glycosylated green fluorescent protein for carbohydrate

1

Glycosylated Green Fluorescent Protein for Carbohydrate

Binding Protein Analysis

A thesis submitted to The University of Manchester for the degree of

Doctor of Philosophy

in the Faculty of Engineering and Physical Sciences

2013

Andrew James Martin

School of Chemistry

2

CONTENTS

LIST OF TABLES AND FIGURES ................................................................................. 7

ABBREVIATIONS ........................................................................................................ 18

EXPLANATORY NOTES ............................................................................................. 21

ABSTRACT .................................................................................................................... 22

DECLARATION ............................................................................................................ 23

COPYRIGHT STATEMENT ......................................................................................... 24

ACKNOWLEDGEMENTS ............................................................................................ 25

Chapter 1: Introduction ................................................................................................... 26

1.1 Protein Glycosylation ............................................................................................ 27

1.1.1 Types of Protein Glycosylation ...................................................................... 28

1.1.2 N-Linked Glycosylation ................................................................................. 29

1.1.3 O-Linked Protein Glycosylation .................................................................... 32

1.1.4 Carbohydrate Mediated Signalling ................................................................ 36

1.2 Medical Applications of Carbohydrates ............................................................... 36

1.2.1 Carbohydrate Based Antibiotics .................................................................... 37

1.2.2 Carbohydrate Based Vaccines........................................................................ 38

1.2.3 Carbohydrates for Cell Specific Drug Delivery ............................................. 38

1.3 Carbohydrate Binding Protein Analysis (Considerations) .................................... 41

1.3.1 Polyvalency .................................................................................................... 41

1.3.2 Heterogeneity ................................................................................................. 43

1.3.3 Synthetic Glycoconjugate Scaffolds .............................................................. 44

1.4 Artificial Glycoproteins ........................................................................................ 46

1.4.1 Synthetic Strategies for Neoglycoproteins ..................................................... 47

1.4.2 Chemical Glycosylation ................................................................................. 50

3

1.4.3 Glycosylating Cysteines ................................................................................. 53

1.5 Green Fluorescent Protein (GFP) .......................................................................... 55

1.5.1 GFPuv ............................................................................................................ 58

1.5.2 Glycosylated GFP .......................................................................................... 59

1.6 Project Aims .......................................................................................................... 60

Chapter 2: The Generation, Expression and Purification of GFPuv Mutants ................. 62

2.1 Generating GFPuv Cysteine Mutants.................................................................... 63

2.1.1 Addition of Hexahistidine Tag to GFPuv ...................................................... 64

2.2 Site Directed Mutagenesis..................................................................................... 65

2.2.1 Inverse PCR ................................................................................................... 65

2.2.2 The Quickchange Method .............................................................................. 67

2.3 Generation of Cysteine Mutants by DNA Shuffling ............................................. 68

2.3.1 General Considerations .................................................................................. 68

2.3.2 Design of Polycysteine Mutants for DNA Shuffling ..................................... 69

2.3.3 DNA Shuffle of Shuffle 1 and sGFPuv_C48A .............................................. 70

2.4 Expression of GFPuv ............................................................................................ 73

2.4.1 Optimisation of Protein Expression ............................................................... 73

2.4.2 Expression of Mutants ................................................................................... 76

2.5 Purification of GFPuv ........................................................................................... 77

2.5.1 Gradient Immobilised Metal Affinity Chromatography (IMAC) .................. 77

2.5.2 Anion Exchange Column ............................................................................... 77

2.5.3 Size Exclusion Chromatography .................................................................... 78

2.5.4 Stepwise IMAC .............................................................................................. 78

2.6 Summary ............................................................................................................... 80

Chapter 3: Synthesis of Aminoethyl Glycosides ............................................................ 81

4

3.1 General Considerations ......................................................................................... 82

3.2 Synthesis of Monosaccharides .............................................................................. 84

3.3 Synthesis of Aminoethyl Trimannoside (41) ....................................................... 86

3.4 Synthesis of Tetramannosides (48 and 49) and Pentamannoside (50) .................. 93

3.5 Activation of Glycosides for Glycosylation of Cysteines ..................................... 95

3.6 Summary ............................................................................................................... 96

Chapter 4: The Glycosylation of GFPuv Mutants .......................................................... 98

4.1 General Considerations ......................................................................................... 99

4.2 Analysis of Protein samples by ESI-MS ............................................................... 99

4.3 Cysteine Reactivity Screen ................................................................................. 104

4.4 Final Glycosylation Procedure ............................................................................ 106

4.5 Analysis of Protein Samples by LCMS .............................................................. 107

4.6 Production of Neoglycoprotein Library .............................................................. 109

4.7 Glycosylation of Lysines..................................................................................... 111

4.8 Summary ............................................................................................................. 113

Chapter 5: The Enzymatic Modification of Glycosides ................................................ 115

5.1 Glycotransferase Screening on Trimannoside (41) ............................................. 116

5.1.1 Screening of Mannosides Against Glycotransferases .................................. 116

5.1.2 Screening of Mannosides Against Yeast Microsomal Extracts ................... 123

5.2 Modification of Lactosylated GFPuv Using Tran-sialidase ............................... 124

5.3 Summary ............................................................................................................. 128

Chapter 6: Lectin Binding Assays................................................................................. 129

6.1 General Considerations ....................................................................................... 130

6.2 Fluorescence Based Plate Assay ......................................................................... 130

6.2.2 Lectins Chosen for Initial Screens ............................................................... 131

5

6.2.3 Plate Assay Results ...................................................................................... 133

6.2.4 Fluorescence Based Assay Summary........................................................... 138

6.3 Isothermal Titration Calorimetry (ITC) .............................................................. 140

6.3.1 Titration of Me-α-Man Against ConA ......................................................... 142

6.3.2 Titration of GFPuv Against ConA ............................................................... 144

6.3.3 ITC Summary ............................................................................................... 146

6.4 Summary ............................................................................................................. 147

Chapter 7: Conclusions and Future Experiments .......................................................... 148

7.1 Conclusions ......................................................................................................... 149

7.2 Future Work ........................................................................................................ 151

Chapter 8: Experimental Details ................................................................................... 153

8.1 Experimental Details for Chapter 2..................................................................... 154

8.1.1 General Methods .......................................................................................... 154

8.1.2 Production of GFPuv Mutant Library .......................................................... 158

8.1.3 Protein Expression and Purification ............................................................. 166


8.2.1 General Procedure 1: Peracetylation with Acetic Anhydride and Pyridine177

............................................................................................................................... 169

8.2.2 General Procedure 2: Deacetylation with Sodium Methoxide177

................. 170

8.2.3 General Procedure 3: Hydrogenolysis of N-Cbz-protecting Groups177

....... 170

8.2.4 Synthesis of Aminoethyl Mannoside (27)177

............................................... 170

8.2.5 Synthesis of Aminoethyl Glucoside (32)177

................................................. 174

8.2.6 Synthesis of Aminoethyl Galactoside (33)177

.............................................. 176

8.2.7 Synthesis of Aminoethyl N-Acetyl glucosamine (34)177

............................. 179

8.2.8 Activation of Glycosides for Glycosylation of Cysteines130

........................ 182

6

8.2.9 Synthesis of Polymannosides178

................................................................... 182


8.3.1 Glycosylation of GFPuv Mutants ................................................................ 192

8.3.2 MS Analysis of Proteins .............................................................................. 193


8.4.1 Enzymatic Screening of Mannosides ........................................................... 194

8.4.2 Transialidase (TcTs) Reactions .................................................................... 196


8.5.1 Lectin 96-Well Plate Assay .......................................................................... 197

8.5.2 ITC Measurements ....................................................................................... 197

REFERENCES .............................................................................................................. 198

APENDICIES ............................................................................................................... 208

Appendix 1: DNA Sequences of GFPuv_WT and GFPuv_C48A_I229C ................ 208

Appendix 2: The DNA Sequences of sGFPuv_C48A and Shuffle 1 ........................ 209

Appendix 3: Screen Capture of a Typical Stepwise IMAC GFPuv_WT Purification

................................................................................................................................... 210

Appendix 4: The Fluorescence Spectra of GFPuv Mutants ...................................... 211

Appendix 5: Screen Capture of a Typical Polymannoside Purification ................... 212

Appendix 6: HSQC-TOCSY of Trimannoside (43).................................................. 213

Appendix 7: HMBC of Trimannoside (43) ............................................................... 214

7

LIST OF TABLES AND FIGURES

Figure 1.1 The structures of asparagine N-linked to GlcNAc (1) and serine O-linked to

GalNAc(2). ...................................................................................................................... 28

Figure 1.2 Proposed mechanism for amide activation towards glycans.15

..................... 29

Figure 1.3 N-linked glycosylation pathway of a correctly folded protein. Solid lines

represent the reactions common to all N-linked glycoproteins. Dashed lines show one of

the many possible routes through the Golgi, producing a complex N-linked glycan.12

. 31

Figure 1.4 Examples of N-linked glycan types: high mannose (3), complex (4) and

hybrid (5). ........................................................................................................................ 32

Figure 1.5 Examples of the initial steps in mucin type O-linked glycan synthesis. The

Tn-antigen (6) can be converted to sialyl Tn-antigen (7) by the enzyme ST6GalNAc.

Alternatively the Tn-antigen can be converted to mucin core 1 (8) or core 3 (9)

structures by enzymes C1GalT and C3GnT respectively. .............................................. 34

Figure 1.6 The 8 core structures of mucin type, O-linked glycans. ............................... 35

Figure 1.7 Structures (10-12) of O-linked glycans identified in mouse colon tissue.32

. 35

Figure 1.8 The structure of Urdamycin A (13). Carbohydrate components are shown in

red. ................................................................................................................................... 37

Figure 1.9 The structure of an anti ovarian cancer vaccine. Carbohydrate component is

shown in red. MUC5AC corresponds to a peptide linker. KLH = Keyhole limpet

hemocyanin, a commonly used immunogenic protein.46

................................................ 38

Figure 1.10 An example of lectin-directed enzyme-activated therapy (LEAPT). In this

case the enzyme is rhamnosidase and the drug released is 5-flurouracil (15).56

............. 40

Figure 1.11 The structure of mannose-6-phosphate (16). .............................................. 40

Figure 1.12 Examples of the polyvalent presentation of lectins and carbohydrates. A)

Cell-cell/cell-surface interaction. B) The separation of glycoproteins by lectin affinity

chromatography............................................................................................................... 42

8

Figure 1.13 Some of the most widely used classes of glycoconjugate scaffold. A)

Linear glycopolymers. B) Glycodendrimers. C) Glycosylated nanoparticles. D)

Neoglycoproteins. Green circles represent glycans. ....................................................... 45

Figure 1.14 Chemical structures of glucoside (17) and galactoside (18). Hydroxyl group

attached to C4 shown in red. ........................................................................................... 46

Figure 1.15 The native chemical ligation (NCL) of two synthetic peptides to form a

natural peptide bond. ....................................................................................................... 48

Figure 1.16 General scheme for the native chemical ligation of peptides to form natural

peptide linkages that do not contain cysteine. ................................................................. 49

Figure 1.17 Examples of reagents which can be used to modify lysine side chains and

their products. .................................................................................................................. 51

Figure 1.18 The bioorthogonal reaction of a ketones with aminooxy compounds or

hydrazine compound to form stable oxime or hydrazone linkages respectively. ........... 52

Figure 1.19 Examples of “click” chemistry cycloaddition reactions between azides and

alkenes or alkynes. .......................................................................................................... 52

Figure 1.20 Examples of unnatural amino acids suitable for “click” chemistry reactions;

azidohomoalanine (19), p-Azido-L-phenylalanine (20), homopropargylglycine (21),

homoallylglycine (22) and two examples of UAAs utilising strain promoted reaction

technology (23 and 24).................................................................................................... 53

Figure 1.21 Summary of commonly used methods of glycosylating cysteines.125

........ 54

Figure 1.22 The formation of GFP’s fluorophore. Fluorophore shown in red............... 55

Figure 1.23 Ribbon diagram of GFP showing the β sheets in yellow, α helix in red,

fluorophore in blue and loops in green. .......................................................................... 56

Figure 1.24 Ribbon diagram of the crystal structure of GFPuv with three amino acids

(E6, C48 and I229) residues highlighted (in yellow). ..................................................... 58

Figure 2.1 Binding of a hexahistidine tagged protein to an immobilised metal affinity

column. ............................................................................................................................ 63

Figure 2.2 Schematic representation of the cloning of GFPuv into a pET-30a vector. . 64

9

Figure 2.3 The additional amino acid sequence introduced on to the N-terminus of

GFPuv. Hexahistidine tag is shown in red and the GFPuv section is shown in green. .. 65

Figure 2.4 Schematic representation of the inverse PCR method for the C48A mutation.

......................................................................................................................................... 65

Figure 2.5 Comparison of the products of the inverse PCR (Inv 1 and Inv 2) with the

GFPuv sequence around the C48A mutation site. Repeat units of the forward primer

used in the PCR are highlighted in green. ....................................................................... 66

Figure 2.6 Schematic representation of the Quickchange site directed mutagenesis

method for the C48A mutation. ...................................................................................... 67

Figure 2.7 Schematic representation of how homologous genes can be combined in a

primerless PCR to create new chimeric genes for screening. ......................................... 68

Figure 2.8 Amino acid sequence of the sGFPuv_C48A gene purchased for DNA

shuffling experiments. Amino acids highlighted in red correspond to the residues

exchanged for cysteine in the Shuffle 1 gene.................................................................. 70

Figure 2.9 Example expression plate containing transformants from DNA shuffle

products. Highlighted section on the left is enlarged on the right. ................................. 70

Figure 2.10 Summary of the active, GFPuv mutants discovered by the DNA shuffling.

Each column corresponds to a new gene. White sections correspond to segments of

sGFP_C48A and the green sections correspond to segments of Shuffle 1. Naturally

occurring C48 has been highlighted yellow. The mutant names correspond to their

library designation. .......................................................................................................... 71

Figure 2.11 Summary of the 12 inactive GFPuv mutants screened. Each column

corresponds to a new gene. White sections correspond to segments of sGFPuv_C48A

and the green sections correspond to segments of Shuffle 1. Naturally occurring C48

has been highlighted yellow. The mutant names correspond to their library designation.

......................................................................................................................................... 73

Figure 2.12 SDS-PAGE gels of the samples taken from cultures expressing

GFPuv_WT at 22, 30 at 37°C. From left to right the lanes correspond to; protein ladder,

0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h and 24 h after induction..................................... 74

10

Figure 2.13 Western blots of the samples taken from cultures expressing GFP_WT at

22, 30 at 37°C. From left to right the lanes correspond to 0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h,

7 h, 8 h and 24h after induction....................................................................................... 75

Figure 2.14 The mass of GFPuv_WT purified relative to total cell mass and total

soluble protein produced. Data relating to 400 mL cultures grown at 37°C until an OD

of 0.7 was reached followed by protein expression at different temperatures. ............... 75

Figure 2.15 A) SDS gel of selected fractions collected after IMAC column. B) The 96-

deep well plate in which the samples were collected. C) The 96-deep well plate in which

the samples were collected illuminated by blue light and viewed through a light filter. 77

Figure 2.16 A) SDS-PAGE gel of fluorescent fractions collected from anion exchange

chromatography of GFPuv_WT. B) SDS-PAGE gel of fluorescent fractions collected

from size exclusion chromatography of GFPuv_WT. .................................................... 78

Figure 2.17 SDS of all mutants purified by stepwise IMAC purification. From left to

right the lanes contain 5 μg of mutants B10, C5, D1, C5, D1, D5, F1, F11, G1, G3, S6,

E6C and I229C. ............................................................................................................... 79

Figure 2.18 Deconvoluted MS of GFPuv_E6C_I229C from 10000-70000 Da after

stepwise IMAC. .............................................................................................................. 80

Figure 3.1 The use of aminoethyl mannoside (27) in carbohydrate arrays and in the

synthesis of glycopeptides. (a) The reaction of amino ethyl mannoside with an activated

array surface. (b) The conversion of amino ethyl mannoside in to an α-halo carbonyl

compound capable of reacting with thiols. (c) The reaction of the activated mannoside

(28) with a cysteine (25) containing peptide. .................................................................. 82

Figure 3.2 Synthesis of aminoethyl mannoside (27). (a) Ac2O in pyridine. (b) BnNH2 in

THF. (c) Cl3CCN, K2CO3 in Dichloromethane (DCM). (d) N-Cbz-aminoethanol,

TMSOTf in DCM. (e) NaOMe in MeOH. (f) Pd/C, H2 in MeOH. (g) N-Cbz-

aminoethanol, BF3.Et2O in DCM. ................................................................................... 84

Figure 3.3 Structures of aminoethyl glucose (32), aminoethyl galactose (33) and

aminoethyl GlcNAc (34). ................................................................................................ 84

11

Figure 3.4 Summary of glycosylation reactions performed on peracetylated

monosaccharides (30, 35-37). ......................................................................................... 85

Figure 3.5 Retrosynthetic analysis of trimannoside (41), demonstrating how it can be

synthesised from aminoethyl mannoside (42) and a mannosyl donor. ........................... 86

Figure 3.6 Structure of mannosyl acceptor (42) with carbon numbering labelled in red.

......................................................................................................................................... 87

Figure 3.7 The reaction of sodium periodate with a mixture of trimannosides (43-45) 88

Figure 3.8 The synthesis of acetobromo mannose (46) from peracetyl mannose (30). . 89

Figure 3.9 The reaction of aminoethyl mannoside (42) with acetobromo mannose (46)

to form a mixture of mannosides including the trimannoside (43). ................................ 89

Figure 3.10 Structure of trimannoside (43) with carbohydrate carbon atoms labelled. . 90

Figure 3.11 A section of a non-decoupled HSQC of trimannoside (43) showing the

coupling of the anomeric protons with their respective carbons..................................... 91

Figure 3.12 Section of a HMBC spectrum showing the coupling of C3 to H1’ in

trimannoside (43). ........................................................................................................... 91

Figure 3.13 The deacylation of trimannoside (43) to trimannoside (47) using sodium

methoxide in methanol. ................................................................................................... 92

Figure 3.14 The hydrogenation of trimannoside (47) to trimannoside (48) using a Pd/C

catalyst in water............................................................................................................... 92

Figure 3.15 Structures of tetramannosides (48 and 49) and pentamannoside (50). ....... 93

Figure 3.16 Conversion of aminoethyl mannoside (27) in to mannosyl iodoacetamide

(28) via reaction with iodoacetic anhydride in sodium bicarbonate buffer. ................... 95

Figure 3.17 Structure of aminoethyl lactose (51) donated by Dr R. Sardzik (The

University of Manchester)............................................................................................... 95

Figure 3.18 structures of glycosyl iodoacetamides produced; mannosyl iodoacetamide

(28), glucosyl iodoacetamide (52), galactosyl iodoacetamide (53), glucosamine

iodoacetamide (54) and lactosyl iodoacetamide (55)...................................................... 96

12

Table 3.1 Summary of HRMS data of glycosyl iodoacetamides produced; mannosyl

iodoacetamide (28), glucosyl iodoacetamide (52), galactosyl iodoacetamide (53),

glucosamine iodoacetamide (54) and lactosyl iodoacetamide (55). ............................... 96

Figure 4.1 The chemical glycosylation of a peptide with an iodoacetamide, under

conditions originally reported.181

.................................................................................... 99

Figure 4.2 A) The acquired spectrum of horse heart myoglobin (HHM), containing the

multiply charged protein peaks of the “charge envelope.” B) The deconvoluted

spectrum of HHM produced by MassLynx 4.0. ............................................................ 100

Table 4.1 Calculated and measure mass values for GFPuv mutants and horse heart

myoglobin (HHM). ....................................................................................................... 101

Figure 4.3 A) The ESI mass spectrum of GFPuv_E6C before to treatment with TCEP.

B) The ESI mass spectrum of the same sample of GFPuv_E6C after treatment with

TCEP. ............................................................................................................................ 103

Figure 4.4 The reaction of mutant GFPuv_E6C with iodoacetamide in ammonium

carbonate buffer. ........................................................................................................... 104

Figure 4.5 Deconvoluted mass spectra (31700-32100 Da) of samples taken from the

reaction of 0.1 mM GFPuv_E6C_I229C with 1 mM iodoacetamide (56). A) Mass

spectrum after 0 hours. B) Mass spectrum after 1 hour. C) Mass spectrum after 5 hours.

D) Mass spectrum after 24 hours. ................................................................................. 105

Table 4.2 Summary of the results of the reaction of four GFP mutants (0.1 mM) with

iodoacetamide (56) (1 mM) over 24 hours. In each case the mass corresponds to the

only significant peaks present in the mass spectra. ....................................................... 106

Figure 4.6 The finalised procedure for glycosylation of all GFPuv mutants. .............. 107

Figure 4.7 UV (205 nm) trace of a typical LCMS run of a GFPuv mutant. ................ 108

Table 4.3 Calculated and measure mass values for GFPuv mutants and HHM using an

Agilent 1100, HPLC system coupled to an Agilent 1100 LC/MSD SL quadrupole mass

spectrometer. ................................................................................................................. 109

Figure 4.8 A) Measured mass spectrum of GFPuv_C5. B) The deconvoluted molecular

ion peak of GFPuv_C5. B) Measured mass spectrum of GFPuv_C5 after reaction with

13

mannosyl iodoacetamide (28). D) The deconvoluted molecular ion peak of GFPuv_ C5

after reaction with mannosyl iodoacetamide (28). ........................................................ 110

Figure 4.9 The structure of 3,3 -dithiobis(sulfosuccinimidylpropionate) DTSSP.

