genetic regulation of pulmonary progenitor cell
TRANSCRIPT
Genetic regulation of pulmonary progenitor cell differentiation
Maria R. Stupnikov
Submitted in partial fulfillment of the
requirements for the degree of
Doctor of Philosophy
in the Graduate School of Arts and Sciences
COLUMBIA UNIVERSITY
2019
© 2019
Maria R. Stupnikov
All rights reserved
ABSTRACT
Genetic regulation of pulmonary progenitor cell differentiation
Maria R. Stupnikov
The respiratory system represents a major interface between the body and the
external environment. Its design includes a tree-like network of conducting tubules
(airways) that carries air to millions of alveoli, where gas exchange occurs. The
conducting airways are characterized by their great diversity in epithelial cell types with
multiple populations of secretory, multiciliated, and neuroendocrine cells. How these
different cell types arise and how these populations are balanced are questions still not
well understood. Aberrant patterns of airway epithelial differentiation have been
described in various human pulmonary diseases, chronic bronchitis, asthma,
neuroendocrine hyperplasia of infancy, and others.
The goal of this thesis is to investigate mechanisms of regulation of airway
epithelial cell fate in the developing lung epithelium. More specifically, these studies
focus on Notch signaling and address a long unresolved issue whether the different Notch
ligands (Jagged and Delta) have distinct roles in the epithelial differentiation program of
the extrapulmonary and intrapulmonary airways. Moreover, these studies investigate the
ontogeny of the bHLH transcription factor Ascl1 and identify its targets in the developing
airways as potential regulators of neuroepithelial body (NEB) size and maturation.
My studies provide evidence that the Notch ligand families Jag and Dll are
required for the specification and formation of different cell lineages in the developing
airway epithelia. Jag ligands regulate multiciliated versus secretory (club) cell fates but
also controls abundance of basal cell progenitors in extrapulmonary airways. Dll ligands
regulate pulmonary neuroendocrine versus club cell fates in intrapulmonary airways.
Analysis of mouse mutants showed that loss of Jag ligands has minimal impact on the
size or abundance of NEBs and their associated secretory cells while loss of Dll ligands
results in an expansion of NEB size and associated cells. To gain additional insights into
the potential mechanisms of how neuroendocrine cells develop and undergo aberrant
hyperplasia, I characterized the global transcriptional profile of embryonic lungs from
mice deficient in Ascl1, which lack NEBs and neuroendocrine cells and identified a
number of genes associated with neuroendocrine cell development, maturation, and the
NEB microenvironment. Among these genes, components of the catecholamine
biosynthesis pathway, such as tyrosine hydroxylase (Th), a key enzyme for
catecholamine production, were downregulated in Ascl1 null lungs. Subsequent
functional analysis using a pharmacological inhibitor of this pathway in lung organ
cultures showed expansion of pulmonary neuroendocrine cells and NEB size, an
observation of potential relevance in human diseases in which neuroendocrine cells are
aberrantly expanded.
Together these studies highlight the distinct role of Notch ligands and further
implicate Ascl1 targets, as illustrated by catecholamine pathway components, in
regulating epithelial cell fate. Further examination of these pathways may provide
insights into the pathogenesis and ultimately therapeutic approaches for airway diseases.
i
TABLE OF CONTENTS
List of Figures .....................................................................................................................v
List of Tables ................................................................................................................... vii
List of Abbreviations ..................................................................................................... viii
Acknowledgements ........................................................................................................ xiii
Dedication .........................................................................................................................xv
Chapter One: Embryonic Lung Development and Notch Signaling.............................1
I. Introduction ........................................................................................................1
II. Stages of Murine Lung Development ................................................................2
III. Progenitor Cells of the Developing Epithelium and Differentiation into Cell
Lineages .............................................................................................................4
IV. Overview of Conducting Airway Lineages .......................................................4
1. Secretory Cells .............................................................................................8
A. Club Cells......................................................................................8
B. NEB-associated Club Cells ...........................................................9
C. Goblet Cells ..................................................................................9
D. Ionocytes .....................................................................................11
2. Multiciliated Cells ......................................................................................11
3. Pulmonary Neuroendocrine Cells ..............................................................12
4. Basal Cells .................................................................................................13
5. Tuft/Brush Cells .........................................................................................14
V. Mammalian Notch Signaling ...........................................................................15
1. Notch Signaling in Multiciliated and Club Cells .......................................17
ii
2. Notch Signaling in PNECs and NEB-CCs ................................................19
3. Notch Signaling in Basal Cells ..................................................................20
Chapter Two: Jagged Control of Tracheal Progenitor Cell Differentiation ..............24
I. Abstract ............................................................................................................24
II. Introduction ......................................................................................................25
III. Materials and Methods .....................................................................................27
1. Mouse Models ............................................................................................27
2. In situ Hybridization ..................................................................................27
3. Immunofluorescence and Immunohistochemistry .....................................27
4. Morphometric Analysis .............................................................................28
IV. Results ..............................................................................................................29
1. Jag1 and Jag2 Have Partially Overlapping Functions in Restricting Basal
Cell Expansion ...........................................................................................29
V. Discussion ........................................................................................................33
Chapter Three: Jagged and Delta Ligands Control Distinct Events during Airway
Progenitor Cell Differentiation .......................................................................................34
I. Abstract ............................................................................................................34
II. Introduction ......................................................................................................36
III. Materials and Methods .....................................................................................38
1. Mouse Models ............................................................................................38
2. Ascl1 Lineage Trace ...................................................................................39
3. Immunofluorescence and Immunohistochemistry .....................................39
4. Morphometric Analysis .............................................................................40
iii
5. In situ Hybridization ..................................................................................41
6. Quantitative Real-Time PCR .....................................................................42
IV. Results ..............................................................................................................43
1. Jagged Ligands Precede the Appearance of Delta in Differentiating
Airway Progenitors ....................................................................................43
2. Jag1 and Jag2 Regulate the Balance of Different Cell Types in Extra- and
Intrapulmonary Airways ............................................................................47
3. Jag Ligands have Minimal Effects in the Establishment and Regulation of
the NE Microenvironment .........................................................................52
4. Dll Ligands Control the Size of the NEB Microenvironment ...................57
5. Notch Signaling and NEB-associated Club Cells are Preserved in the
Absence of Dll Ligands .............................................................................62
6. Preliminary Postnatal Analysis of Dll-cnull Mutants Demonstrate a Defect
in Alveolarization.......................................................................................66
V. Discussion and Future Directions ....................................................................69
Chapter Four: Identification of Ascl1 Targets in Pulmonary Neuroendocrine Cell
Progenitors of the Developing Lung ...............................................................................78
I. Abstract ............................................................................................................78
II. Introduction ......................................................................................................79
III. Materials and Methods .....................................................................................81
1. RNA Microarray ........................................................................................81
2. Gene Ontology Analysis ............................................................................81
3. In situ Hybridization ..................................................................................81
iv
4. Immunohistochemistry ..............................................................................83
5. Lung Organ Culture ...................................................................................83
IV. Results ..............................................................................................................84
1. Genes Differentially Expressed in Ascl1-/- Embryonic Lungs ...................84
2. Gene Ontology Analysis ............................................................................88
3. Localization of Top 15-Downregulated Genes of Interest ........................93
4. Potential Role for Catecholamines in Pulmonary Neuroepithelial Body
Expansion ...................................................................................................99
V. Discussion and Future Directions ..................................................................105
Chapter Five: General Discussion ................................................................................108
References .......................................................................................................................113
v
LIST OF FIGURES
CHAPTER ONE:
Figure 1.1 Stages of lung development
Figure 1.2 Cell types of the conducting airways
Figure 1.3 Schematic of progenitors and cell lineages within the conducting airways
Figure 1.4 Canonical Notch Signaling
CHAPTER TWO:
Figure 2.1 Jag1 and Jag2 have partially overlapping functions in restricting basal cell
expansion
CHAPTER THREE:
Figure 3.1 Wild type expression patterns of Notch ligands during early lung development
Figure 3.2 Loss of Jag-driven Notch signaling results in an excess of multiciliated cells
at the cost of secretory cells
Figure 3.3 Jagged-driven Notch signaling has a minimal impact on PENC and NEB cell
fate specification or maintenance
Figure 3.4 Loss of Dll-driven Notch signaling results in an expansion of the NEB
microenvironment
Figure 3.5 Loss of Delta-driven Notch signaling results in an expansion of the NEB
microenvironment
Figure 3.6 Delta-chet/cnull animals survive past birth but demonstrate significant
morphological defects
vi
Figure 3.7 FACS evolution of GFP+ cells from Ascl1GFP E14.5 mouse lungs
Figure 3.8 Lineage tracing of Ascl1 progenitors is an inadequate method to isolate
PNECs for RNA sequencing
CHAPTER FOUR:
Figure 4.1 Heat map of top 50 significantly downregulated genes of interest in control
and Ascl1-/- E14.5 lungs
Figure 4.2 Heat map of top 50 significantly upregulated genes of interest in control and
Ascl1-/- E14.5 lungs
Figure 4.3 Gene ontology analysis results for all downregulated genes in the array
Figure 4.4 Gene ontology analysis results for all upregulated genes in the array
Figure 4.5 Atf5 expression at E14.5
Figure 4.6 Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray at
E14.5 and E18.5 that colocalized with Ascl1+ PNECs
Figure 4.7 Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray at
E14.5 and E18.5 that were in the NEB microenvironment
Figure 4.8 Catecholamine biosynthesis pathway
Figure 4.9 Expression of Th and Th in the developing airways
Figure 4.10 Inhibition of tyrosine hydroxylase function in lung explant cultures
Figure 4.11 In situ hybridization expression of dopamine receptors 1a and 2 in E14.5
lungs
vii
LIST OF TABLES
CHAPTER THREE:
Table 3.1. Forward and reverse primers used for generation of digoxigenin-labeled UTP
anti-sense RNA probes.
CHAPTER FOUR:
Table 4.1 Forward and reverse primers for top 15 downregulated genes following gene
ontology analysis
Table 4.2 Olfactory receptor genes significantly downregulated in the Ascl1-/- E14.5
microarray from the top 50 downregulated genes
Table 4.3 Top 15-downregulated genes of interest from E14.5 Ascl1-/- mouse lungs
following gene ontology analysis
viii
LIST OF ABBREVIATIONS
ADAM: A disintegrin and metalloprotease
ALI: air-liquid interface
Ascl1: achaete-scute family bHLH transcription factor 1
Atf5: activating transcription factor 5
BADJ: bronchoalveolar duct junction
bHLH: basic helix-loop-helix
bp: base pair(s)
BV: blood vessel
Calca: calcitonin/calcitonin-related polypeptide, alpha
CC10: Clara cells 10 kDa secretory protein
cDNA: complementary DNA
Cgrp: calcitonin gene-related peptide 1
chet: conditional heterozygous
cnull: conditional null
COPD: chronic obstructive pulmonary disease
Ctf1: cardiotrophin 1
Cyp2f2: cytochrome P450, family 2, subfamily f, polypeptide 2
Dβh: dopamine beta-hydroxylase
DAPI: 4’,6-diamidino-2-phenylindole
DAPT: N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester
DBZ: dibenzazepine
Ddc: aromatic L-amino acid decarboxylase
ix
DEPC: diethylpyrocarbonate
DIPNECH: diffuse idiopathic neuroendocrine cell hyperplasia
Dll#: delta-like #
DMSO: dimethylsulfoxide
DNA: deoxyribonucleic acid
Drd1a: dopamine receptor D1a
Drd2: dopamine receptor 2
E#: embryonic day #
E: esophagus
EDTA: ethylenediamine tetraacetic acid
ETS: E26 transformation-specific
FBS: fetal bovine serum
FC: fold change
Fgf10: fibroblast growth factor 10
Fgfr2: fibroblast growth factor receptor 2
Foxj1: forkhead box J1
GABA: gamma-aminobutyric acid
Gabra5: gamma-aminobutyric acid type A receptor Alpha5 subunit
GFP: green fluorescent protein
GO: gene ontology
GOrilla: Gene Ontology enRIchment anaLysis and visualization tool
H&E: hematoxylin and eosin
hALI: human ALI
x
Hand2: heart and neural crest derivatives expressed 2
Hes#: Hairy/enhancer-of-split family bHLH transcription factor #
Hey#: Hairy/enhancer-of-split related with YRPW motif protein #
Hoxd9: homeobox D9
Id2: inhibitor of DNA binding 2
IF: immunofluorescence
IHC: immunohistochemistry
Insm1: insulinoma-associated protein 1
ISH: in situ hybridization
Jag#: jagged #
Krt#: cytokeratin #
L-DOPA: L-3,4-dihydroxyphenylalanine
Lfng: lunatic fringe
Lif: leukemia inhibitory factor
mRNA: messenger ribonucleic acid
Mib1: mindbomb E3 ubiquitin protein ligase 1
MOM: mouse-on-mouse
Muc5AC: mucin-5AC precursor
N#ICD: Notch# intracellular domain
NE: neuroendocrine
NEB: neuroepithelial body
NEB-CC: neuroepithelial body-associated club cell
NECD: Notch extracellular domain
xi
NEHI: neuroendocrine hyperplasia of infancy
Nkx2.1: NK2 homeobox 1
Neurod2: neuronal differentiation 2
Ntrk2: neurotrophic receptor tyrosine kinase 2
OCT: optimal cutting temperature
Olfm3: olfactomedin 3
p63: tumor protein p63
PBS: phosphate buffered saline
PCR: polymerase chain reaction
PGP9.5: protein gene product 9.5
PN#: postnatal day #
PNEC: pulmonary neuroendocrine cell
PNMT: phenylethanolamine N-methyltransferase
Olfr#: olfactory receptor #
OR: olfactory receptor
Phox2b: paired like homeobox 2B
PNEC: pulmonary neuroendocrine cell
Pofut1: protein o-fucosyltransferase 1
qPCR: quantitative polymerase chain reaction
Rbpj: recombination signal binding protein for immunoglobulin kappa J region
Rbpjcnull: abbreviated genotype for Shhcre/+; Rbpjflox/flox
RMA: Robust Multi-array Average
RNA: ribonucleic acid
xii
Scgb1a1: secretoglobin family 1A member 1
Scgb3a2: secretoglobin family 3A member 2
SCLC: small cell lung cancer
SEM: standard error of the mean
Shh: Sonic hedgehog
shRNA: short hairpin RNA
Slc4a10: solute carrier family 4 member 10
SO2: sulfur dioxide
Sox#: SRY-box #
SPC/SFTPC: surfactant protein C
SSEA1: stage-specific embryonic antigen 1
Th: tyrosine hydroxylase
TM: transmembrane
TMX: tamoxifen
TNF-α: tumor necrosis factor alpha
Tomt: transmembrane o-methyltransferase
Tr: trachea
Trp63: transformation related protein 63
Upk3a: uroplakin 3A
xiii
ACKNOWLEDGEMENTS
I would like to thank the following individuals for their support and guidance over
the years as I undertook my dissertation work:
My advisor, Dr. Wellington V. Cardoso, for his outstanding mentorship and
guidance. I have learned so much from him and know I am a better scientist because of
his tutelage. His extraordinarily steadfast support and understanding has been truly
appreciated.
My thesis and defense committee members Drs. Michael Shen, Cathy
Mendelsohn, Amin Ghabrial, and Xin Zhang, for their guidance and for helping me push
my work forward.
Dr. Jining Lü for his scientific feedback and discussions. I thank him for taking
the time to review this dissertation and for all of his constructive criticism and advice.
Past and present members of the Cardoso and Lü labs for their friendship,
camaraderie, and scientific discussions, especially Dr. Munemasa Mori, Dr. Jed
Mahoney, Dr. Hector Marquez, Dr. Ying Yang, Mr. Benjamin van Soldt, Dr. Paul Riccio,
Ms. Jingshu Huang, and Ms. Jun Qian.
The current and former faculty of the Department of Genetics and Development at
Columbia University Irving Medical Center, particularly members of the training
committee and my qualifying committee including Drs. Frank Costantini, Benjamin
Ohlstein, and Lori Sussel.
The current and former faculty at Boston University School of Medicine,
particularly Drs. Vickery Trinkaus-Randall, Andrew Zoeller, Barbara Schreiber, Xingbin
Ai, and Alan Fine.
xiv
The current and former administrative personnel in the Department of Genetics
and Development especially Ms. Stacy Warren.
Mrs. Kathryn Kennedy and Mrs. Rashmi Patel for their administrative support
and for handling all of the crises that have occurred throughout. I thank them for our
chats and their encouragement.
Ms. Elizabeth Roemer for first introducing me to scientific research and teaching
me the importance of scientific integrity.
All of my family and friends for their unwavering support and enthusiasm,
especially Dr. Juliana Barrios, Dr. Margaret Kirkling, Ms. So Jung Lee, Ms. Priya
Zachariah, and Ms. Pryanca Zaman.
My in-laws for their encouragement and support.
My husband, Rob, for his unending love, encouragement, and patience, especially
during these last months of work.
My brother, Matt, for always being there for me and supporting me.
Lastly, I am grateful for my parents who sacrificed so much for me and who
always loved me, inspired me, and pushed me to give my all.
xv
Endeavor (verb)
1. To attempt (something, such as the fulfillment of an obligation) by exertion or effort
Endeavor (noun)
1. Serious determined effort
2. Activity directed toward a goal
I dedicate this endeavor to my parents, who taught me the true meaning of the word.
"endeavor." Merriam-Webster.com. Merriam-Webster, 2019.
1
CHAPTER ONE
Embryonic Lung Development and Notch Signaling
I. Introduction
The mammalian respiratory system has evolved into a highly specialized organ to
allow efficient gas exchange to meet the metabolic demands as species transitioned from
water to air breathing organisms. The overall design is of a tree-like network of
conducting tubules (airways) responsible for carrying air to millions of alveoli, where gas
exchange occurs.
The conducting airways are formed by multiple generations of branched tubules
lined with epithelial cells responsible for humidifying and cleaning the air from
environmental particles and biological agents.
Development of the respiratory system relies on complex morphogenetic events
that pattern the airways into proximal (bronchi) and distal (bronchioles) conduits and
generate the alveoli. The respiratory epithelium is populated by numerous specified cell
types, and this diversity is particularly striking in the conducting airways where different
populations of secretory, multiciliated, and neuroendocrine cells have been described.
How these different cell types arise from airway progenitors has been studied
extensively, however many questions about the regulation of differentiation of these cells
remain unresolved. There is accumulated evidence of a mechanistic link between chronic
pulmonary disease and aberrant patterns of airway epithelial differentiation.
Understanding how differentiation is regulated can lead to further comprehension of
mechanisms of lung diseases.
2
This thesis focuses on the regulation of airway epithelial cell fate in the
developing lung epithelium. More specifically it investigates Notch signaling and
addresses a long unresolved question whether different ligands (Jagged and Delta) have
distinct roles in the epithelial differentiation program of extrapulmonary and
intrapulmonary airways. Moreover, these studies include analysis of the bHLH
transcription factor Ascl1 and its targets as potential regulators of neuroepithelial body
(NEB) size and maturation in the developing airways.
I summarize below the key events in embryonic development and differentiation
of conducting airway epithelial cell types as well as Notch signaling and its role in the
developing murine airways.
II. Stages of Murine Lung Development
Development of the lung begins around embryonic day (E) 9.0 in the mouse when
respiratory progenitors are specified from the anterior foregut endoderm and recognized
by local expression of Nkx2.1. Traditionally, five stages of lung development have been
described, mostly based on morphological criteria (Burri, 1984; Figure 1.1). An early
embryonic lung bud stage occurs from E9.5-E10.5 and is marked by the formation of the
primary lung buds and the tracheal primordium followed by separation of the trachea
from the esophagus through ventral-dorsal patterning of the foregut (Que et al., 2006).
The pseudoglandular stage (E11.5-E16.5) is marked by the process of branching
morphogenesis and initiation of airway epithelial differentiation. Branching
morphogenesis is crucial for formation of the highly arborized airway tree.
3
The following canalicular (E16.5-E17.5) and saccular (E18.5-birth) stages of
development results in close approximation of the developing vascular and epithelial
compartments, and formation of the distal saccules for gas exchange. Postnatally these
saccules undergo a process of septation that incurs the surface area of gas exchange and
form the definitive alveoli (birth-PN14) (Morrisey and Hogan, 2010; Rock and Hogan,
2011; Rackley and Stripp, 2012; Herriges and Morrisey, 2014).
Figure 1.1. Stages of lung development in mice (blue) and humans (red). Adapted from
Rackley and Stripp, 2012.
4
III. Progenitor Cells of the Developing Epithelium and Differentiation into Cell
Lineages
As airways grow and branch, the Nkx2.1+ lung epithelium is specified into two
broad domains along the proximal-distal axis. The proximal domain is marked by
expression of Sox2 and gives rise to conducting airway cell types. The distal domain is
marked by Sox9 and Id2 and gives rise to alveolar epithelial cell types.
Lineage tracing studies show that during branching morphogenesis, distal tips
contain multipotent epithelial progenitor cells that contribute to both airway and alveolar
epithelial lineages (Rawlins et al., 2009). As branching occurs, tip cells leave this distal
position to become more proximal stalk cells, lose their Sox9 and Id2 expression, begin to
express Sox2, and give rise to all different cell types of the conducting airways.
IV. Overview of Conducting Airway Lineages
The conducting airways are comprised of the trachea and primary bronchi, which
are extrapulmonary (outside of the lung lobes), as well as smaller bronchi and
bronchioles (Figure 1.2). The distal gas exchange airways are comprised of alveoli.
Within the conducting airways exists several types of epithelia. The trachea and
extrapulmonary bronchi are pseudostratified and are composed of predominantly basal,
multiciliated, goblet, and club cells, with some pulmonary neuroendocrine cells (PNECs)
in the bronchi, but not trachea as well as rare ionocytes and tuft cells. Intrapulmonary
bronchi are comprised of multiciliated, club, PNECs and clusters of PNECs known as
neuroepithelial bodies (NEBs), and a subset of club cells associated with NEBs that we
refer to as NEB-associated club cells or NEB-CCs (Figure 1.2).
5
Figure 1.2. Cell types of the conducting airways. The respiratory system is composed of
conducting airways, which includes the trachea, primary bronchi and smaller bronchi;
and the distal alveoli or exchange surface, where gas exchange occurs. The
extrapulmonary epithelial are composed of multiciliated, club, goblet, and basal cells,
PNECs, ionocytes, and tuft cells (upper right). Intrapulmonary bronchi are composed of
multiciliated, club, NEB-CCs, PNECs, and NEBs (lower right).
