensen, I., Adams, S., Gossler, A., Fruttiger, M. and Adams, R.

H. (2009). The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.

Cell 137, 1124-1135.

Bjerknes, M., Khandanpour, C., Moroy, T., Fujiyama, T., Hoshino, M., Klisch, T. J.,

Ding, Q., Gan, L., Wang, J., Martin, M. G. and Cheng, H. (2012). Origin of the brush cell

lineage in the mouse intestinal epithelium. Dev. Biol. 362, 194–218.

Blanpain, C., Lowry, W. E., Pasolli, H. A. and Fuchs, E. (2006). Canonical notch

signaling functions as a commitment switch in the epidermal lineage. Genes Dev. 20,

3022-3035.

Borges, M., Linnoila, R. I., van de Velde, H. J. K., Chen, H., Nelkin, B. D., Mabry, M.,

Baylin, S. B. and Ball, D. W. (1997). An achaete-scute homologue essential for

neuroendocrine differentiation in the lung. Nature 386, 852-855.

Bouras, T., Pal, B., Vaillant, F., Harburg, G., Asselin-Labat, M.-L., Oakes, S. R.,

Lindeman, G. J. and Visvader, J. E. (2008). Notch signaling regulates mammary stem cell

function and luminal cell-fate commitment. Cell Stem Cell 3, 429-441.

Branchfield, K., Nantie, L., Verheyden, J. M., Sui, P., Wienhold, M. D. and Sun, X.

(2016). Pulmonary neuroendocrine cells function as airway sensors to control lung

immune response. Science 351, 707-710.

Bray, S. J. (2006). Notch signaling: a simple pathway becomes complex. Nat. Rev. Mol.

Cell Biol. 7, 678-689.

Breuer, R., Zajicek, G., Christensen, T. G., Lucey, E. C. and Snider, G. L. (1990). Cell

kinetics of normal adult hamster bronchial epithelium in the steady state. Am. J. Respir.

Cell Mol. Biol. 2, 51-58.

Brody, A. S. and Crotty, E. J. (2006). Neuroendocrine cell hyperplasia of infancy

(NEHI). Pediatr. Radiol. 36, 1328.

114

Brody, S. L., Yan, X. H., Wuerffel, M. K., Song, S. K. and Shapiro, S. D. (2000).

Ciliogenesis and the left-right axis defects in forkhead factor HFH-4-null mice. Am. J.

Respir. Cell Mol. Biol. 23, 45-51.

Brooker, R., Hozumi, K. and Lewis, J. (2006). Notch ligands with contrasting functions:

Jagged1 and Delta1 in the mouse inner ear. Development 133, 1277-1286.

Brouns, I., Oztay, F., Pintelon, I., De Proost, I. Lembrechts, R., Timmermans, J. P. and

Adriaensen, D. (2009). Neurochemical pattern of the complex innervation of

neuroepithelial bodies in mouse lungs. Histochem. Cell Biol. 131, 55-74.

Burri, P. H. (1984). Fetal and postnatal development of the lung. Annu. Rev. Physiol. 46,

617-628.

Chen, G., Korfhagen, T. R., Xu, Y., Kitzmiller, J., Wert, S. E., Maeda, Y., Gregorieff, A.,

Clevers, H. and Whitsett, J. A. (2009). SPDEF is required for mouse pulmonary goblet

cell differentiation and regulates a network of genes associated with mucus production. J.

Clin. Invest. 119, 2914-2924.

Chen, J., Knowles, H. J., Herbert, J. L. and Hackett, B. P. (1998). Mutation of the mouse

hepatocyte nuclear factor/forkhead homologue 4 gene results in an absence of cilia and

random left-right asymmetry. J. Clin. Investig. 102, 1077-1082.

Chen, H. J., Poran, A., Unni, A. M., Huang, S. X., Elemento, O., Snoeck, H. W. and

Varmus, H. (2019). Generation of pulmonary neuroendocrine cells and SCLC-like

tumors from human embryonic stem cells. J. Exp. Med.

Chiche, A., Moumen, M., Petit, V., Jonkers, J., Medina, D., Deugnier, M.-A., Faraldo, M.

M. and Glukhova, M. A. (2013). Somatic loss of p53 leads to stem/progenitor cell

amplification in both mammary epithelial compartments, basal and luminal. Stem Cells

31, 1857-1867.

Coppens, J. T., Van Winkle, L. S., Pinkerton, K. and Plopper, C. G. (2007). Distribution

of Clara cell secretory protein expression in the tracheobronchial airways of rhesus

monkeys. Am. J. Physiol. Lung Cell Mol. Physiol. 292, L1155-L1162.

Cutz, E., Speirs, V., Yeger, H., Newman, C., Wang, D. and Perrin, D. G. (1993). Cell

biology of pulmonary neuroepithelial bodies – validation of an in vitro model. I. Effects

of hypoxia and Ca2+ ionophore on serotonin content and exocytosis of dense core

vesicles. Anat. Rec. 236, 41-52.

D’Souza, B., Miyamoto, A. and Weinmaster, G. (2008). The many facets of Notch

ligands. Oncogene 27, 5148-5167.