Produced by ................................................................................................................... 111

thermo scientific as a reversible protein crosslinker. .................................................... 111

Figure 4.10 The reaction of GFPuv with DTSSP followed by the reduction of the

disulfides within the crosslinkers by TCEP to give thiol modified lysines. ................. 112

Figure 4.11 MALDI spectra of GFPuv_WT (blue), GFPuv_CL (GFPuv_WT after

treatment with DTSSP followed by reduction with TCEP) (red) and GFP_CL_Man10

(GFPuv_WT derivatised with approximately 10 mannosides) (green). ....................... 113

Figure 5.1 Structures of aminoethyl mannosides (27 and 41) used for glycotransferase

screening. ...................................................................................................................... 116

Figure 5.2 The natural action of N-acetylglucosaminyltransferase (GnT-I) on the N-

glycan core structure Man5GlcNAc2 (58)...................................................................... 117

Figure 5.3 The natural action of protein-O-mannose N-acetylglucosaminyltransferase I

(POMGnT-I) on an O-linked glycopeptides. ................................................................ 117

Figure 5.4 Known substrates for GnT-I (donated by Dr. S. Gluchowska, Trinity College

Dublin). Mannotriose-di-(N-acetyl-D-glucosamine) (60) and 3α,6α-mannotriose (61)

(commercially available from Sigma). .......................................................................... 118

Figure 5.5 MALDI-TOF spectrum of a 1:4 (linker:spacer) SAM on gold. A = mass

peak corresponding to a spacer-spacer homodimer. B = mass peak corresponding to a

spacer-linker heterodimer.............................................................................................. 119

Figure 5.6 The reaction of trimannoside (41) with an activated SAM on a gold plate to

form a carbohydrate array. ............................................................................................ 120

Figure 5.7 MALDI-TOF MS spectrum of trimannoside (41) carbohydrate array. A =

mass peak corresponding to a spacer-spacer homodimer. B = mass peak corresponding

to a spacer-linker heterodimer. C = peak corresponding to a heterodimer covalently

bound to trimannoside (41). .......................................................................................... 121

14

Figure 5.8 MALDI-TOF MS spectrum of mannoside (27) carbohydrate array. A = mass

peak corresponding to a spacer-spacer homodimer. B = mass peak corresponding to a

spacer-linker heterodimer. D = peak corresponding to a heterodimer covalently bound

to mannoside (27). ......................................................................................................... 122

Figure 5.9 A) MALDI-TOF spectrum of trimannoside (41) attached to a SAM on gold.

B) MALDI-TOF spectrum of trimannoside (41) attached to a SAM on gold after

treatment with GnT-I and UDP-GlcNAc. R= SAM spacer-linker hetrodimer. ........... 123

Figure 5.10 Structure of aminoethyl sialyllactose (63). ............................................... 125

Figure 5.11 The reaction of immobilised lactose with fetuin in the presence of trans-

sialidase (TcTs) enzyme to produce immobilised sialyllactose. ................................... 125

Figure 5.12 A) Deconvoluted mass sprectum of GFPuv_I229C. B) Deconvoluted mass

spectrum of GFPuv_I229C_Lac. .................................................................................. 126

Figure 5.13 Mass spectra of samples taken from the reaction of trans-sialidase (TcTs)

with GFPuv_I229C_Lac in the presence of fetuin. A) Reaction after 30 minutes. B)

Reaction after 1 hour. C) Reaction after 2.5 hours. ...................................................... 127

Figure 6.1 Schematic diagram of the lectin plate assay. The protein avidin (red) is

covalently bound to the surface of a 96-well plate, which enables the capture of

biotinylated lectins (blue). Glycosylated GFPuv mutants can then interact with the

immobilised lectins. ...................................................................................................... 131

Figure 6.2 The results of screening the interactions of unglycosylated, mannosylated

and galactosylated GFPuv mutants against streptavidin coated 96-well plates. Samples

are grouped according to their number of glycosylation sites. ..................................... 133


and galactosylated GFPuv mutants against ConA coated 96-well plates. Samples are

grouped according to their number of glycosylation sites. ........................................... 135


and galactosylated GFPuv mutants against GNL coated 96-well plates. Samples are


15


and galactosylated GFPuv mutants against jacalin coated 96-well plates. Samples are


Figure 6.6 Ideal ITC plots. A) The raw data obtained from an ideal series of injections.

B) An ideal plot of the molar energy changes for a bivalent (N = 2) interaction. ........ 141

Figure 6.7 Equations for calculating Gibb’s free energy. R = The molar gas constant

8.314 J mol-1 K-1, T = The temperature in Kelvin. ..................................................... 141

Figure 6.8 Calorimetric data obtained from titration of native ConA (32 μM) with Me-

α-Man (5 mM). A) Raw data from 30 injections of 1 μL each of Me-α-Man into ConA.

B) Integrated curve showing the line of best fit. ........................................................... 143

Figure 6.9 Calorimetric data obtained from titration of native ConA (22 μM) with

GFPuv_C5_Man4 (240 μM). A) Raw data from 30 injections of 1 μL each of

GFPuv_C5_Man4 into ConA. B) Integrated curve showing the line of best fit. .......... 145

Figure 6.10 Raw calorimetric data from 30 injections of 1 μL each of: A) ITC buffer

into ITC buffer. B) GFPuv_C5 (240 μM) into ConA (22 μM). .................................... 146

Table 8.1 The PCR program used for in vitro DNA amplification. ............................. 157

Table 8.2 The PCR program used for site directed mutagenesis. ................................ 159

Table 8.3 The PCR program used for inverse PCR site directed mutagenesis. ........... 161

Table 8.4 The three genes (Shuffle 1-3) designed for DNA shuffle cysteine screen of

GFPuv. Numbers correspond to the amino acids to be substituted for cysteine in each

gene. .............................................................................................................................. 162

Table 8.5 The PCR program used for the DNA shuffle. .............................................. 164

Table 8.6 The PCR program used for the amplification of the DNA shuffle products.

....................................................................................................................................... 165

Figure 8.1 The reaction of mannose (29) with acetic anhydride to form peracetyl

mannose (30). ................................................................................................................ 170

Figure 8.2 The reaction of peracetylated mannose (30) with benzyl N-(2-hydroxyethyl)-

carbamate to form mannoside (31). .............................................................................. 171

16

Figure 8.3 The deprotection of mannoside (31) with NaOH and MeOH to give

mannoside (27). ............................................................................................................. 172

Figure 8.4 The hydrogenation of mannoside (42) using a Pd/C catalyst and hydrogen

gas to give mannoside (27). .......................................................................................... 173

Figure 8.5 The reaction of Peracetyl β-D-glucopyranose (36) and N-Cbz-ethanolamine

to produce glucoside (39). ............................................................................................. 174

Figure 8.6 The deprotection of glucoside (39) with NaOH in MeOH to produce

glucoside (64). ............................................................................................................... 175

Figure 8.7 The hydrogenation of glucoside (39) using a Pd/C catalyst and hydrogen gas

to produce glucoside (32). ............................................................................................. 175

Figure 8.8 The reaction of peracetyl β-D-galactose (37) with N-Cbz-ethanolamine to

produce galactoside (40). .............................................................................................. 176

Figure 8.9 The deprotection of galactoside (40) using NaOH in MeOH to form

galactoside (65). ............................................................................................................ 177

Figure 8.10 The hydrogenation of galactoside (65) using a Pd/C catalyst and hydrogen

gas to produce galactoside (33). .................................................................................... 178

Figure 8.11 The reaction of β-D-Glucosamine pentaacetate (35) with of N-Cbz-

ethanolamine to produce glucoside (38). ...................................................................... 179

Figure 8.12 The deprotection of glucoside (38) using NaOH and MeOH to produce

glucoside (66). ............................................................................................................... 180

Figure 8.13 The hydrogenation of glucoside (66) using a Pd/C catalyst and hydrogen

gas to produce glucoside (34). ...................................................................................... 181

Figure 8.14 Activation of aminoethyl mannoside (27), for reaction with cysteines, via

reaction with iodoacetic anhydride to produce glycosyl iodoacetamide (28). .............. 182

Figure 8.15 The reaction of peracetyl mannose (30) with HBr to produce acetobromo

mannoside (46). ............................................................................................................. 182

Figure 8.16 The reaction of acetobromo mannoside (46) and mannoside (42) to produce

trimannoside (43). ......................................................................................................... 183

17

Figure 8.17 The numbering scheme used for the assignment of NMR spectra of

trimannoside (43). ......................................................................................................... 185

Table 8.7 1H and

13C chemical shifts of the atoms found in the carbohydrate constituent

of trimannoside (43). Additional signals are listed below a long with the remaining

characterisation undertaken. .......................................................................................... 186

Figure 8.18 A section of a multiplicity edited HSQC of trimannoside (43). ............... 186

Figure 8.19 The deprotection of trimannoside (43) with NaOH and MeOH to produce

trimannoside (47). ......................................................................................................... 187

Figure 8.20 The hydrogenation of trimannoside (47) using a Pd/C catalyst and

hydrogen gas to produce trimannoside (41). ................................................................. 188

Figure 8.21 The structures of polymannoside side products 48, 48 and 50. ................ 189

18

ABBREVIATIONS

2-NBDG 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-deoxyglucose

ASGPR Asialoglycoprotein receptor

Aq Aqueous

BCA Bicinchoninic acid

C1GalT GalNAc 3-beta-galactosyltransferase

C3CnT GalNAc 3-beta-galactosyltransferase

ConA Concanavalin A

DCM Dichloromethane

DMSO Dimethyl sulfoxide

DTSSP 3,3 -dithiobis (sulfosuccinimidylpropionate)

DTT Dithiothreitol

EDC N-ethyl-N’-(dimethylaminopropyl)-carbodiimide

ER Endoplasmic reticulum

ERAD Endoplasmic-reticulum-associated protein degradation

ESI Electrospray ionisation

d.p. Decimal place

Fuc Fucose

Gal Galactose

GalNAc N-Acetylgalactosamine

GFP Green fluorescent protein

GFPuv Green fluorescent protein (ultraviolet)

19

Glc Glucose

GlcNAc N-Acetylglucosamine

GNL Galanthus nivalis lectin

GnT-1 N-Acetylglucosaminyltransferase I (GnT-I)

GPI Glycosyl phosphatidyl inositol

HHM Horse heart myoglobin

HIV Human immunodeficiency virus

HMPT Hexamethylphosphorous triamide

HPLC High performance liquid chromatography

IMAC Immobilised metal affinity chromatography

IPTG Isopropyl β-D-1-thiogalactopyranoside

ITC Isothermal titration calorimetry

KLH Keyhole limpet hemocyanin

Lac Lactose

LCMS Liquid chromatography–mass spectrometry

LEAPT Lectin-directed enzyme-activated therapy

Lit. Literature value

MALDI-TOF Matrix-assisted laser desorption/ionisation-time of flight

Man Mannose

Mol eq Mole equivalents

MS Mass spectrometry

MSH O-mesitylenesulfonylhydroxylamine

20

Neu5Ac N-acetylneuraminic acid

NCL Native chemical ligation

NHS N-hydroxysuccinimide

ON Over night

PCR Polymerase chain reaction

PBS Phosphate buffered saline

PEG Polyethylene glycol

POMGnT-1 Protein-O-mannose N-acetylglucosaminyltransferase I

r.t. Room temperature

SAM Self assembled monolayer

Sat. Saturated

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

Siglecs Sialic acid-binding immunoglobulin-type lectins

ST6GalNAc α-2-6-sialyltransferase

TCEP Tris(2-carboxyethyl)phosphine

TcTs Transialidase

TOF Time of flight

UAA Unnatural amino acids

UDP Uridine diphosphate

UV Ultra violet

WT Wild type

21

EXPLANATORY NOTES

Mutant List

WT = GFPuv with N-terminal hexahistidine tag (NB all following mutants were derived

from this construct)

E6C = E6C

C48A = C48A

I229C = I229C

E6C_C48A = E6C, C48A

E6C_I229C = E6C, I229C

E6C_C48A_I229C = E6C, C48A, I229C

B10 = C48A, S202C, N212C, I229C

C5 = S30C, T38C, T43C, K52C

D1 = C48A, I229C

D4 = C48A, I229C

D5 = T38C, T43C

F1 = C48A, S202C

F11 = K52C

G1 = C48A, L221C, I229C

G3 = C48A, N105C, I188C

S6 = L15C, T38C, T43C, C48A, K52C

C5+2 = E6C, S30C, T38C, T43C, K52C, I229C

CL = WT modified with the cross linker DTSSP

22

ABSTRACT

The interactions of glycoconjugates with carbohydrate binding proteins are responsible

for a wide range of recognition events in vivo; including immune response, cell

adhesion and signal transduction. Glycoconjugates have already found many medicinal

uses as therapeutic and diagnostic agents, but their full potential is yet to be realised.

Access to a variety of homogeneously glycosylated glycoproteins is essential for the

study of these important carbohydrate binding events. This requires the chemical

synthesis and attachment of biologically relevant glycans to unglycosylated protein

scaffolds in a site selective manner.

Here we describe the use of a range of glycosyl iodoacetamides to glycosylate proteins

selectively via their cysteine residues. We have chosen the green fluorescent protein

mutant GFPuv for use as a protein scaffold due its known tolerance of two cysteine

mutations (E6C and I229C) and the previous successful derivatisation of these cysteines

with iodoacetamides.1 The inherent fluorescence of GFPuv also makes it a useful

candidate for fluorescence based binding assays or cell labelling studies.

16 active, mutants of GFPuv were created using a mixture of site directed mutagenesis

and DNA shuffling (including one mutant containing six reactive cysteine residues).

This was achieved by producing random combinations of two synthetic variants of

GFPuv, one of which contained 33 surface cysteines. 94 bacterial colonies expressing

active GFPuv were then sequenced and the new chimeric genes analysed.

Four monosaccharides and one trisaccharide (N-glycan core mimic) suitable for the

chemical glycosylation via cysteines were synthesised and successfully used to create a

selection of homogeneous neoglycoproteins. These neoglycoproteins were

demonstrated to interact differently with different lectins (including ConA, GNL and

Jacalin) in a qualitative fluorescence based assay. Interactions were shown to vary with

glycan structure, position of glycosylation sites and the number of glycosylation sites.

23

DECLARATION

I hereby declare that no portion of the work referred to in the thesis has been submitted

in support of an application for another degree or qualification of this or any other

university or other institute of learning.

24

COPYRIGHT STATEMENT

i. The author of this thesis (including any appendices and/or schedules to this

thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he

has given The University of Manchester certain rights to use such Copyright,

including for administrative purposes.

ii. Copies of this thesis, either in full or in extracts and whether in hard or

electronic copy, may be made only in accordance with the Copyright, Designs

and Patents Act 1988 (as amended) and regulations issued under it or, where

appropriate, in accordance with licensing agreements which the University has

from time to time. This page must form part of any such copies made.

iii. The ownership of certain Copyright, patents, designs, trade marks and other

intellectual property (the “Intellectual Property”) and any reproductions of

copyright works in the thesis, for example graphs and tables (“Reproductions”),

which may be described in this thesis, may not be owned by the author and may

be owned by third parties. Such Intellectual Property and Reproductions cannot

and must not be made available for use without the prior written permission of

the owner(s) of the relevant Intellectual Property and/or Reproductions.

iv. Further information on the conditions under which disclosure, publication and

commercialisation of this thesis, the Copyright and any Intellectual Property

and/or Reproductions described in it may take place is available in the

University IP Policy (see http://documents.manchester.ac.uk/

DocuInfo.aspx?DocID=487), in any relevant Thesis restriction declarations

deposited in the University Library, The University Library’s regulations (see

http://www.manchester.ac.uk/library/aboutus/regulations) and in The

University’s policy on Presentation of Theses

25

ACKNOWLEDGEMENTS

Firstly I would like to thank my PhD supervisor Prof. Sabine L. Flitsch for her support,

guidance and inspiration over the past four years. I would also like to thank all members

of the Turner and Flitsch research groups for their help and advice in the lab. Special

thanks to Dr Robert Sardzik for his invaluable assistance with the chemical aspects of

this project and to Prof Josef Vogelmiere for his crash course in molecular biology.

Many thanks also to D. Adri Botes, Oxyrane and the EPSRC funding council for

making this project possible.

I am very grateful for the technical expertise and help I have received from Reynard

Spiess (HRMS and Protein ESI-MS) and Matthew Cliff (NMR).

I would also like to thank my family for their unwavering support and encouragement

over the last four years. As well as providing a much needed sense of perspective

throughout.

Finally many thanks to my wonderful wife Dr. Hannah Reed for her patience, love and

support throughout the last several years. It is difficult to imagine how much more of a

challenge it would have been without her.

26

Chapter 1: Introduction

CHAPTER 1

27

1.1 Protein Glycosylation

Glycosylation has been known to play a vital role in protein function for decades, but

for some time the reasons for these carbohydrate derivatisations was the subject of

debate. Some theories suggested protein glycosylation function was predominantly for

structural or stability enhancement, while others focused more on immunological and

cell signalling roles. In 1965 Edwin H. Eylar hypothesised that glycosylation played a

role in protein trafficking and that the primary structure of the protein would determine

the glycosylation sites.2 This hypothesis, like the many other suggestions for the

function of protein glycosylation is now known to be true. The remarkable versatility of

the carbohydrates and their biological roles was aptly summarised in the title of a

review by Ajit Varki in 1993; “All of the theories are correct”.3 This review is currently

the most citied article from Glycobiology and concludes that it is unlikely that a theory

for predicting any given glycan’s function, purely from its structure is possible; because

it is likely to have multiple functions and that these may alter according to its biological

environment.

Glycosylation is now known to play a vast number of roles, from altering

physiochemical properties of proteins such as conformation, solubility and stability, to

more sophisticated interactions such as protein trafficking, cell signalling and immune

response.3,4

A range of extremely specialised functions of glycoconjugates have also be

discovered including heavily glycosylated proteins, which prevent the nucleation of ice

in some arctic fish. This biological antifreeze allows them to survive in waters as cold

as -2°C without cellular damage.5 A layer of glycans is also crucial in the protection of

lysosomal membrane proteins such as LAMP-1 and LAMP-2, from degradation by the

hydrolytic enzymes they contain.6

Examples such as these demonstrate the extreme

versatility of glycoconjugation in nature and there have been several reviews in this area

over the years.4,7,8

An increasing amount of research is being dedicated to carbohydrate

synthesis and carbohydrate-binding protein interactions and subsequently the

importance of the field of glycobiology continues to grow.

CHAPTER 1

28

1.1.1 Types of Protein Glycosylation

In nature, carbohydrates (or glycans) can be attached to proteins in a number of ways.

Random glycation can occur if the concentrations of reducing sugars become too high,

however this is only significant in certain disease states, such as diabetes.9 Glycans are

usually attached to proteins enzymatically, which can occur in one of three ways; N-

linked, O-linked or attached to the C-terminus. This C-terminus linkage is used to attach

a glycosyl phosphatidyl inositol (GPI) anchor to proteins. These glycolipids anchor their

proteins to cell membranes. However, as GPI anchors are not linked to proteins via

glycosidic bonds these are generally not considered to be a true glycosylation.6,10

N-linked proteins are linked to their glycans through the nitrogen of the amide side

chain of asparagine. This linkage is always made to N-acetylglucosamine (GlcNAc)

which is then linked to the rest of the glycan. The structure of GlcNAc N-linked to an

asparagine (1) is shown in figure 1.1. O-linked proteins are linked to their glycans

through the oxygen atom of a hydroxyl group of serine, threonine, hydroxylysine or

hydroxyproline. This linkage can be made with a range of different monosaccharides

but is often to N-acetylgalactosamine (GalNAc). The structure of serine O-linked to

GalNAc (2) is also shown in figure 1.1.6 About 90% of known glycoproteins carry N-

linked glycans, many of these proteins also feature some O-linked glycans and only

10% of known glycoproteins carry purely O-linked glycans.11

Large glycans can extend

over 3 nm from their protein’s surface and effectively act as separate domains, whilst

others work together with their proteins to interact with other biomolecules.12

Figure 1.1 The structures of asparagine N-linked to GlcNAc (1) and serine O-linked to GalNAc(2).

CHAPTER 1

29

1.1.2 N-Linked Glycosylation

Despite the incredible diversity in N-linked glycan structures, they all share some

common features due to their synthetic origin. Initially a 14-saccharide core, containing

three glucose (Glc), nine mannose (Man) and two GlcNAc monomers is synthesised as

a precursor attached to the endoplasmic reticulum (ER) membrane. As proteins are

formed in the lumen of the ER an oligosaccharyltransferase attaches this core structure

to any Asn-X-Ser/Thr (X = any amino acid except Pro) sequon it recognises.13,14

As

well as recognising this relatively short sequon the active site of this enzyme contains

several negatively charged amino acid side chains. These side chains are believed to

hold the amide group of asparagine in such a position that the lone pair of the nitrogen

can no longer conjugate with the neighbouring carbonyl group (figure 1.2).15

This

would allow it to perform a nucleophilic attack on GlcNAc, which would not otherwise

be possible.

Figure 1.2 Proposed mechanism for amide activation towards glycans.15

This family of enzymes, unlike many other oligosaccharyltransferases, has a very broad

specificity towards different polypeptide substrates so these core N-linked glycans are

attached to the large majority of proteins as they synthesised. However this N-

glycosidic bond formation is only 90% efficient, which leads to some heterogeneity in

the population of glycosylated products or glycoforms of the same protein.16

CHAPTER 1

30

After the initial addition of the 14-saccharide core structure two terminal Glc units are

sequentially removed by ER glucosidases I and II respectively as shown in figure 1.3.