6
Briefly, basal cells function as progenitors derived from proximal progenitors that
can give rise to other basal cells, club cells, PNECs, ionocytes, and tuft cells. Club cells
can give rise to other club cells, goblet cells, as well as multiciliated cells, and
multiciliated cells are terminally differentiated cells that do not proliferate (Figure 1.3).
7
Figure 1.3 Schematic of progenitors and cell lineages within the conducting airways.
Nkx2.1+ lung endoderm progenitors give rise to proximal (Sox2+) or distal (Sox9+ Id2+;
not shown) progenitors. These proximal progenitors then give rise to basal cells, which
can self-renew or differentiate into club, PNECs, ionocytes, and tuft cells. Club cells can
also self-renew but can give rise to multiciliated and goblet cells.
8
1. Secretory Cells
Three main subpopulations of secretory cells are currently known; club cells (also
known as Clara cells), neuroepithelial body-associated club cells (NEB-CCs), and goblet
cells.
A. Club Cells
Club cells are secretory cells responsible for concentrating and metabolizing
endogenous or xenobiotic compounds and for secretion of surfactants and other proteins
into the airway lining fluid. In the mouse these cells are abundant and line the conducting
airways in numbers nearly equal to that of multiciliated cells. In humans and non-human
primates, however, these cells are more rare (Coppens et al., 2007). Studies in the adult
mouse lung using naphthalene have identified two subpopulations of cells in the
intrapulmonary airways. Those that are considered mature and express cytochrome P450
(hereafter referred to simply as “club cells”) which undergo apoptosis following exposure
to naphthalene and those lacking this enzyme, which are immature and surround the
pulmonary neuroepithelial bodies (NEBs), referred to as NEB-associated club cells
(NEB-CCs) which can repopulate the airways following injury and will be discussed in
the following section (Reynolds et al., 2000a; Hong et al., 2001).
There exists a heterogeneity of club cells throughout the airways, with varying
expression of genes depending on location during development. In the proximal airways
club cells are enriched for Reg3g, Chad, Gabrp, and Lrrc26, while distal club cells are
enriched for Hp (Guha et al. 2014). Immature club cells express Scgb3a2 and are
observed as early as E13.5, while more mature club cells express Scgb1a1 and are seen
9
around E16.5 in the developing airways. Recently, Nfia was identified as a transcription
factor enriched in club cells (Montoro et al., 2018).
B. NEB-associated Club Cells
Neuroepithelial body-associated club cells (NEB-CCs) are first detected by the
presence of Scgb3a2 adjacent to regions where Ascl1+ clusters are present at E14.5
(Guha et al., 2012). In the adult these cells are enriched around NEBs and near
bronchoalveolar duct junctions (BADJs) and lack Cyp2f2, the gene encoding cytochrome
P450 and therefore can survive naphthalene injury (Hong et al., 2001; Reynolds et al.,
2000a, 2000b; Giangreco et al., 2002; Giangreco et al., 2009; Volckaert et al., 2011).
These cells express all three Notch receptors as well as Upk3a, a gene specific to this cell
type (Morimoto et al., 2012; Guha et al., 2012; Guha et al., 2014). There is evidence that
in wild type conditions these cells can give rise to club and multiciliated cells (Guha et
al., 2012; Guha et al., 2017). Additionally, following bleomycin injury these cells can
generate alveolar type I and II cells (Guha et al., 2017).
C. Goblet Cells
Mucus-producing goblet cells are a specialized subtype of secretory cell that helps
to maintain tissue homeostasis by secreting a variety of substances including mucins and
trefoil factors, which contribute to the protective mucus layer covering the epithelium.
Muc5AC and Muc5B are the predominant mucins produced by goblet cells in the airway
epithelium.
10
These cells are abundantly found in the human airway epithelia but are rarely
found in the airways of adult mice living in pathogen-free environments. When the
airways are injured, however, the abundance of goblet cells increases in both human and
mouse models of lung disease resulting in an excess of mucus and therefore airway
obstruction.
A recent scRNA-seq study determined there were three subsets of goblet cells;
immature goblet, goblet-1, and goblet-2, with each enriched for different sets of genes.
Goblet-1 cells were enriched for genes encoding mucosal proteins Tff1, Tff2, and Muc5b
and secretory regulators such as LmanIl and P2rx4, while goblet-2 cells were enriched for
Lipf, a secreted gastric lipase that hydrolyses triglycerides and Dcpp1, Dcpp2, and Dcpp3
which are orthologues of ZG16B that encodes for a lectin-like secreted protein that
aggregates bacteria (Montoro et al., 2018).
Spdef, an ETS domain transcription factor, was found to be critical for goblet cell
fate. Genetic deletion of Spdef in mice results in an inhibition of goblet cell formation in
airway injury models and overexpression of Spdef in a subset of club cells was found to
result in their conversion to goblet cells (Park et al., 2007; Chen et al., 2009).
Interestingly, Notch signaling was found to occur upstream of Spdef in mouse airways
and demonstrated to regulate the abundance of goblet cells in the airways (Guseh et al.,
2009; Rock et al., 2011). Pharmacological inhibition of Notch results in a reduction in the
number of goblet cells while transgenically activated Notch in the embryonic airway in
vivo results in an expansion of goblet cells at the cost of multiciliated cells (Guseh et al.,
2009). Additionally, conditional inactivation of Rpbj or Pofut1 in airway epithelial cells
in vivo results in goblet cell metaplasia in the adult mouse airways (Tsao et al., 2011).
11
Notch2 has been demonstrated to promote goblet cells, while inhibition of Notch2 via
antibodies was shown to prevent IL-13 and allergen-driven goblet cell metaplasia
(Danahay et al., 2015; Lafkas et al., 2015).
D. Ionocytes
Recently, two groups individually discovered a novel airway cell type, known as
the pulmonary ionocyte. These cells are found in mouse submucosal glands and the nasal
and olfactory epithelia. Ionocytes express Foxi1 and genes encoding subunits of proton-
secreting V-ATPase, Atp6v1c2 and Atp6v0d2. This cell type was also found to derive
from basal progenitor cells and is a major source of Cftr in the mouse and CFTR in the
human, a gene whose mutations are known to cause cystic fibrosis (Montoro et al., 2018;
Plasschaert et al., 2018). While it is possible that ionocytes are the main cells responsible
cystic fibrosis, additional studies are needed to further characterize this cell type and
explore its role in disease. Notch signaling has also been implicated in regulating
ionocyte numbers; cultures of human airway epithelial cells with the DAPT γ-secretase
inhibitor or antibodies against individual Notch receptors resulted in a reduction in the
number of ionocytes (Plasschaert et al., 2018).
2. Multiciliated Cells
Multiciliated cells have multiple apical motile cilia and with secretory cells are
responsible for mucociliary clearance, a mechanism used for keeping airways clear of
microorganisms and environmental particulates. Commitment to the multiciliated cell
program occurs around E14.5. At this stage multiciliated precursors can be identified in
12
proximal airways by expression of Foxj1, a forkhead transcription factor required for
anchoring of basal bodies to the cytoskeleton to allow for generation of cilia (Chen et al.,
1998; Brody et al., 2000; Gomperts et al., 2004; Rawlins et al., 2007).
Multiciliated cells are derived from airway basal and club cells, are considered as
terminally differentiated, and do not proliferate or transdifferentiate in response to lung
injury (Rawlins et al., 2007; Rawlins and Hogan, 2008; Pardo-Saganta et al., 2013). In
the absence of Notch signaling, airway progenitors in the developing lung default into a
program of differentiation that results in an excess of multiciliated cells at the cost of club
cells (Tsao et al., 2009; Morimoto et al., 2010).
3. Pulmonary Neuroendocrine Cells
Pulmonary neuroendocrine cells (PNEC) are one of the lesser known types of
differentiated airway epithelial cells found in the lung; their exact function has only
become clearer in recent years. These cells are present as solitary cells or in clusters
known as neuroepithelial bodies (NEBs). These cells are thought to function as airway
chemosensory cells, recognizing signals from their environment and signaling through
paracrine, endocrine, or autocrine mechanisms (Lauweryns et al., 1973; Cutz et al., 1993,
Linnoila et al., 2006; Gu et al., 2014). PNECs have also been demonstrated to function as
progenitor cells of the airways to maintain the neuroepithelial (NEB) microenvironment,
which acts as a niche for a distinct subset of club cells (Reynolds et al., 2000a; Guha et
al., 2012; Song et al., 2012; Yao et al., 2018). Postnatally, PNECs have been
demonstrated to regulate mucus overproduction in models of allergic inflammation by
GABA hypersecretion (Barrios et al., 2017; Barrios et al., 2018; Sui et al., 2018).
13
Ascl1, a basic helix-loop-helix transcription factor, is a master regulator of PNECs
(Borges et al., 1997). Systemic knockout of Ascl1 results in animals lacking PNECs
without affecting differentiation of the other epithelial lineages in intrapulmonary
airways. A recent study determined that epithelial-specific deletion of Ascl1 suppresses
type 2 immune responses, confirming a previously proposed role for PNECs in innate
immunity (Branchfield et al., 2016; Sui et al., 2018).
Ascl1 is first detected in the developing murine airways at E12.5. At subsequent
stages neuroendocrine precursors acquire markers such as PGP9.5 and Cgrp at around
E15.5. Recent studies suggest there are three phases of NEB development: PNEC
selection (E12.5 E13.5), cluster formation (E13.5 E15.5), and finally differentiation
(E15.5 onward) (Kuo and Krasnow, 2015). Additionally, the formation of NEBs at
branch points in airways has been suggested to result from directed migration, through a
process of “slithering” of solitary PNECs regulated by Slit-Robo signaling (Kuo and
Krasnow, 2015; Noguchi et al., 2015; Branchfield et al., 2016).
4. Basal Cells
Basal cells function as stem cells of the developing and adult respiratory systems
(Rock et al., 2009). In mice, these cells express the transcription factor p63 and
cytokeratins such as Krt5 and Krt14 and are observed in the trachea as early as E10.5
(Evans et al., 2001; Daniely et al., 2004; Que et al., 2007). In humans, basal cells are
present from the trachea throughout the intrapulmonary conducting airways. p63 is
required for basal cell specification, as p63-/- mice lack basal cells (Daniely et al., 2004).
Basal p63+ cells arising from the lung primordium are initially multipotent progenitors
14
that give rise to both airway and alveolar lineages, however they later become lineage-
restricted proximally to create the adult tracheal stem cell pool (Yang et al., 2018).
There is evidence that basal cells give rise to undifferentiated progenitors known
as suprabasal (or parabasal) cells which are Krt8+ p63- and are able to differentiate into
club and multiciliated cells. Notch has been demonstrated to be active in suprabasal but
not basal cells (Rock et al., 2011; Mori et al. 2015).
5. Tuft/Brush Cells
Another rare cell type in the airway epithelium is the tuft cell (also known as
brush cell) characterized by the presence of a tuft of microvilli on the apical surface. This
cell comprises only 1% of the airway epithelium and is believed to play a chemosensory
role, similar to PNECs, where bioactive substances are released in response to external
stimuli to control local immune and epithelial cell functions (Reid et al., 2005; Krasteva
et al., 2011; Tizzano et al., 2011; Krasteva et al., 2012; Huang et al., 2018). Tuft cells
express Skn-1a/Pou2f3, a transcription factor that is required for their generation
(Yamashita et al., 2017). Other transcription factor lineage markers of tuft cells include
SOX9, GFI1B, and ASCL2 (Bjerknes, et al., 2012; Gerbe et al., 2016; Yan et al., 2017).
A recent scRNA-seq study determined there were three subsets of tuft cells;
immature tuft, tuft-1, and tuft-2 cells, with each enriched for different sets of genes. Tuft-
1 cells were enriched for genes associated with taste transduction and Pou2f3, while tuft-
2 cells were enriched for genes that mediate leukotriene biosynthesis such as Alox5ap, as
well as immune cell associated Ptrprc and transcription factors Gfi1b, Spib, and Sox9
(Montero et al., 2018).
15
V. Mammalian Notch Signaling
Notch signaling has been shown to play critical roles in regulating lung epithelial
cell differentiation and proliferation (Tsao et al., 2008; Tsao et al., 2009; Guseh et al.,
2009; Morimoto et al., 2010; Morimoto et al., 2012; and others).
Four Notch transmembrane receptors (Notch1-4) and five ligands (Jagged1 and 2
(Jag1 and 2) and Delta-like 1, 3 and 4 (Dll1, 3, and 4)) have been reported in the
developing lung. All ligands except Dll3 activate Notch signaling via cell-cell
interactions. Upon ligand-receptor binding the Notch extracellular domain (NECD)
undergoes S2 cleavage from the transmembrane-Notch intracellular domain (TM-NICD)
complex by TNF-α ADAM metalloprotease converting enzyme. The cleaved NECD
remains bound to the ligand and undergoes endocytosis in the signal-sending cell for
recycling. In the signal-receiving cell, the TM-NICD complex undergoes secondary
cleavage via the γ-secretase complex of PSEN1, nicastrin, APH-1, and PEN-2 to release
the NICD from the TM. This results in nuclear translocation of the NICD where it
associates with the RBPJ-activator complex for subsequent activation of downstream
Notch target genes, such as HEY- and HES-family members (Figure 1.4) (Radtke and
Raj, 2003; Bray, 2006).
16
Figure 1.4. Canonical Notch signaling. A signal-sending cell expressing Jagged or Delta
ligand(s) binds to a signal-receiving cell’s Notch receptor, resulting in two cleavages and
transcription of downstream targets. Adapted from Bray, 2006.
17
1. Notch Signaling in Multiciliated and Club Cells
Notch signaling regulates the balance of multiciliated and club cells in the
airways. Loss of Pofut1, an O-fucosyltransferase that mediates a posttranslational
modification of Notch essential for Notch-ligand binding, or Rbpjk specifically in the
airway epithelium during development prevents formation of club cells and expands the
ciliate cell population. However, Notch is not required for ciliated cell fate as confirmed
in FOXJ1-Cre, RBPjκflox/flox mouse embryos in which Rbpj was specifically deleted in
multiciliated cells (Morimoto et al., 2010). Additionally, experiments in which
multiciliated cells were ablated in FOXJ1-creER; LSL-DTA adult mice demonstrated no
effect on basal or club cell populations suggesting the lack of a feedback mechanism to
restore multiciliated cells following injury (Pardo-Saganta et al., 2015b).
Rather, Notch is essential to activate the secretory cell fate program. Analysis of
CCSP-rtTA, (tetO)7-Cre, RBPjκflox/flox mouse mutants in which Rbpj was specifically
deleted in club cells of the embryonic lung determined that club cells do not require
constant Notch activation for their cell fates (Morimoto et al., 2010). Nevertheless, there
is evidence that club cells in the adult lung require sustained Notch activation to prevent
them from differentiating into ciliated cells (Pardo-Saganta et al., 2015b).
Ciliated cells express Jagged1 which activates Notch in neighboring cells (Tsao et
al., 2009; Xu et al., 2010). This expression is seen in rare epithelial cells as early as E13.5
and begins to be strongly expressed at E16.5 in ciliated cells of the airway (Zhang et al.,
2013). Analysis of Jag1flox/flox; Spc-rtTA; Tet-O-Cre transgenic mice showed that loss of
Jag1 in lung epithelial progenitors results in an excess of ciliated cells at the cost of club
cells (Zhang et al., 2013).
18
Ciliated cells do not express Notch receptors or undergo Notch activation. Notch2
was found to have a dominant contribution in club cell fate differentiation whereas
Notch1 and Notch3 contribute only minimally to this process (Morimoto et al., 2012).
Loss of all three Notch receptors led to a major loss of club cells and an increase in
ciliated cells, however, did not result in the same increase in ciliated cells observed in
Rbpjcnull mice. The reason for the difference between Rbpjcnull and Notch triple KO mice
is unclear.
Overexpression of the Notch1 intracellular domain in lung epithelial progenitors
of SPC-Cre; Rosa-NotchIC-IRES-GFP mice during embryonic development resulted in
an excess of mucus-producing secretory cells and a reduction in ciliated cells in proximal
airways of the developing lungs. Mouse embryonic tracheal explant assays and adult
human airway epithelial cultures confirmed that Notch overactivation via addition of
recombinant Dll4 results in an excess of mucous-producing cells with no effect on club
cells. Conversely, Notch inhibition via the DBZ γ-secretase inhibitor in these cultures
demonstrated an increase in ciliated cells, decrease in mucus-producing cells, and no
change in club cells (Guseh et al., 2009). Overexpression of other Notch receptors has not
been investigated.
Overall these reports describe a system where multiciliated cells provide ligands
to neighboring club cells, which undergo Notch activation for initiation of secretory cell
fate and that requires constant Notch to maintain secretory (club) cell phenotype.
Multiciliated cells do not require Notch and are, in fact, restricted by Notch, as
demonstrated by Notch inhibition studies where loss of Notch results in an excess of
multiciliated cells.
19
2. Notch Signaling in PNECs and NEB-CCs
In ShhCre; Rpbjflox/flox and ShhCre; Pofut1flox/flox mice there is a small but
significant excess of PNECs as compared with controls, due to disruption of Notch
signaling and its presumed target Hes1. Hes1 has been previously demonstrated to restrict
PNEC fate and NEB size (Ito et al., 2000; Tsao et al., 2009; Morimoto et al., 2010). In
vitro treatment of lung progenitor cells derived from human embryonic stem cells with
DAPT can generate PNECs (Chen et al., 2019). Overexpression of the Notch1
intracellular domain in the lung epithelium of SPC-Cre; Rosa-NotchIC-IRES-GFP mice
resulted in a loss of PNECs presumably due to overactivation of Notch leading to
increased Hes1 expression (Guseh et al., 2009). These studies suggest PNECs do not
require Notch for cell fate but NEB size is affected by activation of Notch in neighboring
cells.
PNECs are known to express Dll1 and Dll4 and have recently been demonstrated
to express Dll3, a non-Notch-activating ligand (Ito et al., 2000; Post et al., 2000; Tsao et
al., 2009; Verckist et al., 2017). It is believed that Ascl1 regulates expression of Dll1
which can then activate Notch in neighboring NEB-CCs. In airways in which Jag1 has
been specifically removed from the epithelium a slight increase in the number of NEBs
was observed, however NEB size remained the same. It was reported this slight increase
may be due to the downregulation of Hes1 in these mutants (Zhang et al., 2013). Ongoing
studies in our lab, however, have found that the number of PNECs is not affected by loss
of Jag1 (unpublished). Essentially, it is believed the derepression of Hes1 can lead to
excess PNEC. A study examining Insm1 found that Insm1-dependent Hes1 is required for
differentiation but not specification of PNECs (Jia et al., 2015).
20
Loss of all three Notch receptors in the developing airway epithelium resulted in
an increase in PNECs and NEB size as opposed to Rbpjcnull airways where there was only
a modest increase in the number of PNECs as well as a loss of NEB-CCs (Tsao et al.,
2009; Morimoto et al., 2010; Morimoto et al., 2012). PNECs do not express N1ICD and
activate Notch in neighboring cells (Morimoto et al., 2012). However, artificial
introduction of N1ICD into PNECs was found to promote transdifferentiation of PNECs
following airway injury with naphthalene. This transdifferentiation was lost when Rbpj or
Pofut1 was specifically deleted from PNECs (Yao et al., 2018). Additionally, loss of
Notch1 in epithelial cells reduces the ability of NEB-CCs to repopulate the airways
following naphthalene injury (Xing et al., 2012).
In summary, these results suggest NEB size is restricted by Hes1 expressed in
neighboring NEB-CCs and that PNEC fate is not dependent on Notch activation.
However, there exists a feedback mechanism between PNECs and NEB-CCs where
PNECs provide ligands to NEB-CC which then activate Hes1 to restrict NEB size. When
this feedback is disrupted, NEBs expand in size due to loss of Ascl1 suppression.
3. Notch Signaling in Basal Cells
Through SO2 injury studies, two non-overlapping subpopulations of basal cells
have been identified, a c-myb+ subpopulation which differentiates into multiciliated cells
and a N2ICD+ (Notch2 intracellular domain) subpopulation which activates canonical
Notch signaling and differentiates into club cells (Pardo-Saganta et al., 2015a).
In mouse air-liquid-interface (ALI) cultures Notch3 has been shown to be
selectively active in an undifferentiated layer of suprabasal progenitor cells (Mori et al.,
21
2015). Disruption of Notch signaling using gamma secretase inhibitors (DAPT, DBZ) in
culture expands the population of basal cells suggesting that Notch is important for
restricting proliferation of basal cells (Mori et al., 2015). These findings were further
confirmed in vivo using Shhcre; Rbpjflox/flox mice in which Rbpj was specifically deleted
from the airway epithelium. Notch’s role as a negative regulator of basal cell proliferation
was further confirmed in gamma secretase inhibitor-treated human airway basal cells
which had an increase in basal cells versus control (Gomi et al., 2015). Interestingly, in
these cultures Notch fostered expansion at the cost of differentiation; there was reduction
in the number of both secretory and multiciliated cell phenotypes.
Mice in which basal cells were deficient in Mib1, a gene required for
ubiquitination and endocytosis of Notch ligands, further demonstrated that Notch
signaling is required for luminal differentiation of basal cells. Since Mib1 is required
specifically in ligand-expressing cells, it was suggested that basal cells are significant
sources of Notch ligands (Rock et al., 2011). In fact, Jag1 and Jag2 are both expressed in
murine tracheal basal cells (Rock et al., 2011; Mori et al., 2015). Experiments using real-
time PCR determined Dll1 is expressed in basal cells at levels higher than luminal cells
although this has not be confirmed by immunostaining (Rock et al., 2011). Separate
studies determined Dll1 and Jag2 are expressed in basal cells with Jag2 being the most
abundant ligand (Pardo-Saganta et al., 2015b). Expression of DLL1, DLL4, JAG1, JAG2,
and all four Notch receptors was observed in basal cells of human airways as well as
downstream effectors RBPJK, HES1, HES2, HES4, HES5, HES6, HEY1, HEY2, and
HEYL (Gomi et al., 2015; Gomi et al., 2016). It is unclear why there are conflicting
22
reports of which ligands are expressed in basal cells. It could be due to techniques used to
detect ligands or how basal cells were defined in human versus mouse studies.