Danahay, H., Pessotti, A. D., Coote, J., Montgomery, B. E., Xia, D., Wilson, A., Yang,

H., Wang, Z., Bevan, L., Thomas, C., Petit, S., London, A., LeMotte, P., Doelemeyer, A.,

115

Vélez-Reyes, G. L., Bernasconi, P., Fryer, C. J., Edwards, M., Capodieci, P., Chen, A.,

Hild, M. and Jaffe, A. B. (2015). Notch2 is required for inflammatory cytokine-driven

goblet cell metaplasia in the lung. Cell Reports 10, 239-252.

Daniely, Y., Liao, G., Dixon, D., Linnoila, R. I., Lori, A., Randell, S. H., Oren, M. and

Jetten, A. M. (2004). Critical role of p63 in the development of a normal esophageal and

tracheobronchial epithelium. Am. J. Physiol. Cell Physiol. 287, C171-181.

Davies, S. J., Gosney, J. R., Hansell, D. M., Wells, A. U., du Bois, B. M., Burke, M. M.,

Sheppard, M. N. and Nicholson, A. G. (2007). Diffuse idiopathic pulmonary

neuroendocrine cell hyperplasia: an under-recognised spectrum of disease. Thorax 62,

248-252.

DeLellis, R. A. (2001). The neuroendocrine system and its tumors. Am. J. Clin. Pathol.

115 (Suppl 1), S5-S16.

Deterding, R. R., Pye, C., Fan, L. L. and Langston, C. (2005). Persistent tachypnea of

infancy is associated with neuroendocrine cell hyperplasia. Pediatr. Pulmonol. 40, 157-

165.

Donnelly, G. M., Haack, D. G. and Heird, C. S. (1982). Tracheal epithelium: cell kinetics

and differentiation in normal rat tissue. Cell Tissue Kinet. 15, 119-130.

Evans, M. J., Van Winkle, L. S., Fanucchi, M. V. and Plopper, C. G. (2001). Cellular and

molecular characteristics of basal cells in airway epithelium. Experimental Lung

Research 27, 401-415.

Eden, E., Lipson, D., Yogev, S. and Yakhini, Z. (2007). Discovering motifs in ranked

lists of DNA sequences. PLoS Computational Biology 3, e39.

Eden, E., Navon, R., Steinfeld, I., Lipson, D. and Yakhini, Z. (2009). GOrilla: a tool for

discovery and visualization of enriched GO terms in ranked gene lists. BMC

Bioinformatics 10, 48.

Fuchs, E. (2008). Skin stem cells: rising to the surface. J. Cell Biol. 180, 273-284.

Galloway, M. P., Burke, W. J. and Coscia, C. J. (1982).

Tetrahydroisoquinolinecarboxylic acids and catecholamine metabolism in adrenal

medulla explants. Biochemical Pharmacology 31, 3251-3256.

Garg, A., Sui, P., Verheyden, J. M., Young, L. R. and Sun, X. (2019). Consider the lung

as a sensory organ: A tip from pulmonary neuroendocrine cells. Curr. Top. Dev. Biol.

132, 67-89.

Gerbe, F., Sidot, E., Smyth, D. J., Ohmoto, M., Matsumoto, I., Dardalhon, V., Cesses, P.,

Garnier, L., Pouzolles, M., Brulin, B., Bruschi, M., Harcus, Y., Zimmermann, V. S.,

116

Taylor, N., Maizels, R. M. and Jay, P. (2016). Intestinal epithelial tuft cells initiate type 2

mucosal immunity to helminth parasites. Nature 529, 226–230.

Giangreco, A., Reynolds, S. D. and Stripp, B. R. (2002). Terminal bronchioles harbor a

unique airway stem cell population that localizes to the bronchoalveolar duct junction.

Am. J. Pathol. 161, 173-182.

Giangreco, A., Arwert, E. N., Rosewell, I. R., Snyder, J., Watt, F. M. and Stripp, B. R.

(2009). Stem cells are dispensable for lung homeostasis but restore airways after injury.

Proc. Natl. Acad. Sci. U.S.A. 106, 9286-9291.

Glasser, S. W., Hardie, W. D. and Hagood, J. S. (2010). Neuroendocrine cell hyperplasia

of infancy (NEHI). Pediatr. Radiol. 36, 1328.

Gomi, K., Arbelaez, V., Crystal, R. G. and Walters, M. S. (2015). Activation of

NOTCH1 or NOTCH3 signaling skews human airway basal cell differentiation toward a

secretory pathway. PLoS ONE 10, e0116507.

Gomi, K., Staudt, M. R., Salit, J., Kaner, R. J., Heldrich, J., Rogalski, A. M., Arbelaez,

V., Crystal, R. G. and Walters, M. S. (2016). JAG1-mediated notch signaling regulates

secretory cell differentiation of the human airway epithelium. Stem Cell Rev 12, 454-63.

Gomperts, B. N., Gong-Cooper, X. and Hackett, B. P. (2004). Foxj1 regulates basal body

anchoring to the cytoskeleton of ciliated pulmonary epithelial cells. J. Cell Sci. 117,

1329-1337.

Gould, V. E., Linnoila, R. I., Memoli, V. A. and Warren, W. H. (1983). Neuroendocrine

components of the bronchopulmonary tract: hyperplasias, dysplasia, and neoplasms. Lab

Invest. 49, 519-537.

Gu, X. and Ben-Shahar, Y. (2013). Olfactory receptors in human airway epithelia.

Methods Mol. Biol. 1003, 161-169.