The resulting mono glucosylated glycan is recognised by the protein chaperones,

calnexin and calreticulin, which aid protein folding. Glucosidase II then removes the

one remaining Glc unit leaving a high Man glycan, which is recognised by ER

glucosyltransferase. This enzyme is able to recognise proteins folded incorrectly or

incompletely and will reattach a Glc unit if this is the case, preventing it from leaving

the calnexin-calreticulin cycle.14,17

Proteins that fail to fold correctly are removed at this point and recycled via the

Endoplasmic-reticulum-associated protein degradation (ERAD) patway.18

ER-

mannosidase I removes the α(1-2) linked Man from the α(1-3) branch of core N-linked

glycans to leave a 10-saccharide (eight Man and two GlcNAc monomers) structure

shown in figure 1.3. This enzyme acts on most glycans before leaving the ER but is also

thought to be part of the signal for ERAD. Due to its relatively low rate of activity it

could limit the amount of times a protein can participate in the calnexin-calreticulin

cycle before it is recycled. To ensure only unwanted peptides are digested they are first

removed to the cystol to be broken down by 26S proteasomes.14,19

CHAPTER 1

31

Figure 1.3 N-linked glycosylation pathway of a correctly folded protein. Solid lines represent the

reactions common to all N-linked glycoproteins. Dashed lines show one of the many possible routes

through the Golgi, producing a complex N-linked glycan.12

Correctly folded proteins are then transported to the Golgi apparatus where more Man

trimming occurs along with many other modifications that lead to the variety of

different N-linked glycan structures which are present throughout the rest of the cell.

These structures can include a large variety of different monosaccharides including:

galactose (Gal), fucose (Fuc), and N-acetylneuraminic acid (Neu5Ac). Glycoproteins

can spend up to 15 minutes travelling through the whole stack of Golgi towards the cell

surface.12

Unlike the ER, all of the Golgi’s enzymes are membrane bound which

enables a range of different glycosylation pathways to occur simultaneously.20

Mature

N-linked glycans are divided into three different groups; high mannose, complex and

hybrid. Examples of these three classes of N-linked glycans are shown in figure 1.4

(structures 3-5 respectively).6

CHAPTER 1

32

N-linked glycosylation plays a crucial role in the folding process of large proteins,

allowing structures that would not otherwise be stable to form.21

The direct effect of N-

linked glycosylation is to favour certain conformations in the nearby peptide chain

which often induces the formation of a β-turn.22

A third of all N-linked glycosylation

sites occur on β-turns, which suggests that this is an important function.23,24

The polar

nature of glycans solubilises proteins, which helps to prevent aggregation of non folded

proteins and also orientates unfolded segments towards the rest of the protein.12

Figure 1.4 Examples of N-linked glycan types: high mannose (3), complex (4) and hybrid (5).

1.1.3 O-Linked Protein Glycosylation

O-linked glycosylation often occurs in the Golgi, when proteins are already folded. The

biosynthesis of O-linked glycans is quite different from N-linked glycans and less well

understood. Often glycosylation sites are clustered together in contrast to N-linked sites,

which are usually dispersed. Also unlike N-glycosylation there is no universal amino

acid sequon for O-glycosylations making it very difficult to predict where they will

occur.6,25

Statistical studies have come up with some general rules for when O-linked

glycosylation may occur:26

1. O-linked glycosylation sites are tissue specific due to different isoforms of

glycotransferases being present.

CHAPTER 1

33

2. Only exposed residues can be glycosylated by these enzymes because it is a post

folding event.

3. Threonines are more likely to be glycosylated than serines.

4. Regions rich in proline and valine are more likely to be glycosylated.

Many other observations have been made; for example tryptophan is never found

adjacent to an O-linked glycosylation site and proline is often found at positions –1

and +3 in relation to O-linked glycosylation sites. All of these observations have been

used to develop computer programs that are making the prediction of O-linked

glycosylation sites increasingly accurate.26

Some tissue specific sequences have been

identified and the enzymes involved in O-linked glycosylations are generally more

protein specific than with N-linked glycosylations. For example O-linked Fuc in the

epidermal growth factor domains occurs at a serine or threonine in the sequence -Cys-

X-X-Gly-Gly-Thr/Ser-Cys- and O-linked Gal in collagen occurs on a hydroxylysine in

the sequence –Gly-Xaa-Hyl-Gly.27,28

Unlike N-linked glycans which all begin as a 14-saccharide core structure, O-linked

glycans are built sequentially on their proteins, one monomer at a time. The most

common type of O-linked glycosylation in higher eukaryotes are known as mucin type

glycans, which were originally found on mucin proteins but can also occur on other

proteins. Mucin type glycans are characterised by beginning with a GalNAc linked to a

serine or threonine. In other non-mucin type O-linked glycosylations the

monosaccharide linking the glycan to its protein can also be Fuc, Man, Glc, GlcNAc,

xylose or Gal.25,28

In the biosynthesis of mucin type glycans GalNAc is attached to the protein by a family

of enzymes known as polypeptide N-acetylgalactosamine transferases, which use

uridine diphosphate (UDP)–GalNAc as its source of monosaccharide.29

This GalNAc

residue attached to a peptide (6) is known as the Tn-antigen and is the starting point for

CHAPTER 1

34

all mucin type glycans (figure 1.5). The Tn-antigen can be sialylated by GalNAc α-2-6-

sialyltransferase (ST6GalNAc), to produce sialyl Tn-antigen (7). Alternatively the Tn-

antigen could be elongated by GalNAc 3-beta-galactosyltransferase (C1GalT) or

GalNAc β-1,3-N-acetylglucosaminyltransferase (C3GnT) to produce the core 1 (8) or

core 3 (9) mucin structures respectively (figure 1.5).

Figure 1.5 Examples of the initial steps in mucin type O-linked glycan synthesis. The Tn-antigen (6) can

be converted to sialyl Tn-antigen (7) by the enzyme ST6GalNAc. Alternatively the Tn-antigen can be

converted to mucin core 1 (8) or core 3 (9) structures by enzymes C1GalT and C3GnT respectively.

There are eight core mucin structures that have been identified and these are shown in

figure 1.6.30,31

These core structures can then further elaborated to produce a huge

variety of mucin type glycans. Three examples (10-12) of complex mucin type glycans

detected in colon tissue form mice are shown in figure 1.7.32

CHAPTER 1

35

Figure 1.6 The 8 core structures of mucin type, O-linked glycans.

Figure 1.7 Structures (10-12) of O-linked glycans identified in mouse colon tissue.32

Originally mucin glycans were thought to have non-specific roles in protecting the

gastrointestinal and respiratory tracts, maintaining viscoelasticity, hydrodynamic

protease resistance and pH buffering. Now they are known to be involved in many other

CHAPTER 1

36

important functions including; recognition, protein trafficking and modulation of

protein function.6,33

They also act as part of the innate immune system by binding the

lectins of microorganisms, which helps to protect areas such as the gastrointestinal and

respiratory tracts.34,35

1.1.4 Carbohydrate Mediated Signalling

Perhaps the most impressive function of carbohydrates in nature is their ability to act as

recognition domains that can be modified without altering the structure of the cell

component to which they are attached. This can modulate interactions with other

biomolecules, providing an effective and compact communication mechanism. For

example if a mannose attached to a newly synthesised glycoprotein is phosphorylated

by N-acetylglucosamine-1-phosphotransferase the glycoprotein will be transported to a

lysosome, unlike the majority of glycoproteins, which will pass through the Golgi

apparatus.12,36

Carbohydrate recognition plays a role in almost all bodily recognition

functions including immune response, fertilisation and blood group determination.37,38

The potential benefits and applications possible from understanding carbohydrate

recognition interactions are enormous. Thousands of glycan structures are known, but

most of these have features in common and a relatively small number of

monosaccharides are used in their assembly. In many cases such as the calnexin-

calreticulin cycle or the asialoglycoprotein receptor (ASGPR) in hepatocytes, the

difference of only one monosaccharide can determine the fate of a glycoprotein. This

begs the question: exactly how much of a complex glycan is necessary for recognition

and how much is due to its biosynthetic origins? A greater understanding of these

recognition processes could benefit several aspects of biotechnology.

1.2 Medical Applications of Carbohydrates

Proteins constitute a large proportion of candidates for new therapeutic and diagnostic

agents; for example hormones, enzymes, clotting factors, growth factors and

CHAPTER 1

37

monoclonal antibodies. Derivatisation of these therapeutic and analytical agents can

often improve or modulate activity just as with natural proteins. Carbohydrates are also

increasingly found in small molecule therapeutic agents such as antibiotics. The more

that can be understood about natural carbohydrate interactions, the wider the range of

potential benefits that can be achieved.

1.2.1 Carbohydrate Based Antibiotics

Glycan modification of antibiotics such as vancomycin is seen as one way in which

medicine can combat the rapidly increasing antibiotic resistance of some

microorganisms. Many antibiotics contain carbohydrate components and altering this

aspect has been demonstrated to be effective in circumventing resistance in some

cases.39

Naturally occurring antibiotics such as Urdamycin A (13) (figure 1.8) often

contain carbohydrate components, which are essential for their activity. Structures like

these have provided inspiration for many antibacterial and antitumour agents.40,41

Figure 1.8 The structure of Urdamycin A (13). Carbohydrate components are shown in red.

Another approach in the development of new antibiotics, is the use of synthetic

carbohydrate binding molecules that can disrupt pathogens by interacting with their

glycans.42

While these agents do not themselves contain carbohydrates, their effects

depend on interactions with carbohydrates displayed by pathogens. Therefore the

synthesis of homogeneous carbohydrate structures is also important in the development

of these therapeutic agents.

CHAPTER 1

38

1.2.2 Carbohydrate Based Vaccines

Glycoconjugate vaccines for H. influenzae type b43

, HIV44

and malaria45

have already

proven effective in vivo. Several types of cancers are now also known to express

abnormal amounts of certain glycans when compared to healthy cells allowing for the

production of anticancer vaccines.46

Structure 14 is an example of a vaccine presenting

three identical trisaccharide moieties, designed to mimic the presentation of

carbohydrates on ovarian tumour cells (figure 1.9). The carbohydrates are attached to

keyhole limpet hemocyanin (KLH) which stimulates an immune response and the

production of the desired antibodies.

Figure 1.9 The structure of an anti ovarian cancer vaccine. Carbohydrate component is shown in red.

MUC5AC corresponds to a peptide linker. KLH = Keyhole limpet hemocyanin, a commonly used

immunogenic protein.46

There are also several major bacterial pathogens, including V. cholerae, S. dysenteriae

and certain types of E. coli, whose infection mechanisms rely on the O-glycans they

produce. The study of these interactions is ongoing and is likely to play a crucial role in

the production of future vaccines.47,48

1.2.3 Carbohydrates for Cell Specific Drug Delivery

Targeted drug delivery to a specific organ, tissue or tumour in the body is the current

aim of many medicinal chemists. Such technology would reduce adverse side effects at

CHAPTER 1

39

the same time as increasing the efficacy of the treatment. Using the body’s own

recognition and trafficking pathways would be an efficient way of accomplishing this.

Treatments in development for several diseases now involve gene therapy and with our

understanding of the genome constantly increasing, the prevalence of such treatments is

likely to increase. Often the gene being delivered is only desired in specific cells or

tissues. Carbohydrate modification of virus particles has been explored and would be

one way of increasing the tissue specificity of such treatments.49,50

In 1974 it was discovered that hepatic cells showed specificity for proteins presenting

certain carbohydrate structures. Terminal sialic acid moieties were enzymatically

removed from glycans by treatment with neuraminidase to expose Gal residues. The

modified glycoproteins were then isotopically labelled with 125

I to facilitate detection.

When injected into rabbits these modified glycoproteins were found be quickly removed

from circulation by the liver. Further experiments using proteins with a range of

monosaccharides attached have shown that rabbit liver receptors have specificity

towards glycoproteins displaying terminal Glc or Gal residues.51,52

This has led to the

use of sialic acid to mask terminal sugars in therapeutic glycoproteins, which can

significantly improve circulation half lives.53

It also enabled liver targeting by

modifying therapeutic agents with Glc or Gal.54

A more sophisticated method of liver targeting named lectin-directed enzyme-activated

therapy (LEAPT), has shown great potential in recent years. In this approach an enzyme

that is foreign to the host organism is modified so that it will be preferentially absorbed

by hepatocytes and a prodrug is designed which requires this enzyme to be converted in

to its active form (figure 1.10). In the first example of this approach being successfully

trialled the nonmammalian enzyme rhamnosidase was stripped of its natural

glycosylations using endoglycosidase-H and then synthetically d-galactosylated using

2-imino-2- methoxyethyl 1-thioglycosides. The enzyme was then administered and

taken up by hepatocytes via the ASGPRs. Shortly after this the prodrug, consisting of 5-

flurouracil (15) protected with the nonmammalian sugar rhamnose was administered.

This sugar is also recognised by the ASGPR but is not recognised by mammalian

CHAPTER 1

40

enzymes. Although the drug itself has no specificity, it is only released in cells that

contain the galactosylated enzyme as shown in figure 1.10. This method has been

shown to increase the amount of enzyme delivered to the target cells by over 30 times,

therefore it drastically reduced the delivery of active drug to the rest of the body.55,56

Methods like this show great potential and similar approaches are being considered for

other organs and tissue types.56,57

Figure 1.10 An example of lectin-directed enzyme-activated therapy (LEAPT). In this case the enzyme is

rhamnosidase and the drug released is 5-flurouracil (15).56

Other modern examples of carbohydrate mediated cell targeting include the use of

mannose-6-phosphate (16) (figure 1.11) terminal glycans to derivatise

neoglycoproteins, promoting dramatically increased uptake by muscle cells.58

There

have also been several studies in to the use of carbohydrates to promote uptake of target

molecules or vesicles by macrophages which are important in infection, autoimmune

and antitumour response.59,60

These immune cells could then conceivably deliver the

therapeutic agent to the area they were required.61

Figure 1.11 The structure of mannose-6-phosphate (16).

CHAPTER 1

41

Liposomes and nanoparticles have also been trailed as vectors for drug delivery

including many anticancer agents. Glycosylation of these structures is one method of

enhancing tissue specificity. For example the polysaccharide hyaluronan has been

attached to nanoparticles to improve the delivery of 5-flurouracil (15) to colon cancer

cells and Gal has been used to increase the specificity of artificial vesicles for liver

cancer cells.62-64

This approach could provide a versatile method of delivering

therapeutic agents to their target locations without derivatising them directly, but so far

there are only a few successful examples.62,64

There are many areas in which neoglycoproteins and other glycoconjugates have

therapeutic potential and their medicinal use is likely to increase along with an

increased understanding of their biological roles.65-67

Although there have been

significant advances in the synthesis and analysis of glycoconjugates in the past

decades, new glycoconjugate tools are required for the future study of these important

interactions.

1.3 Carbohydrate Binding Protein Analysis (Considerations)

1.3.1 Polyvalency

Carbohydrate binding proteins (known as lectins) generally display multiple, identical

binding sites, thus giving them the ability to bind more than one copy of the same

carbohydrate simultaneously. This ability is known as polyvalency and can be achieved

by the oligomerisation of multiple subunit monomers, surface presentation of lectins or

extended binding sites that recognise multiple monosaccharides.68

Often a combination

of these strategies is employed; for example Concanavalin A (ConA) has an extended

binding site that recognises multiple Man residues and also forms a tetrameric subunit

formation under native conditions.69,70

When the strength of the average monosaccharide-lectin interaction is considered

(association constants in the mM range), it becomes clear that polyvalency is essential

CHAPTER 1

42

to the biological relevance of carbohydrate-protein interactions. Biological media such

as blood or cytoplasm also contain many carbohydrates in solution; therefore the

affinity of any glycoconjugates for a receptor molecule must be significantly higher than

those of simple sugars to have any unique function. The polyvalent presentation of

carbohydrates is able to enhance binding affinities in to the μM or even nM range where

they are capable of participating in many important binding events such cell adhesion

and microbial capture. Figure 1.12 (A) represents a bacterial cell presenting multiple

lectins binding to a surface presenting multiple glycan structures.69,71

Polyvalent

interactions are also significant enough to allow the separation of different classes of

glycoproteins with a lectin such as ConA, which has different affinities for several

different glycans. This approach, depicted in figure 1.12 (B), is used for glycoprotein

purification.72

Figure 1.12 Examples of the polyvalent presentation of lectins and carbohydrates. A) Cell-cell/cell-

surface interaction. B) The separation of glycoproteins by lectin affinity chromatography.

This binding enhancement is partly achieved by cooperative binding and high ligand

densities can also provide increased local concentrations of ligands, which can achieve

high binding site occupancy despite low affinities. However the effect multivalent

presentation has on binding interactions is still not fully understood. Several studies on

the area have been undertaken and many key factors have been identified such as ligand

density, ligand spacing and ligand flexibility.73-75

A single theory explaining the

phenomenon of polyvalent interactions is unlikely, as lectins with high affinities for the

same ligands can achieve their specificities via different mechanisims.70

Therefore any

CHAPTER 1

43

receptor of interest still requires separate and systematic study, which requires the use of

synthetic ligands.

In addition to the multiplying of ligand affinity, polyvalency also has a dramatic effect

on the specificity of lectins. Many lectins show a broad range of specificity towards

monosaccharides, seemingly with only small preferences between them in solution.

However when presented polyvalently as a cluster, polymer or on a surface, the

specificity is dramatically enhanced. ConA has an affinity for methyl Man, only four

times that of methyl Glc, but when polymerised the preference can be enhanced by over

100 times.76

It has also been shown that carbohydrate ligands with the highest affinity

for a lectin in solution do not always correlate to the structures that have the highest

affinities when presented polyvalently.77

This gives a valuable insight into how natural

glycoconjugates or cell surface glycans achieve their specificity.

Given the dramatic effect multiple ligand presentation (polyvalency) has on

carbohydrate binding any potential therapeutic agent intending to utilise carbohydrates

in their activity must be capable of presenting them multiple times. This can be

achieved by attaching multiple copies of the same monosaccharide ligand, by

synthesising branched ligands that incorporate multiple copies of the monosaccharide

concerned or (as found in nature) a combination of the two. Having a range of

multivalent tools to probe target receptors is essential for the development of future

carbohydrate based therapeutics.

1.3.2 Heterogeneity

In the synthesis of natural N-linked glycoproteins the initial N-glycosidic bond

formation that occurs as proteins are formed in the lumen of the ER is known to be

approximately 90% efficient.16

This leads to some initial heterogeneity in the population

of the glycosylated products (different glycoforms) of the same protein. Subsequent

enzymes also do not have 100% efficiency, therefore increasing the diversity of

glycoforms further. The final structure is the product of a competition between a variety

CHAPTER 1

44

of glucosyltransferases and glycosidases with different specificities and activities.

Additionally, proteins in different regions of a cell or those that have been in circulation

longer will have been modified in different manners. This intrinsically dynamic nature

of glycans in vivo is a source of their versatility; however it makes the purification and

analysis of natural glycans and glycoconjugates extremely problematic. Even when

natural glycans can be purified, the lack of a universal sequencing method for glycans

and the fact that the many different monosaccharides have identical masses makes the

elucidation of complex structures difficult.5,78

Determining the structure activity relationship of therapeutics is essential for assessing

potential harmful effects or developing improved treatments. This means artificial

glycans are required in the development of therapeutic glycoconjugates. They can also

be synthesised at higher purities and on larger scales than would be feasible by the

purification of natural glycoproteins. Furthermore the potential for unwanted side

effects is significantly reduced when therapeutic agents are well defined.

1.3.3 Synthetic Glycoconjugate Scaffolds

There are now a wide range of tools available for the analysis of lectin-carbohydrate

interactions. Due to the importance of presenting multiple copies of the carbohydrate of

interest and doing so in a controlled manner any glycoconjugate designed must be well

defined and have the ability to be multivalent. There are several approaches for creating

multivalent ligands for binding assays or therapeutic applications. Some of the most

successful types include; linear polymers, glycol dendrimers, nanoparticles and

neoglycoproteins. Representations of these structures are shown in figure 1.13.

CHAPTER 1

45

Figure 1.13 Some of the most widely used classes of glycoconjugate scaffold. A) Linear glycopolymers.

B) Glycodendrimers. C) Glycosylated nanoparticles. D) Neoglycoproteins. Green circles represent

glycans.

While there will always be some heterogeneity in a polymer population it is now

relatively straightforward to synthesise glycopolymers with polydispersities lower than

1.1 by a range of different methods.79-81

Having accurate control of both chain length

and polydispersity means the binding affinities of glycopolymers can be tailored to their

use. Glycopolymers and dendrimers offer the most reliable method of creating highly

polyvalent ligands with nM binding affinities.82,83

Their high flexibility, long chain

length and potential for high ligand density can allow them to fit the orientation of any

binding site. These properties have made them extremely useful for cell or surface

labelling and inhibition assays. However these scaffolds are not well suited for the

detailed analysis of carbohydrate binding interactions and require the addition of radio

or fluorescent labels to allow detection.

In the past decades there has been great interest in a variety of carbohydrate coated

nanoparticles for receptor analysis, imaging and drug delivery.84-86

The potential for

carrying therapeutic compounds inside their shell and easy incorporation of labelling

agents make them a desirable delivery mechanism. However the surface presentation of

carbohydrates is not well defined, limiting their use in structure-activity studies.

Synthetic glycoproteins are the most biologically compatible construct for the study of

carbohydrate binding. While they will not easily achieve the high binding affinities

possible using glycopolymers they can be extremely useful. Neoglycoproteins have

been widely used since the 1980’s to probe lectin specificity and to develop

CHAPTER 1

46

carbohydrate based methods for cell targeting.87-89

More recently glycopeptides and

glycoproteins have been seen as strong candidates for future vaccines.90,91

In most cases

neoglycoproteins are nonselectively glycosylated, but a wide variety of selective

methods are now available.92

This means they also have the potential for the systematic

study of the structure-activity relationship of carbohydrate binding proteins.