A number of studies have determined that overexpression of activated Notch in
basal cells results in an increased differentiation into club cell lineages. Forced
expression of N1ICD in Krt5+ basal cells resulted in differentiation into club cell lineages
(Rock et al., 2011). Overexpression of N1ICD or N3ICD in human airway ALI resulted
in increased club cells and decreased numbers of TRP63+ basal cells and multiciliated
cells whereas overexpression of N2ICD or N4ICD had no significant change in basal,
club, or multiciliated cell populations (Gomi et al., 2015). Conversely, global Notch3-/-
mice had an expansion of basal in the tracheal epithelium by E14.5 similar to Rbpjcnull
tracheas where Rbpj was specifically deleted from the endoderm and airway epithelium
(Shhcre/+; Rbpjflox/flox mice hereafter referred to as Rbpjcnull). It was found that Notch3 was
found to be responsible for controlling the pool of basal cells available for differentiation
(Mori et al., 2015).
Overexpression of the downstream target of Notch signaling Hes1 in human
primary lung basal cells had a similar effect as N1ICD overexpression in murine basal
cells; resulting in differentiation into secretory cells (Rock et al., 2011).
Overexpression of JAG1 in human ALI (hALI) cultures resulted in a significant
increase in club cells at the expense of basal cells with no change in multiciliated cells
suggesting that JAG1-driven Notch signaling promotes differentiation of basal cells into
club cells (Gomi et al., 2016). Knockdown of JAG1 in hALI using shRNA demonstrated
a decrease in expression of club cell markers with no change in TP63 or multiciliated cell
markers (Gomi et al., 2016). These data contradict findings in mice, in which loss of Jag1
23
resulted in excess multiciliated cells (Zhang et al., 2013). Knockdown of Jag2 in mALI
by shRNA resulted in a decreased number of club cells and an increased number of
multiciliated cells. Selective loss of Jag2 in basal cells in Krt5cre; Jag2flox/flox mice
phenocopied the effects of shRNA and also caused a decrease in N2ICD+ parabasal cells
with no change in p63+ cells (Pardo-Saganta et al., 2015b). It remains unclear, however,
the effect of deficiency in Jagged ligands.
Overall these studies demonstrate Notch is required to restrict proliferation of
basal cells and their differentiation into club and multiciliated cell lineages.
24
CHAPTER TWO
Jagged Control of Tracheal Progenitor Cell Differentiation
Part of this chapter has been published in:
Mori, M., Mahoney, J. E., Stupnikov, M. R., Paez-Cortez, J. R., Szymaniak, A. D.,
Varelas, X., Herrick, D. B., Schwob, J., Zhang, H. and Cardoso, W. V. (2015). Notch3-
Jagged signaling controls the pool of undifferentiated airway progenitors. Development
142, 258-267. doi:10.1242/dev.116855
I. Abstract
Basal cells are multipotent airway progenitors that generate distinct epithelial cell
phenotypes crucial for homeostasis and repair of the conducting airways. Little is known
about how these progenitor cells expand and transition to differentiation to form the
pseudostratified airway epithelium in the developing adult lung.
My role in this work was to investigate whether Jag-driven Notch signaling plays
a role in the balance of parabasal-basal stem cell compartments. I generated the Shhcre/+;
Jag1flox/flox and Shhcre/+; Jag2flox/flox knock-in lines, performed microdissection of
embryonic lungs and tracheas and performed histological and marker analyses of tissues
by immunofluorescence and confocal microscopy. Results from this analysis showed that
loss of Jag1 or Jag2 results in an excess of basal cells and reduction of parabasal cells
and subsequent differentiation. I demonstrate that Jag2 has a predominant role in
restricting basal cells in the proximal trachea while Jag1 has a predominant role in
25
regulating basal cells in the distal trachea. This differential spatial regulation continues
into the intrapulmonary airways which will be discussed in a subsequent chapter.
II. Introduction
Basal cells are multipotent epithelial progenitors recognized largely by expression
of p63 and intermediate filament keratins, such as Krt5 and Krt14 in multiple organs,
including the skin, upper digestive, respiratory, and urinary tracts (Yang and McKeon,
2000; Rock and Hogan, 2011; Hegab et al., 2011; Pignon et al., 2013; Fuchs, 2008;
Kurita et al., 2004). In the adult human lung, these cells are seen throughout the airway
epithelium from the trachea to the distal bronchioles; in mice, basal cells are found
predominantly in the trachea, submucosal glands and extrapulmonary airways (Rock and
Hogan, 2011; Hegab et al., 2011). Lineage studies have shown that these cells self-renew
and generate secretory and multiciliated epithelial cell phenotypes crucial for homeostasis
of the conducting airways. Still, little is known about how basal cells transition from the
proliferative uncommitted state to differentiation in the developing and the adult airway
epithelium. Studies in different tissues, including the human lung, have identified a non-
basal intermediate cell with some ultrastructural features of basal cells but no defined
features of the typically differentiated cellular phenotypes of the airway epithelium
(Donnelly et al., 1982; Mercer et al., 1994; Breuer and Zajicek, 1990). The topographic
nuclear position in between the basal and luminal cell led them to be named as suprabasal
or parabasal cells. These cells have also been shown to have limited proliferative capacity
and were identified as early progenitors of the airway epithelium. The process that gives
rise to these cells resembles that described during the generation of the epidermis and is
26
strongly dependent on Notch signaling. In the skin, Notch is required for repression of
basal cell genes and commitment of basal to the suprabasal cell phenotype early in
epidermal development, initiating a genetic program of differentiation (Blanpain et al.,
2006). In the adult lung, Notch signaling has been shown to promote the transition of
basal cells into a population of early epithelial progenitors and later to drive
differentiation to secretory cell fate (Rock et al., 2011). Although these studies clearly
implicate Notch in the process, they raise multiple questions about how these events
occur as the epithelial progenitors undergo differentiation. Are these regulated by a single
Notch signal acting through different thresholds that determine initially suprabasal cell
fate and later secretory differentiation? Are parabasal cells progenitor cells but
presumably already committed precursors to a particular cell fate? Is there more than one
Notch signaling event regulating the stepwise transition of the basal cells to the
differentiated airway epithelium? If so, what specific Notch receptors and ligands are
differentially involved?
In this paper (Mori et al., 2015) we demonstrated that endogenous activation of
Notch3 signaling selectively controls the pool of undifferentiated progenitors of upper
airways available for differentiation. This mechanism depends on the availability of Jag1
and Jag2, and is key to generating a population of parabasal cells that later activates
Notch1 and Notch2 for secretory-multiciliated cell fate selection. For the purposes of this
thesis I am focusing solely on data related to the Notch ligands Jag1 and Jag2 and their
role in controlling the pool of undifferentiated progenitors. Please see the final
manuscript for all data relating to Notch3 mutants and pharmacological experiments
related to the function of Notch3 (Mori et al., 2015).
27
III. Materials and Methods
1. Mouse Models
Jag1flox/flox mice were kindly provided by Dr. Julian Lewis (Brooker et al., 2006).
Jag1cnull mice were generated by crossing Jag1flox/flox females with Jag1flox/+; Shhcre/+
males. Jag2flox/flox mice were kindly provided by Dr. Thomas Gridley (Xu et al., 2010).
Jag2cnull mice were generated by crossing Jag2flox/flox females with Jag2flox/+; Shhcre/+
males. Embryos were harvested at E14.5 and E18.5, where 0.5 was counted as the
morning when a vaginal plug was found. All experiments involving animals were
performed in accordance with the protocols approved by Columbia University Medical
Center IACUC.
2. In situ Hybridization
In situ hybridization was performed in frozen sections (5-7 μm) using
digoxigenin-UTP-labeled Jag1 or Jag2 riboprobes, as previously described (Tsao et al.,
2008, 2009, 2011). Sections were briefly postfixed and immunohistochemistry was
performed on the same sections as for colocalization studies.
3. Immunofluorescence and Immunohistochemistry
Immunohistochemistry was carried out in 5 μm paraffin wax-embedded sections
from wild-type, or mutant mice at various developmental stages using ABC or MOM kit
(Vector Laboratories) according to the manufacturer’s protocol. When necessary, antigen
retrieval was performed using Unmasking Solution (Vector Laboratories #H-3300) and
microwave or Tris-EDTA buffer (1 mM EDTA/Tris-HCl at pH8.3) for 15 min at 110°C
28
in a pressure cooker. Antibodies used were: anti-Scgb3a2 (a gift from Dr S. Kimura,
NIH, Bethesda, MD, USA; 1:1000), anti-Krt5 (Covance, #PRB-160P, 1:500), anti-Foxj1
(eBioscience, #2A, 1:100), anti- acetylated α-tubulin (Abcam, ab125356, 1:1000), anti-
acetylated α-tubulin (Sigma, T7451, 1:2000), antiacetylated β-tubulin IV (Abcam,
ab11315, 1:500), anti-p63 (Santa Cruz, #4E4, 1:100), anti-p63 (H-137) (Santa Cruz, sc-
8343, 1:100), anti-Krt8 (Abcam, ab107115, 1:2000), anti-Scgb1a1 goat (Santa Cruz, sc-
9772, 1:500), Jag1 Rb mAb (Cell Signaling, #2155, 1:50), Jag2 Rb mAb (Cell Signaling,
#2210, 1:50), Nuclei were visualized by NucBlue Fixed Cell ReadyProbes Reagent (Life
Tech, R37606). Images were acquired using a Nikon Labophot 2 microscope equipped
with a Nikon Digital Sight DS-Ri1 charge-coupled device camera or on a Zeiss LSM700
confocal laser scanning microscope.
4. Morphometric Analysis
Morphometric analysis of immunohistochemistry in E14.5-E18.5 lungs was
performed similarly. The percentage of epithelial cells labeled with each antibody was
determined by counting cells in equivalent regions (within the anterior-posterior axis) of
the trachea from control and mutants animals. To minimize variability, only regions
associated with cartilage rings and at roughly equivalent levels along the anterior-
proximal axis of the trachea were analyzed (based on distance from the carina; three or
four regions/trachea, n=3 per group). Data are represented as mean ± SEM; Student’s t-
test, differences are significant if P<0.05.
29
IV. Results
1. Jag1 and Jag2 Have Partially Overlapping Functions in Restricting Basal
Cell Expansion
Preferential Notch ligand-receptor binding depends on multiple factors, including
biological context and cell type (D’Souza et al., 2008; Kopan and Ilagan, 2009). We
reasoned that p63+ airway progenitors were a source of Notch ligands activating Notch3
signaling in neighbor cells, ultimately controlling expansion of the p63 basal cell
population to initiate differentiation. A relationship between Notch3 and Jagged1 (Jag1)
has been reported in the context of cancer cell survival and growth (Konishi et al., 2007;
Sansone et al., 2007). To gain insights into this relationship in our system, we
investigated expression of Jag ligands in the airway epithelium in regions associated with
p63 during development and in adult progenitors cultured under ALI conditions. In situ
hybridization analysis of Jag1 showed epithelial signals in E14.5 luminal and basal-
located cells enriched in p63+ cells. Around this stage Jag2 signals were stronger and
more clearly associated with basal cells (Figure 2.1A). Later, expression of both ligands
extended to intrapulmonary airways in basal and multiciliated cells. In adult airways,
Jag2 has been reported as the most differentially expressed ligand in basal cells (Rock et
al., 2011). Our immunofluorescent analysis of adult airway progenitors in culture showed
that both Jag1 and Jag2 are strongly expressed in the cell surface of p63+ cells (Figure
2.1B). We could not detect expression of Dll ligands other than in neuroendocrine cells
using in situ hybridization (Guha et al., 2012). I asked whether these Jag ligands
contributed equally to mediate the Notch effects in restricting the pool of the p63+ cell
population. Thus, first I investigated the effect of inactivating Jag1 independently in the
30
airway epithelium using mice carrying Jag1 floxed alleles and the ShhCre line. My
approach differed from that of a previously reported Jag1f/f; Sftpc-rtTA;Tet-O-Cre
transgenic mice (Zhang et al., 2013); here, ShhCre induces recombination much earlier, at
the onset of lung development (Harris et al., 2006). Analysis of Jag1cnull mutants
confirmed the imbalance between secretory and multiciliated cells previously seen in
other Notch-deficient models (Tsao et al., 2009, 2011; Morimoto et al., 2010; Zhang et
al., 2013). Moreover, I found increased number of p63+ cells in trachea and
extrapulmonary airways already at E14.5, a phenotype not reported in the Jag1f/f; Sftpc-
rtTA;Tet-O-Cre mice (Figure 2.1C). Interestingly, the expansion in p63+ cells was no
longer seen in E18.5 Jag1cnull but was clearly present at E18.5 in Jag2cnull mice (Jag2f/f;
ShhCre). This expansion occurred predominantly in the upper trachea (Figure 2.1D) and at
the expense of luminal cells, as suggested by the reduced thickness of the Krt8-labeled
cell layer in Jag2cnull airways (Figure 2.1E). Jag2cnull mice also showed the imbalance
between secretory and multiciliated cells seen in Jag1cnull (Figure 2.1F). Overall, these
data suggested that Jag2 contributes more prominently than Jag1 to restrict the expansion
of p63+ cells mediated by Notch signaling in vivo. During development, this function
appears to be regulated in a temporally and regionally distinct fashion, with Jag1 being
less important than Jag2 at later stages and Jag2 being more relevant in upper trachea.
31
32
Figure 2.1 Jag1 and Jag2 have partially overlapping functions in restricting basal
cell expansion. (A) Expression pattern of Jag1 and Jag2 by in situ hybridization and p63
by immunohistochemistry in developing airways. Stronger signals for Jag2 compared
with Jag1 in E14.5-E15.5 proximal airways initially in all epithelial cells and then
overlapping with p63 at E15.5 (double in situ hybridization/immunohistochemistry; aw,
airway; bv, blood vessels). Diagram summarizes temporal-spatial patterns from the
panels above and data not shown. Proximal-distal domains of expression in trachea (Tr),
extrapulmonary and intrapulmonary proximal airways of the lung (Lu). Solid and dotted
bars represent strong and weak signals, respectively, as revealed by in situ hybridization
or immunohistochemistry. (B) Jag1 and Jag2 are expressed in adult p63+ airway
progenitors in culture (ALI day 2). (C) p63 immunofluorescence and morphometric
analysis (% labeling) showing expansion of basal cells in the E14.5 trachea and
extrapulmonary airways of Jag1cnull mice. (D) Double p63-Scgb1a1 immunofluorescence
in E18.5 wild-type, Jag1cnull and Jag2cnull tracheas showing local (squares) expansion of
p63+ cells in Jag2cnull mice (arrows) not present in wild type or Jag1cnull. (E) In E18.5
Jag2cnull airways, expansion of p63+ cells was accompanied by reduced thickness of the
luminal Krt8-labeled cell layer, and (F) suppression of the secretory (Scgb3a2+)
phenotype with expansion of multiciliated cell population (β-tubulin+). Data are mean ±
SEM of the percentage of p63+ cells/total cells, n=3 per group; **P<0.01, Student’s t-
test. Scale bars: 10 μm in A-C,E,F; 100 μm in D. From Mori et al., 2015.
33
V. Discussion
In this chapter I described the role of Jag1 and Jag2 in restricting the basal cell
population during development of the trachea. The expression pattern of Jag ligands and
the expansion of p63+ cells in Jag1cnull and Jag2cnull airways strongly suggested that these
ligands activate endogenous Notch3 in the basal cell compartment. How this mechanism
initiates is unclear. I propose that p63+ airway progenitors are largely Jag-expressing
cells and, in the absence of Notch signaling, have uninhibited proliferation. As basal cells
expand, extensive cell-cell communication triggers a bias that leads to the appearance of
Notch3-expresssing cells and activation of Notch signaling. This ultimately leads to
suppression of p63 and acquisition of a Notch3-expressing parabasal cell phenotype
primed for further differentiation. P63-negative-Notch3-positive cells maintain Jag
expression in p63-positive basal cells. This balance is maintained until activation of other
Notch receptors is initiated to trigger differentiation.
Mechanisms controlling the balance of p63 and Notch3-expressing cell
populations could presumably be relevant in maintaining homeostasis of the
pseudostratified epithelium. Our results are consistent with those reported in the
mammary gland and bladder in which growth of p63+ cells is inhibited by Notch
signaling (Bouras et al., 2008). Aberrant expansion of stem/progenitor cell populations
contribute to tumorigenesis (Chiche et al., 2013; Lim et al., 2009). Thus, failure of
mechanisms that prevent abnormal expression of p63+ basal cells in the airway
epithelium could also play a role in lung cancer.
34
CHAPTER THREE
Jagged and Delta Ligands Control Distinct Events during Airway Progenitor Cell
Differentiation
I. Abstract
Notch signaling regulates cell fate selection during development in multiple
organs including the lung. Previous studies addressing the role of Notch in the lung
focused on central components of this pathway (Rbpj, Pofut1) or on Notch receptor-
specific functions. It is unclear, however, whether individual ligand families (Delta and
Jagged) or specific ligands (Dll1, Dll4, Jag1, and Jag2) influence distinct aspects of
differentiation of airway epithelial progenitors. Expression analysis of these ligands
showed partially overlapping, but also distinct domains, suggestive of different functions
during development. To understand the contribution of these ligands to Notch signaling
and their role in lung epithelial cell fate I used knock-in mice carrying floxed alleles of
Notch ligands and Shhcre/+ and examined the impact of inactivating these genes
individually or in combinations in the developing airway epithelium. Analysis of these
mutants showed that although overall airway growth and branching were not affected,
there were notable ligand family-selective changes in epithelial differentiation.
Inactivation of Jag ligands had a major impact in balancing the populations of club and
multiciliated cells. Interestingly, a specific population of secretory cell precursors labeled
by Upk3a, SSEA1, and Scgb3a2 in the pulmonary neuroendocrine cell (PNEC)
microenvironment were not affected by Jag ligand deletion. Jag1; Jag2 compound null
mutants maintained strong nuclear N1ICD in NEB-associated club cells (also known as
35
NEB-CCs) suggesting that Dll signals from adjacent PNECs were sufficient to promote
and maintain the fate of this cell population in the absence of Jag ligands. Remarkably,
inactivation of Dll1 alone or in combination with Dll4 in early lung epithelial progenitors
resulted in marked expansion of neuroepithelial bodies (NEBs). This expansion did not
involve changes in the cell proliferation and appear to have resulted from aberrant
recruitment of neighboring cells to the PNEC fate program. Thus, my data suggest that
Notch ligands regulate specific aspects of the cell fate specification program that
establishes the normal balance of differentiated phenotypes in the airway epithelium.
36
II. Introduction
Notch signaling has been demonstrated to play important roles in stem cell
maintenance and cell fate decisions across species. It has been shown that central core
components of the Notch pathway, such as its transcriptional effector Rbpj and Pofut1
(protein o-fucosyltransferase 1), have been shown to be crucial in regulating cell fate of
epithelial progenitors in the developing airways (Tsao et al., 2008; Tsao et al., 2009;
Morimoto et al., 2010; Tsao et al., 2016). Genetic inactivation of these core components
leading to loss of Notch signaling results in excessive formation of multiciliated and
pulmonary neuroendocrine cells (PNECs) and an inability to form secretory cells.
Notch receptors have also been described as playing specific roles in epithelial
cell fate (Morimoto et al., 2012). Notch2 was found to have a more predominant
contribution in mediating secretory versus multiciliated cell fate decision, while Notch1
and Notch3 had a lesser role. However, all three Notch receptors were found to contribute
in an additive fashion to control the abundance of PNEC populations and the sizes of
neuroepithelial bodies (NEBs).
The roles of individual Notch ligands in epithelial progenitors in extrapulmonary
and intrapulmonary airways of the developing lung, however, have not been fully
elucidated. Dll1 and Dll4 have been previously shown to be expressed in PNECs, while
Jag1 and Jag2 are expressed in multiciliated and basal cell precursors (Tsao et al., 2009;
Zhang et al., 2013; Mori et al., 2015). Previous studies supported a key role for Jag1 in
cell fate selection of intrapulmonary airways, but the roles of Jag1, Dll1, and Dll4 have
not been systematically investigated (Zhang et al., 2013).
37
Here I use mouse genetic models in which the Delta-like and Jag family of genes
have been inactivated in lung progenitors. I show overlapping and distinct effects of Jag
and Dll ligands in intra- and extrapulmonary airways. I find that deficiency in Jag ligands
have little effect on the NEB microenvironment, however loss of Dll ligands results in a
remarkable expansion of the NEB microenvironment.
38
III. Materials and Methods
1. Mouse Models
Dll1flox/flox and Jag1flox/flox mice were kindly provided by Dr. Julian Lewis
(Brooker et al., 2006). Dll1cnull mice were generated by crossing Dll1flox/flox female mice
with Dll1flox/+; Shhcre/+ males (Harfe et al., 2004). Dll4flox/flox mice were kindly provided
by Dr. Freddy Radtke (Koch et al., 2008). Dll4cnull mice were generated by crossing
Dll4flox/flox female mice with Dll4flox/+; Shhcre/+ males. Dll1cnull; Dll4cnull mice were
generated by crossing Dll1flox/flox; Dll4flox/flox females with Dll1flox/+; Dll4flox/+; Shhcre/+
males. Jag1cnull mice were generated by crossing Jag1flox/flox females with Jag1flox/+;
Shhcre/+ males. Jag2flox/flox mice were kindly provided by Dr. Thomas Gridley (Xu et al.,
2010). Jag2cnull mice were generated by crossing Jag2flox/flox females with Jag2flox/+;
ShhCre/+ males. Jag1cnull; Jag2cnull mice were generated by crossing Jag1flox/flox; Jag2flox/flox
females with Jag1flox/+; Jag2flox/+; Shhcre/+ males. Embryos were harvested at E14.5 and
E18.5, where day 0.5 was counted as the morning when a vaginal plug was found. All
experiments involving animals were performed in accordance with the protocols
approved by Columbia University Medical Center IACUC.
Ascl1GFP mice were bred and maintained at Dr. Jane Johnson’s laboratory at UT
Southwestern (Leung et al., 2007). All experiments utilizing these mice were performed
at that institution by Ms. Trisha Savage.
Ascl1creERT2/+ animals were purchased from Jackson Labs (Kim et al., 2011) and
crossed with Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (R26tdTomato) mice to label Ascl1-
expressing cells and progeny (Madisen et al., 2010).
39
Wild type (WT) sections were obtained from timed pregnancy embryos from CD1
mice (Charles River Laboratories).
2. Ascl1 Lineage Traces
Ascl1creERT2/+ mice were crossed with R26tdTomato/+ or R26tdTomato/tdTomato animals to
generate tdTomato labeled Ascl1+ cells and lineage. Pregnant mothers were injected
intraperitoneally with 2 mg or 4 mg tamoxifen (Millipore Sigma #T5648) diluted in
sunflower oil when embryos were at E9.5 or E12.5 and sacrificed at E14.5. Lungs and
brains were dissected out and frozen embedded in OCT.