Gu, X., Karp, P. H., Brody, S. L., Pierce, R. A., Welsh, M. J., Holtzman, M. J. and Ben-

Shahar, Y. (2014). Chemosensory functions for pulmonary neuroendocrine cells. Am. J.

Respir. Cell Mol. Biol. 50, 637-646.

Guha, A., Vasconcelos, M., Cai, Y., Yoneda, M., Hinds, A., Qian, J., Li, G., Dickel, L.,

Johnson, J. E., Kimura, S., Guo, J., McMahon, J., McMahon, A. P. and Cardoso, W. V.

(2012). Neuroepithelial body microenvironment is a niche for a distinct subset of Clara-

like precursors in the developing airways. Proc. Natl. Acad. Sci. USA. 109, 12592-12597.

Guha, A., Vasconcelos, M., Zhao, R., Gower, A. C., Rajagopal, J. and Cardoso, W. V.

(2014). Analysis of Notch signaling-dependent gene expression in developing airways

reveals diversity of Clara cells. PLoS One 9, e88848.

117

Guha, A., Deshpande, A., Jain, A., Sebastiani, P. and Cardoso, W. V. (2017). Uroplakin

3a+ cells are a distinctive population of epithelial progenitors that contribute to airway

maintenance and post-injury repair. Cell Reports 19, 246-254.

Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L.

(1993). Mammalian achaete-scute homolog 1 is required for the early development of

olfactory and autonomic neurons. Cell 75, 463-476.

Gupta, R., Hong, D., Iborra, F., Sarno, S. and Enver, T. (2007). NOV (CCN3) functions

as a regulator of human hematopoietic stem or progenitor cells. Science 316, 590-593.

Guseh, J. S., Bores, S. A., Stanger, B. Z., Zhou, Q., Anderson, W. J., Melton, D. A. and

Rajagopal, J. (2009). Notch signaling promotes airway mucous metaplasia and inhibits

alveolar development. Development 136, 1751-1759.

Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K. Yoshimoto, M., Nakahata, T., Ikuta,

K. and Honjo, T. (2002). Inducible gene knockout of transcription factor recombination

signal binding protein-J reveals its essential role in T versus B lineage decision. Int.

Immunol. 15, 637-645.

Harfe, B. D., Scherz, P. J., Nissim, S., Tian, H., McMahon, A. P. and Tabin, C. J. (2004).

Evidence for an expansion-based temporal Shh gradient in specifying vertebrate digit

identities. Cell 118 517-528.

Harris, K. S., Zhang, Z., McManus, M. T., Harfe, B. D. and Sun, X. (2006). Dicer

function is essential for lung epithelium morphogenesis. Proc. Natl. Acad. Sci. USA 103,

2208-2213.

Hegab, A. E., Ha, V. L., Gilbert, J. L., Zhang, K. X., Malkoski, S. P., Chon, A. T.,

Darmawan, D. O., Bisht, B., Ooi, A. T., Pellegrini, M., Nickerson, D. W. and Gomperts,

B. N. (2011). Novel stem/progenitor cell population from murine tracheal submucosal

gland ducts with multipotent regenerative potential. Stem Cells 29, 1283-1293.

Herriges, M. and Morrisey, E. E. (2014). Lung development: orchestrating the generation

and regeneration of a complex organ. Development 141, 502-513.

Hong, K. U., Reynolds, S. D., Giangreco, A., Hurley, C. M. and Stripp, B. R. (2001).

Clara cell secretory protein-expressing cells of the airway neuroepithelial body

microenvironment include a label-retaining subset and are critical for epithelial renewal

after progenitor cell depletion. Am. J. Respir. Cell Mol. Biol. 24, 671-681.

Huang, H. P., Chu, K., Nemoz-Gaillard, E., Elberg, D. and Tsai, M. J. (2002).

Neogenesis of beta-cells in adult BETA2/NeuroD-deficient mice. Mol. Endocrinol. 16,

541-551.

118

Huang, Y. H., Klingbeil, O., He, X. Y., Wu, X. S., Arun, G., Lu, B., Somerville, T. D. D.,

Milazzo, J. P., Wilkinson, J. E., Demerdash, O. E., Spector, D. L., Egeblad, M., Shi, J.

and Vakoc, C. R. (2018). POU2F3 is a master regulator of a tuft cell-like variant of small

cell lung cancer. Genes Dev. 32, 915-928.

Huber, K., Brühl, B., Guillemot, F., Olson, E. N., Ernsberger, U. and Unsicker, K.

(2002). Development of chromaffin cells depends on MASH1 function. Development

129, 4729-4738.

Huber, K., Karch, N., Ernsberger, U., Gordis, C. and Unsicker, K. (2005). The role of

Phox2b in chromaffin cell development. Dev. Biol. 279, 501-508.

Ito, T., Udaka, N., Yazawa, T., Okudela, K., Hayashi, H., Sudo, T., Guillemot, F.,

Kageyama, R. and Kitamura, H. (2000). Basic helix-loop-helix transcription factors

regulate the neuroendocrine differentiation of fetal mouse pulmonary epithelium.

Development 127, 3913-3921.

Jia, S., Wildner, H. and Birchmeier, C. (2015). Insm1 controls the differentiation of

pulmonary neuroendocrine cells by repressing Hes1. Developmental Biology 408, 90-98.