1.4 Artificial Glycoproteins

Artificial glycoproteins (or neoglycoproteins) have long been used to better understand

the role of carbohydrates in biology. In 1929, simple carbohydrate structures were

attached to immunogenic proteins to determine the effect of small changes to glycan

structure on immunological specificity. Glucoside (17) and galactoside (18) which

differ in structure by the inversion of just one stereocenter, (figure 1.14) were converted

to their diazonium derivatives and then attached to the lysines of the target proteins to

create neoglycoproteins. It was found that changing the carbohydrate attached to a

protein changed the antigenic specificity induced by the glycoprotein. It was also found

that even if different proteins were used the immune response was dictated by the

glycans attached rather than the protein, despite the fact that the glycans alone did not

induce a response. This is a very early example of the importance of carbohydrate

recognition and illustrates how even the smallest possible variation in glycan structure

can lead to significant changes in biological function when glycans are presented as

polyvalent glycoconjugates.93

Figure 1.14 Chemical structures of glucoside (17) and galactoside (18). Hydroxyl group attached to C4

shown in red.

The most common use for neoglycoproteins has been the study of carbohydrate binding

protein interactions. They have been used to identify the specificity of several cell

membrane bound carbohydrate binding proteins both in vivo and in vitro. For example

Man binding of epidermal cell receptors in rats,94

bovine airway smooth muscle cells95

CHAPTER 1

47

and Langerhans cells.88

The specificity of purified intracellular lectins has also been

probed using neoglycoproteins. For example the specificity of some lectins found in cell

nuclei for glucose and N-acetylglucosamine.96

Another use of neoglycoproteins is in the production of tailored monoclonal antibodies.

Synthetic glycans are generally attached to immunogenic proteins so that the host

organism produces antibodies which bind the glycan structures. Antibodies produced in

this way have potential uses in both treatment and diagnosis of disease. However carful

screening is required to ensure the antibodies produced are specific to the glycan of

interest and not to the protein scaffold.97,98

1.4.1 Synthetic Strategies for Neoglycoproteins

The total synthesis of naturally occurring proteins is now possible and has been

achieved for a number of proteins including biologically active enzymes and hormones.

The most common and most versatile approach involves the solid support synthesis of

peptide fragments followed by native chemical ligation (NCL) of these fragments to

produce the final protein.99-102

NCL is particularly useful in the generation of proteins

containing a range of different post translational modifications. This is because different

structures can either be incorporated in to separate peptide fragments during their

synthesis or attached to completed fragments before NCL takes place. This method can

be used to produce high purity glycoproteins containing only natural linkages, which is

why it is the current method of choice for the synthesis of bio mimetic

neoglycoproteins.103-106

CHAPTER 1

48

Figure 1.15 The native chemical ligation (NCL) of two synthetic peptides to form a natural peptide bond.

NCL was first introduced in 1994 using N-terminal cysteine peptides and C-terminal

thioester peptides as shown in figure 1.15.107

In the first step the cysteine residue

performs a reversible transthioesterification with the C-terminal thioester. This could

also take place with any unprotected cysteine side chains, however in the case of the N-

terminal cysteine the next step, which is an irreversible S N acyl transfer, rapidly

takes place to form an amide bond between the two fragments. Although this method

was very successful the linkage was limited to sites containing cysteine; a relatively

uncommon amino acid.

Over the last two decades the NCL methodology has been extended to facilitate the

formation of natural linkages at a variety of sites including, alanine, phenylalanine,

valine, leucine, threonine, lysine, proline and glutamine.108

The first step in this

development was the discovery that peptides could be desulfurized (have their thiol

groups removed) using a Raney’s nickel or palladium/aluminium oxide catalysts. This

was first used to convert cysteine to alanine after NCL to achieve the first “alanine

ligation”.109

Eventually it was found that desulfurization could be achieved without a

CHAPTER 1

49

metal catalysts and in aqueous (aq) media using the reducing agent tris(2-

carboxyethyl)phosphine (TCEP) and a free radical initiator (2,20-azo bis(2-(2-

imidazoline-2-yl)propane) dihydrochloride).110

The general scheme for this approach is

shown in figure 1.16 in which R = H for the “alanine ligation” but can be many other

groups if a different linkage is desired. The distance of the thiol group from the N-

terminus can also be altered, thus broadening the scope of NCL linkages even further.

Figure 1.16 General scheme for the native chemical ligation of peptides to form natural peptide linkages

that do not contain cysteine.

NCL of glycosylated peptide fragments can now be used to create synthetic

glycoproteins identical to their natural counterparts.102,103

This method guarantees the

glycoprotein produced only contains the desired glycoforms and provides total control

over the addition or removal of glycosylation sites. The main drawback of NCL is it still

requires the synthesis of peptide fragments and artificial amino acids required for non

CHAPTER 1

50

cysteine based couplings. It is still faster and cheaper for most recombinant proteins to

purify them once they have been overexpressed in vivo, especially if large quantities are

required. If expressed in an organism lacking the biological machinery for glycosylation

then large amounts of high purity, unglycosylated proteins can be quickly and easily

attained. The desired glycans can then be attached chemically or enzymatically if

required.

Carbohydrates purified from bacterial sources have been used effectively in some

vaccines.111

However the purification of such material is difficult, yields are poor and

the usefulness of the products is often limited by purity. The chemical synthesis of

complex glycosides is by no means easy due to the challenge of selectively

glycosylating a single hydroxyl group on a glycan out of many. However recent

improvements in solution-phase and solid support oligosaccharide synthesis have made

it possible to produce complex glycans on a more practical scale.112-114

For these

reasons a semisynthetic approach in which a synthetic glycan is chemically attached to a

unglycosylated protein produced in vivo is our favoured method of creating

homogeneous neoglycoproteins.

1.4.2 Chemical Glycosylation

There are numerous ways in which carbohydrates have been artificially linked to

proteins, but all methods have disadvantages or limitations. Some early examples are;

diazonium salts or imidates of glycosides being used to glycosylate lysines115,116

or

glycosylamines being used to glycosylate the carboxyl groups of a protein.117

Although

these methods have been used to produce many useful neoglycoproteins they do not

produce well defined products and can alter the physical properties of a protein and

thereby disrupt its function. For example lysines are an attractive target for

glycosylations because they can react with a wide range of functional groups including;

activated esters (such as the NHS-ester), isocyanates, isothiocyanates and sulfonyl

chlorides.118

Examples of these reagents and the linkages they produce are shown in

figure 1.17.

CHAPTER 1

51

Figure 1.17 Examples of reagents which can be used to modify lysine side chains and their products.

Lysine is however a relatively common amino acid and therefore does not provide the

selectivity required for a systematic study of the effect of protein glycosylation. Also

lysine often plays an important role in solubilising proteins so the removal or

derivatisation of several lysine residues could have a detrimental effect on protein

stability and function.

Introducing unnatural amino acids (UAAs) with unique reactivities into peptides is a

good way of ensuring specificity. Ketone containing amino acids have been

incorporated into both solid support and biological syntheses of proteins.119,120

This

group reacts selectively under mild conditions with both with aminooxy compounds or

hydrazine compound to form stable oxime or hydrazone linkages respectively (figure

1.18). Other functional groups also not present in nature have been incorporated in

similar ways; including anilines, aryl halides, and boronic acids.121

Like ketones, these

CHAPTER 1

52

functional groups also react bioorthogonally which means they do not require the use of

any protecting groups.

Figure 1.18 The bioorthogonal reaction of a ketones with aminooxy compounds or hydrazine compound

to form stable oxime or hydrazone linkages respectively.

“Click” chemistry is now a commonly used strategy for protein derivatisation due to its

biocompatibility and selectivity. Generally the reactions used are cycloadditions

between an azide and either an alkene or an alkyne as shown in figure 1.19. Either the

azide or the alkene/alkyne can be incorporated in to a protein’s structure and then the

complimentary functional group required is incorporated in to the molecule which is to

be attached to the protein.

Figure 1.19 Examples of “click” chemistry cycloaddition reactions between azides and alkenes or

alkynes.

Many UAAs containing azide, alkyne or alkene functionality can be incorporated in to

proteins genetically or by simply replacing cell feedstocks.92,121

Structures 19-22 shown

in figure 1.20 are examples of UAAs compatible with “click” chemistry. More recent

examples such as structures 23 and 24 (figure 1.20) utilise strain-promoted reaction

technology and are particularly suited to live cell labelling studies because they do not

require catalysis.122,123

There is now a huge variety of UAAs available for use in a wide

range of organisms.124

However, due to time consuming syntheses and the need for

CHAPTER 1

53

specially engineered cell lines, the use of naturally occurring amino acids is still often

preferable.

Figure 1.20 Examples of unnatural amino acids suitable for “click” chemistry reactions;

azidohomoalanine (19), p-Azido-L-phenylalanine (20), homopropargylglycine (21), homoallylglycine

(22) and two examples of UAAs utilising strain promoted reaction technology (23 and 24).

1.4.3 Glycosylating Cysteines

Cysteines are well suited for potential glycosylation sites because they are the only

amino acid containing a thiol group and are a relatively uncommon amino acid.

Furthermore, many cysteines are internal and form disulphide bridges so will not be

accessible for chemical reactions when the protein is in its native state. With site

directed mutagenesis now a standard laboratory practice and the relatively low cost of

synthetic genes, cysteines can easily be incorporated into any sequenced protein. Many

useful methods have been developed for selectively modifying cysteines, some of which

are summarised in figure 1.21. The more useful include: the formation of disulphides,

the oxidation of cysteine (25) to dehydroalanine (26) and alkylation with

electrophiles.125

A disulphide linkage can be formed by reacting cysteine with another

thiol under oxidising conditions or by disulphide exchange. However, glycoproteins

made by this method are not stable in vivo because they are prone to reduction. This can

CHAPTER 1

54

Figure 1.21 Summary of commonly used methods of glycosylating cysteines.125

be solved by converting the disulphide into a thioether using hexamethylphosphorous

triamide (HMPT),126

in a process known as desulfurization (illustrated in figure 1.21).

O-mesitylenesulfonylhydroxylamine (MSH) can be used to convert cysteine (25) to

dehydroalanine (26) via oxidative elimination. The double bond of dehydroalanine (26)

can then act as a Michael acceptor to nucleophiles, as shown in figure 1.21. Using this

method does result in the loss of stereoselectivity, but has been successfully used to

create glycoproteins stable in vivo. MSH can also oxidise proteins glycosylated via a

thioether linkage back to dehydroalanine, making this method reversible.127

Alkylating cysteine can produce stable linkages in one step and a range of electrophiles

can be used. Michael acceptors (such as maleimides and vinyl sulfones) have been used

to selectively glycosylate128

therapeutic proteins successfully. α-halocarbonyls were one

of the first electrophiles used to modify cysteines129

and are still in use today.

Iodoacetamides are used most often, but reactions with lysine have been reported to

occur.125,130

Chloro or bromoacetamides can be used to increase selectivity at the

expense of the reaction rate. α-halocarbonyl compounds are easy to prepare and can also

mimic the natural N-linked glycosylation structure, displaying glycans in their naturally

CHAPTER 1

55

occurring conformations.131

Glycosides of this type have been successfully used to

prepare many glycoproteins and other protein conjugates.125,132

1.5 Green Fluorescent Protein (GFP)

Wild type GFP is a 26.9 kDa protein consisting of 238 amino acids and is found in

nature expressed by the jellyfish Aequorea victoria along with the protein aequorin. In

the presence of Ca2+

ions and the cofactor coelenterazine, aequorin emits a blue light

(λmax = 470 nm). GFP has a major excitation peak at 395 nm and a minor one at 475

nm allowing it to absorb the light emitted by aequorin and fluoresces at 508 nm to

produce the characteristic bluish-green colour of the jellyfish.133,134

The cloning of the

GFP gene into E. coli in 1992 allowed large quantities of this protein to be produced

quickly for the first time and the mechanism of the fluorophore formation was

elucidated soon after.134,135

As shown in figure 1.22, the fluorophore is formed from

three adjacent amino acids in GFP; Ser 65, Try 66 and Gly 67, which together make

structure 27. In the first step the amido group of Gly 67 performs a nucleophilic attack

on the carbonyl group of Ser 65 to form the tetrahedral intermediate 28. This

intermediate collapses to form the cyclic structure 29 which is then oxidised to form

structure 30 which contains the completed fluorophore (shown in red (figure 1.22)).

Figure 1.22 The formation of GFP’s fluorophore. Fluorophore shown in red.

CHAPTER 1

56

The β-barrel structure of GFP (figure 1.23) consists of a β-sheet, made of 11 parallel β-

strands, with an α-helix running through the centre that contains the fluorophore

sequence. In the centre of the barrel structure this fluorophore is relatively protected

from possible quenching reactions.136,137

Formation of the fluorophore requires no

specialised cofactors or substrates from Aequorea victoria, only that molecular oxygen

to be present during protein expression.

The first GFP fusion protein was expressed by Wang and Hazelrigg in 1994138

and since

then it has been expressed in a variety of organisms including; bacteria, fungi, insects,

fish, plants and mammals as well as in human cells. It is a popular tool for fluorescent

microscopy and live cell imaging because unlike many fluorescent molecules it is

considered to be non toxic in most cases, but can be cytotoxic if exited for extended

periods of time.139,140

It was also found to be relatively resistant to heat, pH (5-12),

detergents, salts and most proteases. GFP is commonly used as a fusion protein because

it rarely affects the mobility or activity of the protein it is attached to. GFP fusion

proteins have been extremely useful for studying protein dynamics, expression and

interactions.141-143

Figure 1.23 Ribbon diagram of GFP showing the β sheets in yellow, α helix in red, fluorophore in blue

and loops in green.

CHAPTER 1

57

A number of improvements have been made to photostability and thermal stability of

wild type (WT) GFP since it was first cloned.144

Enhanced GFP, reported in 1996 was

created by making the single point mutation F64L. This increased the folding

efficiency at 37°C and facilitated the use of GFP in mammalian cells.145

Other

significant improvements include GFPuv146

and superfolded GFP147

in 2005, which

respectively increased the fluorescence and folding efficiency of the protein.

The emission wavelength of GFP’s fluorophore is very sensitive to the hydrogen

bonding and π-stacking interactions with the surrounding amino acids. This has made it

possible to create different coloured GFP mutants, which has widened the scope of their

application. Available GFP mutants now include blue fluorescent protein, cyan

fluorescent protein and yellow fluorescent protein.148

There are also several red

fluorescent proteins commercially available, such as mCherry, however these are

derived from the choral protein DsRed originally found in Discosoma sp.

pH and redox sensitive mutants have allowed GFP to act as a reactive biosensor. These

variants have facilitated the visualisation of biological processes; for example

visualisation of synaptic activity in neurons.149,150

Mutants have also been produced

which act as a detector of metal and halide ions.139

The significance of this remarkable

protein was demonstrated in 2008 when Martin Chalfie, Osamu Shimomurra and Roger

Tsien shared the Nobel Prize in chemistry in for GFP’s discovery and development.

One potential drawback is GFP’s tendency to form dimers at high concentration which

can lead to aggregation of fusion proteins. This has been reported when expressed in a

confined area such as with membrane proteins. However a single point mutation

(K206A) has been found to alleviate this problem with no effect on the fluorescence.151

CHAPTER 1

58

1.5.1 GFPuv

GFPuv was primarily chosen as the protein for our glycosylation studies because

cysteine mutants of it have previously been made and these mutants were successfully

derivatised using iodoacetamides.152

Additionally, the use of a florescent protein as a

model glycoprotein eliminates the need for a separate chemical or radio label.

GFPuv differs from wild type GFP by three point mutations; F99S, M153T and V163A.

These mutations improve the protein’s expression by increasing the efficiency of

folding. The protein produced is more stable to variations in temperature and pH and

also around 45 times more fluorescent than WT GFP.153

Its excitation maximum does

not move from 395 nm, but its emission maximum changes from 509 nm to 508 nm.

Like WT GFP it only contains two cysteines and one of them is internal (C70),

therefore not chemically reactive when the protein is correctly folded. C48 however is

on the surface of the protein and therefore likely to react with α-halocarbonyl reagents.

Mutation of C48 to alanine, E6 to cysteine or I229 to cysteine has been reported to have

no detrimental effect on GFPuv’s fluorescence.152

Therefore there are three potential

Figure 1.24 Ribbon diagram of the crystal structure of GFPuv with three amino acids (E6, C48 and I229)

residues highlighted (in yellow).

CHAPTER 1

59

glycosylation sites already available and a range of mutants with two or three

glycosylation sites should be easy to produce. The relative positions of these previously

mutated residues are shown in figure 1.24.

1.5.2 Glycosylated GFP

The production of glycosylated GFP mutants is not a novel idea. There have been many

cases of glycosylated GFP or GFP fusion proteins being engineered and expressed in

vivo for the use in protein trafficking and enzyme activity studies.154-156

These

neoglycoproteins were generated by incorporating glycosylation sites in to the amino

acid sequence of GFP. However in the majority of cases these glycosylation sites were

incorporated in to either the N or C-terminal sequences, which are not ideally suited due

to increased risk of processing and degradation. More recently there has been an interest

in the incorporation of glycosylation sites in more central positions to produce more

stable glycoconjugates.157

There are limitations to the sites at which natural glycosylation sites can be placed in the

GFP sequence because of the specific three amino acid sequon required. In one study157

only three sites were identified for screening, all on loops protruding from the β-barrel

structure. Of these three one prevented GFP folding and one was not recognised as a

glycosylation site. Position 133 was the only successfully engineered non terminal

glycosylation site, which was still considered a potentially valuable tool for the study of

protein trafficking. Given the restrictions imposed by natural glycosylation sites, it is

unlikely that many more will be discovered for GFP in this way.

The sites in which GFP can be chemically glycosylated are significantly more diverse

because only one amino acid residue requires alteration to create a glycosylation site.

This also makes it easier to glycosylate GFP in central positions (not just at the termini)

to produce more biomimetic neoglycoproteins. GFP modified with a C-terminal

thioester has been attached to a glycopeptides via NCL and the product was successfully

used for lectin binding analysis.158

Additionally GFP-lectin fusion proteins have been

CHAPTER 1

60

successfully used for carbohydrate binding studies.159

In both cases the fluorescence of

the protein was used as a simple way of demonstrating carbohydrate-protein interaction

which suggests our approach should also be successful. Glycosylated GFP mutants

made via chemical glycosylations could be used both for in vitro carbohydrate binding

assays or injected into cells for in vivo protein trafficking studies. However the use of

glycosylated GFP in cells requires careful consideration of the location in which they

are used due to the potential for glycan modification by host enzymes.160

1.6 Project Aims

The interactions of glycoconjugates with carbohydrate binding proteins are responsible

for a wide range of recognition events in vivo; including immune response, cell

adhesion and signal transduction. Glycoconjugates have already found many medicinal

uses as therapeutic and diagnostic agents, but their full potential is yet to be realised.

Access to a variety of homogeneously glycosylated glycoproteins is essential for the

study of these important carbohydrate binding events. However glycoproteins expressed

in vivo are produced in a variety of different glycoforms. Therefore the chemical

synthesis and attachment of biologically relevant glycans to unglycosylated protein

scaffolds is required for a detailed analysis of structure-activity relationships.

The reaction of glycosyl iodoacetamides with cysteines was our chosen method of

selectively glycosylating our protein scaffolds. Cysteines are well suited as

glycosylation sites because they are the only amino acid containing a thiol group and

are relatively uncommon. Iodoacetamides provide an irreversible, one step method of

derivatising proteins, which is selective for cysteines.

We have chosen the green fluorescent protein mutant GFPuv for use as a protein

scaffold due its known tolerance of two cysteine mutations (E6C and I229C) and the

previously successful derivatisation of these cysteines with iodoacetamides.1 The

inherent fluorescence of GFPuv also makes it a useful candidate for fluorescence based

binding assays or cell labelling studies.

CHAPTER 1

61

The general aim of this project was to produce a range of homogenously glycosylated

GFPuv mutants suitable for carbohydrate binding protein analysis and to use then to

analyse the specificity of some carbohydrate binding proteins. The strategic aims were

to first produce a range of active GFPuv mutants containing additional cysteines using

the previously reported mutations E6C and I229C as a starting point. Then a simple

method for the overexpression and purification of these mutants would be optimised to

produce adequate amounts for analysis and derivatisation. The synthesis of a range of

glycosyl iodoacetamides suitable for carbohydrate-binding protein analysis was also

necessary. Simple glycan structures were the initial targets to confirm the validity of

this approach and if this was successful then more complex glycans of biological

significance would be targeted. It was essential that the glycosylation reaction between

synthetic glycosides and GFPuv mutants was optimised to ensure the production of

homogeneous neoglycoproteins. This in turn required a sufficiently sensitive method of

glycoprotein analysis to assess the levels of derivatisation. Finally methods of

measuring carbohydrate binding protein interactions would be needed to be explored to

assess the potential of glycosylated GFPuv as a diagnostic tool.

In summary, the strategic aims for this project are:

To produce a variety of active GFPuv cysteine mutants

To develop a simple, effective method of purifying GFPuv

To synthesise a variety glycosyl iodoacetamides

To optimise the cysteine selective glycosylation of GFPuv mutants

To optimise an efficient method of monitoring neoglycoprotein derivatisation

To screen the neoglycoproteins produced against selected carbohydrate binding

proteins

62

Chapter 2: The Generation, Expression and

Purification of GFPuv Mutants

CHAPTER 2

63

2.1 Generating GFPuv Cysteine Mutants

Our primary goal was the generation of a range of GFPuv cysteine mutants; starting

with those previously reported followed by the screening for additional sites capable of

tolerating mutation to cysteine without effecting activity. However the expression and

purification of both WT GFPuv and any mutants produced was also in need of

consideration.