3. Immunofluorescence and Immunohistochemistry
Whole lung and trachea were harvested from mice at E14.5 and E18.5 and fixed
in 4% paraformaldehyde at 4 °C overnight. Samples then underwent PBS washes and
15% and 30% sucrose washes before embedding in OCT. 7 μm frozen sections were then
cut from tissue blocks. Samples were incubated with primary antibodies (overnight at 4
°C) and secondary antibodies conjugated with Alexa488, 568, or 647 (1:300) with
NucBlue Fixed Cell ReadyProbes Reagent (DAPI) (Thermo Fisher #R37606) for 45 min.
After washing, samples were mounted with ProLong Gold antifade reagent for analysis.
When necessary, heat-induced epitope retrieval was performed using citric acid-based
antigen unmasking solution (Vector Laboratories #H-3300). Ascl1 and N1ICD staining
required tyramide amplification (Perkin Elmer #SAT704A001EA) used with horse radish
peroxidase conjugation (species-specific ImmPRESS kit, Vector Laboratories).
Antibodies used were: anti-Ascl1 (Thermo Fisher #14-5794-82, 1:100), anti-CC10 (Santa
40
Cruz sc9772, 1:150), anti-Cgrp (Sigma Aldrich #C8198, 1:2500), anti-Foxj1 (Thermo
Fisher #14-9965-80, 1:50), anti-N1ICD (Cell Signaling #4147, 1:100), anti-Scgb3a2
(R&D Systems #AF3465, 1:100), anti-SSEA1 (EMD Millipore #MAB4301, 1:300).
Standard hematoxylin and eosin (H&E) staining was performed on postnatal
sections of control and Delta-cnull mutant lung sections.
Images were acquired using a Leica DMi8 microscope or Zeiss LSM710 confocal
laser scanning microscope.
4. Morphometric Analysis
To determine the percentage of Foxj1+ multiciliated cells in control and Jag-cnull
mutant intrapulmonary airways E18.5 coronal sections of whole lungs were stained with
Foxj1 and DAPI. Two sections from two separate embryos for each genotype were used
for counting. DAPI+ epithelial cells were counted in intrapulmonary airways and were
compared to the number of Foxj1+ cells to determine Foxj1+ percentages.
To determine the percentage of Foxj1+ multiciliated cells in control and Jag-cnull
mutant tracheas E18.5 coronal sections of whole tracheas were stained with Foxj1 and
DAPI. Two sections of whole trachea from one embryo for each genotype were used for
counting. DAPI+ epithelial cells were counted in one side of the trachea and were
compared to the number of Foxj1+ cells to determine Foxj1+ percentages.
Analysis of neuroendocrine cells and neuroepithelial bodies (NEBs) was
performed on E14.5 Delta-cnull mutants. Sections were stained with Ascl1 and DAPI.
Three sections from three separate embryos for each genotype were used for counting.
For each section the number of intrapulmonary airways was counted, as well as the
41
number of NEBs and solitary neuroendocrine cells. The ratios of NEBs/airway and
solitary neuroendocrine cells/airway were calculated. Additionally, NEB size was
examined. In each section, NEB size was determined by counting the number of
neuroendocrine cells in contact with each other, where an NEB was determined to be a
group of three or more cells.
5. In Situ Hybridization
In situ hybridization (ISH) was performed as previously described using
digoxigenin-labeled UTP anti-sense RNA probes. Frozen sections of E14.5 and E18.5
embryonic lungs (control and mutant) were used. Primer sequences used to generate
probes are listed in Table 3.1. T7 or T3 sequences were included in forward or reverse
primers, respectively. Probes were ordered from Integrated DNA Technologies at 25nM
with standard desalting and stored as 100 μM stocks in DEPC-treated water.
Gene Forward (5’ 3’) Reverse (5’ 3’)
Dll1 AATTAACCCTCACTAAAGGGAGA
CTGCTGAGAGAGGAAGGGAG
TAATACGACTCACTATAGGGAGA
AGACCCGAAGTGCCTTTGTA
Dll4 AATTAACCCTCACTAAAGGGAGA
CTACTCAGACACCCAGCTCC
TAATACGACTCACTATAGGGAGA
ATCCTTTGCAAGCCTCCTCT
Jag1 AATTAACCCTCACTAAAGGGAGA
CGCCATAGGTAGAGTTTGAGG
TAATACGACTCACTATAGGGAGA
TAGTTGCTGTGGTTCTGAGC
Jag2 AATTAACCCTCACTAAAGGGAGA
TGGCACCCAGAACCCTTG
TAATACGACTCACTATAGGGAGA
ATACTCCGTTGTTTTCCGCC
Ascl1 AATTAACCCTCACTAAAGGGTCG
TCCTCTCCGGAACTGAT
TAATACGACTCACTATAGGGAG
AAGAAGCAAAGACCGTGGGAG
Upk3a AATTAACCCTCACTAAAGGGGTG
GCTGGACTGTGAACCTC
TAATACGACTCACTATAGGGTT
GCCCACCCTGACTAGGTA
Table 3.1. Forward and reverse primers used for generation of digoxigenin-labeled UTP
anti-sense RNA probes.
42
6. Quantitative Real-Time PCR
Quantitate real-time PCR was performed as previously described (Tsao et al.,
2009). RNA was extracted using the RNeasy kit (Qiagen) and reverse transcribed using
Oligo(DT) primers (SuperScript III or IV kits, Thermo Fisher). The following primers
(Thermo Fisher) were used: Ascl1 (Mm03058063_m1), Cgrp (Mm00801463_g1), Foxj1
(Mm01267279_m1), Scgb1a1/CC10 (Mm00442046_m1), Scgb3a2 (Mm00504412_m1),
Upk3a (Mm00452321_m1). Reactions were performed using Taq-Man Advanced Master
Mix (Thermo Fisher #4444556) using β-actin as internal control and a Step-One Plus
Instrument (Applied Biosystems). ΔΔCT method was used to calculate changes in
expression levels.
43
IV. Results
1. Jagged Ligands Precede the Appearance of Delta in Differentiating Airway
Progenitors
Although the expression patterns of Jag and Dll have been reported in the
developing respiratory tract, specific information about their onset of expression and
regional distribution in the epithelial compartment at early stages of differentiation has
been scattered and not well integrated into functional studies. To gain further insights into
the impact of Notch signaling in the establishment of cell fate we revisited the spatial and
temporal pattern of expression of Notch ligands when epithelial cells are initiating
commitment to different cell fates in developing airways. The presence of these ligands
in both epithelial and mesenchymal layers of the developing lung precluded their
assessment of gene expression in whole lung homogenates.
None of these ligands were detectable by ISH in the airway epithelium prior to or
at E11.5 (not shown). However, a day later low levels of Jag2 in the developing trachea
and extrapulmonary airways made it the first of all Notch ligands to be induced in the
differentiation program of airways (Figure 3.1A). This contrasted with the strong Jag2
signals present in the esophageal epithelium and in neighboring vascular structures.
Notably, the Jag2 detection in E12.5 tracheal epithelial progenitors coincided with the
previously reported onset of Notch activation and appearance of Scgb3a2 locally. This
supports the idea of a Jag2-Notch program giving rise to secretory cell precursors as one
of the earliest events initiating differentiation in airways, potentially even preceding the
appearance of PNECs. Indeed, Ascl1, which marks PNEC progenitors, was expressed
44
diffusely in relatively broad domains in the airway epithelium suggesting that Ascl1 fate
was still undergoing restriction through a classically described lateral inhibition.
By E13.5 strong Jag2 epithelial signals could be detected throughout the trachea
and main bronchi, in great contrast to Jag1, which was present only at background levels
in the airway epithelium (Figure 3.1B). At this time NEBs and PNECs were sharply
demarcated by Ascl1, and Dll1 and Dll4transcripts were first detected in NEBs. This
coincided with the appearance of clusters of adjacent cells collectively labeled by Upk3a,
SSEA1, Scgb3a2, with low levels of Cyp2f2 and CC10, consistent with the initiation of a
Notch-dependent program of secretory cells in the NEB microenvironment (Guha et al.,
2012, Figure 3.1C).
Thus, Jag and Dll ligands seem to appear in different domains and in a sequential
proximal-distal fashion during the establishment of cell fate in airway progenitors,
initiating with Jag2 in the trachea, Jag1, and lastly Dll1 and Dll4 once NEBs form in
intrapulmonary airways.
45
46
Figure 3.1 Wild type expression patterns of Notch ligands during early lung
development. (A) E12.5 wild type sections demonstrating Jag2 is the first ligand
expressed and is observed in the developing trachea (Tr), esophagus (E), and blood
vessels (BV). Early disperse expression of Ascl1 is also seen (right panel). (B) E13.5 WT
sections demonstrating early expression of Jag2 in the trachea and proximal
extrapulmonary airways and Jag1 expression only in blood vessels. At this point Ascl1
becomes clustered as NEBs form. Dll1 and Dll4 are also seen in PNECs at this point. (C)
The earliest expression of Scgb3a2 is seen at E13.5 in regions surrounding NEBs
(arrows). This expression becomes more disperse as development continues through
E16.5.
47
2. Jag1 and Jag2 Regulate the Balance of Different Cell Types in Extra- and
Intrapulmonary Airways
Given the distinct timing and spatial distribution of Jag ligands described above, I
reasoned that common but also non-overlapping functions were likely to exist in the
distinct domains of the respiratory tract. Inactivation of Jag1 in epithelial progenitors of
intrapulmonary airways undergoing branching morphogenesis using a Sftpc-tet-O system
has been shown to disrupt differentiation, confirming the previously reported role of
Notch signaling in this process (Zhang et al., 2013). This targeting strategy, however,
could not provide information about a more global role of Notch ligands in the
respiratory tract epithelia encompassing extrapulmonary airways (trachea, main bronchi)
and early stages at these sites. Moreover, little is known about how Jag2 influences lung
development and whether there is potential functional overlap with Jag1 in exerting these
functions. Jag2 system knockout animals die at birth (Jiang et al., 1998). Lastly, no
information has been available whether other putative Notch ligands could compensate
for Jag during epithelial differentiation.
Thus, I used the Shh-cre line to inactivate Jag1 and Jag2 individually or in
combination in epithelial progenitors of both extrapulmonary and intrapulmonary airways
at the onset of lung development (Harfe, et al. 2004). Jag1flox/flox; Shhcre/+ (Jag1cnull),
Jag2flox/flox; Shhcre/+ (Jag2cnull) and double (Jag1cnull; Jag2cnull) null mutants were analyzed
early (E14.5) and late (E18.5) stages of airway differentiation. Gross analysis of these
lungs showed no notable macroscopic difference in size or shape between the various
genotypes at these stages (not shown). I compared the effects of Jag1 and Jag2 in
48
multiciliated-secretory cell fate selection at E18.5, once differentiated cell profiles were
largely established in extrapulmonary (trachea) and intrapulmonary (lung) airways.
qPCR analysis of E18.5 lung homogenates showed significant changes in markers
of epithelial differentiation in all mutants (Figure 3.2A). Notably, intrapulmonary airways
were more severely affected in Jag1cnull mutants compared to Jag2cnull mutants.
Expression of the secretory markers Scgb3a2 and Scgb1a1 (encoding CC10) were
reduced by 86.2% (P = 5 x 10-12) and 85.6% (P = 0.0001), respectively in Jag1cnull
mutants, but only by 25.9% (P = 0.015) and 34.4% (P = 0.019), respectively in Jag2cnull
mutants. These changes were accompanied by a significant increase in Foxj1 expression
in Jag1cnull (183% increase, P = 0.0006) but not in Jag2cnull (13% reduction, P = 0.501)
mutants. Double Jag1cnull; Jag2cnull mutants showed Scgb3a2 and Scgb1a1 nearly
abolished and an increase in Foxj1 that reproduced results found in Jag1cnull. The
predominant contribution of Jag1 to the program of secretory cell fate as represented by
these markers could be clearly seen in double Jag1cnull; Jag2cnull mutants. The double null
mutants also showed that airway progenitors are largely dependent on Jag ligands to
execute the program of secretory cell differentiation.
Immunofluorescence of Foxj1 and CC10 in E18.5 lung sections confirmed the
changes in gene expression in intrapulmonary airways revealed by qPCR and showed
secretory cells less abundant in Jag1cnull compared to Jag2cnull mutants (Figure 3.2B).
Interestingly, multiciliated cell fate appeared to be minimally affected in Jag2cnull
airways. Morphometric analysis showed no significant change in the number of Foxj1+
cells in Jag2cnull airways relative to control (P = 0.164), in contrast to the ~2.5-fold
increase in these cells in Jag1cnull mutants (P = 4.17 x 10-7) (Figure 3.2C).
49
In the E18.5 trachea loss of Jag2 resulted in an increase in the number of basal
cells but had no significant impact in multiciliated cells population (Mori et al., 2015 and
Figures 2.1, 3.2D). The excess of basal cells in Jag2cnull tracheas is accompanied by a
decrease in the population of club cells. A similar pattern was observed in Jag1cnull;
Jag2cnull tracheas where the percentage of p63+ cells was greater than in control tracheas.
Interestingly, similar to Jag1cnull tracheas, Jag1cnull; Jag2cnull tracheas had an increased
number of multiciliated cells versus controls. Together these data suggest that Jag2
regulates the basal versus club cell fate in the developing trachea and that Jag1 regulates
the multiciliated versus club cell fate in the developing trachea. This could possibly be
ascribed to the regional differences in distribution of secretory versus multiciliated cells
and Jag1 versus Jag2 ligands along the respiratory tract epithelium. Multiciliated cells
are known to be less abundant in bronchioles, which comprise most of the
intrapulmonary airway sites where Jag1 is the predominant Notch ligand, as opposed to
Jag2 which is more abundant proximally in extrapulmonary airways. I propose that Jag1-
Notch mediated signaling compensates for the loss of Jag2, preserving most of the
secretory cell population in these mutants.
50
51
Figure 3.2. Loss of Jag-driven Notch signaling results in an excess of multiciliated
cells at the cost of secretory cells. (A) qPCR analysis of multiciliated cell marker Foxj1
and secretory cell markers Scgb3a2 and Scgb1a1 in mutant and respective control lung
homogenates (n=4 Jag1 control, n=3 Jag1cnull; n=4 Jag2 control; n=4 Jag2cnull; n=4
Jag1/Jag2 control; n=4 Jag1cnull; Jag2cnull). Error bars represent SEM. (B)
Immunofluorescence of multiciliated cell marker Foxj1 (red) and mature secretory cell
marker CC10 (green) in control and mutant airways. (C) Morphometric analysis of
Foxj1+ multiciliated cells in control and mutant intrapulmonary airways. Error bars
represent standard deviation. (D) Loss of Jag ligands in the embryonic E18.5 trachea
results in an increase in imbalance of epithelial cell types. Top left panel: IF analysis of
control and Jag-cnull tracheas for multiciliated (Foxj1, green) and basal (p63, red) cell
types. Lower left graph: morphometric analysis of p63+ cells in control and Jag-cnull
tracheas. Lower right graph: morphometric analysis of Foxj1+ cells in control and Jag-
cnull tracheas. Right panel: IF analysis of control and Jag-cnull tracheas for basal (Krt5,
green), multiciliated (β-tub, red), and luminal (Krt8, blue) cells. * P < 0.05; n.s. = not
significant. Error bars represent standard deviation.
52
3. Jag Ligands have Minimal Effects in the Establishment and Regulation of
the NE Microenvironment
Next I investigated whether Jag ligands could influence cell fate events that
ultimately regulate the PNEC pool in intrapulmonary airways, regardless of its
organization as NEBs or as solitary cells. Thus, I compared levels of Ascl1 expression in
homogenates of Jag-cnull mutant lungs at E18.5, when NEBs are already widely
distributed at branch point and internodal locations. qPCR analysis showed no difference
in Ascl1 expression between controls and mutants in any of the Jag-deficient airways
(Figure 3.3). Consistent with this, immunofluorescence for Cgrp, another established
marker of PNEC fate, did not reveal differences in its pattern of distribution suggestive of
alterations in the size of NEBS (~8-10 PNECs per NEB control, Jag1cnull, Jag2cnull, and
double Jag1cnull; Jag2cnull) or frequency in intrapulmonary airways of mutants compared
to controls (Figure 3.3B-D). Since in my mutants Jag is deleted well before epithelial
progenitors differentiate, we concluded that Jag-mediated Notch signaling is unlikely to
be involved in the mechanisms that initiate or restrict the domains of NEB or PNEC fate.
Neither NEBs nor PNECs were identified in extrapulmonary airways of mutants or
control animals.
I then examined the effect of Jag deletion in the population of secretory
progenitors known to be tightly associated with the developing NEBs. Previous studies
have shown that they arise around E14.5 immediately adjacent to Ascl1-expressing cell
clusters, being distinguished from other secretory precursors collectively by their
expression of Upk3a, SSEA1, Scgb3a2, and low levels of Cyp2f2 and CC10 (Guha et al.,
2012; Morimoto et al., 2012). Immunofluorescence of E18.5 lung sections triple-labeled
53
with SSEA1, Scgb3a2, and Cgrp identified the typical SSEA1+ Scgb3a2+ cells around
Cgrp+ clusters similarly preserved in intrapulmonary airways of Jag1cnull and Jag2cnull
mutants (Figure 3.3B-D). This contrasted with the marked difference in expression of
these markers outside the NEB microenvironment in Jag mutants (Figure 3.3 and
described above). Remarkably, in double Jag1cnull; Jag2cnull airways the only population
of cells expressing secretory markers was that associated with NEBs (Figure 3.3C, D).
As in the controls, this population was heterogeneous in labeling even in the same
airway (Figure 3.3C) and showed no evidence that it was expanded or reduced in size
relative to NEBs. Given that these cells are crucially dependent on Notch signaling and
that the only potential source of ligand should be Dll1 and/or Dll4 from PNECs, I
examined the status of local Notch activation. N1ICD immunofluorescence showed
strong labeling selectively in SSEA1+ NEB-associated cell populations of mutants,
indistinguishable from controls (Figure 3.3D). Lastly, qPCR analysis of Upk3a, another
secretory marker highly enriched in cells in the PNEC microenvironment but also present
in scattered secretory cells of intrapulmonary airways showed markedly decreased levels
of expression in double Jag1cnull; Jag2cnull lungs (Figure 3.3E). ISH of Upk3a in these
mutants showed signals restricted to branch points in proximal regions of intrapulmonary
airways associated with Ascl1-expressing NEBs (Figure 3.3F).
Together these results suggested that Jag ligands have overlapping but also
distinct roles in the cell fate specification of respiratory lineages in extrapulmonary and
intrapulmonary airways. These ligands, however, appear to be dispensable for activation
of Notch and induction of NEB-associated secretory cells, which have available Dll
54
ligands. Moreover, my data show no evidence that Jag ligands have any impact in
regulating size or frequency of NEBs.
55
56
Figure 3.3 Jagged-driven Notch signaling has a minimal impact on PNEC and NEB
cell fate specification or maintenance. (A) qPCR analysis of PNEC marker Ascl1 in
control or Jag-cnull mutants. There were no significant differences between control and
mutant lungs. (n=4 Jag1 control, n=3 Jag1cnull; n=4 Jag2 control; n=4 Jag2cnull; n=4
Jag1/Jag2 control; n=4 Jag1cnull; Jag2cnull). Error bars represent SEM. (B)
Immunofluorescence of secretory (Scgb3a2, green), NEB-associated secretory (SSEA1,
red), and PNEC (Cgrp, cyan) markers in control and mutants. (C) Immunofluorescence
demonstrating the undisturbed presence of the NEB microenvironment. Mature secretory
cells (CC10, green) are present throughout the airway in control lungs but there are only
low levels of CC10 surrounding NEBs (Cgrp, blue) in Jag1cnull; Jag2cnull double mutants.
NEB-associated secretory cells are labeled by SSEA1 (red). (D) Immunofluorescence
demonstrating the presence of the NEB microenvironment. NEB (Cgrp, red) and NEB-
associated secretory cells (SSEA1, green) are undisturbed in double cnull airways and
phenocopy control NEB microenvironments (inset). NEB-associated club cells (SSEA1,
red) undergo Notch1 activation (N1ICD, green) in control and double cnull mutants
(upper and lower right panels). (E) qPCR analysis of Upk3a in control and double cnull
mutants. There is almost a complete abolishment of Upk3a mRNA in double cnull
mutants. (n=3 control; n=3 double cnull). *** P<0.0005. Error bars represent SEM. (F)
Expression of Upk3a via ISH. In control airways Upk3a is predominantly surrounding
putative NEBs and is scattered throughout the airways. In double cnull mutants Upk3a
becomes restricted to the NEB microenvironment, only surrounding NEBs.
57
4. Dll Ligands Control the Size of the NEB Microenvironment
My analysis of Jag1cnull; Jag2cnull mutants identified self-contained units
comprised of Dll-expressing NEBs and immediately adjacent cells able to activate and
maintain robust Jag-independent Notch signaling for local secretory differentiation.
Previous studies in Ascl1-/- mice showed that these units were strictly dependent on
presence of NEBs (Guha et al., 2012). Questions remained whether preventing NEBs
from expressing Dll ligands would have any impact on the NEB microenvironment or
elsewhere if Jag ligands were still expressed. Unlike Jag1 and Jag2, found in largely
non-overlapping spatial and temporal patterns, Dll1 and Dll4 are collectively expressed in
a very restricted fashion to PNEC/NEB. Given the high probability of functional overlap,
we generated mouse mutants in which both Dll ligands were deleted conditionally in the
developing lung epithelium. Double deletion (Dll1cnull; Dll4cnull) was achieved from early
stages using a similar targeting strategy with a Shhcre/+ line.
Analysis of E14.5 lungs from control mice showed distinct small clusters of
Ascl1+ cells in the epithelium of proximal intrapulmonary airways consistent with the
emerging NEBs. By contrast, Dll1cnull; Dll4cnull E14.5 showed a striking expansion in the
population of Ascl1+ cells (Figure 3.4). Although individual clusters could still be
identified throughout the epithelium of main bronchi, they seem to coalesce in large
patches to form a continuous layer of Ascl1+ cells. In spite of the distribution in wider
domains in proximal airways, these cells were not seen ectopically in extrapulmonary
airways or distally in airways undergoing branching morphogenesis. These large patches
of Ascl1+ cells were identified at branch points in E18.5 lungs and by then co-expressed
Cgrp, indicating their identity as NEBs. Thus, loss of Dll ligands expanded the Ascl1+
58
pool of PNEC precursors but did not prevent them from initiating differentiation.