Jiang, R., Lan, Y., Chapman, H. D., Shawber, C., Norton, C. R., Serreze, D. V.,

Weinmaster, G. and Gridley, T. (1998). Defects in limb, craniofacial, and thymic

development in Jagged2 mutant mice. Genes Dev 12, 1046-1057.

Jiménez-González, M., Jaques, F., Rodríguez, S., Porciuncula, A., Principe, R. M.,

Abizanda, G., Iñiguez, M., Escalada, J., Salvador, J., Prósper, F., Halban, P. A. and

Barajas, M. (2013). Cardiotrophin 1 protects beta cells from apoptosis and prevents

streptozotocin-induced diabetes in a mouse model. Diabetologia 56, 838-846.

Kadur Lakshminarasimha Murthy, P., Srinivasan, T., Bochter, M. S., Xi, R., Varanko, A.

K., Tung, K. L., Semerci, F., Xu, K., Maletic-Savatic, M., Cole, S. E. and Shen, X.

(2018). Radical and lunatic fringes modulate notch ligands to support mammalian

intestinal homeostasis. eLife 7, e35710.

Kalbe, B., Schulz, V. M., Schlimm, M., Philippou, S., Jovancevic, N., Jansen, F., Scholz,

P., Lübbert, H., Jarocki, M., Faissner, A., Hecker, E., Veitinger, S., Tsai, T., Osterloh, S.

and Hatt, H. (2017). Helional-induced activation of human olfactory receptor 2J3

promotes apoptosis and inhibits proliferation in a non-small-cell lung cancer line. Eur. J.

Cell Biol. 96, 34-46.

Kameda, Y., Nishimaki, T., Miura, M., Jiang, S. X. and Guillemot, F. (2007). Mash1

regulates the development of C cells in mouse thyroid glands. Developmental Dynamics

236, 262-270.

119

Kameda, Y. (2014). Signaling molecules and transcription factors involved in the

development of the sympathetic nervous system, with special emphasis on the superior

cervical ganglion. Cell Tissue Res. 357, 527-548.

Katsube, K., Sakamoto, K., Tamamura, Y. and Yamaguchi, A. (2009). Role of CCN, a

vertebrate specific gene family, in development. Dev. Growth Differ. 51, 55-67.

Kiernan, A. E., Cordes, R., Kopan, R., Gossler, A. and Gridley, T. (2005). The Notch

ligands DLL1 and JAG2 act synergistically to regulate hair cell development in the

mammalian inner ear. Development 132, 4353-4362.

Kim, E. J., Ables, J. L., Dickel, L. K., Eisch, A. J. and Johnson, J. E. (2011). Ascl1

(Mash1) defines cells with long-term neurogenic potential in subgranular and

subventricular zones in adult mouse brain. PLoS One 6, e18472.

Koch, U., Fiorini, E., Benedito, R., Besseyrias, V., Schuster-Gossler, K., Pierres, M.,

Manley, N. R., Duarte, A., Macdonald, H. R. and Radtke, F. (2008). Delta-like 4 is the

essential, nonredundant ligand for Notch1 during thymic T cell lineage commitment. J.

Exp. Med. 205, 2515-1523.

Kokubu, H., Ohtsuka, T. and Kageyama, R. (2008). Mash1 is required for

neuroendocrine cell development in the glandular stomach. Genes to Cells 13, 41-51.

Koliakos, E., Thomopoulos, T., Abbassi, Z., Duc, C. and Christodoulou, M. (2017).

Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia: a case report and review

of the literature. Am. J. Case Rep. 18, 975-979.

Konishi, J., Kawaguchi, K. S., Vo, H., Haruki, N., Gonzalez, A., Carbone, D. P. and

Dang, T. P. (2007). Gamma-secretase inhibitor prevents Notch3 activation and reduces

proliferation in human lung cancers. Cancer Res. 67, 8051-8057.

Kopan, R. and Ilagan, M. X. G. (2009). The canonical Notch signaling pathway:

unfolding the activation mechanism. Cell 137, 216-233.

Krasteva, G., Canning, B. J., Hartmann, P., Veres, T. Z., Papadakis, T., Mühlfeld, C.,

Schliecker, K., Tallini, Y. N., Braun, A., Hackstein, H., Baal, N., Weihe, E., Schütz, B.,

Kotlikoff, M., Ibanez-Tallon, I. and Kummer, W. (2011). Cholinergic chemosensory cells

in the trachea regulate breathing. Proc. Natl. Acad. Sci. USA. 108, 9478-9483.

Krasteva, G., Canning, B. J., Papadakis, T. and Kummer, W. (2012). Cholinergic brush

cells in the trachea mediate respiratory responses to quorum sensing molecules. Life

Sciences 91, 992-996.

Kuhar, M. J., Couceyro, P. R. and Lambert, P. D. (1999). Biosynthesis of

Catecholamines. In: Siegel, G. J., Agranoff, B. W., Albers, R. W., et al., editors. Basic

120

Neurochemistry: Molecular, Cellular and Medical Aspects. 6th edition. Philadelphia:

Lippincott-Raven .Available from: https://www.ncbi.nlm.nih.gov/books/NBK27988/

Kuo, C. and Krasnow, M. (2015). Formation of a neurosensory organ by epithelial cell

slithering. Cell 163, 1-12.

Kurita, T., Medina, R. T., Mills, A. A. and Cunha, G. R. (2004). Role of p63 and basal

cells in the prostate. Development 131, 4955-4964.