The ability to quickly produce milligram quantities of molecular GFPuv mutant was

important so overexpression in E. coli followed by purification was the logical method

of production. Several GFP mutants are routinely prepared in this way usually

expressed between 25°C and 37°C. Lower incubation temperatures produce protein at a

reduced rate but have been reported to yield a higher proportion of active protein, which

in most cases is more desirable161,162

The purification of untagged GFP can be achieved

in a number of ways including: hydrophobic interaction chromatography, organic

extraction, high performance liquid chromatography (HPLC) and chromatofocusing on

a pH gradient.162,163

Methods have even been developed for purifying untagged GFPuv

by gradient immobilised metal affinity chromatography (IMAC).161

However this may

not be as effective with all GFPuv mutants.

Figure 2.1 Binding of a hexahistidine tagged protein to an immobilised metal affinity column.

Although not suitable for some biomedical applications and not ideal for larger scale

production IMAC using a hexahistidine tag is still the most reliable method that can be

applied to all conceivable GFP mutants.162

This method relies on the binding of multiple

histidine residues attached to either protein terminus to metal ions immobilised on a

solid phase resin (figure 2.1). The captured protein can subsequently be eluted by

CHAPTER 2

64

washing the resin with a solution containing high concentrations of imidazole.

Therefore our first objective was to introduce a hexahistidine tag on to a terminus of the

GFPuv gene.

2.1.1 Addition of Hexahistidine Tag to GFPuv

The WT GFPuv gene was amplified by polymerase chain reaction (PCR) before being

purified and cloned in to a pET-30a vector using the restriction sites NotI and EcoRI, as

illustrated in figure 2.2 (details section 8.1.2).

Figure 2.2 Schematic representation of the cloning of GFPuv into a pET-30a vector.

The resulting construct was sequenced to confirm the desired product had been

produced (full sequence shown in appendix 1). Figure 2.3 shows the corresponding

amino acid sequence with the hexahistidine tag and GFPuv sections highlighted. This

protein shall be referred to as GFPuv_WT. To maintain the numbering of the GFPuv

residues the hexahistidine tag and other additional amino acids will be assigned

negative values if required (-52M to -1F).

CHAPTER 2

65

MHHHHHHSSGLVPRGSGMKETAAAKFERQ

HMDSPDLGTDDDDKAMADIGSEF-GFPuv

Figure 2.3 The additional amino acid sequence introduced on to the N-terminus of GFPuv. Hexahistidine

tag is shown in red and the GFPuv section is shown in green.

2.2 Site Directed Mutagenesis

To compare the reactivity of the two additional cysteines reported to be tolerated in

GFPuv (E6C and I229C) against the naturally occurring cysteines (C48 and C70) a

range of mutants were required. C48 would be mutated to alanine (the mutation C48A)

and the E6C mutation and the I229C mutation would be introduced separately. For the

C48A mutation a parallel approach was undertaken using inverse PCR with the primers

previously described1 and the more conventional Quickchange method.

2.2.1 Inverse PCR

Figure 2.4 Schematic representation of the inverse PCR method for the C48A mutation.

The GFPuv_WT vector was amplified by a PCR using the primers previously

reported,1,164

the purified PCR product was phosphorylated and then a self ligation was

performed. This procedure is summarised in figure 2.4 (details section 8.1.2). Five of

the resulting plasmids were sequenced and it was confirmed that the ligation and

transformation were successful. However, the sequences showed that the PCR reaction

CHAPTER 2

66

did not produce the desired product. Instead, varying numbers of primer pairs were

inserted into the mutation site. Some examples of the sequences obtained from the

inverse PCR products are shown compared to the GFPuv sequence in figure 2.5. The

repeated sequence of the forward primer used is highlighted in green and is repeated

three times in the sequence Inv 1 and once in the sequence Inv 2. The sequences also

show that the sequence both before and after the primer insertions are in consensus with

the GFPuv sequence. Therefore it was definitely an insertion rather than a mutation

which had taken place and these products were not useful to us.

Figure 2.5 Comparison of the products of the inverse PCR (Inv 1 and Inv 2) with the GFPuv sequence

around the C48A mutation site. Repeat units of the forward primer used in the PCR are highlighted in

green.

It is possible that if enough PCR products from this method were screened then one

would contain the desired mutation or that the PCR reaction could have been optimised.

However, this approach was not pursued further due to our success with the

Quickchange method, which was conducted in parallel to the inverse PCR approach.

CHAPTER 2

67

2.2.2 The Quickchange Method

Figure 2.6 Schematic representation of the Quickchange site directed mutagenesis method for the C48A

mutation.

The C48A mutation was introduced using a modified version of the Quickchange site

directed mutagenesis procedure which is summarised in figure 2.6 (details in section

8.1.2). This new mutant in which the C48A mutation was successful will be referred to

as GFPuv_C48A.

The I229C mutation was introduced to both GFPuv_WT and GFPuv_C48A using the

same PCR conditions found to work for the C48A mutation. In both cases the I229

mutation was introduced successfully. The two new mutants will be referred to as

GFPuv_I229C and GFPuv_C48A_I229C respectively. The GFPuv_C48A_I229C PCR

reaction did alter one base pair that was not intended, but fortunately it was a silent

mutation (aaaaag at L125) (full sequence in appendix 1).

The E6C mutation was introduced to all previously generated mutants (GFPuv_WT,

GFPuv_C48A, GFPuv_I229C and GFPuv_C48A_I229C using a slightly different PCR

(details in section 8.1.2). These new mutants will be referred to as GFPuv_E6C,

GFPuv_E6C_I229C and GFPuv_E6C_C48A_I229C respectively. The GFPuv_EC

contained two silent mutations occurring at P54 (cctccc) and K126 (aaaaag).

CHAPTER 2

68

2.3 Generation of Cysteine Mutants by DNA Shuffling

Many of the improvements to WT GFP have been achieved using a combination of

error prone DNA shuffling and directed evolution.146,147

This technique can also be used

to combine homologous genes with desired characteristics to quickly create libraries of

chimeric proteins (depicted in figure 2.7).165,166

We have demonstrated a method of

using DNA shuffling to rapidly scan several surface residues of GFPuv specifically for

mutation to cysteine. To our knowledge this approach has not been used to generate

cysteine mutants before.

Figure 2.7 Schematic representation of how homologous genes can be combined in a primerless PCR to

create new chimeric genes for screening.

2.3.1 General Considerations

It is of course possible to screen every surface residue of GFPuv for its tolerance to

mutating to cysteine. Then residues which were found to tolerate these mutations could

be screened in pairs or higher order combinations to discover which were still viable.

However, if only ten residues were found to tolerate mutation to cysteines then there

would be 1023 different cysteine mutants combinations to screen. Not only would this

method be time consuming, but it may fail to find mutations which were viable in

combination and were not successful individually. Random mutagenesis of GFP would

CHAPTER 2

69

inevitably produce some useful cysteine mutants if libraries were large enough, but

sifting through all of the non-cysteine mutations would require the analysis of the DNA

sequences of all active mutants produced. Finding sequences containing combinations

of usefully mutated sites would also be extremely unlikely using this approach.

The DNA shuffling of two or more GFPuv genes containing different numbers of

cysteine codons provided a solution to the rapid discovery of new cysteine mutants.

This approach simultaneously screens combinations of cysteines and is potentially

applicable to any protein. Using GFPuv’s inherent fluorescence, large numbers of genes

can be rapidly screened for activity without the need for an additional assay and then

only the sufficiently active products needed sequencing.

2.3.2 Design of Polycysteine Mutants for DNA Shuffling

After analysis of GFPuv’s structure it was found that over 140 of GFPuv’s 238 amino

acids were near the surface of the β-barrel structure. Therefore mutation of any of these

amino acids could yield potentially reactive cysteine mutants. Three synthetic genes

named Shuffle 1-3 were designed to scan 107 of these sites (details in section 8.1.2). In

individual genes the sites to be screened were separated by a minimum of 12 bp (usually

15 or more) to increase the chances of successfully recombining with the unmodified

GFPuv sequence. We initially chose a gene containing 33 surface cysteines (Shuffle 1),

including two sites known to tolerate cysteines (C48 and C229) as controls for the

screen. Shuffle 1 and a GFPuv gene with the mutation C48A (sGFPuv_C48A) were

codon optimised for E. coli and purchased from GeneArt (sequences shown in appendix

2). Both synthetic genes were the cloned in to pET-30a vectors using the EcoRI and

NotI restriction sites included in their design. The amino acid sequence of

sGFPuv_C48A is shown in figure 2.8 with the amino acids corresponding to cysteines

in the sequence of Shuffle 1 highlighted in red.

CHAPTER 2

70

Figure 2.8 Amino acid sequence of the sGFPuv_C48A gene purchased for DNA shuffling experiments.

Amino acids highlighted in red correspond to the residues exchanged for cysteine in the Shuffle 1 gene.

2.3.3 DNA Shuffle of Shuffle 1 and sGFPuv_C48A

Approximately 1 kb fragments containing both synthetic genes (Shuffle 1 and

sGFPuvC48A) were obtained from their respective plasmids by digestion using EcoRI

and NotI. These gene containing fragments were further digested using DNaseI into

random fragments of less than 200 bp for use in the DNA shuffle PCR. A primerless

PCR was then conducted using these fragments under the same conditions as previously

reported (details in section 8.1.2).146,167

The 1 kb fragments obtained were cloned back

in to pET30a and transformed in to an expression vector for screening. Colonies

containing active GFPuv mutants were detectable using UV light (659 nm) a few hours

after induction and visible to the human eye after a few more. As shown in figure 2.9

the colonies expressing active GFPuv mutants were visibly green and the colonies

expressing inactive GFPuv mutants appeared to be the natural brown of E. coli.

Figure 2.9 Example expression plate containing transformants from DNA shuffle products. Highlighted

section on the left is enlarged on the right.

CHAPTER 2

71

Several of the colonies were unusually small, which may be because some of the

mutants produced were harmful to the cells. Around 30% of the normal sized colonies

were visibly green. 94 green colonies were sequenced and out of these ten were found to

be novel mutants whilst the rest were identified as sGFPuv_C48A. The amino acid

sequence of these ten novel GFPuv mutants are summarised in figure 2.10.

Figure 2.10 Summary of the active, GFPuv mutants discovered by the DNA shuffling. Each column

corresponds to a new gene. White sections correspond to segments of sGFP_C48A and the green sections

correspond to segments of Shuffle 1. Naturally occurring C48 has been highlighted yellow. The mutant

names correspond to their library designation.

From these novel GFPuv mutants, ten new sites were found to tolerate mutation to

cysteine and some combinations were also produced. Four new double mutants, one

triple mutant and two quadruple mutants were found in this relatively small library. The

mutants identified in this screen were named corresponding to their library designation.

CHAPTER 2

72

E.g. mutant GFPuv_B10 was the tenth mutant sequenced in row B of the plate

sequenced and refers to the mutations C48A, S202C, N212C and I229C. Interestingly

I229C (previously known to be tolerated) was the most common mutation observed and

the A48C (mutation back to WT) was one of the second most common mutations found

in the genes produced. Also cysteines were less commonly found towards the centre of

the gene (figure 2.10). Further investigation or a larger library size would be needed to

determine if this was due to the protein stability towards mutations, the DNase digest

not being sufficiently random or the PCR conditions.

Due to the fact that so many of the active mutants sequenced were found to match the

DNA sequence of sGFPuv_C48A it was decided to investigate the sequences of some

inactive colonies to determine if they matched the sequence of shuffle one. If this was

the case it would suggest that the DNase digest was not thorough enough. 12 inactive

colonies were sequenced to assess the efficacy of the DNA shuffling experiment and it

was found that all of them had been successfully shuffled. The amino acid sequences of

these inactive mutants are summarised in figure 2.11. These results suggest that if a

larger library of active colonies was screened many more combinations of cysteine

mutations would be discovered.

It was decided that we had a sufficient variety of new mutants to produce a range of

neoglycoproteins for initial screening so no further sequencing or DNA shuffling

reactions were embarked upon. Two further genes were purchased from Gene Art for

screening. One contained all 13 cysteines found to be tolerated in different mutants and

the other contained six cysteines not present in GFPuv_WT (E6C, S30C, T38C, T43C,

K52C and I229C) and C48. The latter turned out to be active and was named

GFPuv_C5+2, but the mutant containing all 13 mutations was not successfully

expressed in an active form.

CHAPTER 2

73

Figure 2.11 Summary of the 12 inactive GFPuv mutants screened. Each column corresponds to a new

gene. White sections correspond to segments of sGFPuv_C48A and the green sections correspond to

segments of Shuffle 1. Naturally occurring C48 has been highlighted yellow. The mutant names

correspond to their library designation.

2.4 Expression of GFPuv

2.4.1 Optimisation of Protein Expression

The optimisation of protein expression was carried out using GFPuv_WT. Induction of

protein production was tested at 22°C, 30°C and 37°C. Samples of each culture were

removed at 1 hour intervals for 8 hours and also after 24 hours. The remaining bulk of

the cell cultures were also harvested stored for quantitative analysis (details in section

8.1.3).

CHAPTER 2

74

Figure 2.12 SDS-PAGE gels of the samples taken from cultures expressing GFPuv_WT at 22, 30 at

37°C. From left to right the lanes correspond to; protein ladder, 0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h

and 24 h after induction.

Figure 2.12 shows that a protein of approximately the correct mass for GFPuv_WT

(32,500 Da) has been successfully over expressed at all three temperatures tested and is

the main product of the cell cultures. Production of the protein appears to occur faster at

higher temperatures. At 22°C there is a continuous increase in the levels of protein

expressed, but there seems to be little increase in the in the amount of protein produced

at 30°C after 8 hours or at 37°C after 5 hours.

The Western blots in figure 2.13 show that the over expressed protein is successfully

labelled with a hexahistidine tag. It appears that at both 22°C and 30°C there is a

continuous increase in the level of this protein expressed, but at 37°C the increase much

quicker in the first few hours. Also at 37°C there appears to be more prominent bands of

different masses, which suggest an increased amount of incompletely expressed

proteins.

CHAPTER 2

75

Figure 2.13 Western blots of the samples taken from cultures expressing GFP_WT at 22, 30 at 37°C.

From left to right the lanes correspond to 0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h and 24h after induction.

For a more quantitative analysis of the expression at different temperatures the bulk of

the cells from each culture were analysed for protein content before and after

purification (details in section 8.1.3). The total cell mass, total soluble protein produced

and total purified GFPuv obtained at each temperature are summarised in figure 2.14.

Figure 2.14 The mass of GFPuv_WT purified relative to total cell mass and total soluble protein

produced. Data relating to 400 mL cultures grown at 37°C until an OD of 0.7 was reached followed by

protein expression at different temperatures.

Under the conditions tested there was very little difference in the amount of GFPuv_WT

produced following induction at 30°C and 37°C over 24 hours, although the production

seemed to be much faster at 37°C. Lowering the temperature to 26°C had a more

0

200

400

600

800

1000

1200

26°C 30°C 37°C

Mas

s re

cord

ed

(m

g)

Induction Temperature

Expression of GFP_WT

Total Cell

Total Soluble Protein

Total purified GFPuv

CHAPTER 2

76

significant impact of the amount of GFPuv_WT produced over this time so was not

considered for bulk production. Cysteine mutants are likely to fold less efficiently than

GFPuv rather than more efficiently and that protein folding is generally reported to be

more efficient at lower temperatures. Therefore it was decided that a longer induction

time (up to 24 hours) at 30°C would be more suitable that a shorter induction time (3-5

hours) at 37°C, which would produce a similar amount of protein but be more likely to

contain a higher percentage of incomplete or missfolded protein.

2.4.2 Expression of Mutants

Initially all of the mutants created by site directed mutagenesis were expressed under

the same conditions as optimised for GFPuv_WT. All of these mutants suffered a

reduction in protein yield to some extent (20-50%), but mutants GFPuv_C48A,

GFPuv_C48A_I229C and GFPuv_I229C showed over 95% reduction in yields

compared to GFPuv_WT. Furthermore GFPuv_E6C_C48A and

GFPuv_E6C_C48A_I229C yielded no detectable GFPuv.

DNA sequence analysis revealed that some mutants contained an increased amount of

rare codons when compared to GFP_WT. After transformation in to Rosetta 2

competent cells the yield of GFPuv_I229C was increased over ten fold. The mutants

containing the C48A mutation did not show an improvement in yield upon the same

treatment suggesting the mutation itself was detrimental to expression or folding.

Another possibility is that when the C48A mutation was introduced a mutation in the T7

promoter region occurred and was subsequently passed on to the mutants derived from

it.

As C48 was later found to be unreactive to iodoacetamides, these mutants became

superfluous so no further investigation in to the lower protein yields was undertaken. To

reduce the chances of any further expression problems all further mutants produced

(from DNA shuffling) were derived from codon optimised GFPuv. The expression of

CHAPTER 2

77

these mutants was never as efficient as that of GFPuv_WT under the same conditions,

but was deemed sufficient for our needs. Typical yields of these mutants were 10-30 mg

of purified protein per 400 mL culture, compared to over 100 mg for GFPuv_WT.

2.5 Purification of GFPuv

2.5.1 Gradient Immobilised Metal Affinity Chromatography (IMAC)

GFPuv_WT was purified by nickel chelating chromatography using an imidazole

gradient (details in section 8.1.3). The fractions were collected in a 96-deep well plate

and analysed by SDS-PAGE electrophoresis. The fractions collected from this

purification and the SDS-PAGE Gel of some fractions of interest are shown in figure

2.15.

Figure 2.15 A) SDS gel of selected fractions collected after IMAC column. B) The 96-deep well plate in

which the samples were collected. C) The 96-deep well plate in which the samples were collected

illuminated by blue light and viewed through a light filter.

As shown in figure 2.15 fractions A2-A6 showed some florescence, but contained a

large mixture of protein and little GFPuv_WT. Fractions E12-F3 contained relatively

large amounts of GFPuv_WT with few impurities, however some impurities could be

seen in all fractions.

2.5.2 Anion Exchange Column

It was envisaged that we may need GFPuv_WT mutants at a higher purity than was

achieved using IMAC so other purification methods were investigated. The eluent from

CHAPTER 2

78

wells E12-F3 (figure 2.15) were combined, purified using an anion exchange column

(details in section 8.1.3) and the eluted fractions collected for analysis. Fractions

collected show similar levels of purity to that after IMAC (figure 2.16.A). While the

relative concentration of GFPuv_WT appears higher, the concentrations of impurities

had also increased slightly suggesting this purification step was of little use. Anion

exchange chromatography was not used again for GFPuv purification.

2.5.3 Size Exclusion Chromatography

The GFPuv_WT containing fractions eluted from the anion exchange column were

combined, purified using size exclusion chromatography (details in section 8.1.3) and

the eluted fractions were collected for analysis (figure 2.16.B). The purity of the protein

collected was significantly increased using this method although size exclusion

chromatography takes longer than anionic affinity chromatography and the yields were

significantly reduced.

Figure 2.16 A) SDS-PAGE gel of fluorescent fractions collected from anion exchange chromatography

of GFPuv_WT. B) SDS-PAGE gel of fluorescent fractions collected from size exclusion chromatography

of GFPuv_WT.

2.5.4 Stepwise IMAC

It was noticed that two peaks were often seen in the UV trace when eluting from the

IMAC column with a constant imidazole gradient. Using a stepwise gradient was found

to dramatically improve the efficiency of the IMAC column. The best results were

obtained when 10% elution buffer was used until an initial peak was eluted followed by

CHAPTER 2

79

100% elution buffer until all remaining GFPuv was removed from the column. This

method (details in section 8.1.3) was found to work well with all mutants produced as

shown in figure 2.17. A typical UV trace of a GFPuv purification using this method is

shown in appendix 3.

Figure 2.17 SDS of all mutants purified by stepwise IMAC purification. From left to right the lanes

contain 5 μg of mutants B10, C5, D1, C5, D1, D5, F1, F11, G1, G3, S6, E6C and I229C.

MS of proteins purified in this way showed no significant impurities and no dimmer

formation so it was decided that no further purification was required before

glycosylation reactions were undertaken. Size exclusion chromatography was held as a

reserve method for when additional purification was required before use. An example of

a deconvoluted mass spectrum of GFPuv_E6C_I229C is shown in figure 2.18. No ions

were detected above 8% abundance when compared to the molecular ion peak (detected

at 31857 Da). The absorbance and emission spectra were measured for each mutant

prepared in this way and found to be unaffected by the mutations introduced (spectra

shown in appendix 4).

CHAPTER 2

80

Figure 2.18 Deconvoluted MS of GFPuv_E6C_I229C from 10000-70000 Da after stepwise IMAC.

2.6 Summary

In this chapter we have described the cloning of GFPuv and the addition of a

hexahistidine tag to aid purification. We have also described the production of six

GFPuv mutants by site directed mutagenesis and 11 novel active mutants of GFPuv by

DNA shuffling. Each of the mutants produced differs from WT_GFPuv in the addition

or removal of cysteine residues making them suitable for the synthesis of

neoglycoproteins. These new GFPuv variants include two mutants containing four

additional cysteines and one mutant containing six additional cysteines which are not

present in the WT sequence of GFPuv.

The expression and purification of the GFPuv mutants produced has also been

optimised and a general procedure suitable for the milligram scale production of any of

the mutants produced has been demonstrated. Further details of the prodedures

described in this chapter can be found in section 8.1.

.