Interestingly, Ki67 staining showed no difference in labeling between control and double
mutants, suggesting that the NEB expansion did not result from an increase in
proliferation.
To assess the contribution of each of these ligands to the Dll1cnull; Dll4cnull
phenotype, I examined Dll1cnull and Dll4cnull individual mutants. E18.5 lungs were
isolated from single and double mutants and changes in expression of Ascl1 and Cgrp
were analyzed by qPCR in homogenates (Figure 3.4C). Double cnull mutants showed a
significant increase in these transcripts compared with control (Ascl1 P = 1.1 x 10-6;
Cgrp P = 5.9 x 10-5), consistent with the PNEC expansion. However, Cgrp mRNA was
not altered in Dll1cnull or Dll4cnull individual mutants and Ascl1 was only slightly
increased in Dll1cnull mutants. The marked difference in response of the lung in Dll1cnull;
Dll4cnull compared to single mutants suggested functional redundancy between Dll1 and
Dll4 in controlling NEB or PNEC-associated events.
To understand more precisely what these events were, I performed morphometric
analysis in E14.5 lungs to determine the impact of Dll in the size and frequency of NEBs
and PNECs (Figure 3.4D). Quantitation of the number of solitary PNECs in the airway
epithelium showed no difference between controls and any of the single or double
mutants, suggesting that Dll disruption affected primarily the NEB microenvironment.
The frequency of NEBs per airway (%) was largely unaffected, although a small
difference in Dll4 mutants reached statistical significance. However, the number of
PNECs per NEB was significantly increased in both the Dll1cnull; Dll4cnull and single
59
Dll4cnull airways, suggestive that the size of NEBs was dramatically altered in these
mutants.
These data were consistent with the idea that the mechanisms that restrict PNEC
fate and limit expansion of NEB were severely disrupted in Dll mutants.
60
61
Figure 3.4. Loss of Dll-driven Notch signaling results in an expansion of the NEB
microenvironment. (A) Immunofluorescence of PNEC (Ascl1, green) in control and
double null mutants at E14.5. There is a vast expansion of the size of NEBs in
intrapulmonary airways in mutant versus control. (B) Immunofluorescence demonstrating
the expansion of NEB size at E18.5. PNECs (Ascl1, green and Cgrp, red in top two rows)
are abundant in mutant versus control airways. The great increase in PNECs is not due to
proliferation (Ki67, red, lower two rows). (C) qPCR analysis of PNEC markers Ascl1 and
Cgrp at E18.5. Both are significantly upregulated in double null mutants as compared
with control (n=3 Dll1 control, n=5 Dll1cnull for Ascl1 and n=4 Dll1 control, n=6 Dll1cnull
for Cgrp; n=3 Dll4 control n=6 Dll4cnull for Ascl1 and Cgrp; n=3 Dll1/Dll4 control; n=3
Dll1cnull; Dll4cnull for Ascl1 and Cgrp). Error bars represent SEM. ***P<0.0005; n.s., not
significant. (D) Morphometric analysis of PNECs and NEBs in E14.5 control and mutant
lungs. Left panel: NEB size as determined by number of PNECs per NEB. Center panel:
solitary PNEC per airway. Right panel: number of NEBs per airway. *P<0.05;
**P<0.005; *** P<0.0005; n.s., not significant.
62
5. Notch Signaling and NEB-associated Club Cells are Preserved in the Absence
of Dll Ligands
The strikingly preserved integrity of the NEB microenvironment seen in double
Jag-cnull mutants led me to hypothesize that Dll1 and Dll4 were not only necessary and
sufficient to activate local Notch signaling but also endowed the unique features of the
NEB-associated club cells that distinguish them from club cells elsewhere. The absence
of the Dll ligands in the expanded population of NEB of double Dll mutants provided an
opportunity to examine this issue. First, I asked whether the robust activation of Notch
signaling observed in NEB-associated club cells of Jag-cnull double mutants was also
present in this same population of Dll1cnull; Dll4cnull.
Double immunofluorescence for Ascl1 and N1ICD in E18.5 lung sections showed
distinctive non-overlapping nuclear labeling in NEBs and NEB-associated cells,
respectively. N1ICD signals were equally strong in control and mutant airways. The
identity of each of these cell populations as components of the NEB microenvironment
was further confirmed by immunostaining with SSEA1 and Cgrp (Figure 3.5A, B).
Notably, the extended PNEC domain in the airway epithelium of these mutants was
accompanied by an expanded population of NEB-associated secretory cells. This was
already supported by the extended domain of expression of SSEA1 and N1ICD in E18.5
Dll1cnull; Dll4cnull compared to control. In addition, qPCR analysis showed that even in
lung homogenates, the increase in expression of markers of PNEC fate (Ascl1, Cgrp) was
accompanied by a significant increase in the NEB-associated secretory marker Upk3a.
Importantly, neither Scgb1a1, nor Foxj1, which mark predominantly non-NEB associated
secretory and multiciliated cells, respectively, was significantly altered in Dll1cnull;
63
Dll4cnull airways (Figure 3.5B). I performed double ISH/IHC to further examine how the
increase in Upk3a expression correlated spatially with the expansion of NEBs. Analysis
of E18.5 lungs showed large groups of cells labeled with Upk3a. These large cell clusters
were limited to the areas immediately adjacent to the Ascl1-expressing NEBs but not
outside this microenvironment and, as in controls, had variable levels of Upk3a (Figure
3.5C).
Together the data strongly suggested that, in spite of the inability to express Dll1
and Dll4, key known features of the NEB microenvironment are preserved in these
mutants likely by Jag ligand activation of Notch signaling. Thus, the preserved Jag-
Notch signaling in intrapulmonary areas of Dll1cnull; Dll4cnull mutants establishes the
normal balance of multiciliated-secretory differentiation. However, intriguingly, neither
the loss of Dll nor the activation of Jag-Notch prevent the appearance of the distinct
features of NEB-associated secretory cells.
64
65
Figure 3.5. Loss of Delta-driven Notch signaling results in an expansion of the NEB
microenvironment. (A) Immunofluorescence analysis demonstrating that the NEB
microenvironment is maintained in Dll1cnull; Dll4cnull mutants. Top row: NEB-associated
secretory cells adjacent to PNECs (Ascl1, green) express N1ICD (red) in both control and
double cnull mutants, demonstrating that these cells undergo Notch activation. Middle
row: SSEA1+ (green) NEB-associated secretory cells undergo Notch activation (N1ICD,
red) in control and double mutant airways. Bottom row: the NEB microenvironment is
expanded in double cnull mutants. PNECs (Cgrp, red); NEB-associated secretory cells
(SSEA1, green). (B) qPCR analysis of NEB-associated secretory cell marker Upk3a,
mature club cell marker Scgb1a1, and multiciliated cell marker Foxj1 in control and
double cnull mutants (n=3 for controls and double cnull mutants) * P<0.05. Error bars
represent SEM. (C) Double ISH-IHC against Upk3a (purple) and Ascl1 (brown)
demonstrating an expansion in the size of the NEB microenvironment in double cnull
mutants.
66
6. Preliminary Postnatal Analysis of Dll-cnull Mutants Demonstrate a Defect in
Alveolarization
Although my studies focused on embryonic development, I allowed several litters
from Dll1flox/flox; Dll4flox/flox females bred with Dll1flox/+; Dll4flox/+; Shhcre/+ males to be
born. Most Dll1cnull; Dll4cnull mice died in utero (at or before E18.5) or at birth therefore
we were unable to perform a systematic analysis of the postnatal events in these mutants.
However, in the rare mutants that survived to adulthood, I found important morphological
differences compared to controls (Figure 3.6). Dll1flox/flox; Dll4flox/+; Shhcre/+ (Dll1cnull;
Dll4chet) or Dll1flox/+; Dll4flox/flox; Shhcre/+ (Dll1chet; Dll4cnull) mice were overall
significantly smaller in body size than their control littermates and possessed craniofacial
malformations (Figure 3.6A). This phenotype was more severe in mutants with
homozygous deletion of Dll1 and heterozygous deletion of Dll4. At PN21 their lungs
were smaller proportionally to their body size (Figure 3.6B). Histological analysis
showed enlarged alveolar airspaces and overall simplification of the distal architecture
suggestive of a defect in alveolar formation. The abnormal alveolar enlargement is
reminiscent of findings reported in Pofut1flox/flox; Shhcre/+ and Notch2flox/flox; Shhcre/+
mutants (Tsao et al., 2016). It is possible that Delta-driven Notch signaling plays a role in
postnatal morphogenesis of the alveolar compartment of the lungs. Further studies are
needed to determine how this occurs but these are beyond the scope of my thesis.
67
68
Figure 3.6 Delta-chet/cnull animals survive past birth but demonstrate significant
morphological defects. (A) Delta-cnull animals are smaller than littermates and show
cranial malformations. Littermates at age PN21. Left: Dll1flox/+; Dll4flox/flox; Shh+/+ control
littermate. Center: Dll1chet; Dll4cnull mutant. Right: Dll1cnull; Dll4chet mutant. Mutants are
smaller than control littermates and possess craniofacial malformations. (B) Control (left)
and Dll1cnull; Dll4chet (right) lungs. Mutant lungs were smaller than control but were
proportionate to their observed body size. (C) Control (left) and Dll1cnull; Dll4chet mutant
(right) lung sections showing alveolar airspace enlargement in mutant lungs.
69
V. Discussion and Future Directions
The results from this study provide evidence for distinct roles of Notch ligand
families in airway progenitor cell differentiation during development. Jagged-driven
Notch signaling was found to be essential for regulating multiciliated versus club cell fate
with minimal effect on PNECs or the NEB microenvironment. In double Jag-cnull
airways the epithelium was overpopulated with multiciliated cells at the cost of club cells
except those surrounding NEBs. The data also showed that Delta-driven Notch signaling
preferentially regulates NEB size and PNEC versus club cell fate; double Delta-cnull
mouse airways had excess PNECs and NEB-CCs. NEB-CCs can have their Notch
receptors activated by either Jagged or Delta ligands but ultimately require Notch for
their cell fate.
Attempts to generate quadruple Jag; Dll knockouts were made but after
unsuccessful trials this goal was abandoned. Both Dll4 and Jag1 are located on
Chromosome 2 thereby making recombination events rare and difficult to attain. I predict
the phenotype of a quadruple knockout will recapitulate results previously reported in
Rbpjflox/flox; Shhcre/+ mice.
NEB-CCs were present in both double Jag-cnull and double Dll-cnull mice, thus
these cells can have their Notch receptors activated by either ligand family. It is unclear,
however, whether there is a preference for one ligand family over the other. Lfng has
been reported to be present in PNECs and it is known to promote Delta-driven Notch
activation (Xu et al., 2010). A recent study in post-mitotic secretory cells of the upper
crypt of the intestinal epithelium found that LFNG promotes DLL surface expression in
ligand-presenting cells and promotes Notch activation in neighboring cells (Kadur
70
Lakshminarasimha Murthy et al., 2018). It is possible that in wild type conditions there is
a preference for activation of Notch in NEB-CCs by Dll expressed in neighboring NEBs,
but in double Dll-cnull this preference is lost and cells could instead be Notch-activated
by Jag from multiciliated cells.
An alternative hypothesis is that there is a currently unidentified signal inherently
present in PNECs which has the ability to activate or modulate Notch signaling in NEB-
CCs to confer their unique features. It has been reported that Rbpjflox/flox; Shhcre/+ mice
have increased numbers of PNECs and a loss of all secretory cells, suggesting NEB-CCs
require Notch to be specified (Tsao et al., 2009). Additionally, the inability of Ascl1-/-
mice to form PNECs and NEB-CCs suggest that NEB-CCs require the presence of
PNECs (Borges et al., 1997; Guha et al., 2012). These reports, along with my results that
loss of both Dll ligand members does not abolish the NEB-CCs or their unique features
suggests that there may exist a signal in PNECs that can activate Notch in NEB-CCs. It is
tempting to speculate that a candidate signal could be the CCN family member Nov.
There is evidence that Nov is a diffusible short-range signal that can act as a Notch ligand
or co-activator activating or modulating Notch signaling (Sakamoto et al., 2002; Wang,
2011). Preliminary studies in my lab identified Nov strongly expressed in NEBs of the
developing lung epithelium. Analysis of Rbpjcnull (Rbpjflox/flox; Shhcre/+) mice showed
increased Nov expression consistent with the expansion of NEBs seen in these mutants.
Studies were designed to identify these putative signals by sorting PNECs from
Ascl1GFP lungs at E14.5 and E18.5 to characterize their transcriptional profile. However,
E14.5 cell yields (obtained via collaboration with Ms. Trisha Savage of the Jane Johnson
Laboratory at UT Southwestern) were insufficient due to a much weaker reporter
71
expression in the developing lung compared to the brain (Leung et al., 2007; Figure 3.7).
Thus these experiments could not be performed.
72
73
Figure 3.7. FACS evolution of GFP+ cells from Ascl1GFP E14.5 mouse lungs. Sufficient
numbers of GFP+ cells could not be attained for transcriptional analysis. (A-D) FACS
plots from four different lungs. DsRED served as negative control. (E) Table showing the
amount of GFP+ and GFP- cells from each lung.
74
Because reporter expression was weak in Ascl1GFP mice, I reasoned that it may be
possible to isolate PNECs from an alternative mouse model. A knock-in mouse strain,
Ascl1tm1.1(Cre/ERT2)Jejo had been recently reported with targeted integration of CreERTT2
into the Ascl1 locus (Kim et al., 2011). I generated Ascl1creERT2/+; R26tdTomato mice and
intraperitoneally administered tamoxifen to pregnant mothers at E9.5 or E12.5. Embryos
were analyzed at E14.5, a stage when Ascl1 expression is broader in forming NEBs as
compared to later stages. Immunofluorescence showed tdTomato labeling in the E14.5
brain and lungs (Figure 3.8A, B). Interestingly, while signals could be identified in
PNECs, tdTomato also labeled the neural tissue associated with the intrapulmonary
airways (innervation) (Figure 3.8B, C). Because nerves were also labeled, I deemed this
approach inadequate for PNEC isolation studies, since a pure population of PNECs
would not be obtained if cells were sorted out for tdTomato. A subsequent experiment
injecting TMX at E12.5 and sacrificing mice at E14.5 revealed off-target labeling in the
mesenchyme (left panel) and low efficiency of labeling Ascl1+ cells in NEBs (right
panel) (Figure 3.8D). Thus, this mouse model proved to be not suitable to accomplish this
goal.
Further studies in our lab are being carried out by a colleague using single cell
RNA sequencing of E14.5 lungs which may yield information about signaling pathways
expressed in PNECs and their potential role in maintaining the NEB microenvironment.
75
76
Figure 3.8. Lineage tracing of Ascl1 progenitors is an inadequate method to isolate
PNECs for RNA sequencing. (A-C) Ascl1creERT2/+; R26tdTomato embryos injected at E9.5
and sacrificed at E14.5. (A) Brain (control) demonstrating tdTomato labeling of Ascl1+
neurons and descendants. (B) Whole lung image demonstrating tdTomato labeling in
intrapulmonary nerves (white boxes), making this method ineffective for RNA
sequencing of a pure population. (C) Sections of extrapulmonary and intrapulmonary
airways showing some but not all Ascl1 (green) expressing cells double labeled with
tdTomato (D) Ascl1creERT2/+; R26tdTomato lung from an embryo injected at E12.5 and
sacrificed at E14.5. Whole lung sections (left) demonstrating off-target labeling. Right
panel demonstrates lineage labeling in some PNECs (arrow).
77
In summary, studies in this section determined that NEB-CCs are minimally
affected by Jag ligands and require Dll ligands to restrict the size of the NEB
microenvironment. Future studies may yield insight into postnatal effects of ligand loss
and relevance to human disease.
78
CHAPTER FOUR
Identification of Ascl1 Targets in Pulmonary Neuroendocrine Cell Progenitors of
the Developing Lung
I. Abstract
Ascl1 is widely known as a master regulator of neuroendocrine fate across
species. Mice deficient in Ascl1 lack neuroendocrine cells in multiple organs including
the lung. Conversely, there exists a number of human diseases related to aberrant
formation, differentiation, and proliferation of pulmonary neuroendocrine cells (PNECs).
Understanding normal homeostatic development of PNECs is crucial in order to
recognize what goes wrong during disease.
To better understand the role of Ascl1 and related genes I analyzed microarray
data from Ascl1-/- embryonic mutant lungs that lack PNECs and found a number of genes
that may be relevant in neuroendocrine cell development and formation of the
neuroepithelial body microenvironment. Two main groups of genes were found, those
that colocalized with Ascl1 expression and those that colocalized with the NEB
microenvironment. Of particular interest is tyrosine hydroxylase (Th), a member of the
catecholamine biosynthesis pathway, which I demonstrate to be expressed in PNECs at
both E14.5 and E18.5. Pharmacological interruption of this enzyme in embryonic lung
cultures via metyrosine administration resulted in an expansion of PNECs and therefore
larger neuroepithelial bodies (NEBs). Future studies are needed to confirm this effect and
understand the role that catecholamines may play in NEB size regulation and any role in
disease.
79
II. Introduction
Pulmonary neuroendocrine cells (PNECs) are a rare endoderm-derived airway
epithelial cell that comprise approximately 1% of the airway epithelium (Kuo and
Krasnow, 2015; Noguchi et al., 2015). PNECs can be found as solitary cells or in
clusters, known as neuroepithelial bodies (NEBs) that are innervated by both afferent and
efferent neurons (Brouns et al., 2009). NEBs are involved in multiple human conditions,
including cancer. Aberrant formation, differentiation, and proliferation of PNECs has
been associated with rare conditions such as Neuroendocrine Hyperplasia of Infancy
(NEHI), a pediatric disorder where there is an increase in the size and number of NEBs
and abnormal presence of solitary PNECs in distal airways and Diffuse Idiopathic
Pulmonary Neuroendocrine Cell Hyperplasia (DIPNECH), an adult disorder where there
is an increase in PNEC hyperplasia; as well as common disorders such as
bronchopulmonary dysplasia, asthma, chronic obstructive pulmonary disorder (COPD),
and small cell lung cancer (SCLC), amongst others (Gould et al., 1983; DeLellis, 2001;
Deterding 2005; Brody and Crotty, 2006; Davies et al., 2007; Glasser et al., 2010; Young
2011; Koliakos et al., 2017; Garg et al., 2019).Therefore understanding the ontogeny and
maturation of PNECs is of high significance.
Neuroendocrine fate is dependent on the expression of Ascl1. Homozygous
disruption of Ascl1 was demonstrated to prevent formation of neuroendocrine cells in
multiple organs, including the thyroid, adrenal medulla, the glandular stomach, and the
lung (Borges et al., 1997; Lanigan et al., 1997; Huber et al., 2002; Kameda et al., 2007;
Kokubu et al., 2008). Thus, investigating the gene network controlled by Ascl1 can
provide insights about mechanisms that control expansion and maturation of PNECs in
80
the developing lung. Additionally, there is a possibility of discovering new markers of
neuroendocrine cells by exploring genes that are differentially up- or downregulated in
Ascl1-/- developing lungs. An RNA microarray analysis of E14.5 from WT and Ascl1-/-
mice previously generated in my lab was used for this study. This developmental stage
was chosen due to the larger proportion of nascent Ascl1+ PNECs in the airways
compared to later stages. Also, in spite of its expression in broader domains at E14.5,
Ascl1 at this stage is still largely restricted to the most proximal generation of airways.
Thus, differences in gene expression resulting from the deletion of Ascl1 could be more
easily detected.
81
III. Materials and Methods
1. RNA Microarray
The Affymetrix GeneChip Mouse Gene 1.0 ST array, which measures mRNA and
covers 26,166 RefSeq transcripts and 21,041 Entrez genes, was used for comparison of
control and Ascl1-/- E14.5 dissected lungs (n=3 each) (Guillemot et al., 1993). Ascl1-/-
mice lack the protein-coding sequence of Ascl1, located in a single exon (Guillemot et al.,
1993). The Ascl1-/- mice were generated and lungs dissected, and the microarray
performed by Dr. Arjun Guha, a former member of the Cardoso laboratory. I then
analyzed these microarray data and generated a heat map for the top 50 downregulated or
upregulated genes using relative gene values as signified by RMA (Babicki et al., 2016).
2. Gene Ontology Analysis
Gene ontology analysis was performed using Gene Ontology enRIchment anaLysis
and visuaLizAtion (GOrilla) software (Eden et al., 2007; Eden et al., 2009). To analyze the
gene list for ontology analysis, I used the background of all genes that were analyzed in
the microarray versus all genes that were downregulated or upregulated. This then
generated a set of GO processes that were enriched in our gene set as compared to the
background list of all genes.
3. In Situ Hybridization
In situ hybridization (ISH) was performed as previously described in prior
sections of this thesis using digoxigenin-labeled UTP anti-sense RNA probes. Sections of
WT E14.5 and E18.5 embryonic lungs were used to map the spatial and temporal pattern
82
of expression of the selected genes differentially expressed in Ascl1-/- versus WT lungs.
Primer sequences used to generate probes are in table 4.1. T7 or T3 sequences were
added to forward or reverse primers, respectively.
Gene Forward Reverse
Ascl1 TCGTCCTCTCCGGAACTGAT AGAAGCAAAGACCGTGGGAG
Atf5 TAGGCTTCCCCTCTGCCTAA TCCCCCTACACCCAACTAGG
Ctf1 CCATCTGTCTCCCTGTGATCC CAGCCTAGGGCGGTATGAAA
Gabra5 TAGGAAACCCCACTCCCACA CTGTTGGCTGGGAAAAACCG
Hand2 CCTGGAGCTCAAGCAGTGAA AGAATGACGGGGGTCCCTTA
Hoxd9 GCAGCGACTCGGACTTTCTT CCTTGAGCAGCTGAGTTGGA
Insm1 GAACTGTGCCTTCACTCGGA GTCCAAAGGAGTCACAGCGA
Lif CTCTCTGGCACCCCCTAGAT AGCTTCCATGCTGGTCGAAA
Neurod2 GACCTGGGAACAGCCTTACC AAAATTGCGTGTGTGGGGTG
Ntrk2 GCCAGCAGTACCTGGCATTA GGTCAATTGGCCATCCCTCT
Olfm3 GTATGCTTGCGGTTGGGTTG AAGGTAGCAATCTGGGCGTC
Phox2b GGTTTTGGTCTTGCGAACCC GTTGCGCTAATGGCGAGATG
Slc4a10 ACAAGGGTTGCTTCCCGAAT ACAGTTGGAGACCTGTTGGT
Th TCTTGAAGGAACGGACTGGC CACCGGCTGGTAGGTTTGAT
Tomt ATGGCATAGCCCAACTCACC GCCTCTTGCTTCCAGTTCCT
Table 4.1. Forward and reverse primers for top 15 downregulated genes following gene
ontology analysis. These primers were used to generate anti-sense RNA ISH probes.