Lanigan, T. M., DeRaad, S. K. and Russo, A. F. (1997). Requirement of MASH-1

transcription factor for neuroendocrine cell differentiation of thyroid C cells. J.

Neurobiol. 34, 126-134.

Lauweryns, J. M. and Cokelaere, M. (1973). Intrapulmonary Neuro-Epithelial Bodies:

Hypoxia-Sensitive Neuro (Chemo-) Receptors. Experientia 29, 1384-1396.

Lauweryns, J. M. and van Ranst, L. (1988). Immunocytochemical localization of

aromatic l-amino acid decarboxylase in human, rat, and mouse bronchopulmonary and

gastrointestinal endocrine cells. The Journal of Histochemistry and Cytochemistry 36,

1181-1186.

Lafkas, D., Shelton, A., Chiu, C., de Leon Boenig, G., Chen, Y., Stawicki, S. S., Siltanen,

C., Reichelt, M., Zhou, M., Wu, X., Eastham-Anderson, J., Moore, H., Roose-Girma, M.,

Chinn, Y., Hang, J. Q., Warming, S., Egen, J., Lee, W. P., Austin, C., Wu, Y., Payandeh,

J., Lowe, J. B. and Siebel, C. W. (2015). Therapeutic antibodies reveal Notch control of

transdifferentiation in the adult lung. Nature 528, 127-131.

Leung, C. T., Coulombe, P. A. and Reed, R. R. (2007). Contribution of olfactory neural

stem cells to tissue maintenance and growth. Nat. Neuroscience 10, 720-726.

Lim, E.,Vaillant, F.,Wu, D., Forrest, N. C., Pal, B., Hart, A. H., Asselin-Labat, M.-L.,

Gyorki, D. E.,Ward, T., Partanen, A., Feleppa, F., Huschtscha, L. I., Thorne, H. J.,

kConFab, Fox, S. B., Yan, M., French, J. D., Brown, M. A., Smyth, G. K., Visvader, J. E.

and Lindeman, G. J. (2009). Aberrant luminal progenitors as the candidate target

population for basal tumor development in BRCA1 mutation carriers. Nat. Med. 15, 907-

913.

Linnoila, R. I. (2006). Functional facets of the pulmonary neuroendocrine system. Lab

Invest. 85, 425-444.

Lucas, M. E., Muller, F., Rudiger, R., Henion, P. D. and Rohrer, H. (2006). The bHLH

transcription factor hand2 is essential for noradrenergic differentiation of sympathetic

neurons. Development 133, 4015-4024.

Maßberg, D. and Hatt, H. (2018). Human olfactory receptors: novel celluar function

outside of the nose. Physiol. Rev. 98, 1739-1763.

121

McCormick, M. B., Tamimi, R. M., Snider, L., Asakura, A., Bergstrom, D. and Tapscott,

S. J. (1996). NeuroD2 and neuroD3: distinct expression patterns and transcriptional

activation potentials within the neuroD gene family. Mol. Cell Biol. 16, 5792-5800.

Madisen, L., Zwingman, T. A., Sunkin, S. M., Oh, S. W., Zariwala, H. A., Gu, H., Ng, L.

L., Palmiter, R. D., Hawrylycz, M. J., Jones, A. R., Lein, E. S. and Zeng, H. (2010). A

robust and high-throughput Cre reporting and characterization system for the whole

mouse brain. Nat. Neurosci. 13, 133-140.

Mercer, R. R., Russell, M. L., Roggli, V. L. and Crapo, J. D. (1994). Cell number and

distribution in human and rat airways. Am. J. Respir. Cell Mol. Biol. 10, 613-624.

Minamizato, T., Sakamoto, K., Liu, T., Kokubo, H., Katsube, K., Perbal, B. Nakamura,

S. and Yamaguchi, A. (2007). CCN3/NOV inhibits BMP-2-induced osteoblast

differentiation by interacting with BMP and Notch signaling pathways. Biochem.

Biophys. Res. Commun. 354, 567-573.

Montoro, D. T., Haber, A. L., Biton, M., Vinarsky, V., Lin, B., Birket, S. E., Yuan, F.,

Chen, S., Leung, H. M., Villoria, J., Rogel, N., Burgin, G., Tsankov, A. M., Waghray, A.,

Slyper, M., Waldman, J., Nguyen, L., Dionne, D., Rozenblatt-Rosen, O., Tata, P. R.,

Mou, H., Shivaraju, M., Bihler, H., Mense, M., Tearney, G. J., Rowe, S. M., Engelhardt,

J. F., Regev, A. and Rajagopal, J. (2018). A revised airway epithelial hierarchy includes

CFTR-expressing ionocytes. Nature 560, 319-324.

Mori, M., Mahoney, J. E., Stupnikov, M. R., Paez-Cortez, J. R., Szymaniak, A. D.,

Varelas, X., Herrick, D. B., Schwob, J., Zhang, H. and Cardoso, W. V. (2015). Notch3-

Jagged signaling controls the pool of undifferentiated airway progenitors. Development

142, 258-267.

Morikawa, Y., D’Autreaux, F., Gershon, M. D. and Cserjesi, P. (2007). Hand2

determines the noradrenergic phenotype in the mouse sympathetic nervous system. Dev.

Biol. 307, 1140126.

Morimoto, M., Liu, Z., Cheng, H. T., Winters, N., Bader, D. and Kopan, R. (2010).