81

Chapter 3: Synthesis of Aminoethyl

Glycosides

CHAPTER 3

82

3.1 General Considerations

The conjugation of carbohydrates to biomolecules (such as peptides, lipids and

metabolites) and surface arrays has been achieved through a range of different

methods.168-170

Aminoalkyl linkers have become the most popular due to their stability

and ease of synthesis from commercially available materials. The aminoethyl linker is

one of the most widely used and known to be biocompatible.169,171,172

This linker is also

Figure 3.1 The use of aminoethyl mannoside (27) in carbohydrate arrays and in the synthesis of

glycopeptides. (a) The reaction of amino ethyl mannoside with an activated array surface. (b) The

conversion of amino ethyl mannoside in to an α-halo carbonyl compound capable of reacting with thiols.

(c) The reaction of the activated mannoside (28) with a cysteine (25) containing peptide.

CHAPTER 3

83

easily converted to alpha halo carbonyl compounds which would allow their use on both

carbohydrate arrays and in the synthesis of neoglycoproteins. Figure 3.1 shows the

conversion of aminoethyl mannoside (27) in to mannosyl iodoacetamide (28) by the

reaction with iodoacetic anhydride. The subsequent reaction of 28 with cysteine (25) to

produce a cysteine coupled to a mannose via an amino ethyl linkage is also shown.

An alternative use of the aminoethyl mannoside (27) is in the formation of a mannose

carbohydrate array. This can be achieved by using carboxylic acid terminal linkers on a

gold coated chip as shown in figure 3.1. These carboxylic acid linkers first need

activating using N-ethyl-N’-(dimethylaminopropyl)-carbodiimide (EDC) and N-

hydroxysuccinimide (NHS) before they can successfully be couple to the aminoethyl

linkers.

Aminoethyl glycosides have been prepared via several routes. In many cases the

carbohydrate is first glycosylated with chloroethanol, bromoethanol or azidoethanol

before conversion to the amine.173,174, 175

Alternatively N-Cbz-aminoethanol can be used

directly to avoid a functional group conversion step. Activation of glycosides with

trichloroacetimidate can potentially increases the overall yield (illustrated by steps b-d

in figure 3.2), but the additional two steps involved are difficult to justify in the

synthesis of simple glycosides.176

The direct reaction of a range peracetylated mono and

disaccharides with N-Cbz-aminoethanol (illustrated by step g in figure 3.2) has been

reported with reasonable yields (varying with the glycoside used).177

This is the

approach we have chosen in the synthesis of our aminoethyl glycosides. The products

made by this method also have the desired anomeric configurations that correspond to

naturally occurring terminal glycans, which is essential for a relevant study of

carbohydrate binding interactions.

The example in figure 3.2 shows the synthesis of aminoethyl mannoside (27) from

mannose (29). In the first step (a) the glycoside is protected to form per acetylated

mannose (30). Step g is the coupling of 30 with N-Cbz-aminoethanol to produce the

CHAPTER 3

84

protected aminoethyl mannoside (31) which can be converted to 27 by two deprotection

steps (e and f).

Figure 3.2 Synthesis of aminoethyl mannoside (27). (a) Ac2O in pyridine. (b) BnNH2 in THF. (c)

Cl3CCN, K2CO3 in Dichloromethane (DCM). (d) N-Cbz-aminoethanol, TMSOTf in DCM. (e) NaOMe in

MeOH. (f) Pd/C, H2 in MeOH. (g) N-Cbz-aminoethanol, BF3.Et2O in DCM.

3.2 Synthesis of Monosaccharides

Mannose (29) was peracetylated using acetic anhydride in pyridine to yield 30 as

mixture of both anomers. This mixture of anomers was then coupled with N-Cbz-

aminoethanol in the presence of BF3·Et2O to form the protected aminoethyl mannoside

(31). This glycoside was first deacylated by treatment with sodium hydroxide in

methanol and then the carboxybenzyl group was removed by hydrogenation using a

Pd/C catalyst to yield the deprotected aminoethyl mannoside (27) (details in section

8.2.4).

Figure 3.3 Structures of aminoethyl glucose (32), aminoethyl galactose (33) and aminoethyl GlcNAc

(34).

CHAPTER 3

85

The synthesis of the corresponding aminoethyl glycosides for Glc (32), Gal (33) and

GlcNAc (34) were carried out in a similar fashion to that of the aminoethyl mannoside

(27). In these three cases the enantiomerically pure, β-peracetylated glycosides were

deemed economically viable starting materials so the initial acetylation step was not

required. The final products of these syntheses (32-34) are shown in figure 3.3. The

main variation in the synthesis of glycosides 32-34 was in the coupling step with N-

Cbz-aminoethanol in which the yields were different for each monosaccharide. Also a

different Lewis acid (SnCl4) was used for the coupling of peracetyl glucosamine (35) to

N-Cbz-aminoethanol as it is reported to give preferable yields to BF3·Et2O,177

which

was used in the case of the other monosaccharides. A summary of the coupling

reactions of all of the peracetylated monosaccharides (30, 35-37) to produce the

corresponding protected aminoethyl glycosides (31, 38-40) is shown in figure 3.4. The

final deprotection steps were identical for each of the monosaccharide, aminoethyl

glycosides produced (details in section 8.2.5-7).

Figure 3.4 Summary of glycosylation reactions performed on peracetylated monosaccharides (30, 35-37).

CHAPTER 3

86

3.3 Synthesis of Aminoethyl Trimannoside (41)

The synthesis of trimannoside (41) (shown in figure 3.5) was undertaken to provide a

branched glycoside suitable for attachment to a target protein or a carbohydrate array.

This structure was specifically chosen due to its similarities to the N-glycan trimannose

core and hence the potential for further elaboration with glycotransferases. The

inspiration for this synthesis was taken from previous work undertaken by Kaul and

Hindsgaul in 1991,178

which negated the use of difficult and time consuming protecting

group chemistry. When compared to a traditional chemical synthesis of the same

compound179

this approach was significantly faster, taking only two weeks as opposed

to two months and used much more robust techniques.

The GlcNAc-GlcNAc section of the Man5GlcNAc2 core is reportedly not required for

GlcNAc-transferase I (GnT-I) activity and the substitution of these two sugars for an

alkyl group has been shown to increase the Km of this enzyme for some substrates.180

A

further simplification of the reported method was to disregard the synthetically

challenging β-mannose linkage. It was hoped that this linkage would also be

nonessential for GnT-I activity and would allow the use of aminoethyl mannoside (42)

in the synthesis. Stereoselectivity for α-glycosidic bond formation is inherent in the use

of Man due to both the anomeric and neighboring group participation effects which

further simplifies the synthesis.

Figure 3.5 Retrosynthetic analysis of trimannoside (41), demonstrating how it can be synthesised from

aminoethyl mannoside (42) and a mannosyl donor.

CHAPTER 3

87

The retrosynthetic analysis in figure 3.5 demonstrates how trimannoside 41 could be

made using aminoethyl mannoside 42 and a mannosyl donor. The challenging part of

this synthesis is the selective glycosylation at the 3 and 6 positions of the mannosyl

acceptor (carbon numbering shown in figure 3.6). A similar reaction has been reported

without the use of protecting groups with the overall yield of 17%.178

This is a relatively

low yield for a three step synthesis. However, the alternative is the use of protecting

groups on hydroxyl groups 2 and 4 of the mannosyl acceptor which would require

several additional steps and the purifications which would take significantly longer and

likely not improve the overall yield.

Figure 3.6 Structure of mannosyl acceptor (42) with carbon numbering labelled in red.

This approach depends on the increased reactivity of position 6 and 3 over the other

hydroxyl groups on the mannose acceptor. Reaction at the 6 position is highly favoured

as it is a primary alcohol. Reaction at position 1 would also be favoured, but in this case

it is prevented by the aminoethyl linker. Position 2, 3 and 4 are likely to have similar

reactivities, but position 3 should be favoured due to steric factors affecting the other

two hydroxyl groups. The hydroxyl group at position 2 is hindered by 1,3-diaxial

interactions unlike groups 3 and 4. Also position 4 will experience a larger steric effect

from the mannose attached to the 6 position than position 3. Of course the preference of

the 3 position over 2 and 4 is not enough to produce the desired product only. However

the desired 3,6-linked trimannoside (43) is the only trimannoside which does not

contain vicinal diols. Therefore the two unwanted trimannoside side products (4,6-

linked (44) and 2,6-linked (45)) can be removed by reaction with sodium periodate as

shown in figure 3.7, followed by silica chromatography. This methodology should also

affect the removal of any dimannose compounds which will also be produced.

CHAPTER 3

88

Figure 3.7 The reaction of sodium periodate with a mixture of trimannosides (43-45)

Separation of trimannosides from any tetra or pentamannoside produced would present

the main challenge for this synthesis. The proportion of mannosyl donor could be kept

low enough to prevent the formation of these unwanted side products, removing the

need for further purification, but this would reduce yield of trimannose in favour of

dimannose.

Acetobromo mannose (46) was chosen as the mannosyl donor for the synthesis of

trimannose (41) because it had previously been reported to react successfully in a

similar synthesis.178

46 was successfully synthesised from peracetylated mannose (30)

and HBr as shown in figure 3.8 and was then immediately used for the glycosylation

reaction with 42.

CHAPTER 3

89

Figure 3.8 The synthesis of acetobromo mannose (46) from peracetyl mannose (30).

Aminoethyl mannoside 42 required heating (35°C) and sonication for it to fully dissolve

in acetonitrile before it’s coupling with 46. The reaction was catalysed using HgBr2/

Hg(CN)2 (figure 3.9) and molecular sieves were used to maximise yield. Initial

purification of this reaction by silica chromatography removed the majority of the

unreacted monosaccharide and disaccharide side products.

Figure 3.9 The reaction of aminoethyl mannoside (42) with acetobromo mannose (46) to form a mixture

of mannosides including the trimannoside (43).

This trimannoside rich mixture was treated with sodium periodate for 48 hours and then

further purified by silica chromatography to yield pure trimannoside. The yield of this

synthesis so far with respect to the aminoethyl mannoside (42) was just over 4%.

However considering the large amounts of mannose wasted on forming dimannosides

and the fact that no tetramannosides were detected in the reaction mixture by MS it was

thought that this yield could be improved upon by increasing the proportion of

acetobromo mannose used. The optimisation of this reaction was undertaken by

MChem student Siak Gee Lim, but the yield of 4% with respect to aminoethyl

mannoside (42) was not improved upon.

CHAPTER 3

90

Figure 3.10 Structure of trimannoside (43) with carbohydrate carbon atoms labelled.

To be certain of the success of the synthesis of trimannoside 41 a full characterisation of

the protected derivative 43 was undertaken with the help of Dr R. Sardzik (The

University of Manchester). The numbering system for the carbohydrate ring carbons use

in the NMR assignments is shown in figure 3.10. Conformation of the stereochemistry

of the glycosidic bonds formed was achieved by analysing the coupling of the anomeric

protons with their respective carbons in a non-decoupled HSQC (shown in figure 3.11).

These couplings are all characteristic of α-glycosides, confirming that the predicted

stereochemistry had been achieved. Conformation that the product was glycosylated at

the 3 position and not at position 2 or 4 was found in the coupling of C3 to H1’ in the

HMBC spectrum (relevant section shown in figure 3.12).

CHAPTER 3

91

Figure 3.11 A section of a non-decoupled HSQC of trimannoside (43) showing the coupling of the

anomeric protons with their respective carbons.

Figure 3.12 Section of a HMBC spectrum showing the coupling of C3 to H1’ in trimannoside (43).

CHAPTER 3

92

Figure 3.13 The deacylation of trimannoside (43) to trimannoside (47) using sodium methoxide in

methanol.

Deacetylation of trimannoside (43) to produce 47 was achieved as previously described

for the aminoethyl monosaccharides, using sodium hydroxide in methanol as shown in

figure 3.13. However attempts to hydrogenate trimannoside (47) as previously

described for the aminoethyl monosaccharides (using ethanol or methanol as the

solvent) did not result in a pure product. If both the amount of catalyst and the time of

the reaction were carefully controlled then trimannoside (41) could be obtained as the

main product, but usually with a mixture of adducts also present. Performing the

reaction in water (as shown in figure 3.14) was found to be faster and produced the pure

deprotected mannoside desired. The formation of increasing amounts of side products

with increased reaction times in ethanol or methanol was possibly due to the poor

solubility of trimannoside (41) in these solvents.

Figure 3.14 The hydrogenation of trimannoside (47) to trimannoside (48) using a Pd/C catalyst in water.

CHAPTER 3

93

3.4 Synthesis of Tetramannosides (48 and 49) and Pentamannoside (50)

Increasing the proportion of mannosyl donor (46) compared to mannosyl acceptor (42)

in the glycosylation reaction shown in figure 3.9 increases the probability of forming

tetramannosides (48 and 49) and the pentamannoside (50) shown in figure 3.15. It was

decided to attempt the synthesis of a mixture of these larger branched mannosides as

they could also be used on the carbohydrate arrays and potentially in the production of

glycoproteins. Altering the reaction conditions in this way would also significantly

reduce the amount of material wasted in the formation of unwanted dimannosides which

would increase the overall yield of the synthesis.

Figure 3.15 Structures of tetramannosides (48 and 49) and pentamannoside (50).

The synthesis of 42 and 46 were carried out in the same manner as previously

described, however in the glycosylation step of the synthesis 7 mole equivalents (mol

eq) of acetobromo mannose (46) were used instead of 2.5 mol eq used in the synthesis

of trimannoside (41). The reaction was left stirring for 1 hour at 35°C. Initial

purification of this reaction by silica chromatography resulted in a fraction rich in all of

CHAPTER 3

94

the branched mannosides predicted (43-45, 48-50). This mixture of polymannosides

was treated with sodium periodate to remove the unwanted trimannosides (44 and 45)

and dimannosides, however no solvent system was found to adequately separate the

polymannosides (43, 48-50) on silica.

A small portion of this mixture was deacylated and purified by exclusion

chromatography trials using Bio-Gel. Some fractions did yield purified mannosides

however only very small amounts of product could be separated on each column and the

method was extremely time consuming.

After a solvent system was optimised it was possible to purify each of the

polymannosides simultaneously by HPLC (details in section 8.2.9). This method was

faster than size exclusion chromatography and much larger sample sizes could be

purified per run. A typical trace UV trace for the purification is shown in appendix 5.

This method could also be scaled up and improved upon if a preparative HPLC

instrument was employed. There was some slight separation observed between the two

tetramannosides (48 and 49) at lower column loadings, however for speed of

purification these were collected as a mixture.

Yield of trimannoside (43), tetramannosides (48 and 49) and pentamannoside (50) in

relation to aminoethyl mannoside (42), were 10.2%, 12.9% and 2.7% respectively. The

main losses in yield were through unwanted dimannoside and trimannoside formation.

It is also worth noting that approximately 90% of the acetobromo mannose was lost

through various side products. However, considering the complexity of the products

produced in just one glycosylation step, an overall yield of 25.8% with respect to

aminoethyl mannoside (42) was considered acceptable.

CHAPTER 3

95

3.5 Activation of Glycosides for Glycosylation of Cysteines

Figure 3.16 Conversion of aminoethyl mannoside (27) in to mannosyl iodoacetamide (28) via reaction

with iodoacetic anhydride in sodium bicarbonate buffer.

Each aminoethyl glycoside used for protein derivatisation was activated for reaction

with cysteine by reaction with iodoacetic anhydride as shown in figure 3.16 (full detils

in section 8.2.8). In addition to the glycosides mention in this chapter aminoethyl

lactose (51) donated by Dr R. Sardzik (The University of Manchester), shown in figure

3.17, was also converted to its corresponding glycosyl iodoacetamide.

Figure 3.17 Structure of aminoethyl lactose (51) donated by Dr R. Sardzik (The University of

Manchester).

Product formation was confirmed by HRMS (summarised in table 3.1) and then stored

at -20°C to avoid additional hydrolysis of the products. The structures of all glycosyl

iodoacetamides produced in this way (28, 52-55) are shown in figure 3.18. To maximise

yield it was important to keep the reaction time and time between desalting and

lyophilisation a short as possible to reduce product hydrolysis. Care was taken to

maintain a pH below 8 as a higher pH also resulted in reduced yields. An m/z peak

corresponding to the hydrolysed product was usually observed, but yields of over 90%

were possible.

CHAPTER 3

96

Figure 3.18 structures of glycosyl iodoacetamides produced; mannosyl iodoacetamide (28), glucosyl

iodoacetamide (52), galactosyl iodoacetamide (53), glucosamine iodoacetamide (54) and lactosyl

iodoacetamide (55).

Calculated Mass (Da) Measured Mass (Da) Glycosyl

Iodoacetamide

[M + H]+ = 392.0206

[M + Na]+ = 414.0026

[M + Na]+ = 414.0025 28

[M + H]+ = 392.0206

[M + Na]+ = 414.0026

[M + Na]+ = 414.0025 52

[M + H]+ = 392.0206

[M + Na]+ = 414.0026

[M + Na]+ = 414.0025 53

[M + H]+ = 433.0472

[M + Na]+ = 455.0291

[M + Na]+ = 455.0292 54

[M + H]+ = 554.734

[M + Na]+ = 576.0554

[M + Na]+ = 576.0556 55

Table 3.1 Summary of HRMS data of glycosyl iodoacetamides produced; mannosyl iodoacetamide (28),

glucosyl iodoacetamide (52), galactosyl iodoacetamide (53), glucosamine iodoacetamide (54) and

lactosyl iodoacetamide (55).

3.6 Summary

In this chapter we have described the synthesis of four biologically relevant

monosaccharide aminoethyl glycosides (27, 32-34) and a trisaccharide aminoethyl

glycoside (41) similar to the N-linked glycan trimannose core. All of these glycosides

are suitable for the use on carbohydrate arrays or conversion to their corresponding

glycosyl iodoacetamides for use in the synthesis of neoglycoproteins. All of these

CHAPTER 3

97

glycosides are also biologically relevant due to their anomeric configurations being the

same as naturally occurring terminal glycans. Full details of all of the syntheses

discussed in this chapter can be found in chapter 8.2. The synthesis and purification of

tetramannosides (48 and 49) and pentamannoside (50) was also explored.

98

Chapter 4: The Glycosylation of GFPuv

Mutants

CHAPTER 4

99


α-halocarbonyl compounds are straightforward to prepare and can be used to create

linkages, similar to that of naturally occurring N-linked glycans.181,182

These compounds

have been widely used in the synthesis of neoglycoproteins and require only that the

acceptor protein contains a cysteine at the desired glycosylation site. Whilst chloro and

bromoacetamides are more stable to hydrolysis and provide an increased

selectivity,125,132,183

we have opted for the use of the more reactive and more commonly

used iodoacetamides.130,181,184

Figure 4.1 shows the reaction of an iodoacetamide with a

peptide containing a cysteine residue under the conditions originally reported.

Figure 4.1 The chemical glycosylation of a peptide with an iodoacetamide, under conditions originally

reported.181

In previous chapters the synthesis of a range of glycosyl iodoacetamides for the

chemical glycosylation of proteins has been described. We have also discussed the

production of multiple cysteine mutants of GFPuv. In this chapter we bring these two

elements together to produce neoglycoproteins for the use in lectin binding assays. It is

essential that we have homogenously glycosylated glycoproteins to obtain meaningful

results, therefore it is crucial that the glycosylation reaction can be accurately

monitored. Electrospray ionisation mass spectrometry (ESI-MS) is a “soft” ionisation

method and very accurate, making it the method of choice for protein and glycoprotein

mass spectrum analysis.

4.2 Analysis of Protein samples by ESI-MS

Benchmark spectra were acquired using horse heart myoglobin (HHM). HHM is a very

stable protein, commercially available and a commonly used calibrant for ESI. A

sample spectrum acquired for this protein is shown in figure 4.2.A and the

CHAPTER 4

100

corresponding deconvoluted mass spectrum, produced by the software is also shown

(figure 4.2.B).

Figure 4.2 A) The acquired spectrum of horse heart myoglobin (HHM), containing the multiply charged

protein peaks of the “charge envelope.” B) The deconvoluted spectrum of HHM produced by MassLynx

4.0.

Sample preparation was very important, to obtain clean, accurate mass spectra of

GFPuv mutants by direct injection MS. The first consideration was that the samples

were sufficiently pure to obtain a clear spectrum. This involved removal of buffer salts,

imidazole (from purification by IMAC) and unreacted iodoacetamides, in the case of

derivatised samples. The second consideration was that the protein concentration was

high enough to provide a sufficient noise to background ratio for the data processing to

be successful.

CHAPTER 4

101

Initially samples of GFPuv were prepared by precipitation in acetone/methanol

followed by resuspended in deionised water (details in section 8.3.2). Direct injection of

the resulting solution resulted in mass spectra which could be used to accurately

determine the molecular mass of GFPuv mutants. Table 4.1 shows examples of the

accuracy achieved with this method and the measured mass of HHM for the

corresponding calibration.

Protein Species Calculated Mass (Da) Measured Mass

(Da) Mono-isotopic Average

WT 32463.86 32484.31 32485.2

E6C 32437.82 32458.34 32458.6

C48A 32431.89 32452.25 32452.7

I229C 31852.49 31882.63 31883.0

HHM 16951.49 (Literature value (Lit.))185

16951.6

Table 4.1 Calculated and measure mass values for GFPuv mutants and horse heart myoglobin (HHM).

Preparing protein samples in this way was useful for initial MS experiments, mainly

because it provided concentrated and significantly desalted samples in one step.

However, these samples often did not completely redissolve and the yields of protein

obtained were therefore inconsistent. The spectra obtained were not as clear as those of

HHM at the same concentration, which was assumed to be partly due to the mass

difference of the proteins, but incomplete desalting was also suspected to be a factor.