83
4. Immunohistochemistry
Sections that underwent in situ hybridization were double stained for an antibody
against Ascl1 (BD #556604) using standard immunohistochemistry methods previously
described.
Organ culture samples underwent fixation with 4% paraformaldehyde in 1X PBS
overnight at 4 °C and were frozen embedded in OCT following incubation in 15%
sucrose in 1X PBS and 30% sucrose in 1X PBS for 4 hours and overnight, respectively.
Following embedding, 7 μm thick sections were cut and samples were processed for
immunofluorescence following previously described methods in this thesis for Ascl1 or
Ki67 (Cell Signaling #9129S).
5. Lung Organ Culture
E12.5 lungs isolated from CD1 WT mice were cultured for 48 hours on transwells
with BGJb media containing 1% FBS, 1% Penicillin/Streptomycin, and 25% w/v of
ascorbic acid. Organ cultures were treated for 48 hours with DMSO (vehicle control) or
0.5 mM metyrosine diluted in DMSO (Sigma #1443205).
84
IV. Results
1. Genes Differentially Expressed in Ascl1-/- Embryonic Lungs
As an initial step in the analysis of the microarray dataset, the top 50
downregulated or upregulated genes were identified in control versus Ascl1-/- lungs.
Genes were selected based on statistical significance and P values greater than 0.05 were
excluded from the analysis. The ranking was then performed based on the log2 fold
change among the list of genes with P < 0.05. The top 50 downregulated genes are shown
in the heat map in Figure 4.1 and the top 50 upregulated genes are shown in the heat map
in Figure 4.2.
Ascl1 was significantly downregulated in the array (log2 FC = -0.43, P = 0.046)
thus confirming the accuracy of the microarray approach to identify Ascl1 targets.
Moreover, Scgb3a2 was highly downregulated in this microarray (log2 FC = -0.58, P =
0.047). Scgb3a2 is a known marker of airway club cells, which along with PNECs,
comprise the NEB microenvironment. Downregulation of this gene is consistent with the
requirement of Ascl1 for specification and maintenance of the NEB and its
microenvironment. Thus, this array analysis will also provide the opportunity to identify
genes relevant to development of NEB-associated club cells.
85
Figure 4.1. Heat map of top 50 significantly downregulated genes of interest in control
(Control (1), Control (2), Control (3)) and Ascl1-/- (Ascl1-/- (1), Ascl1-/- (2), Ascl1-/- (3))
E14.5 lungs. Red signifies lower levels whereas green signifies higher levels of
expression.
86
Figure 4.2. Heat map of top 50 significantly upregulated genes of interest in control
(Control (1), Control (2), Control (3)) and Ascl1-/- (Ascl1-/- (1), Ascl1-/- (2), Ascl1-/- (3))
E14.5 lungs. Red signifies lower levels whereas green signifies higher levels of
expression.
87
A number of olfactory receptor (OR) genes were found to be downregulated in
the Ascl1-/- lungs. ORs can detect environmental odorants (volatile and non-volatile) and
are highly expressed in a variety of cancers including non-small-cell lung cancer (Kalbe,
et al., 2017; Maßberg and Hatt, 2018). In PNECs ORs have been demonstrated to
influence serotonin release; stimulation by odorants results in decreased serotonin levels
which leads to release of Cgrp and local stimulation of neighboring basal cells and airway
smooth muscles (Gu et al., 2013; Gu et al., 2014). Of the top 30 downregulated genes
identified by our array, seven were ORs. Overall 61 OR genes were downregulated in
Ascl1-/- lungs (not shown). Gene names and human orthologues of the top seven
downregulated OR family genes are presented in Table 4.2. A study in airway epithelial
cells from human lungs or in primary cell culture also identified members of the OR
family expressed in PNECs (Gu et al., 2014). This study showed that PNECs expressed
OR2W1 (Olfr263/Olfr1369-ps1) and a subset of PNECs expressed OR2F1
(Olfr38/Olfr452/Olfr453). The olfactory receptors I identified in our array may label
subsets of PNECs responsible for chemosensory function.
88
Mouse gene Human orthologue log2 FC
Olfr503 OR52N4 -0.67
Olfr1062 OR8J3, OR8J1 -0.63
Olfr1029 OR5M11 -0.61
Olfr707 OR2D3 -0.56
Olfr1128 OR5W1P -0.55
Olfr1152 OR5W2 -0.48
Olfr394 OR1E1*, OR1E2* -0.47
Olfr1356 OR7C2* -0.41
Olfr160 OR8A1 -0.40
Olfr1282 OR4F17 -0.37
Olfr229 OR8G2P -0.37
Table 4.2. Olfactory receptor genes significantly downregulated in the Ascl1-/- E14.5
microarray from the top 50 downregulated genes. (*) Asterisk depicts olfactory receptor
gene also identified in human airway epithelia (Gu et al., 2014).
2. Gene Ontology Analysis
Gene ontology analysis identified a number of biological processes enriched for
in the gene sets differentially expressed in Ascl1-/- and WT lungs (Figures 4.3 and 4.4).
Of particular interest among the downregulated genes were those related to “neuron
development,” “noradrenergic neuron development,” “adrenal chromaffin cell
differentiation,” and “peripheral nervous system neuron development.” While adrenal
chromaffin cells derive from the neural crest and PNEC derive from the endoderm, they
both rely on Ascl1 for cell fate (Borges et al., 1997; Huber et al., 2002; Kuo and
Krasnow, 2015). The importance of Ascl1 in neuron development raised the possibility
that genes downregulated in our array could be relevant here. The top 15 genes related to
these GO processes are listed in Table 4.3.
Upregulated genes in Ascl1-/- lungs were related to actin filament-based processes
including movement; cell-cell adhesion mediated by cadherin; and osteoclast
89
differentiation (Figure 4.4). For the purpose of this thesis I focused on the genes that were
downregulated in mutants since they showed fold changes statistically higher than those
upregulated. Analysis of upregulated genes in Ascl1-/- lungs shall be pursued in the future.
90
Figure 4.3. Gene ontology analysis results for all downregulated genes in the array. Of
particular interest are terms highlighted in yellow and orange as these were the enriched
biological processes terms.
91
Figure 4.4. Gene ontology analysis results for all upregulated genes in the array. Of
particular interest are terms highlighted in yellow as these were the enriched biological
processes terms.
92
Name Description p value log2 FC
Hoxd9A,D Homeobox D9 0.007 -0.50
Ascl1A,B,C Achaete-scute complex homolog 1 (Drosophila) 0.046 -0.43
LifA Leukemia inhibitory factor 0.018 -0.35
ThA Tyrosine hydroxylase 0.043 -0.32
Insm1A,B,C Insulinoma-associated 1 0.007 -0.28
Atf5A Activating transcription factor 5 0.015 -0.25
Ctf1A Cardiotrophin 1 0.045 -0.23
Olfm3A Olfactomedin 3 0.001 -0.23
Hand2A,D Heart and neural crest derivatives expressed transcript 2 0.010 -0.21
Slc4a10A Solute carrier family 4, sodium bicarbonate cotransporter-
like, member 10
0.015 -0.18
Ntrk2A,D Neurotrophic tyrosine kinase, receptor, type 2 0.013 -0.15
Gabra5A Gamma-aminobutyric acid (GABA) A receptor, subunit
alpha 5
0.049 -0.11
Neurod2A Neurogenic differentiation 2 0.017 -0.11
TomtA Transmembrane O-methyltransferase 4.11E-05 -0.10
Phox2bA,B Paired-like homeobox 2b 0.026 -0.07
Table 4.3. Top 15-downregulated genes in E14.5 Ascl1-/- mouse lungs following gene
ontology analysis. ANeuron development, BNoradranergic neuron development, cAdrenal
chromaffin cell differentiation, DPeripheral nervous system neuron development.
93
3. Localization of Top 15-Downregulated Genes of Interest
To identify the sites of expression of the top 15 downregulated genes and
determine their relation to PNECs I generated RNA antisense probes for each of these
genes and performed in situ hybridization in E14.5 and E18.5 sections (Figure 4.6).
Several of these genes were found in PNECs (Atf5, Ctf1, Hand2, Insm1, Neurod2, and
Phox2b) (Figure 4.6). Others were in the region immediately adjacent, presumably under
the influence of Ascl1+ cells, in the NEB microenvironment (Gabra5, Hoxd9, Lif,
Slc4a10, Tomt) (Figure 4.7). Olfm3 and Ntrk2 were not detected in the airway epithelium
(not shown). Th expression will be described in the next section.
A recent study showed that PNECs require Insm1 not for their specification but
for their differentiation and that loss of Insm1 upregulates Hes1 and interferes with PNEC
differentiation (Jia et al., 2015). Thus, an Insm1-dependent Hes1 repression appears to be
required for proper PNEC development. INSM1 was also found to be a marker for
neuroendocrine and neuroepithelial neoplasms (Rosenbaum et al., 2015).
Hand2, Neurod2, and Phox2b have also been shown to play important roles in
neuroendocrine development in other organ systems (Huber et al., 2002; McCormick et
al., 1996; Huang et al., 2002; Huber et al., 2005).
Interestingly, Ascl1, Phox2b, Insm1, Hand2, and Th are components of a pathway
critical for noradrenergic neuron development (Kameda, 2014). All except Th are
transcription factors. Phox2b has been demonstrated to be critical in regulating
expression of Dβh and Th, members of the catecholamine biosynthesis pathway, as well
as maintaining expression of Ascl1 and Hand2 (Pattyn et al., 1999).
94
Ctf1 is expressed in pancreatic beta cells and has been shown to have an anti-
apoptotic effect in these cells in WT conditions while having a stimulatory effect on
insulin secretion in the presence of glucose (Jiménez-González et al., 2013).
Atf5 shows a pattern of expression similar to that of Ascl1 (Figures 4.5 and 4.6).
The expression levels of Ascl1 are not affected in the Atf5-/- olfactory, suggesting that
Atf5 is not upstream of Ascl1 however there is no information whether Atf5 regulates
PNEC development (Wang et al., 2012).
Figure 4.5. Atf5 expression at E14.5
95
Some of the genes found to be strongly expressed at E14.5 showed only weak or
no signals in E18.5 lung suggesting a potential role as early markers or regulators of NEB
development. This was the case for Atf5, Gabra5, Neurod2, Phox2b, and Tomt. It would
be of interest to examine expression patterns at the onset of Ascl1 expression (E12.5) and
explore the possibility that genes identified in this screen may also be involved in
regulatory loops during PNEC cell fate selection.
96
Figure 4.6. Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray at E14.5
and E18.5 that colocalized with Ascl1+ PNECs. All sections were co-labeled with an antibody
against Ascl1.
97
98
Figure 4.7. Wild type expression of genes of interest from the E14.5 Ascl1-/- microarray
at E14.5 and E18.5 that were in the NEB microenvironment. All sections were co-labeled
with an antibody against Ascl1.
99
4. Potential Role for Catecholamines in Pulmonary Neuroepithelial Body
Expansion
Tyrosine hydroxylase (Th) was selected here to illustrate how genes identified in
this screen can be further explored functionally in NEB development. This protein is a
member of the catecholamine biosynthesis pathway and is responsible for converting
tyrosine to L-DOPA to allow for subsequent production by dopamine decarboxylase and
ultimately generate epinephrine (Figure 4.8) (Kuhar et al., 1999). In our array, Th
(P = 0.043), Ddc (P = 0.033), and Dβh (P = 0.042) were significantly downregulated in
Ascl1-/- lungs.
Figure 4.8. Catecholamine biosynthesis pathway. Metyrosine blocks the function of
tyrosine hydroxylase and thus production of L-DOPA.
Previous studies have demonstrated the ability of PNEC to express Ddc and
therefore produce dopamine, thus I was especially interested if there exists a role for Th
in PNEC maintenance or NEB expansion (Lauweryns and van Ranst, 1988). I first
examined the wild type expression patterns of Th in the lung (Figure 4.9). An antisense
RNA probe was generated to assess Th mRNA distribution by ISH. At E14.5, Th was
predominantly seen in the epithelium of the airways overlapping with PNECs, but was
also detected in non-NE epithelial cells in airways (Figure 4.9A, B). This pattern
100
persisted at E18.5 (Figure 4.9C). To determine if Th protein was present
immunofluorescence was also performed in developing airways. The Th antibody labeled
a subpopulation of the Th mRNA-expressing epithelial cells, suggesting that this protein
may be already active at least in some of these epithelial progenitors (Figure 4.9D-F).
101
Figure 4.9. Expression of Th and Th in the developing airways. In situ hybridization
using antisense probes against Th (positive regions in purple) at E14.5 (A) and co-
staining with an antibody against Ascl1 (brown) at E14.5 (B) and E18.5 (C).
Immunofluorescence of Th protein (green) in an airway of E14.5 lungs (D-F).
102
Metyrosine is a known inhibitor of tyrosine hydroxylase function (Weissman and
Koe, 1965). To investigate the role of tyrosine hydroxylase in PNEC development
embryonic lungs were isolated from E12.5 WT CD1 mice and cultured in control
(DMSO) or 0.5 mM metyrosine-containing media for 48 hours (Galloway et al, 1982).
Analysis of these explants did not reveal any consistent effect in the overall morphology
or pattern of branching (Figure 4.10A). However, when stained with Ascl1 antibody,
metyrosine cultures showed large clusters with a significant increase in the number of
Ascl1-expressing cells compared to controls (P = 0.0009, Figure 4.10C). This suggested
either an increase in proliferation of PNECs or a change in cell fate specification.
Immunostaining for Ki67 in serial sections indicated that PNECs are not proliferating
following treatment with metyrosine thereby suggesting a change in progenitor cell fate
specification or transdifferentiation (Figure 4.10B).
103
104
Figure 4.10. Inhibition of tyrosine hydroxylase function in lung explant cultures. (A)
Freshly isolated left lung explant (top) at 0h (E12.5) and after 48h of culture (bottom). No
significnat morphological differences between control and treated lungs were observed.
(B) Immunofluorsence of Ascl1 and Ki67 in sections of 48h cultures. Increase in the
number of Ascl1+ cells in 0.5mM metyrosine treated samples but similar Ki67 labeling
in control and treated lungs. (C) Morphometric analysis confirms a significant increase in
Ascl1+ cells suggesting an increase in the PNEC popultion in metyrosine treated cultures.
105
V. Discussion and Future Directions
Previous studies in the pituitary gland demonstrated that mouse mutants lacking
the D2 dopamine receptor undergo lactotroph (pituitary neuroendocrine cell) hyperplasia
which ultimately results in production of tumors. The same study concluded that there
was an antiproliferative role of dopamine in neuroendocrine cells (Saiardi et al., 1997). It
is intriguing that an expansion in the PNEC population was also obtained with
pharmacological inhibition of Th function, however without the effect in proliferation
reported in the pituitary gland. It is also of interest that Th is expressed relatively early in
the airways, when NEBs are still forming and potentially even at the onset of NEB
formation. It is possible that the PNECs secrete dopamine as a means of self-regulation to
prevent NEB size from becoming too large.
Future studies will determine if the addition of dopamine (using a
pharmacological agonist) alters the number of PNECs per NEB, implicating dopamine in
PNEC development. Moreover, further examination of the spatial distribution of
dopamine receptors may yield insight into the populations potentially affected by
production of dopamine by PNECs. To my knowledge there are no published studies
demonstrating a role for dopamine in the lung, however there are in situ hybridization
data suggesting these receptors are expressed in the lung (Figure 4.11).
106
Figure 4.11. In situ hybridization expression of dopamine receptors 1a (left), and 2
(right) in E14.5 lungs. Images from EurExpress Database.
Both Drd1aflox/flox and Drd2flox/flox mice are available which could then be crossed
with Shhcre/+ mice or with an Ascl1CreERT2/+ mouse line to delete receptors in the lung
epithelium or in neuroendocrine cells only, respectively. Should these receptors be
expressed in another specific subset of airway epithelial cells, there are a variety of cre-
driving lines which could be used to specifically delete the receptors in those cells. The
functional consequences of dopamine-producing neuroendocrine cells could then be
examined more closely.
Hand2 is another gene of interest identified in Ascl1-/- mutants. Hand2 has been
shown to regulate differentiation of Th+ neurons and thus production of catecholamines
(Lucas et al., 2006; Morikawa et al., 2007). In our array, Hand2 was significantly down-
regulated, which could explain why Th, Ddc, and Dβh expression levels were
significantly down-regulated in Ascl1-/- animals. Previous studies have determined the
importance of Hand2 in chromaffin cell development, the neuroendocrine cells of the
107
adrenal medulla (Huber et al. 2002). It is possible that Hand2 acts downstream of Ascl1
to regulate Th expression in PNECs. Since my preliminary study showed that inhibition
of tyrosine hydroxylase expands PNECs, it is possible that Hand2 regulates PNEC
expansion through Th. To explore this possibility, spatial and temporal expression of
Hand2 should be investigated at both early (E12.5) and later (E14.5, E18.5) time points.
If Hand2 protein is in fact expressed by PNECs, as suggested by in situ hybridization data
(Figure 4.6), functional studies can be conducted in Hand2flox/flox mice crossed with
Shhcre/+ mice to examine its role in the developing airways.
In summary, the microarray analysis of the Ascl1 targets in the developing lung
has identified a number of genes that label PNECs or the NEB microenvironment. Some
of these are likely to be early PNEC markers while others, such as Th, may have a
regulator function as suggested by the experiments in which Th-dopamine signaling was
shown to control NEB size. Future studies are required to better understand how these
genes may play roles in PNEC specification, differentiation, and maintenance of the NEB
microenvironment.
108
CHAPTER FIVE
General Discussion
The work presented here provides novel evidence of distinct roles for Notch
ligands in regulating various functions during development of the conducting airway
epithelium (Chapters Two and Three). It also identifies targets of Ascl1 as potentially
early markers of NEB development or regulators of this process, as suggested by the
observations on the role of catecholamine signaling in controlling NEB size (Chapter
Four).
Interestingly, in systems such as the mouse inner ear, Dll and Jag family members
can act synergistically but also by exerting contrasting functions (Brooker et al., 2006).
For example, a number of studies have shown a role for Notch signaling in differentiation
of the hair cells and supporting cells of the developing cochlea. However, while
conditional deletion of Dll1 results in an over-abundance of auditory hair cells, Jag1
deficiency leads to a major reduction in the number of these cells (Brooker et al., 2006).
By contrast, in the same organ, Dll1 and Jag2 exert a synergistic role in regulating the
number of hair cells of the cochlea, likely by signaling through Notch1 (Kiernan et al.,
2005).
A more dramatic example of Dll-Jag contrasting effects has been reported in
endothelial sprouting during retinal angiogenesis. In this process activation of Notch
signaling by Dll4 in tip endothelial cells inhibits sprouting by reducing Vegf signaling
receptor expression. However, Jag1 antagonizes Dll4-Notch to stimulate angiogenesis in
109
cells expressing Fringe glycosyltransferases, enhancing Vegf signaling (Benedito et al.,
2009).
Here I have demonstrated a role for Jagged-driven Notch signaling in regulating
basal cell populations in the developing trachea (Figures 2.1 and 3.2) as well as
multiciliated cell populations in the developing conducting airways (Figure 3.2). My
studies differ from previously published functional studies that utilized temporally and
spatially more restricted Cre drivers to disrupt ligand expression (Zhang et al., 2013) or
focused on adult airways (Lafkas et al., 2015). I determined that Jag2 is the earliest
expressed Notch ligand in the developing trachea at E12.5, when branching
morphogenesis is still in its initial stages. I also confirmed that Jag1 is the predominant
ligand in the developing intrapulmonary airways, controlling multiciliated versus
secretory cell fate.
My studies also demonstrated that Delta-driven Notch signaling regulates
neuroendocrine versus club cell fate in the developing conducting airways and also is
critical in regulating neuroepithelial body size (Figures 3.4 and 3.5). Notch-dependent
events associated with the pulmonary neuroendocrine microenvironment were
determined to be regulated predominantly by Delta-driven Notch signaling, whereas
Jagged-driven Notch signaling played a lesser role. Future studies exploring how these
signaling pathways regulate the NEB microenvironment should be considered.
It is possible that Jag-driven and Dll-driven Notch signaling result in the
activation of different target genes, contributing to the differences in phenotype observed.
It would be of interest to misexpress these ligands in cells where they are not
typically present, for example expressing Jag1 and/or Jag2 in pulmonary neuroendocrine
110
cells may rescue the phenotype observed in the Dll1cnull; Dll4cnull double knockouts,
where there is an expansion in the size of neuroepithelial bodies and the NEB
microenvironment. Conversely, if Dll1 and/or Dll4 were forcibly expressed in
multiciliated cells there might not be a loss of non-NEB-associated club cells in the
Jag1cnull; Jag2cnull double knockout. Should these findings be true, it would reject the
possibility that there is ligand-specific functions and instead suggest that the differences
observed in Jag double knockouts versus Dll double knockouts were actually due to the
spatial distribution of these ligands.
Additionally, results found here may be relevant to other organ systems. For
example, in the intestinal epithelium, there is a known role of Dll1 and Dll4 in regulating
goblet cell numbers (Pellegrinet et al., 2011). Dll1 and Dll4 are key ligands mediating the
effects of Notch signaling in differentiation. Gut-specific conditional deletion of Dll4
ligand using a Villin-Cre line shows no intestinal abnormalities in Dll4 mutants and only
a moderate increase in the number of mucous-secreting intestinal cells without noticeable
effects in expansion of the progenitor pool. The data suggest a functional redundancy
among Dll1 and Dll4 although Dll1 is not fully compensated for by Dll4 based on the
phenotype. By contrast, double Dll1; Dll4 conditional deletion resulted in a massive
conversion of proliferating progenitors into mucous-secreting cells (Pellegrinet et al.,
2011).