Canonical Notch signaling in the developing lung is required for determination of arterial

smooth muscle cells and selection of Clara versus multiciliated cell fate. J. Cell Sci. 123,

213-224.

Morimoto, M., Nishinakamura, R., Saga, Y. and Kopan, R. (2012). Different assemblies

of Notch receptors coordinate the distribution of major bronchial Clara, multiciliated and

neuroendocrine cells. Development 139, 4365-4373.

Morrisey, E. E. and Hogan, B. L. M. (2010). Preparing for the first breath: genetic and

cellular mechanisms in lung development. Developmental Cell 18, 8-23.

122

Noguchi, M., Sumiyama, K. and Morimoto, M. (2015). Directed migration of pulmonary

neuroendocrine cells toward airway branches organizes the stereotypic location of

neuroepithelial bodies. Cell Reports 13, 2679-2686.

Ohuchi, H., Hori, Y., Yamasaki, M., Harada, H., Sekine, K., Kato, S. and Itoh, N. (2000).

FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development.

Biochem. Biophys. Res. Commun. 277, 643-649.

Pardo-Saganta, A., Law, B. M., Gonzalez-Celeiro, M., Vinarsky, V. and Rajagopal, J.

(2013). Ciliated cells of pseudostratified airway epithelium do not become mucous cells

after ovalbumin challenge. Am. J. Respir. Cell Mol. Biol. 48, 364-373.

Pardo-Saganta, A., Law, B. M., Tata, P. R., Villovia, J., Saez, B., Mou, H., Zhao, R. and

Rajagopal, J. (2015a). Injury induces direct lineage segregation of functionally distinct

airway basal stem/progenitor cell subpopulations. Cell Stem Cell 16, 184-197.

Pardo-Saganta, A., Tata, P. R., Law, B. M., Saez, B., Chow, R. D. W., Prabhu, M.,

Gridley, T. and Rajagopal, J. (2015b). Parent stem cells can serve as niches for their

daughter cells. Nature 532, 597-601.

Park, K. S., Korfhagen, T. R., Bruno, M. D., Kitzmiller, J. A., Wan, H., Wert, S. E.,

Khurana Hershey, G. K., Chen, G. and Whitsett, J. A. (2007). SPDEF regulates goblet

cell hyperplasia in the airway epithelium. J. Clin. Invest. 117, 978-988.

Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F. (1999). The homeobox

gene Phox2b is essential for the development of autonomic neural crest derivatives.

Nature 399, 366-370.

Pellegrinet, L., Rodilla, V., Liu, Z., Chen, S., Koch, U., Espinosa, L., Kaestner, K. H.,

Kopan, R., Lewis, J. and Radtke, F. (2011). Dll1- and dll4-mediated notch signaling are

required for homeostasis of intestinal stem cells. Gastroenterology 140, 1230-1240.

Pignon, J.-C., Grisanzio, C., Geng, Y., Song, J., Shivdasani, R. A. and Signoretti, S.

(2013). P63-expressing cells are the stem cells of developing prostate, bladder, and

colorectal epithelia. Proc. Natl. Acad. Sci. USA 110, 8105-8110.

Plasschaert, L. W., Žilionis, R., Choo-Wing, R., Savova, V., Knehr, J., Roma, G., Klein,

A. M. and Jaffe, A. B. (2018). A single-cell atlas of the airway epithelium reveals the

CFTR-rich pulmonary ionocyte. Nature 560, 377-381.

Post, L. C., Ternet, M. and Hogan, B. L. M. (2000). Notch/Delta expression in the

developing lung. Mechanisms of Development 98, 95-98.

Que, J., Choi, M., Ziel, J. W., Klingensmith, J. and Hogan, B. L. (2006). Morphogenesis

of the trachea and esophagus: current players and new roles for noggin and Bmps.

Differentiation 74, 422-437.

123

Que, J., Okubo, T., Goldenring, J. R., Nam, K. T., Kurotani, R., Morrisey, E. E.,

Taranova, O., Pevny, L. H. and Hogan, B. L. (2007). Multiple dose-dependent roles for

Sox2 in the patterning and differentiation of anterior foregut endoderm. Development

134, 2521-2531.

Rackley, C. R. and Stripp, B. R. (2012). Building and maintaining the epithelium of the

lung. J. Clin. Invest. 122, 2724-2730.

Radtke, F. and Raj, K. (2003). The role of Notch in tumorigenesis: oncogene or tumour

suppressor? Nat. Rev. Cancer 3, 756-767.

Rawlins, E. L., Ostrowski, L. E., Randell, S. H. and Hogan, B. L. M. (2007). Lung

development and repair: contribution of the multiciliated lineage. Proc. Natl. Acad. Sci.

USA 104, 410-417.

Rawlins, E. L. and Hogan, B. L. M. (2008). Ciliated epithelial cell lifespan in the mouse

trachea and lung. Am. J. Physiol. Lung Cell Mol. Physiol. 295, L231-L234.

Rawlins, E. L., Clark, C. P., Xue, Y. and Hogan, B. L. (2009). The Id2+ distal tip lung

epithelium contains individual multipotent embryonic progenitor cells. Development 136,

3741-3745.

Reid, L., Meyrick, B., Antony, V. B., Chang, L.-Y., Crapo, J. D. and Reynolds, H. Y.