To improve the quality of mass spectra obtained of GFPuv samples, different methods

of sample preparation were explored. The use of a PD-10 desalting column was found

to be very successful for buffer exchange of GFPuv samples. Once found to be effective

PD-10 columns were used for buffer exchange before reactions, removal of unreacted

iodoacetamides (to quench reactions) and desalting samples prior to MS analysis. This

method completely removes unwanted salts from samples, which improved the quality

of the mass spectra obtained. The process was reproducible and did not involve the

CHAPTER 4

102

precipitation and problematic resuspension of protein, therefore yields were

quantitative. Buffer exchange also allowed for complete removal of imidazole after

purification so that the concentration of protein could be more easily determined. The

only disadvantage of this method of protein preparation was that a separate

concentration step (using a vivaspin, 10 kDa, spin filter), was often required. Protein

concentration in this manner was often more time consuming than precipitation, but

generally resulted in higher protein yields and was more appropriate for production of

useful glycoproteins.

Reducing Agents

Reducing agents are frequently used on proteins prior to alkylation reactions to prevent

aggregates and maximise the efficiency of derivatisation.1,186

Some of the most

commonly used in the reduction of proteins are dithiothreitol (DDT), 2-mercaptoethanol

and tris(2-carboxyethyl)phosphine (TCEP).

Initial treatment of GFPuv samples with DTT or TCEP showed no change in the mass

spectrum before and after treatment with reducing agent. For this reason it was believed

that reduction of GFPuv mutants before glycosylation was unnecessary. However, after

time it became clear that some samples did not give as clear a spectrum as others and

this could usually be improved by reduction. Example spectra of GFPuv_E6C both

before and after reduction with TCEP are shown in figure 4.3. To maintain consistency

between reactions all samples were treated with TCEP prior to glycosylation.

CHAPTER 4

103

Figure 4.3 A) The ESI mass spectrum of GFPuv_E6C before to treatment with TCEP. B) The ESI mass

spectrum of the same sample of GFPuv_E6C after treatment with TCEP.

TCEP was chosen as our preferred reducing agent because it reacts stoichiometrically

with thiols, in under 10 minutes, at room temperature (r.t.) It is also more stable to

oxidation than other reducing agents such as DTT. TCEP also does not react with metal

ions, making it suitable for use on proteins purified by nickel chelating chromatography.

It was originally believed that TCEP did not react with α-halocarbonyl compounds

although it is now known to do so. However, as such low concentrations are required

for rapid reduction, the removal of TCEP before reactions is not necessary.186-188

CHAPTER 4

104

4.3 Cysteine Reactivity Screen

It was decided to test the reaction of the original GFPuv mutants produced with

commercially available iodoacetamide (56) to conserve the glycosides synthesised in

chapter three. The aim was to determine which of the three cysteines (C6, C48 and

C229) were reactive to α-halocarbonyls and to optimise the reaction (shown in figure

4.4) before undertaking glycoprotein synthesis.

Figure 4.4 The reaction of mutant GFPuv_E6C with iodoacetamide in ammonium carbonate buffer.

Four GFPuv mutants were chosen for this initial screen to assess the reactivity of the

mutants produced by site directed mutagenesis; GFPuv_WT, GFPuv_E6C,

GFPuv_I229C and GFPuv_E6C_I229C. Each of these mutants was purified as

described in section 8.1.3, and treated with TCEP before derivatisation (details in

section 8.3.1). Samples were removed at time points of 0, 1, 2, 5 and 24 hours and

immediately buffer exchanged in to deionised water to quench the reaction. Example

mass spectra taken of samples from the reaction of GFPuv_E6C_I229C with

iodoacetamide (56) are shown in figure 4.5.

CHAPTER 4

105

Figure 4.5 Deconvoluted mass spectra (31700-32100 Da) of samples taken from the reaction of 0.1 mM

GFPuv_E6C_I229C with 1 mM iodoacetamide (56). A) Mass spectrum after 0 hours. B) Mass spectrum

after 1 hour. C) Mass spectrum after 5 hours. D) Mass spectrum after 24 hours.

From these spectra it is evident that only two molecules of iodoacetamide (56) have

reacted with each of the protein species. This suggests two of the cysteines present in

this mutant are unreactive to iodoacetamides under these conditions. It was suspected

that C70 would be unreactive as it is buried in GFPuv’s hydrophobic core. From the

data collected from these initial reactions (summarised in table 4.2) it can be deduced

that C48 is not reactive to iodoacetamides under these conditions either. It should be

noted that the expected mass difference corresponding to the addition reaction of

iodoacetamide (56) would be +57 Da. The fact that none of the additions are exactly

+57 or multiples thereof is due to slight variations in the calibration used before and

after the reactions.

CHAPTER 4

106

GFPuv

Mutant

Measured mass at time point

(Da)

Mass

Difference

(Da)

Cysteines

reacted

0 h 24 h

WT 32486 32488 +2 0

E 32460 32519 +59 1

I 31885 31943 +58 1

EI 31859 31974 +115 2

Table 4.2 Summary of the results of the reaction of four GFP mutants (0.1 mM) with iodoacetamide (56)

(1 mM) over 24 hours. In each case the mass corresponds to the only significant peaks present in the mass

spectra.

4.4 Final Glycosylation Procedure

The unspecific reaction of glycosyl iodoacetamides with proteins has been previously

reported.130

This issue can reportedly be solved by the addition of imidazole to the

reaction buffer. For these reasons and the simplification of our glycoprotein synthesis it

was decided that glycosylation reactions with glycosyl iodoacetamides should be

carried out in the same buffer used to elute proteins from their IMAC columns during

purification. This avoids a buffer exchange step between purification and glycosylation

and also greatly reduces the chances of any unwanted glycosylations which may occur.

The finalised glycoprotein preparation protocol is shown in figure 4.6 and only requires

one buffer exchange step, in which the glycoprotein can be eluted in a suitable buffer

for its desired use (details section 8.3.1).

CHAPTER 4

107

Figure 4.6 The finalised procedure for glycosylation of all GFPuv mutants.

4.5 Analysis of Protein Samples by LCMS

For the preparation of a wide range of neoglycoproteins for screening purposes it was

preferable to have a rapid and reliable method for analysis of products. While the direct

injection method used previously was accurate, it required careful sample preparation

and a large amount of material (50 µg or more) to produce clear spectra. For these

reasons a semi automated liquid chromatography MS (LCMS) method was developed

on a separate instrument.

The Agilent 1100, HPLC system coupled to the Agilent 1100 LC/MSD SL quadrupole

mass spectrometer, allowed for the purification and simultaneous MS and ultraviolet

(UV) measurement of analytes. This allowed buffer salts and other small molecules to

pass through the column prior to MS analysis, increasing the resolution of the spectra

and preventing unnecessary contamination of the detector. Typically only 1 µL of 0.5

CHAPTER 4

108

mg/mL protein sample was required for a clear mass spectrum on this instrument (0.5

μg).

Figure 4.7 is an UV (205 nm) trace from an example LCMS run of a GFPuv mutant in

glycosylation buffer. The UV spectrum shows a large peak (corresponding to buffer

salts) between 1 and 3 minutes after injection of the sample, followed by an interval of

approximately 7 minutes before a second peak is seen. This second peak corresponds to

the protein being eluted from the column into the detector. MS analysis was only carried

out between 10 and 15 minutes after injection of the sample to minimise instrument

contamination.

Figure 4.7 UV (205 nm) trace of a typical LCMS run of a GFPuv mutant.

Data collected in this manner produced a charge envelope of multiply charged protein

species that could be deconvoluted in the same manner as the data obtained by direct

injection. This method removed the need for lengthy sample preparation techniques and

drastically reduced waste protein (over 100 times less protein required for a clear

spectrum). Although each LCMS run took 30 minutes, where as the direct injection

measurements only took 10 minutes per sample, the lack of preparation time and

increased reproducibility more than compensated for this. The masses of each mutant

CHAPTER 4

109

produced were measured using this method (results summarised in table 4.3) and all

future glycosylation reactions were monitored in this way (details in section 8.3.2).

GFPuv

Mutant

Calculated Mass (Da) Measured Mass (Da)

Mono-isotopic Average

WT 32463.86 32484.31 32481.58

E 32437.82 32458.34 32456.00

I 31852.49 31882.63 31878.14

EI 31836.46 31856.65 31854.35

B10 32426.75 32447.33 32447.86

C5 32458.67 32479.41 32477.85

D1 32421.81 32442.23 32438.10

D5 32435.81 32456.32 32453.70

F1 32447.86 32468.31 32467.70

F11 32438.77 32459.28 32456.89

G1 32411.74 32432.21 32430.51

G3 32410.78 32431.27 32432.16

S6 32432.63 32453.32 32451.72

HHM 16951.49 (Lit.)185

16951.28

Table 4.3 Calculated and measure mass values for GFPuv mutants and HHM using an Agilent 1100,

HPLC system coupled to an Agilent 1100 LC/MSD SL quadrupole mass spectrometer.

4.6 Production of Neoglycoprotein Library

For initial lectin binding assays a range of glycoproteins were synthesised containing 1-

4 glycans at various positions on the GFPuv scaffold. All selected mutants were

glycosylated using the method previously described in this chapter (details in section

8.3.1) with both mannosyl iodoacetamide (28) and galactosyl iodoacetamide (53).

Samples were then analysed by LCMS before glycosylation to confirm their purity and

CHAPTER 4

110

again after glycosylation (details in section 8.3.2). If the reactions were found not to be

complete, additional glycosyl iodoacetamide was added and the reaction left to continue

for a further hour before further analysis.

The mass spectra and deconvoluted spectra of GFPuv_C5 before and after glycosylation

with mannosyl iodoacetamide (28) are shown in figure 4.8. The observed mass

difference is 1059 Da, which fit well with the predicted increase of 1052 Da which

would correspond to the addition of four mannosyl moieties. This was the result we

were hoping for because it means that all four cysteine introduce are reactive in this

mutant.

Figure 4.8 A) Measured mass spectrum of GFPuv_C5. B) The deconvoluted molecular ion peak of

GFPuv_C5. B) Measured mass spectrum of GFPuv_C5 after reaction with mannosyl iodoacetamide (28).

D) The deconvoluted molecular ion peak of GFPuv_ C5 after reaction with mannosyl iodoacetamide (28).

CHAPTER 4

111

4.7 Glycosylation of Lysines

Although the main aim of this project was to produce homogeneous neoglycoproteins

by glycosylating GFPuv mutants via their cysteines, it was recognised that

glycosylating all of GFPuv’s lysines could also produce useful products. GFPuv has 16

surface lysines and glycosylating all of these residues would yield a glycoprotein that

could be screened alongside the proteins glycosylated via their cysteines. The

interactions of these unspecifically glycosylated products with carbohydrate binding

proteins could to provide interesting results when compared to the interactions of our

specifically glycosylated glycoproteins. Glycoprotein made in this manner could also

potentially be used in cell labelling studies. It is of course possible to synthesise

glycosides with linkers reactive to primary amines by a variety of methods.121

However,

it was decided to explore methods using our aminoethyl glycosides for reaction with

lysines to avoid additional syntheses.

The possibility of increasing the reactivity of lysine residues towards iodoacetamides by

first activating them with another linker was explored. It was decided that derivatising

lysines so that they become cysteine mimics would be our favoured approach. This

facilitated the used of our existing glycosylation protocol and only required a short

additional step in glycoprotein synthesis. 3,3 -dithiobis (sulfosuccinimidylpropionate)

(DTSSP) (57) is a commercially available, water soluble, reversible, crosslinker

(structure shown in figure 4.9) that was found to suit our requirements.

Figure 4.9 The structure of 3,3 -dithiobis(sulfosuccinimidylpropionate) DTSSP. Produced by

thermo scientific as a reversible protein crosslinker.

GFPuv_WT samples were reacted with DTSSP as recommended in the manufacturer’s

instructions. The upper limit of the recommended DTSSP concentrations were used in

CHAPTER 4

112

conjunction with relatively low GFPuv concentrations to ensure the maximum amount

of lysines were derivatised and reduce the probability of intermolecular crosslinking

which would result in aggregation. Some precipitate was observed, but this always

redissolved once the crosslinkers were reduced.

DTT (50 mM) or 2-mercaptoethanol (5% volume) were recommended to reduce the

crosslinkers, but TCEP (10 mM) was found to be much more effective. However it was

essential that extra buffering capacity be introduced to the solution before the addition

of TCEP or the solution became too acidic and the protein would denature. Typically

the addition of 10% volume of 500 mM Tris buffer was sufficient. After reduction of

the crosslinkers the protein solution could be buffer exchanged into IMAC elution

buffer ready for glycosylation as described previously. The general scheme for the

modification of lysine with TCEP followed by reduction to produce a thio modified

lysine is shown in figure 4.10 (details in section 8.3.1).

Figure 4.10 The reaction of GFPuv with DTSSP followed by the reduction of the disulfides within the

crosslinkers by TCEP to give thiol modified lysines.

Analysis of these products by LCMS was unsuccessful, likely due to a mixture of

several different protein species with varying numbers of crosslinkers and glycosides

attached. Example MALDI spectra of these products are shown in figure 4.11 along

with the MALDI spectra of the starting material (GFPuv_WT) for comparison. The

average increase in mass after treatment with DTSSP followed by reduction with TCEP

was 1079 Da. This corresponds to the modification of an average of 12.16 lysines per

protein. The average increase in mass after this protein sample was subsequently treated

with mannosyl iodoacetamide (28) was 2829 Da. This corresponds to the average

addition of 10.75 mannoside residues to each protein. After each reaction the mass

CHAPTER 4

113

peaks became much broader, indicating an increase in homogeneity, which was

expected given the nature of these modifications. The efficiency of these reactions was

considered acceptable for the production of polyglycosylated GFPuv reference samples,

for use in initial assays. GFPuv samples derivatised with approximately 10 glycosides

were expected to provide a significant binding comparison to the more defined

glycoproteins containing between one and four glycoside modifications. Samples

prepared in this way were termed GFPuv_CL (cross linked GFPuv).

Figure 4.11 MALDI spectra of GFPuv_WT (blue), GFPuv_CL (GFPuv_WT after treatment with DTSSP

followed by reduction with TCEP) (red) and GFP_CL_Man10 (GFPuv_WT derivatised with

approximately 10 mannosides) (green).

4.8 Summary

In this chapter we have described a simple method for the analysis of protein samples

by direct injection MS. We have also described a more sensitive and efficient method of

analysing proteins by LCSM. This method has been shown to be suitable for the

CHAPTER 4

114

monitoring of protein glycosylation reactions and determining the level of glycosylation

present in the products. LCMS analysis greatly reduces the amount of protein needed

for analysis while at the same time eliminating the need for additional purification steps

before analysis of samples.

The optimisation of a reproducible glycosylation procedure of cysteines with

iodoacetamides has been described in this chapter. The final procedure eliminates the

need for buffer exchange after protein purification by IMAC and only requires the use

of a Pd-10 desalting column to quench and purify the reaction mixture. In addition to

the selective glycosylation of cysteines a method for the non specific glycosylation of

lysines using iodoacetamides has also been described. This method has been shown to

produce GFPuv samples with an average of over 10 glycosylations per protein molecule

using GFPuv_WT (which contains no reactive cysteines). Further details of the

procedures described in this chapter can be found in section 8.3.

115

Chapter 5: The Enzymatic Modification of

Glycosides

CHAPTER 5

116

5.1 Glycotransferase Screening on Trimannoside (41)

The synthesis of trimannoside (41) was undertaken to provide polyvalent glycosides

suitable for microarray or glycoprotein attachment if required. Trimannoside (41) also

provided a potential substrate for some glycotransferases. If this glycoside was accepted

as an N-glycan core mimic then it could provide a route to more complex glycan

syntheses or a screening tool for novel enzymes. It is known that the diacetylchitobiose

tail of N-glycans is not essential for N-acetylglucosaminyltransferase I (GnT-I) activity,

but whether a β-linked mannose is required or how the aminoethyl linker would be

tolerated remained unknown.178,180

5.1.1 Screening of Mannosides Against Glycotransferases

Figure 5.1 Structures of aminoethyl mannosides (27 and 41) used for glycotransferase screening.

It was decided to undertake the initial screening of trimannoside (41) and aminoethyl

mannose (27) (structures shown in figure 5.1) using GnT-I (donated by Dr. S.

Gluchowska, Trinity College Dublin) and protein-O-mannose N-

acetylglucosaminyltransferase I (POMGnT-I) (donated by Dr P. Both, University of

Manchester) to assess their potential as glycotransferase substrates. GnT-I occurs

naturally in the Golgi of eukaryotic cells and transfers a GlcNAc moiety from UDP-

GlcNAc to an α-1,3-linked mannose of the Man5GlcNAc2 (58) N-linked glycan core to

produce structure 59 (Man5GlcNAc3) (reaction shown in figure 5.2).189

CHAPTER 5

117

Figure 5.2 The natural action of N-acetylglucosaminyltransferase (GnT-I) on the N-glycan core structure

Man5GlcNAc2 (58).

POMGnT-I is an extracellular enzyme that transfers a GlcNAc moiety from UDP-

GlcNAc to O-linked mannopeptides (reaction shown in figure 5.3).190

Neither enzyme

was expected to react with aminoethyl mannose (27) and POMGnT-I was not expected

to react with either mannoside. However we were hopeful that GnT-I would show some

activity towards the trimannoside (41) as some activity had been observed against

similar trimannosides [mannotriose-di-(N-acetyl-D-glucosamine) (60) and 3α,6α-

mannotriose (61) (figure 5.4)].

Figure 5.3 The natural action of protein-O-mannose N-acetylglucosaminyltransferase I (POMGnT-I) on

an O-linked glycopeptides.

CHAPTER 5

118

Figure 5.4 Known substrates for GnT-I (donated by Dr. S. Gluchowska, Trinity College Dublin).

Mannotriose-di-(N-acetyl-D-glucosamine) (60) and 3α,6α-mannotriose (61) (commercially available

from Sigma).

Matrix assisted laser desorption ionisation-time of flight (MALDI-TOF) MS of

immobilised carbohydrates has previously been used to monitor enzymatic reactions.191

The sensitivity of MALDI-TOF MS means that only small amounts of material are

required for each assay making it well suited for the use of hard to synthesise

compounds such as polysaccharides.

Gold plates coated in alkanethiol spacers (HS-(CH2)17-EG3-OH) and linkers (HS-

(CH2)17-EG6-OCH2COOH) can be used to produce a self assembled monolayer (SAM),

which can then be derivatised with amine fictionalised carbohydrates. These SAMs can

be tailored to produce carbohydrate arrays of different densities by varying proportion

of the carboxylic acid terminal (linker) molecules present in the layer.

Gold plates were coated with SAMs containing alkanethiol spacers and linkers in a

ration 4:1 as described in section 8.4.1. Formation of these monolayers was verified by

MALDI-TOF MS. A sample spectrum shown in figure 5.5 has the expected peaks

corresponding to a successful SAM formation. Peak A corresponds to the homodimer of

two spacer molecules linked by a disulphide bond (m/z = 862). Peak B corresponds to

CHAPTER 5

119

the heterodimer of a spacer molecule linked to a linker molecule by a disulphide bond

(m/z 1052).

Figure 5.5 MALDI-TOF spectrum of a 1:4 (linker:spacer) SAM on gold. A = mass peak corresponding to

a spacer-spacer homodimer. B = mass peak corresponding to a spacer-linker heterodimer.

Trimannoside (41) and mannoside (27) were then immobilised on separate parts of a

SAM coated gold plate as described in section 8.4.1 to produce two different

carbohydrate arrays. The reaction of trimannoside (41) with the activated SAM is

shown in figure 5.6.

CHAPTER 5

120

Figure 5.6 The reaction of trimannoside (41) with an activated SAM on a gold plate to form a

carbohydrate array.

MALDI-TOF MS analysis of the carbohydrate arrays produced showed the expected

mass peaks A (m/z = 862) and B (m/z 1052) corresponding to the SAMs and additional

peaks corresponding to the addition of the carbohydrate structures to some of the linker-

spacer heterodimers. MALDI-TOF MS spectra of the trimannoside (41) and mannoside

(27) arrays are shown in figures 5.7 and 5.8 respectively. Attachment of both glycosides

was found to be successful and clean. In figure 5.7 the hetrodimer coupled to

trimannoside (41) is labeled peak C (m/z = 1581). In figure 5.8 the heterodimer linked

to mannoside (27) is labeled D (m/z = 1257).

CHAPTER 5

121

Figure 5.7 MALDI-TOF MS spectrum of trimannoside (41) carbohydrate array. A = mass peak

corresponding to a spacer-spacer homodimer. B = mass peak corresponding to a spacer-linker

heterodimer. C = peak corresponding to a heterodimer covalently bound to trimannoside (41).

CHAPTER 5

122

Figure 5.8 MALDI-TOF MS spectrum of mannoside (27) carbohydrate array. A = mass peak

corresponding to a spacer-spacer homodimer. B = mass peak corresponding to a spacer-linker

heterodimer. D = peak corresponding to a heterodimer covalently bound to mannoside (27).

To test the enzyme activity of GnT-I and POMGnT-I against the carbohydrate arrays

produced they were incubated with solutions of GnT-I or POMGnT-I in a solution of

UDP-GlcNAc as described in section 8.1.4. The MALDI-TOF MS spectrum of a typical

trimannoside (41) carbohydrate array both before and after treatment with GnT-I is

shown in figure 5.9. In 5.9A the only two peaks correspond to the mass of the

trimannoside (41) attached to the hetrodimer (m/z = 1559) and the corresponding

sodium adduct (m/z = 1581). After treatment with GnT-I and UDP-GlcNAc the

predicted peak corresponding to the addition of a GlcNAc moiety to trimannoside (41)

attached to the heterodimer (m/z = 1762) and its sodium adduct (m/z = 1784) were

observed (Figure 5.9.B). Dr P. Both (The University of Manchester) collaborated with

these enzymatic reaction and assisted with the preparation of the carbohydrate arrays.