Interestingly, intestinal loss of Dll1 and Dll4 results in an increase in goblet cells,
just as loss of Dll1 and Dll4 in our system resulted in an increase in pulmonary
neuroendocrine cells (Akiyama et al., 2010; Pellegrinet et al., 2011). Further study of Dll-
111
driven Notch activation may have relevance in both the developing airway epithelium
and the developing intestinal epithelium.
My findings from the Dll1cnull; Dll4cnull double knockout system may be relevant
in studying diseases where there is aberrant differentiation of pulmonary neuroendocrine
cells, such as Neuroendocrine Hyperplasia of Infancy (NEHI) and Diffuse Idiopathic
Pulmonary Neuroendocrine Cell Hyperplasia (DIPNECH), rare pediatric and adult
disorders, respectively, where patients present with excess PNECs.
It would be of interest to examine samples from diseased patients to determine if
there are mutations in the Dll1 and/or Dll4 genes of these individuals, which may suggest
a mechanism of action relevant to disease onset since the cause(s) of these diseases
currently remain unknown.
In this thesis I have also presented partial evidence that catecholamine signaling
may play a role in PNEC fate (Figures 4.9 and 4.10). Organ cultures treated with a
tyrosine hydroxylase inhibitor, metyrosine, had increased numbers of PNECs compared
with control cultures without changes in cell proliferation, suggesting a change in cell
fate or transdifferentiation event (Figure 4.10). Future studies involving the introduction
of agonists of tyrosine hydroxylase or dopamine to organ cultures should result in the
restriction of NEB size. It would be interesting to identify which cells express dopamine
receptors as it may yield information on how catecholamines regulate NEB size. Notably,
there is evidence that addition of epinephrine, the end product of the catecholamine
biosynthesis pathway, to in vitro cultures significantly increased the self-renewal of
pancreatic cancer stem cells by increasing Notch Signaling (Xu et al., 2017). Specifically,
epinephrine was found to increase expression of the activated forms of presenilin1 (of the
112
γ-secretase complex) and N1ICD, thus suggesting an interaction between catecholamines
and Notch signaling.
In the developing pancreas, there is evidence that the catecholamine pathway may
be required for normal development of beta cells. Analysis of embryos lacking tyrosine
hydroxylase demonstrated reduction of beta cells with increased expression of Hes1, a
known transcriptional repressor of Ascl1 and downstream target of Notch signaling.
Dopamine was also found to be a pro-beta cell stimulus (Vázquez et al., 2014). These
data further suggest a connection between catecholamine signaling and Notch signaling
and a non-neural role of tyrosine hydroxylase in cell fate specification.
It may be possible that by blocking tyrosine hydroxylase with metyrosine, in the
experiments described in Chapter Four, epinephrine levels were reduced, thereby
blocking Notch signaling and allowing for expansion of NEBs. Future studies would
allow for full investigation of this potential mechanism.
In conclusion, this work has used basic developmental and cell biology
techniques, genetic tools, and a variety of other approaches to investigate the role of
Notch ligands in airway development and how pulmonary neuroendocrine cells
differentiate.
113
References
Akiyama, J., Okamoto, R., Iwasaki, M., Zheng, X., Yui, S., Tsuchiya, K., Nakamura, T.
and Watanabe, M. (2010). Delta-like 1 expression promotes goblet cell differentiation in
Notch-inactivated human colonic epithelial cells. Biochem. Biophys. Res. Commun. 393,
662-667.
Babicki, S., Arndt, D., Marcu, A., Liang, Y., Grant, J. R., Maciejewski, A. and Wishart,
D. S. (2016). Heatmapper: web-enabled heat mapping for all. Nucleic Acid Res. 44,
W147-W153.
Benedito, R., Roca, C., Sörensen, I., Adams, S., Gossler, A., Fruttiger, M. and Adams, R.
H. (2009). The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.
Cell 137, 1124-1135.
Bjerknes, M., Khandanpour, C., Moroy, T., Fujiyama, T., Hoshino, M., Klisch, T. J.,
Ding, Q., Gan, L., Wang, J., Martin, M. G. and Cheng, H. (2012). Origin of the brush cell
lineage in the mouse intestinal epithelium. Dev. Biol. 362, 194–218.
Blanpain, C., Lowry, W. E., Pasolli, H. A. and Fuchs, E. (2006). Canonical notch
signaling functions as a commitment switch in the epidermal lineage. Genes Dev. 20,
3022-3035.
Borges, M., Linnoila, R. I., van de Velde, H. J. K., Chen, H., Nelkin, B. D., Mabry, M.,
Baylin, S. B. and Ball, D. W. (1997). An achaete-scute homologue essential for
neuroendocrine differentiation in the lung. Nature 386, 852-855.
Bouras, T., Pal, B., Vaillant, F., Harburg, G., Asselin-Labat, M.-L., Oakes, S. R.,
Lindeman, G. J. and Visvader, J. E. (2008). Notch signaling regulates mammary stem cell
function and luminal cell-fate commitment. Cell Stem Cell 3, 429-441.
Branchfield, K., Nantie, L., Verheyden, J. M., Sui, P., Wienhold, M. D. and Sun, X.
(2016). Pulmonary neuroendocrine cells function as airway sensors to control lung
immune response. Science 351, 707-710.
Bray, S. J. (2006). Notch signaling: a simple pathway becomes complex. Nat. Rev. Mol.
Cell Biol. 7, 678-689.
Breuer, R., Zajicek, G., Christensen, T. G., Lucey, E. C. and Snider, G. L. (1990). Cell
kinetics of normal adult hamster bronchial epithelium in the steady state. Am. J. Respir.
Cell Mol. Biol. 2, 51-58.
Brody, A. S. and Crotty, E. J. (2006). Neuroendocrine cell hyperplasia of infancy
(NEHI). Pediatr. Radiol. 36, 1328.
114
Brody, S. L., Yan, X. H., Wuerffel, M. K., Song, S. K. and Shapiro, S. D. (2000).
Ciliogenesis and the left-right axis defects in forkhead factor HFH-4-null mice. Am. J.
Respir. Cell Mol. Biol. 23, 45-51.
Brooker, R., Hozumi, K. and Lewis, J. (2006). Notch ligands with contrasting functions:
Jagged1 and Delta1 in the mouse inner ear. Development 133, 1277-1286.
Brouns, I., Oztay, F., Pintelon, I., De Proost, I. Lembrechts, R., Timmermans, J. P. and
Adriaensen, D. (2009). Neurochemical pattern of the complex innervation of
neuroepithelial bodies in mouse lungs. Histochem. Cell Biol. 131, 55-74.
Burri, P. H. (1984). Fetal and postnatal development of the lung. Annu. Rev. Physiol. 46,
617-628.
Chen, G., Korfhagen, T. R., Xu, Y., Kitzmiller, J., Wert, S. E., Maeda, Y., Gregorieff, A.,
Clevers, H. and Whitsett, J. A. (2009). SPDEF is required for mouse pulmonary goblet
cell differentiation and regulates a network of genes associated with mucus production. J.
Clin. Invest. 119, 2914-2924.
Chen, J., Knowles, H. J., Herbert, J. L. and Hackett, B. P. (1998). Mutation of the mouse
hepatocyte nuclear factor/forkhead homologue 4 gene results in an absence of cilia and
random left-right asymmetry. J. Clin. Investig. 102, 1077-1082.
Chen, H. J., Poran, A., Unni, A. M., Huang, S. X., Elemento, O., Snoeck, H. W. and
Varmus, H. (2019). Generation of pulmonary neuroendocrine cells and SCLC-like
tumors from human embryonic stem cells. J. Exp. Med.
Chiche, A., Moumen, M., Petit, V., Jonkers, J., Medina, D., Deugnier, M.-A., Faraldo, M.
M. and Glukhova, M. A. (2013). Somatic loss of p53 leads to stem/progenitor cell
amplification in both mammary epithelial compartments, basal and luminal. Stem Cells
31, 1857-1867.
Coppens, J. T., Van Winkle, L. S., Pinkerton, K. and Plopper, C. G. (2007). Distribution
of Clara cell secretory protein expression in the tracheobronchial airways of rhesus
monkeys. Am. J. Physiol. Lung Cell Mol. Physiol. 292, L1155-L1162.
Cutz, E., Speirs, V., Yeger, H., Newman, C., Wang, D. and Perrin, D. G. (1993). Cell
biology of pulmonary neuroepithelial bodies – validation of an in vitro model. I. Effects
of hypoxia and Ca2+ ionophore on serotonin content and exocytosis of dense core
vesicles. Anat. Rec. 236, 41-52.
D’Souza, B., Miyamoto, A. and Weinmaster, G. (2008). The many facets of Notch
ligands. Oncogene 27, 5148-5167.
Danahay, H., Pessotti, A. D., Coote, J., Montgomery, B. E., Xia, D., Wilson, A., Yang,
H., Wang, Z., Bevan, L., Thomas, C., Petit, S., London, A., LeMotte, P., Doelemeyer, A.,
115
Vélez-Reyes, G. L., Bernasconi, P., Fryer, C. J., Edwards, M., Capodieci, P., Chen, A.,
Hild, M. and Jaffe, A. B. (2015). Notch2 is required for inflammatory cytokine-driven
goblet cell metaplasia in the lung. Cell Reports 10, 239-252.
Daniely, Y., Liao, G., Dixon, D., Linnoila, R. I., Lori, A., Randell, S. H., Oren, M. and
Jetten, A. M. (2004). Critical role of p63 in the development of a normal esophageal and
tracheobronchial epithelium. Am. J. Physiol. Cell Physiol. 287, C171-181.
Davies, S. J., Gosney, J. R., Hansell, D. M., Wells, A. U., du Bois, B. M., Burke, M. M.,
Sheppard, M. N. and Nicholson, A. G. (2007). Diffuse idiopathic pulmonary
neuroendocrine cell hyperplasia: an under-recognised spectrum of disease. Thorax 62,
248-252.
DeLellis, R. A. (2001). The neuroendocrine system and its tumors. Am. J. Clin. Pathol.
115 (Suppl 1), S5-S16.
Deterding, R. R., Pye, C., Fan, L. L. and Langston, C. (2005). Persistent tachypnea of
infancy is associated with neuroendocrine cell hyperplasia. Pediatr. Pulmonol. 40, 157-
165.
Donnelly, G. M., Haack, D. G. and Heird, C. S. (1982). Tracheal epithelium: cell kinetics
and differentiation in normal rat tissue. Cell Tissue Kinet. 15, 119-130.
Evans, M. J., Van Winkle, L. S., Fanucchi, M. V. and Plopper, C. G. (2001). Cellular and
molecular characteristics of basal cells in airway epithelium. Experimental Lung
Research 27, 401-415.
Eden, E., Lipson, D., Yogev, S. and Yakhini, Z. (2007). Discovering motifs in ranked
lists of DNA sequences. PLoS Computational Biology 3, e39.
Eden, E., Navon, R., Steinfeld, I., Lipson, D. and Yakhini, Z. (2009). GOrilla: a tool for
discovery and visualization of enriched GO terms in ranked gene lists. BMC
Bioinformatics 10, 48.
Fuchs, E. (2008). Skin stem cells: rising to the surface. J. Cell Biol. 180, 273-284.
Galloway, M. P., Burke, W. J. and Coscia, C. J. (1982).
Tetrahydroisoquinolinecarboxylic acids and catecholamine metabolism in adrenal
medulla explants. Biochemical Pharmacology 31, 3251-3256.
Garg, A., Sui, P., Verheyden, J. M., Young, L. R. and Sun, X. (2019). Consider the lung
as a sensory organ: A tip from pulmonary neuroendocrine cells. Curr. Top. Dev. Biol.
132, 67-89.
Gerbe, F., Sidot, E., Smyth, D. J., Ohmoto, M., Matsumoto, I., Dardalhon, V., Cesses, P.,
Garnier, L., Pouzolles, M., Brulin, B., Bruschi, M., Harcus, Y., Zimmermann, V. S.,
116
Taylor, N., Maizels, R. M. and Jay, P. (2016). Intestinal epithelial tuft cells initiate type 2
mucosal immunity to helminth parasites. Nature 529, 226–230.
Giangreco, A., Reynolds, S. D. and Stripp, B. R. (2002). Terminal bronchioles harbor a
unique airway stem cell population that localizes to the bronchoalveolar duct junction.
Am. J. Pathol. 161, 173-182.
Giangreco, A., Arwert, E. N., Rosewell, I. R., Snyder, J., Watt, F. M. and Stripp, B. R.
(2009). Stem cells are dispensable for lung homeostasis but restore airways after injury.
Proc. Natl. Acad. Sci. U.S.A. 106, 9286-9291.
Glasser, S. W., Hardie, W. D. and Hagood, J. S. (2010). Neuroendocrine cell hyperplasia
of infancy (NEHI). Pediatr. Radiol. 36, 1328.
Gomi, K., Arbelaez, V., Crystal, R. G. and Walters, M. S. (2015). Activation of
NOTCH1 or NOTCH3 signaling skews human airway basal cell differentiation toward a
secretory pathway. PLoS ONE 10, e0116507.
Gomi, K., Staudt, M. R., Salit, J., Kaner, R. J., Heldrich, J., Rogalski, A. M., Arbelaez,
V., Crystal, R. G. and Walters, M. S. (2016). JAG1-mediated notch signaling regulates
secretory cell differentiation of the human airway epithelium. Stem Cell Rev 12, 454-63.
Gomperts, B. N., Gong-Cooper, X. and Hackett, B. P. (2004). Foxj1 regulates basal body
anchoring to the cytoskeleton of ciliated pulmonary epithelial cells. J. Cell Sci. 117,
1329-1337.
Gould, V. E., Linnoila, R. I., Memoli, V. A. and Warren, W. H. (1983). Neuroendocrine
components of the bronchopulmonary tract: hyperplasias, dysplasia, and neoplasms. Lab
Invest. 49, 519-537.
Gu, X. and Ben-Shahar, Y. (2013). Olfactory receptors in human airway epithelia.
Methods Mol. Biol. 1003, 161-169.
Gu, X., Karp, P. H., Brody, S. L., Pierce, R. A., Welsh, M. J., Holtzman, M. J. and Ben-
Shahar, Y. (2014). Chemosensory functions for pulmonary neuroendocrine cells. Am. J.
Respir. Cell Mol. Biol. 50, 637-646.
Guha, A., Vasconcelos, M., Cai, Y., Yoneda, M., Hinds, A., Qian, J., Li, G., Dickel, L.,
Johnson, J. E., Kimura, S., Guo, J., McMahon, J., McMahon, A. P. and Cardoso, W. V.
(2012). Neuroepithelial body microenvironment is a niche for a distinct subset of Clara-
like precursors in the developing airways. Proc. Natl. Acad. Sci. USA. 109, 12592-12597.
Guha, A., Vasconcelos, M., Zhao, R., Gower, A. C., Rajagopal, J. and Cardoso, W. V.
(2014). Analysis of Notch signaling-dependent gene expression in developing airways
reveals diversity of Clara cells. PLoS One 9, e88848.
117
Guha, A., Deshpande, A., Jain, A., Sebastiani, P. and Cardoso, W. V. (2017). Uroplakin
3a+ cells are a distinctive population of epithelial progenitors that contribute to airway
maintenance and post-injury repair. Cell Reports 19, 246-254.
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L.
(1993). Mammalian achaete-scute homolog 1 is required for the early development of
olfactory and autonomic neurons. Cell 75, 463-476.
Gupta, R., Hong, D., Iborra, F., Sarno, S. and Enver, T. (2007). NOV (CCN3) functions
as a regulator of human hematopoietic stem or progenitor cells. Science 316, 590-593.
Guseh, J. S., Bores, S. A., Stanger, B. Z., Zhou, Q., Anderson, W. J., Melton, D. A. and
Rajagopal, J. (2009). Notch signaling promotes airway mucous metaplasia and inhibits
alveolar development. Development 136, 1751-1759.
Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K. Yoshimoto, M., Nakahata, T., Ikuta,
K. and Honjo, T. (2002). Inducible gene knockout of transcription factor recombination
signal binding protein-J reveals its essential role in T versus B lineage decision. Int.
Immunol. 15, 637-645.
Harfe, B. D., Scherz, P. J., Nissim, S., Tian, H., McMahon, A. P. and Tabin, C. J. (2004).
Evidence for an expansion-based temporal Shh gradient in specifying vertebrate digit
identities. Cell 118 517-528.
Harris, K. S., Zhang, Z., McManus, M. T., Harfe, B. D. and Sun, X. (2006). Dicer
function is essential for lung epithelium morphogenesis. Proc. Natl. Acad. Sci. USA 103,
2208-2213.
Hegab, A. E., Ha, V. L., Gilbert, J. L., Zhang, K. X., Malkoski, S. P., Chon, A. T.,
Darmawan, D. O., Bisht, B., Ooi, A. T., Pellegrini, M., Nickerson, D. W. and Gomperts,
B. N. (2011). Novel stem/progenitor cell population from murine tracheal submucosal
gland ducts with multipotent regenerative potential. Stem Cells 29, 1283-1293.
Herriges, M. and Morrisey, E. E. (2014). Lung development: orchestrating the generation
and regeneration of a complex organ. Development 141, 502-513.
Hong, K. U., Reynolds, S. D., Giangreco, A., Hurley, C. M. and Stripp, B. R. (2001).
Clara cell secretory protein-expressing cells of the airway neuroepithelial body
microenvironment include a label-retaining subset and are critical for epithelial renewal
after progenitor cell depletion. Am. J. Respir. Cell Mol. Biol. 24, 671-681.
Huang, H. P., Chu, K., Nemoz-Gaillard, E., Elberg, D. and Tsai, M. J. (2002).
Neogenesis of beta-cells in adult BETA2/NeuroD-deficient mice. Mol. Endocrinol. 16,
541-551.
118
Huang, Y. H., Klingbeil, O., He, X. Y., Wu, X. S., Arun, G., Lu, B., Somerville, T. D. D.,
Milazzo, J. P., Wilkinson, J. E., Demerdash, O. E., Spector, D. L., Egeblad, M., Shi, J.
and Vakoc, C. R. (2018). POU2F3 is a master regulator of a tuft cell-like variant of small
cell lung cancer. Genes Dev. 32, 915-928.
Huber, K., Brühl, B., Guillemot, F., Olson, E. N., Ernsberger, U. and Unsicker, K.
(2002). Development of chromaffin cells depends on MASH1 function. Development
129, 4729-4738.
Huber, K., Karch, N., Ernsberger, U., Gordis, C. and Unsicker, K. (2005). The role of
Phox2b in chromaffin cell development. Dev. Biol. 279, 501-508.
Ito, T., Udaka, N., Yazawa, T., Okudela, K., Hayashi, H., Sudo, T., Guillemot, F.,
Kageyama, R. and Kitamura, H. (2000). Basic helix-loop-helix transcription factors
regulate the neuroendocrine differentiation of fetal mouse pulmonary epithelium.
Development 127, 3913-3921.
Jia, S., Wildner, H. and Birchmeier, C. (2015). Insm1 controls the differentiation of
pulmonary neuroendocrine cells by repressing Hes1. Developmental Biology 408, 90-98.
Jiang, R., Lan, Y., Chapman, H. D., Shawber, C., Norton, C. R., Serreze, D. V.,
Weinmaster, G. and Gridley, T. (1998). Defects in limb, craniofacial, and thymic
development in Jagged2 mutant mice. Genes Dev 12, 1046-1057.
Jiménez-González, M., Jaques, F., Rodríguez, S., Porciuncula, A., Principe, R. M.,
Abizanda, G., Iñiguez, M., Escalada, J., Salvador, J., Prósper, F., Halban, P. A. and
Barajas, M. (2013). Cardiotrophin 1 protects beta cells from apoptosis and prevents
streptozotocin-induced diabetes in a mouse model. Diabetologia 56, 838-846.
Kadur Lakshminarasimha Murthy, P., Srinivasan, T., Bochter, M. S., Xi, R., Varanko, A.
K., Tung, K. L., Semerci, F., Xu, K., Maletic-Savatic, M., Cole, S. E. and Shen, X.
(2018). Radical and lunatic fringes modulate notch ligands to support mammalian
intestinal homeostasis. eLife 7, e35710.
Kalbe, B., Schulz, V. M., Schlimm, M., Philippou, S., Jovancevic, N., Jansen, F., Scholz,
P., Lübbert, H., Jarocki, M., Faissner, A., Hecker, E., Veitinger, S., Tsai, T., Osterloh, S.
and Hatt, H. (2017). Helional-induced activation of human olfactory receptor 2J3
promotes apoptosis and inhibits proliferation in a non-small-cell lung cancer line. Eur. J.
Cell Biol. 96, 34-46.
Kameda, Y., Nishimaki, T., Miura, M., Jiang, S. X. and Guillemot, F. (2007). Mash1
regulates the development of C cells in mouse thyroid glands. Developmental Dynamics
236, 262-270.
119
Kameda, Y. (2014). Signaling molecules and transcription factors involved in the
development of the sympathetic nervous system, with special emphasis on the superior
cervical ganglion. Cell Tissue Res. 357, 527-548.
Katsube, K., Sakamoto, K., Tamamura, Y. and Yamaguchi, A. (2009). Role of CCN, a
vertebrate specific gene family, in development. Dev. Growth Differ. 51, 55-67.
Kiernan, A. E., Cordes, R., Kopan, R., Gossler, A. and Gridley, T. (2005). The Notch
ligands DLL1 and JAG2 act synergistically to regulate hair cell development in the
mammalian inner ear. Development 132, 4353-4362.
Kim, E. J., Ables, J. L., Dickel, L. K., Eisch, A. J. and Johnson, J. E. (2011). Ascl1
(Mash1) defines cells with long-term neurogenic potential in subgranular and
subventricular zones in adult mouse brain. PLoS One 6, e18472.
Koch, U., Fiorini, E., Benedito, R., Besseyrias, V., Schuster-Gossler, K., Pierres, M.,
Manley, N. R., Duarte, A., Macdonald, H. R. and Radtke, F. (2008). Delta-like 4 is the
essential, nonredundant ligand for Notch1 during thymic T cell lineage commitment. J.
Exp. Med. 205, 2515-1523.
Kokubu, H., Ohtsuka, T. and Kageyama, R. (2008). Mash1 is required for
neuroendocrine cell development in the glandular stomach. Genes to Cells 13, 41-51.
Koliakos, E., Thomopoulos, T., Abbassi, Z., Duc, C. and Christodoulou, M. (2017).
Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia: a case report and review
of the literature. Am. J. Case Rep. 18, 975-979.