(2005). The mysterious pulmonary brush cell. Am. J. Respir. Crit. Care Med. 172, 136-

139.

Reynolds, S. D., Giangreco, A., Power, J. H. and Stripp, B. R. (2000a). Neuroepithelial

bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial

regeneration. Am. J. Pathol. 156, 269-278.

Reynolds, S. D., Hong, K. U., Giangreco, A., Mango, G. W., Guron, C., Morimoto, Y.

and Stripp, B. R. (2000b). Conditional clara cell ablation reveals a self-renewing

progenitor function of pulmonary neuroendocrine cells. Am. J. Physiol. Lung Cell Mol.

Physiol. 278, L1256-1263.

Rock, J. R., Onaitis, M. W., Rawlins, E. L., Lu, Y., Clark, C. P., Xue, Y., Randell, S. H.

and Hogan, B. L. M. (2009). Basal cells as stem cells of the mouse trachea and human

airway epithelium. Proc. Natl. Acad. Sci. USA 106, 12771-12775.

Rock, J. R., Gao, X., Xue, Y., Randell, S. H., Kong, Y. Y. and Hogan, B. L. (2011).

Notch-dependent differentiation of adult airway basal stem cells. Cell Stem Cell. 8, 639-

648.

Rock, J. R. and Hogan, B. L. (2011). Epithelial progenitor cells in lung development,

maintenance, repair, and disease. Annu. Rev. Cell Dev. Biol. 27, 493-512.

124

Rosenbaum, J. N., Guo, Z., Baus, R. M., Werner, H., Rehrauer, W. M. and Lloyd, R. V.

(2015). INSM1: a novel immunohistochemical and molecular marker for neuroendocrine

and neuroepithelial neoplasms. Am. J. Clin. Pathol. 144, 579-591.

Saiardi, A., Bozzi, Y., Baik, J. H. and Borrelli, E. (1997). Antiproliferative role of

dopamine: loss of D2 receptors causes hormonal dysfunction and pituitary hyperplasia.

Neuron 19, 115-126.

Sakamoto, K., Yamaguchi, S., Ando, R. Miyawaki, A., Kabasawa, Y., Takagi, M., Li, C.

L., Perbal, B. and Katsube, K. (2002). The nephroblastoma overexpressed gene

(NOV/ccn3) protein associates with Notch1 extracellular domain and inhibits myoblast

differentiation via Notch signaling pathway. J. Biol. Chem. 277, 29399-29405.

Sansone, P., Storci, G., Giovannini, C., Pandolfi, S., Pianetti, S., Taffurelli, M., Santini,

D., Ceccarelli, C., Chieco, P. and Bonafe, M. (2007). p66Shc/Notch-3 interplay controls

self-renewal and hypoxia survival in human stem/progenitor cells of the mammary gland

expanded in vitro as mammospheres. Stem Cells 25, 807-815.

Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita,

N., Matsui, D., Koga, Y., Itoh, N. and Kato, S. (1999). Fgf10 is essential for limb and

lung formation. Nat. Genet. 21, 138-141.

Song, H., Yao, E., Lin, C., Gacayan, R., Chen, M. H. and Chuang, P. T. (2012).

Functional characterization of pulmonary neuroendocrine cells in lung development,

injury, and tumorigenesis. PNAS 109, 17531-17536.

Sui, P., Wiesner, D. L., Zu, J., Zhang, Y., Lee, J., van Dyken, S., Lashua, A., Yu, C.,

Klein, B. S., Locksley, R. M., Deutsch, G. and Sun, X. (2018). Pulmonary

neuroendocrine cells amplify allergic asthma responses. Science 360.

Tizzano, M., Cristofoletti, M., Sbarbati, A. and Finger, T. E. (2011). Expression of taste

receptors in solitary chemosensory cells of rodent airways. BMC Pulmonary Medicine

11, 1-12.

Tsao, P.-N., Chen, F., Izvolsky, K. I., Walker, J., Kukuruzinska, M. A., Lu, J. and

Cardoso, W. V. (2008). Gamma-secretase activation of notch signaling regulates the

balance of proximal and distal fates in progenitor cells of the developing lung. J. Biol.

Chem. 283, 29532-29544.

Tsao, P. N., Vasconcelos, M., Izvolsky, K. I., Qian, J., Lu, J. and Cardoso, W. V. (2009).

Notch signaling controls the balance of multiciliated and secretory cell fates in

developing airways. Development 136, 2297-2307.

Tsao, P. N., Wei, S. C., Wu, M. F., Huang, M. T., Lin, H. Y., Lee, M. C., Lin, K. M.,

Wang, I. J., Kaartinen, V., Yang, L. T. and Cardoso, W. V. (2011). Notch signaling

125

prevents mucous metaplasia in mouse conducting airways during postnatal development.

Development 138, 3533-3543.

Vázquez, P., Robles, A. M., de Pablo, F., Hernández-Sánchez, C. (2014). Non-neural

tyrosine hydroxylase, via modulation of endocrine pancreatic precursors, is required for

normal development of beta cells in the mouse pancreas. Diabetologia 57, 2339-2347.

Verckist, L., Lembrechts, R., Thys, S., Pintelon, I., Timmermans, J. P., Brouns, I. and

Adriaensen, D. (2017). Selective gene expression analysis of the neuroepithelial body

microenvironment in postnatal lungs with special interest for potential stem cell

characteristics. Respir Res 18, 87.