Konishi, J., Kawaguchi, K. S., Vo, H., Haruki, N., Gonzalez, A., Carbone, D. P. and
Dang, T. P. (2007). Gamma-secretase inhibitor prevents Notch3 activation and reduces
proliferation in human lung cancers. Cancer Res. 67, 8051-8057.
Kopan, R. and Ilagan, M. X. G. (2009). The canonical Notch signaling pathway:
unfolding the activation mechanism. Cell 137, 216-233.
Krasteva, G., Canning, B. J., Hartmann, P., Veres, T. Z., Papadakis, T., Mühlfeld, C.,
Schliecker, K., Tallini, Y. N., Braun, A., Hackstein, H., Baal, N., Weihe, E., Schütz, B.,
Kotlikoff, M., Ibanez-Tallon, I. and Kummer, W. (2011). Cholinergic chemosensory cells
in the trachea regulate breathing. Proc. Natl. Acad. Sci. USA. 108, 9478-9483.
Krasteva, G., Canning, B. J., Papadakis, T. and Kummer, W. (2012). Cholinergic brush
cells in the trachea mediate respiratory responses to quorum sensing molecules. Life
Sciences 91, 992-996.
Kuhar, M. J., Couceyro, P. R. and Lambert, P. D. (1999). Biosynthesis of
Catecholamines. In: Siegel, G. J., Agranoff, B. W., Albers, R. W., et al., editors. Basic
120
Neurochemistry: Molecular, Cellular and Medical Aspects. 6th edition. Philadelphia:
Lippincott-Raven .Available from: https://www.ncbi.nlm.nih.gov/books/NBK27988/
Kuo, C. and Krasnow, M. (2015). Formation of a neurosensory organ by epithelial cell
slithering. Cell 163, 1-12.
Kurita, T., Medina, R. T., Mills, A. A. and Cunha, G. R. (2004). Role of p63 and basal
cells in the prostate. Development 131, 4955-4964.
Lanigan, T. M., DeRaad, S. K. and Russo, A. F. (1997). Requirement of MASH-1
transcription factor for neuroendocrine cell differentiation of thyroid C cells. J.
Neurobiol. 34, 126-134.
Lauweryns, J. M. and Cokelaere, M. (1973). Intrapulmonary Neuro-Epithelial Bodies:
Hypoxia-Sensitive Neuro (Chemo-) Receptors. Experientia 29, 1384-1396.
Lauweryns, J. M. and van Ranst, L. (1988). Immunocytochemical localization of
aromatic l-amino acid decarboxylase in human, rat, and mouse bronchopulmonary and
gastrointestinal endocrine cells. The Journal of Histochemistry and Cytochemistry 36,
1181-1186.
Lafkas, D., Shelton, A., Chiu, C., de Leon Boenig, G., Chen, Y., Stawicki, S. S., Siltanen,
C., Reichelt, M., Zhou, M., Wu, X., Eastham-Anderson, J., Moore, H., Roose-Girma, M.,
Chinn, Y., Hang, J. Q., Warming, S., Egen, J., Lee, W. P., Austin, C., Wu, Y., Payandeh,
J., Lowe, J. B. and Siebel, C. W. (2015). Therapeutic antibodies reveal Notch control of
transdifferentiation in the adult lung. Nature 528, 127-131.
Leung, C. T., Coulombe, P. A. and Reed, R. R. (2007). Contribution of olfactory neural
stem cells to tissue maintenance and growth. Nat. Neuroscience 10, 720-726.
Lim, E.,Vaillant, F.,Wu, D., Forrest, N. C., Pal, B., Hart, A. H., Asselin-Labat, M.-L.,
Gyorki, D. E.,Ward, T., Partanen, A., Feleppa, F., Huschtscha, L. I., Thorne, H. J.,
kConFab, Fox, S. B., Yan, M., French, J. D., Brown, M. A., Smyth, G. K., Visvader, J. E.
and Lindeman, G. J. (2009). Aberrant luminal progenitors as the candidate target
population for basal tumor development in BRCA1 mutation carriers. Nat. Med. 15, 907-
913.
Linnoila, R. I. (2006). Functional facets of the pulmonary neuroendocrine system. Lab
Invest. 85, 425-444.
Lucas, M. E., Muller, F., Rudiger, R., Henion, P. D. and Rohrer, H. (2006). The bHLH
transcription factor hand2 is essential for noradrenergic differentiation of sympathetic
neurons. Development 133, 4015-4024.
Maßberg, D. and Hatt, H. (2018). Human olfactory receptors: novel celluar function
outside of the nose. Physiol. Rev. 98, 1739-1763.
121
McCormick, M. B., Tamimi, R. M., Snider, L., Asakura, A., Bergstrom, D. and Tapscott,
S. J. (1996). NeuroD2 and neuroD3: distinct expression patterns and transcriptional
activation potentials within the neuroD gene family. Mol. Cell Biol. 16, 5792-5800.
Madisen, L., Zwingman, T. A., Sunkin, S. M., Oh, S. W., Zariwala, H. A., Gu, H., Ng, L.
L., Palmiter, R. D., Hawrylycz, M. J., Jones, A. R., Lein, E. S. and Zeng, H. (2010). A
robust and high-throughput Cre reporting and characterization system for the whole
mouse brain. Nat. Neurosci. 13, 133-140.
Mercer, R. R., Russell, M. L., Roggli, V. L. and Crapo, J. D. (1994). Cell number and
distribution in human and rat airways. Am. J. Respir. Cell Mol. Biol. 10, 613-624.
Minamizato, T., Sakamoto, K., Liu, T., Kokubo, H., Katsube, K., Perbal, B. Nakamura,
S. and Yamaguchi, A. (2007). CCN3/NOV inhibits BMP-2-induced osteoblast
differentiation by interacting with BMP and Notch signaling pathways. Biochem.
Biophys. Res. Commun. 354, 567-573.
Montoro, D. T., Haber, A. L., Biton, M., Vinarsky, V., Lin, B., Birket, S. E., Yuan, F.,
Chen, S., Leung, H. M., Villoria, J., Rogel, N., Burgin, G., Tsankov, A. M., Waghray, A.,
Slyper, M., Waldman, J., Nguyen, L., Dionne, D., Rozenblatt-Rosen, O., Tata, P. R.,
Mou, H., Shivaraju, M., Bihler, H., Mense, M., Tearney, G. J., Rowe, S. M., Engelhardt,
J. F., Regev, A. and Rajagopal, J. (2018). A revised airway epithelial hierarchy includes
CFTR-expressing ionocytes. Nature 560, 319-324.
Mori, M., Mahoney, J. E., Stupnikov, M. R., Paez-Cortez, J. R., Szymaniak, A. D.,
Varelas, X., Herrick, D. B., Schwob, J., Zhang, H. and Cardoso, W. V. (2015). Notch3-
Jagged signaling controls the pool of undifferentiated airway progenitors. Development
142, 258-267.
Morikawa, Y., D’Autreaux, F., Gershon, M. D. and Cserjesi, P. (2007). Hand2
determines the noradrenergic phenotype in the mouse sympathetic nervous system. Dev.
Biol. 307, 1140126.
Morimoto, M., Liu, Z., Cheng, H. T., Winters, N., Bader, D. and Kopan, R. (2010).
Canonical Notch signaling in the developing lung is required for determination of arterial
smooth muscle cells and selection of Clara versus multiciliated cell fate. J. Cell Sci. 123,
213-224.
Morimoto, M., Nishinakamura, R., Saga, Y. and Kopan, R. (2012). Different assemblies
of Notch receptors coordinate the distribution of major bronchial Clara, multiciliated and
neuroendocrine cells. Development 139, 4365-4373.
Morrisey, E. E. and Hogan, B. L. M. (2010). Preparing for the first breath: genetic and
cellular mechanisms in lung development. Developmental Cell 18, 8-23.
122
Noguchi, M., Sumiyama, K. and Morimoto, M. (2015). Directed migration of pulmonary
neuroendocrine cells toward airway branches organizes the stereotypic location of
neuroepithelial bodies. Cell Reports 13, 2679-2686.
Ohuchi, H., Hori, Y., Yamasaki, M., Harada, H., Sekine, K., Kato, S. and Itoh, N. (2000).
FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development.
Biochem. Biophys. Res. Commun. 277, 643-649.
Pardo-Saganta, A., Law, B. M., Gonzalez-Celeiro, M., Vinarsky, V. and Rajagopal, J.
(2013). Ciliated cells of pseudostratified airway epithelium do not become mucous cells
after ovalbumin challenge. Am. J. Respir. Cell Mol. Biol. 48, 364-373.
Pardo-Saganta, A., Law, B. M., Tata, P. R., Villovia, J., Saez, B., Mou, H., Zhao, R. and
Rajagopal, J. (2015a). Injury induces direct lineage segregation of functionally distinct
airway basal stem/progenitor cell subpopulations. Cell Stem Cell 16, 184-197.
Pardo-Saganta, A., Tata, P. R., Law, B. M., Saez, B., Chow, R. D. W., Prabhu, M.,
Gridley, T. and Rajagopal, J. (2015b). Parent stem cells can serve as niches for their
daughter cells. Nature 532, 597-601.
Park, K. S., Korfhagen, T. R., Bruno, M. D., Kitzmiller, J. A., Wan, H., Wert, S. E.,
Khurana Hershey, G. K., Chen, G. and Whitsett, J. A. (2007). SPDEF regulates goblet
cell hyperplasia in the airway epithelium. J. Clin. Invest. 117, 978-988.
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F. (1999). The homeobox
gene Phox2b is essential for the development of autonomic neural crest derivatives.
Nature 399, 366-370.
Pellegrinet, L., Rodilla, V., Liu, Z., Chen, S., Koch, U., Espinosa, L., Kaestner, K. H.,
Kopan, R., Lewis, J. and Radtke, F. (2011). Dll1- and dll4-mediated notch signaling are
required for homeostasis of intestinal stem cells. Gastroenterology 140, 1230-1240.
Pignon, J.-C., Grisanzio, C., Geng, Y., Song, J., Shivdasani, R. A. and Signoretti, S.
(2013). P63-expressing cells are the stem cells of developing prostate, bladder, and
colorectal epithelia. Proc. Natl. Acad. Sci. USA 110, 8105-8110.
Plasschaert, L. W., Žilionis, R., Choo-Wing, R., Savova, V., Knehr, J., Roma, G., Klein,
A. M. and Jaffe, A. B. (2018). A single-cell atlas of the airway epithelium reveals the
CFTR-rich pulmonary ionocyte. Nature 560, 377-381.
Post, L. C., Ternet, M. and Hogan, B. L. M. (2000). Notch/Delta expression in the
developing lung. Mechanisms of Development 98, 95-98.
Que, J., Choi, M., Ziel, J. W., Klingensmith, J. and Hogan, B. L. (2006). Morphogenesis
of the trachea and esophagus: current players and new roles for noggin and Bmps.
Differentiation 74, 422-437.
123
Que, J., Okubo, T., Goldenring, J. R., Nam, K. T., Kurotani, R., Morrisey, E. E.,
Taranova, O., Pevny, L. H. and Hogan, B. L. (2007). Multiple dose-dependent roles for
Sox2 in the patterning and differentiation of anterior foregut endoderm. Development
134, 2521-2531.
Rackley, C. R. and Stripp, B. R. (2012). Building and maintaining the epithelium of the
lung. J. Clin. Invest. 122, 2724-2730.
Radtke, F. and Raj, K. (2003). The role of Notch in tumorigenesis: oncogene or tumour
suppressor? Nat. Rev. Cancer 3, 756-767.
Rawlins, E. L., Ostrowski, L. E., Randell, S. H. and Hogan, B. L. M. (2007). Lung
development and repair: contribution of the multiciliated lineage. Proc. Natl. Acad. Sci.
USA 104, 410-417.
Rawlins, E. L. and Hogan, B. L. M. (2008). Ciliated epithelial cell lifespan in the mouse
trachea and lung. Am. J. Physiol. Lung Cell Mol. Physiol. 295, L231-L234.
Rawlins, E. L., Clark, C. P., Xue, Y. and Hogan, B. L. (2009). The Id2+ distal tip lung
epithelium contains individual multipotent embryonic progenitor cells. Development 136,
3741-3745.
Reid, L., Meyrick, B., Antony, V. B., Chang, L.-Y., Crapo, J. D. and Reynolds, H. Y.
(2005). The mysterious pulmonary brush cell. Am. J. Respir. Crit. Care Med. 172, 136-
139.
Reynolds, S. D., Giangreco, A., Power, J. H. and Stripp, B. R. (2000a). Neuroepithelial
bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial
regeneration. Am. J. Pathol. 156, 269-278.
Reynolds, S. D., Hong, K. U., Giangreco, A., Mango, G. W., Guron, C., Morimoto, Y.
and Stripp, B. R. (2000b). Conditional clara cell ablation reveals a self-renewing
progenitor function of pulmonary neuroendocrine cells. Am. J. Physiol. Lung Cell Mol.
Physiol. 278, L1256-1263.
Rock, J. R., Onaitis, M. W., Rawlins, E. L., Lu, Y., Clark, C. P., Xue, Y., Randell, S. H.
and Hogan, B. L. M. (2009). Basal cells as stem cells of the mouse trachea and human
airway epithelium. Proc. Natl. Acad. Sci. USA 106, 12771-12775.
Rock, J. R., Gao, X., Xue, Y., Randell, S. H., Kong, Y. Y. and Hogan, B. L. (2011).
Notch-dependent differentiation of adult airway basal stem cells. Cell Stem Cell. 8, 639-
648.
Rock, J. R. and Hogan, B. L. (2011). Epithelial progenitor cells in lung development,
maintenance, repair, and disease. Annu. Rev. Cell Dev. Biol. 27, 493-512.
124
Rosenbaum, J. N., Guo, Z., Baus, R. M., Werner, H., Rehrauer, W. M. and Lloyd, R. V.
(2015). INSM1: a novel immunohistochemical and molecular marker for neuroendocrine
and neuroepithelial neoplasms. Am. J. Clin. Pathol. 144, 579-591.
Saiardi, A., Bozzi, Y., Baik, J. H. and Borrelli, E. (1997). Antiproliferative role of
dopamine: loss of D2 receptors causes hormonal dysfunction and pituitary hyperplasia.
Neuron 19, 115-126.
Sakamoto, K., Yamaguchi, S., Ando, R. Miyawaki, A., Kabasawa, Y., Takagi, M., Li, C.
L., Perbal, B. and Katsube, K. (2002). The nephroblastoma overexpressed gene
(NOV/ccn3) protein associates with Notch1 extracellular domain and inhibits myoblast
differentiation via Notch signaling pathway. J. Biol. Chem. 277, 29399-29405.
Sansone, P., Storci, G., Giovannini, C., Pandolfi, S., Pianetti, S., Taffurelli, M., Santini,
D., Ceccarelli, C., Chieco, P. and Bonafe, M. (2007). p66Shc/Notch-3 interplay controls
self-renewal and hypoxia survival in human stem/progenitor cells of the mammary gland
expanded in vitro as mammospheres. Stem Cells 25, 807-815.
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita,
N., Matsui, D., Koga, Y., Itoh, N. and Kato, S. (1999). Fgf10 is essential for limb and
lung formation. Nat. Genet. 21, 138-141.
Song, H., Yao, E., Lin, C., Gacayan, R., Chen, M. H. and Chuang, P. T. (2012).
Functional characterization of pulmonary neuroendocrine cells in lung development,
injury, and tumorigenesis. PNAS 109, 17531-17536.
Sui, P., Wiesner, D. L., Zu, J., Zhang, Y., Lee, J., van Dyken, S., Lashua, A., Yu, C.,
Klein, B. S., Locksley, R. M., Deutsch, G. and Sun, X. (2018). Pulmonary
neuroendocrine cells amplify allergic asthma responses. Science 360.
Tizzano, M., Cristofoletti, M., Sbarbati, A. and Finger, T. E. (2011). Expression of taste
receptors in solitary chemosensory cells of rodent airways. BMC Pulmonary Medicine
11, 1-12.
Tsao, P.-N., Chen, F., Izvolsky, K. I., Walker, J., Kukuruzinska, M. A., Lu, J. and
Cardoso, W. V. (2008). Gamma-secretase activation of notch signaling regulates the
balance of proximal and distal fates in progenitor cells of the developing lung. J. Biol.
Chem. 283, 29532-29544.
Tsao, P. N., Vasconcelos, M., Izvolsky, K. I., Qian, J., Lu, J. and Cardoso, W. V. (2009).
Notch signaling controls the balance of multiciliated and secretory cell fates in
developing airways. Development 136, 2297-2307.
Tsao, P. N., Wei, S. C., Wu, M. F., Huang, M. T., Lin, H. Y., Lee, M. C., Lin, K. M.,
Wang, I. J., Kaartinen, V., Yang, L. T. and Cardoso, W. V. (2011). Notch signaling
125
prevents mucous metaplasia in mouse conducting airways during postnatal development.
Development 138, 3533-3543.
Vázquez, P., Robles, A. M., de Pablo, F., Hernández-Sánchez, C. (2014). Non-neural
tyrosine hydroxylase, via modulation of endocrine pancreatic precursors, is required for
normal development of beta cells in the mouse pancreas. Diabetologia 57, 2339-2347.
Verckist, L., Lembrechts, R., Thys, S., Pintelon, I., Timmermans, J. P., Brouns, I. and
Adriaensen, D. (2017). Selective gene expression analysis of the neuroepithelial body
microenvironment in postnatal lungs with special interest for potential stem cell
characteristics. Respir Res 18, 87.
Volckaert, T., Dill, E., Campbell, A., Tiozzo, C., Majka, S., Bellusci, S. and De Langhe,
S. P. (2011). Parabronchial smooth muscle constitutes an airway epithelial stem cell
niche in the mouse lung after injury. J. Clin. Invest. 121, 4409-4419.
Wang, M. M. (2011). Notch signaling and Notch signaling modifiers. Int. J. Biochem.
Cell Biol. 43, 1550-1562.
Wang, S. Z., Ou, J., Zhu, L. J. and Green, M. R. (2012). Transcription factor ATF5 is
required for terminal differentiation and survival of olfactory sensory neurons. Proc.
Natl. Acad. Sci. USA 109, 18589-18594.
Watson, J. K., Rulands, S., Wilkinson, A. C., Wuidart, A., Ousset, M., Van Keymeulen,
A., Göttgens, B., Blanpain, C., Simons, B. D. and Rawlins, E. L. (2015). Clonal
dynamics reveal two distinct populations of basal cells in slow-turnover airway
epithelium. Cell Rep. 12, 90-101.
Weissman, A. and Koe, B. K. (1965). Behavioural effects of L-a-methyltyrosine, an
inhibitor of tyrosine hydroxylase. Life Sciences 4, 1037-1048.
Xing, Y., Li, A., Borok, Z., Li, C. and Minoo, P. (2012). NOTCH1 is required for
regeneration of Clara cells during repair of airway injury. Stem Cells 30, 945-955.
Xu, J., Krebs, L. T. and Gridley T. (2010). Generation of mice with a conditional null
allele of the Jagged2 gene. Genesis 48, 390-393.
Xu, K., Nieuwenhuis, E., Cohen, B. L., Wang, W., Canty, A. J., Danska, J. S., Coultas,
Kl., Rossant, J., Wu, M. Y. J., Piscione, T. D., Nagy, A., Gossler, A., Hicks, G. G., Hui,
C. C., Henkelman, R. M., Yu, L. X., Sled, J. G., Gridley, T. and Egan, S. E. (2010).
Lunatic Fringe-mediated Notch signaling is required for lung alveogenesis. Am J Physiol
Lung Cell Mol Physiol 298, L45-L56.
Xu, X., Hu, C. and Schuller, H. M. (2017). Epinephrine-induced gamma secretase/Notch
signaling in pancreatic cancer stem cells [abstract]. In: Proceedings of the American
126
Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC.
Philadelphia (PA): AACR; Cancer Res 77, Abstract nr 2894.
Yamashita, J., Ohmoto, M., Yamaguchi, T., Matusmoto, I. and Hirota, J. (2017). Skn-
1a/Pou2f3 functions as a master regulator to generate Trmp3-expressing chemosensory
cells in mice. PLoS One 12, e0189340.
Yan, K. S., Gevaert, O., Zheng, G. X. Y., Anchang, B., Probert, C. S., Larkin, K. A.,
Davies, P. S., Cheng, Z. F., Kaddis, J. S., Han, A., Roelf, K., Calderon, R. I., Cynn, E.,
Hu, X., Mandleywala, K., Wilhelmy, J., Grimes, S. M., Corney, D. C., Boutet, S. C.,
Terry, J. M., Belgrader, P., Ziraldo, S. B., Mikkelsen, T. S., Wang, F., von Furstenberg,
R. J., Smith, N. R., Chandrakesan, P., May, R., Chrissy, M. A. S., Jain, R., Cartwright, C.
A., Niland, J. C., Hong, Y. K., Carrington, J., Breault, D. T., Epstein, J., Houchen, C. W.,
Lynch, J. P., Martin, M. G., Plevritis, S. K., Curtis, C., Ji, H. P., Li, L., Henning, S. J.,
Wong, M. H. and Kuo, C. J. (2017). Intestinal enteroendocrine lineage cells possess
homeostatic and injury-inducible stem cell activity. Cell Stem Cell 21, 78–90 e76.
Yang, A. and McKeon, F. (2000). P63 and P73: P53 mimics, menaces and more. Nat.
Rev. Mol. Cell Biol. 1, 199-207.
Yang, Y., Riccio, P., Schotsaert, M., Mori, M., Lu, J., Lee, D. K., Garcia-Sastre, A., Xu,
J. and Cardoso, W. V. (2018). Spatial-temporal lineage restrictions of embryonic p63+
progenitors establish distinct stem cell pools in adult airways. Developmental Cell 44,
752-761.
Yao, E., Lin, C., Wu, Q., Zhang, K., Song, H. and Chuang, P. T. (2018). Notch signaling
controls transdifferentiation of pulmonary neuroendocrine cells in response to lung
injury. Stem Cells 36, 377-391.
Young, L. R., Brody, A. S., Inge, T. H., Acton, J. D., Bokulic, R. E., Langston, C. and
Deutsch, G. H. (2011). Neuroendocrine cell distribution and frequency distinguish
neuroendocrine hyperplasia of infancy from other pulmonary disorders. Chest 139, 1060-
1071.
Zhang, S., Loch, A. J., Radtke, F., Egan, S. E. and Xu, K. (2013). Jagged1 is the major
regulator of Notch-dependent cell fate in proximal airways. Dev Dyn 242, 678-686.