Volckaert, T., Dill, E., Campbell, A., Tiozzo, C., Majka, S., Bellusci, S. and De Langhe,

S. P. (2011). Parabronchial smooth muscle constitutes an airway epithelial stem cell

niche in the mouse lung after injury. J. Clin. Invest. 121, 4409-4419.

Wang, M. M. (2011). Notch signaling and Notch signaling modifiers. Int. J. Biochem.

Cell Biol. 43, 1550-1562.

Wang, S. Z., Ou, J., Zhu, L. J. and Green, M. R. (2012). Transcription factor ATF5 is

required for terminal differentiation and survival of olfactory sensory neurons. Proc.

Natl. Acad. Sci. USA 109, 18589-18594.

Watson, J. K., Rulands, S., Wilkinson, A. C., Wuidart, A., Ousset, M., Van Keymeulen,

A., Göttgens, B., Blanpain, C., Simons, B. D. and Rawlins, E. L. (2015). Clonal

dynamics reveal two distinct populations of basal cells in slow-turnover airway

epithelium. Cell Rep. 12, 90-101.

Weissman, A. and Koe, B. K. (1965). Behavioural effects of L-a-methyltyrosine, an

inhibitor of tyrosine hydroxylase. Life Sciences 4, 1037-1048.

Xing, Y., Li, A., Borok, Z., Li, C. and Minoo, P. (2012). NOTCH1 is required for

regeneration of Clara cells during repair of airway injury. Stem Cells 30, 945-955.

Xu, J., Krebs, L. T. and Gridley T. (2010). Generation of mice with a conditional null

allele of the Jagged2 gene. Genesis 48, 390-393.

Xu, K., Nieuwenhuis, E., Cohen, B. L., Wang, W., Canty, A. J., Danska, J. S., Coultas,

Kl., Rossant, J., Wu, M. Y. J., Piscione, T. D., Nagy, A., Gossler, A., Hicks, G. G., Hui,

C. C., Henkelman, R. M., Yu, L. X., Sled, J. G., Gridley, T. and Egan, S. E. (2010).

Lunatic Fringe-mediated Notch signaling is required for lung alveogenesis. Am J Physiol

Lung Cell Mol Physiol 298, L45-L56.

Xu, X., Hu, C. and Schuller, H. M. (2017). Epinephrine-induced gamma secretase/Notch

signaling in pancreatic cancer stem cells [abstract]. In: Proceedings of the American

126

Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC.

Philadelphia (PA): AACR; Cancer Res 77, Abstract nr 2894.

Yamashita, J., Ohmoto, M., Yamaguchi, T., Matusmoto, I. and Hirota, J. (2017). Skn-

1a/Pou2f3 functions as a master regulator to generate Trmp3-expressing chemosensory

cells in mice. PLoS One 12, e0189340.

Yan, K. S., Gevaert, O., Zheng, G. X. Y., Anchang, B., Probert, C. S., Larkin, K. A.,

Davies, P. S., Cheng, Z. F., Kaddis, J. S., Han, A., Roelf, K., Calderon, R. I., Cynn, E.,

Hu, X., Mandleywala, K., Wilhelmy, J., Grimes, S. M., Corney, D. C., Boutet, S. C.,

Terry, J. M., Belgrader, P., Ziraldo, S. B., Mikkelsen, T. S., Wang, F., von Furstenberg,

R. J., Smith, N. R., Chandrakesan, P., May, R., Chrissy, M. A. S., Jain, R., Cartwright, C.

A., Niland, J. C., Hong, Y. K., Carrington, J., Breault, D. T., Epstein, J., Houchen, C. W.,

Lynch, J. P., Martin, M. G., Plevritis, S. K., Curtis, C., Ji, H. P., Li, L., Henning, S. J.,

Wong, M. H. and Kuo, C. J. (2017). Intestinal enteroendocrine lineage cells possess

homeostatic and injury-inducible stem cell activity. Cell Stem Cell 21, 78–90 e76.

Yang, A. and McKeon, F. (2000). P63 and P73: P53 mimics, menaces and more. Nat.

Rev. Mol. Cell Biol. 1, 199-207.

Yang, Y., Riccio, P., Schotsaert, M., Mori, M., Lu, J., Lee, D. K., Garcia-Sastre, A., Xu,

J. and Cardoso, W. V. (2018). Spatial-temporal lineage restrictions of embryonic p63+

progenitors establish distinct stem cell pools in adult airways. Developmental Cell 44,

752-761.

Yao, E., Lin, C., Wu, Q., Zhang, K., Song, H. and Chuang, P. T. (2018). Notch signaling

controls transdifferentiation of pulmonary neuroendocrine cells in response to lung

injury. Stem Cells 36, 377-391.

Young, L. R., Brody, A. S., Inge, T. H., Acton, J. D., Bokulic, R. E., Langston, C. and

Deutsch, G. H. (2011). Neuroendocrine cell distribution and frequency distinguish

neuroendocrine hyperplasia of infancy from other pulmonary disorders. Chest 139, 1060-

1071.

Zhang, S., Loch, A. J., Radtke, F., Egan, S. E. and Xu, K. (2013). Jagged1 is the major

regulator of Notch-dependent cell fate in proximal airways. Dev Dyn 242, 678-686.

genetic regulation of pulmonary progenitor cell

Documents