CHAPTER 5

123

Figure 5.9 A) MALDI-TOF spectrum of trimannoside (41) attached to a SAM on gold. B) MALDI-TOF

spectrum of trimannoside (41) attached to a SAM on gold after treatment with GnT-I and UDP-GlcNAc.

R= SAM spacer-linker hetrodimer.

POMGnT-I did not modify trimannoside (41) under the conditions used and neither

POMGnT-I or GnT-I modified mannoside (27). Although only a small proportion of the

trimannoside (41) was seen to react (figure 5.9.B), the reactivity was comparable to that

of commercially available mannotriose-di-(N-acetyl-D-glucosamine) (60) under the

same conditions, which suggests the β-mannose linage is not essential for GnT-I

recognition.

5.1.2 Screening of Mannosides Against Yeast Microsomal Extracts

Much is known about the N-linked glycosylation pathways in eukaryotes, but the

specificity of glycosidases and glycotransferases with respect to the trimannoside (41),

when immobilised on a carbohydrate array are unknown. Identifying any other enzymes

which show activity on the trimannoside (41) itself or the product of its reaction with

GnT-1 would provide a synthetic route to more complex glycosides. However,

purifying and screening every known candidate would be extremely time consuming.

CHAPTER 5

124

Crude microsomal extracts from yeasts or higher organisms have previously been used

to modify synthetic glycans and glycoconjugates.192-195

These extracts contain a variety

of glycotransferases and can be used as a relatively quick source of active enzymes. If

modification of the mimetic trimannoside core (41) could be achieved using microsomal

extracts we hoped to investigate the effect of different UDP-sugars being available to

the enzymes contained and potentially the organism that the microsomes were extracted

from. Yeast microsomal extracts were prepared by Dr P. Both (The University of

Manchester), who also helped perform the experiments the subsequent experiments on

the SAM-coated gold plates.

Multiple experiments were performed on the immobilised mannoside (27) and

trimannoside (41), in the presence of UDP-GlcNAc, UDP-Glucose, GDP-Mannose or a

mixture of all three. Microsomal extracts were pretreated with swainsonine to inhibit

mannosidases that would be present in the cell extracts and could cleave mannose

residues from the trimannoside (41) or other potential products. However no

modifications were detected under the conditions used (full details section 8.4.1). This

suggest that either the mannosides (27 and 41) are not substrates for any other the

enzymes present in the yeast microsomal extracts or that active enzymes were not

present in high enough concentrations to produce a detectable amount of product.

5.2 Modification of Lactosylated GFPuv Using Tran-sialidase

Sialic acid-binding immunoglobulin-type lectins (Siglecs) play an important role in a

variety of cellular interactions including inflammatory and immune response.196,197

Sialyllactose coated carbohydrate arrays have previously been shown to bind Siglec

expressing cells,191

therefore GFPuv attached to multiple sialyllactose moieties could

potentially be used to label cells in a similar way.

CHAPTER 5

125

Figure 5.10 Structure of aminoethyl sialyllactose (63).

Chemical synthesis of aminoethyl sialyllactose (63) (structure shown in figure 5.10)

would be significantly more difficult than the synthesis of aminoethyl lactose (51).

However using a trans-sialidase enzyme from Trypanosoma cruzi (TcTs) to selectively

transfer a sialic acid moiety from a donor glycoprotein such as fetuin to a galactose

terminal glycan is relatively straightforward. This reaction forms an α-(2,3)-glycosidic

bond between Gal and sialic acid moieties to produce a recognisable glycan for Siglec

recognition (reaction shown in figure 5.11).191

Figure 5.11 The reaction of immobilised lactose with fetuin in the presence of trans-sialidase (TcTs)

enzyme to produce immobilised sialyllactose.

Optimisation of Trans-sialidase Reaction

GFPuv_I229C was derivatised using lactosyl iodoacetamide (55) as described in section

8.4.2 to produce lactosyl GFPuv (GFPuv_I229C_Lac), on which the TcTs reaction was

optimised. Figure 5.12.A shows the deconvoluted mass spectrum of GFPuv_I229C

before glycosylation and figure 5.12.B shows the corresponding deconvoluted mass

spectrum on GFP_I229C_Lac. The observed mass increase was 429 Da which fit well

CHAPTER 5

126

with the expected increase of 425 Da corresponding to derivitisation with lactosyl

iodoacetamide (55).

Figure 5.12 A) Deconvoluted mass sprectum of GFPuv_I229C. B) Deconvoluted mass spectrum of

GFPuv_I229C_Lac.

GFPuv_I229C_Lac was treated with TcTs (provided by Dr E. Reyes, The University of

Manchester) in the presence of fetuin to produce sialyllactosyl GFPuv

(GFPuv_I229C_Lac_Neu5Ac) as described in section 8.4.2. However, TcTs also

catalyses the hydrolysis of glycosidic bond formed, therefore the reaction time must be

kept relatively low to obtain optimal yields. Samples were removed from the reaction at

half hourly time intervals to determine the optimum length of reaction to maximise the

amount of GFPuv_I229C_Lac_Neu5Ac produced. Samples were denatured using 6 M

guanidine hydrochloride to quench the reaction and then analysed by ESI-MS (results

summarised in figure 5.13). Figure 5.13.A shows the reaction after 30 minutes and

CHAPTER 5

127

illustrates the mass difference between the product and the starting material. Figure

5.13.B shows the reaction after 1 hour and illustrates the structures of

GFPuv_I229C_Lac and GFPuv_I229C_Lac_Neu5Ac. This was also the time point

when the maximum amount of product was observed. Figure 5.13.C shows the reaction

after 2.5 hours when the equilibrium is becoming less favorable to the desired product

(GFPuv_I229C_Lac_Neu5Ac).

Figure 5.13 Mass spectra of samples taken from the reaction of trans-sialidase (TcTs) with

GFPuv_I229C_Lac in the presence of fetuin. A) Reaction after 30 minutes. B) Reaction after 1 hour. C)

Reaction after 2.5 hours.

CHAPTER 5

128

It was decided to limit the length of the TcTs reactions to 1 hour, but for production of

active glycosylated GFPuv samples, the options for quenching the reaction were

limited. Guanidine hydrochloride worked well for quenching samples for analysis but

also rendered the GFPuv inactive. High temperature or extreme pH conditions known to

denature TcTs were also found not to be suitable for use with GFPuv. Size exclusion

chromatography (details in section 8.3.1) was found to separate the two proteins

effectively and GFPuv could be eluted from the column in less than 30 minutes which

was fast enough to effectively quench the reaction before the equilibrium became

unfavorable.

Glycoprotein samples prepared in this manner were analysed by ESI-MS to determine

the efficiency of the derivatisation. Analysis of the spectra suggested at least 60% of the

lactose moieties were successfully modified. This is comparable to previously reported

yields for these types of reactions.198

However it is difficult to determine the exact yield

of this process due to the lack of a truly quantitative method and the lability of the sialic

acid moiety to hydrolysis and ionisation fragmentation.

5.3 Summary

In this chapter we have described the use of enzymes to modify chemically synthesised

aminoethyl glycans on both carbohydrate arrays and when conjugated to GFPuv

mutants. Trimannoside (41) was shown to be successfully glycosylated with a GlcNAc

moiety using the enzyme GnT-I when immobilised on a SAM coated gold plate.

However attempts to used trimannoside (41) to screen glycotransferase activity from

crude yeast microsomal extracts were unsuccessful. Lactosyl iodoacetamide (55) was

shown shown to be successfully in the derivitisation GFPuv_I229C to produce

GFPuv_I229C_Lac which was then enzymatically derivitised using TcTs to produce

GFPuv_I229C_Lac_Neu5Ac. This method was optimised and could potentially be used

to create GFPuv samples suitable for Siglec labeling.

129

Chapter 6: Lectin Binding Assays

CHAPTER 6

130


Having made a library of neoglycoproteins we wanted to determine the viability of

glycosylated GFPuv as a lectin probe. Several issues needed to be addressed before

more complicated cell based assays were undertaken. Firstly it needed to be verified that

sugars attached to GFPuv were free to interact with carbohydrate binding proteins and

that the unglycosylated mutants did not interact unspecifically with target proteins. Also

it needed to be determined whether a difference could be seen in the interactions of

polyglycosylated GFPuv mutants when compared to the interactions on singly

glycosylated mutants. Additionally we hoped to investigate methods of measuring the

strength of the interaction of glycosylated GFPuv with target lectins. If this could be

done for a lectin with a known binding affinity then we could assess the effect that the

attachment of glycosides to GFPuv has on their binding.

6.2 Fluorescence Based Plate Assay

Initially we wanted a high throughput assay to determine whether or not there were

interactions between glycosylated GFPuv mutants and target lectins. Immobilising the

lectin of choice on a surface of a 96-well plate, incubating different wells with different

glycoproteins, followed by washing and then measuring the fluorescence of each well,

provided a simple method of rapidly obtaining data. Carrying out an assay in this format

allowed the use of a fluorescence plate reader to scan all wells at once and do so quickly

and reproducibly.

CHAPTER 6

131

Figure 6.1 Schematic diagram of the lectin plate assay. The protein avidin (red) is covalently bound to

the surface of a 96-well plate, which enables the capture of biotinylated lectins (blue). Glycosylated

GFPuv mutants can then interact with the immobilised lectins.

The avidin-biotin interaction (affinity constant > 1015

M-1

)199

was the method chosen to

immobilise lectins on to a 96-well plate. This is an efficient method of immobilisation

known not to inhibit the biological activity of proteins. Also several commercially

available lectins are available in biotinylated form, aiding in the reproducibility of initial

assays. This approach (depicted in figure 6.1) is also very versatile, as once optimised

any protein of interest could be biotinylated and applied to the same surface. Whole

cells can also be biotinylated in a similar way,170,200

providing quick access to simple in

vivo assays and eliminating the need for lengthy purifications of the protein of interest.

6.2.2 Lectins Chosen for Initial Screens

Only biotinylated lectins that were commercially available were considered for the

initial screening, to maximise assay reproducibility. All lectins chosen were to be

CHAPTER 6

132

screened against unglycosylated mutants, mannosylated mutants and galactosylated

mutants to provide a protein-protein interaction control and a sugar specificity control.

Concanavalin A (ConA) was chosen due to its relatively strong affinity to

monosaccharides when compared to other lectins available (approximately 1 x 104 M

-1

for Me-α-Man).201,202

Also ConA has previously been the focus of several polyvalent

interaction studies so provides a good bench mark for any data acquired on its binding

preferences.70,203

ConA is a tetrameric lectin (at neutral pH) with one carbohydrate

binding site per subunit. Due to its relative size glycosylated GFPuv (32 kDa) could

only interact with one subunit per ConA molecule (106 kDa). However ConA does

show significantly increased binding affinities for branched polymannosides; for

example it is reported to have an affinity of 2.6 x 105

M-1

(26 times that of monomeric

mannose) for some branched trimannosides.70

Additionally binding affinities of up to

5.1 x 105

M-1

(51 times that of monomeric mannose) have been reported for ConA and

some branched Man derivatised polymers.202

Galanthus nivalis lectin (GNL) is also a tetrameric lectin but it is significantly smaller

than ConA (50 kDa) and contains both a Man and dimannose binding pockets per

subunit.204

This allows for the possibility of several different polyvalent interactions

between glycosylated GFPuv mutants and individual GNL molecules. GNL has been

reported to have binding affinities of up to 3.3 x 103

M-1

for some dimannosides which

is three times less than the affinity of ConA for monomeric Man and 10 times less than

ConA for the same dimmanoside.70

Jacalin is another tetrameric lectin, approximately 64 kDa in size and known to

preferentially bind α-galactose terminal glycans. Like ConA, jacalin only contains one

binding site per subunit, however it is small enough that a polyvalent interaction with

glycosylated GFPuv_B10 may be possible. Jacalin is reported to have an adsorption

coefficient of up to 2.2 x 107

M-1

for Gal coated carbohydrate arrays which is

CHAPTER 6

133

significantly higher than the adsorption coefficient of ConA for its corresponding Man

coated carbohydrate array (5.6 x 106

M-1

).205,206

Jacalin is also known to interact with a

range of other monosaccharides including; N-acetylgalactosamine, Man, Neu5Ac and

Glc.206

6.2.3 Plate Assay Results

Samples of all mutants produced were mannosylated (α-Man) and galactosylated (β-

Gal) in preparation for this initial lectin screen as described in section 8.3.1. Firstly, all

of these samples (10 μM) were assayed against the streptavidin coated 96-well plates as

described in section 8.5.1 with no lectins present, to assess the potential for unspecific

binding between GFPuv mutants and streptavidin (results summarised in figure 6.2).

Error bars in graphs are the standard deviation from the mean over three replicates for

each reading shown.

Figure 6.2 The results of screening the interactions of unglycosylated, mannosylated and galactosylated

GFPuv mutants against streptavidin coated 96-well plates. Samples are grouped according to their

number of glycosylation sites.

CHAPTER 6

134

Under the conditions used there was relatively little unspecific binding between the

GFPuv samples and the streptavidin coated plates. The only sample that showed

significant interaction between protein and streptavidin coated plates was the

unglycosylated GFPuv_CL sample, which suggests that the linkers themselves have

some interaction with the plates. Fortunately neither glycosylated samples modified in

this way (GFPuv_CL_Gal10 and GFPuv_CL_Man10) show the same increased binding.

Therefore these samples could still be used for comparison with the other glycosylated

GFPuv mutants. The GFPuv_I229C mutant show more background binding than

GFPuv_D1 mutant and as they both are glycosylated at the same position (C229),

GFPuv_I was not included in the remainder of the assays.

For the remaining assays, in which one of the chosen lectins was bound to each plate,

the protein concentrations were adjusted so that the glycan concentration was kept

constant (10 μL). Therefore singly glycosylated mutants (E6C, D1, F1 and F11) were

assayed at 10 μM, doubly glycosylated mutants (EI, G1, G3 and D5) were assayed at 5

μM, B10 was assayed at 3.3 μM and C5 and S6 were assayed at 2.5 μM.

GFPuv_CL_Man/Gal10 were estimated to have an average of 10 glycans per protein

molecule by MALDI-TOF MS, so were assayed at 1 μM.

The results from the screening of GFPuv samples against ConA (summarised in figure

6.3) show that all mannosylated mutants interacted significantly more with ConA than

both the unglycosylated and galactosylated mutants. The fact that the F1 mutant

interacts so much more than the other singly glycosylated mutants suggest this mutant

has significantly stronger protein-protein interactions than E6C, D1 and F11. However

the fact that the unglycosylated and galactosylated F1 variants do not show this

increased binding show that the carbohydrate-protein interaction is still the deciding

factor. Most of the polyglycosylated mutants interact more than the singly glycosylated

mutants despite the lower concentrations used.

CHAPTER 6

135


GFPuv mutants against ConA coated 96-well plates. Samples are grouped according to their number of

glycosylation sites.

Mannosylated G1 and D5 show almost twice the fluorescence of mannosylated G3 and

four times the fluorescence of mannosylated E6C_I229C despite the fact they all have

two glycosylations. This suggests that the spacing of the glycosides is influential in

determining the strength of the interactions between these glycoproteins and ConA.

Additionally both mutants with four mannose residues attached (C5 and S6) and CL

with approximately 10 Man residues attached show no increased fluorescence when

compared to the best doubly mannosylated mutants. This suggests that ConA is not

capable of interacting with more than two mannosides in the way they are presented on

these glycoproteins.

CHAPTER 6

136


GFPuv mutants against GNL coated 96-well plates. Samples are grouped according to their number of


The results from the screening of GFPuv samples against GNL (summarised in figure

6.4) again show the expected preference of mannosylated GFP mutants. However the

fluorescence levels measured are significantly lower than that with ConA with the same

mutants. This suggests GNL has a lower overall affinity for mannose than ConA. Once

again the F1 mutant shows significantly higher fluorescence than the other singly

glycosylated mutants in both its mannosylated and galactosylated forms, but not in its

unglycosylated form. This suggests there are some important protein-protein

interactions occurring, but that the carbohydrate-protein interactions are again the

discriminating factor.

Interestingly the mutants with the strongest interactions with GNL (G1 and D5) are both

doubly glycosylated. This could be related to the spacing or orientation of the glycans

on these mutants but there is no discernible pattern when comparing the glycosylation

CHAPTER 6

137

site distances. For example the distances between glycosylation sites of the G1 and G3

mutants are almost identical (25 Å) and their affinities for GNL appear to be drastically

different. Potentially this difference could be due to the Man residues attached to G1

being orientated in such a way that they can both fit in to one of GNL’s dimannosides

binding sites or binding two of its binding sites seperatly.70

Surprisingly there seems to

be very little binding of the mannosylated GFPuv samples with more than two Man

residues attached (C5, S6 and CL). It is possible this trend could alter if higher GFPuv

concentrations were used. Unfortunately there were not sufficient amounts of these

samples available to repeat this assay at higher concentrations of GFPuv.


GFPuv mutants against jacalin coated 96-well plates. Samples are grouped according to their number of


The results from the screening of GFPuv samples against jacalin (summarised in figure

6.5) show a preference towards Man in some cases. Jacalin is known to have a broad

specificity to many different monosaccharides and reportedly binds more strongly to α-

Gal than α-Man. In this assay we are using β-Gal and α-Man and so this result is not

contrary to previous results. For most mutants, the sugar attached had little effect on the

CHAPTER 6

138

fluorescence measured, with glycosylated D5 and CL mutants being the exception. F1,

again stands out as the highest binding singly glycosylated mutant and shows the

expected preference for mannose. G1 and D5 again show higher fluorescence than the

other doubly glycosylated mutants. This suggests that glycosides attached to these

mutants could be more accessible for binding than for the E6C_I229C and G3 mutants.

The mutants with four or more glycosylations (C5, S6 and CL) do show more

fluorescence than the majority of the singly and doubly glycosylated mutants even at

their lower concentrations. The fact the binding is not significantly higher for the CL

mutant suggests that the presentation of the glycosides is the critical factor or that the

concentrations used on the assay are too low to provide an effective comparison.

Additional assays with a larger range of concentrations would be useful in determining

the effect of polyvalent presentation; however there were not sufficient amounts of these

samples available to repeat this assay at higher concentrations of GFPuv.

6.2.4 Fluorescence Based Assay Summary

More could be done to improve the quality of the data gained from the fluorescence

based lectin plate assay. Testing a larger range of concentrations would give more

detailed information on the effect of degree of glycosylation of glycoproteins.

Specifically it would be useful to determine whether the surprisingly low fluorescence

measurements for the mutants B10, C5, S6 and CL were only due to the concentrations

used in the assay. Unfortunately there was insufficient time to prepare new batches of

the glycoproteins required for this.

The results from the assays performed do demonstrate that glycosylated GFPuv mutants

can be used to probe lectin specificity. The attached glycans are evidentially available

for lectin binding because in each assay the glycosylated mutants achieved significantly

higher fluorescence measurements than the unglycosylated mutants. Also discrimination

was clearly shown between Man and Gal by both ConA and GLN. Therefore

CHAPTER 6

139

glycosylated GFPuv mutants do provide a simple and effective method of screening

lectin specificity. Additionally some potential mutants of interest were identified for

further investigation such as the F1, G1 and D5 mutants. These mutants gave

significantly higher readings when compared to other glycoproteins with the same level

of glycosylation with each of the lectins tested.

The sensitivity of this assay in its current format is not good enough to determine the

preference of Jacalin for α-Man over β-Gal with certainty. Both sugars are known to

bind Jacalin, but previous studies suggest Me-α-Man has a significantly higher affinity

than Me-β-Gal.207,208

The main issue is that once bound to the plate, it seems difficult to

remove GFPuv mutants. This is demonstrated by the unexpectedly high binding

observed by singly glycosylated mutants when compared to mutants with more glycans

attached. Whether this is a result of protein-protein interactions or GFPuv aggregation

on the surfaces is unclear. It is possible this could be overcome by including sugars in

the washing buffer used. However we did not have sufficient material available to

undertake these experiments.

The assay in its current form can determine that there are interactions between GFPuv

mutants and the immobilised lectins, but it is not possible to quantify the strength or

type of interactions occurring with the current data. Reproducibility between triplicate

measurements was quite good but could be improved further if GFPuv concentrations

and wash buffer constitution were optimised. Another obstacle to quantifying data from

these assays is the slight variations in fluorescence measurements between GFPuv

batches prepared and GFPuv’s susceptibility to photo bleaching. To minimise this

problem it is very important to maintain consistency with the preparation and storage of

all GFPuv samples.

The results from the fluorescence based assay described do provide a qualitative

comparison of the relative binding strength of the neoglycoproteins produced and the

CHAPTER 6

140

lectins chosen. However, due to the limited amount of time available and the relatively

large amounts of glycosylated GFPuv required for this assay it was decided to

investigate the use of quantitative techniques for assessing lectin binding.

6.3 Isothermal Titration Calorimetry (ITC)

ITC is routinely used technique for the study of reactions and binding thermodynamics

and kinetics via the measurement of minute changes in heat generated by mixing two

solutions. Using ITC it is possible to measure heat changes as small as 0.1 μcal (0.4 μJ),

which allows the determination of binding constants as large as 1 x 109

M-1

.209

The

understanding of several protein-carbohydrate interactions has been improved through

the use of this methodology.70,201,202

ITC can be used not only to generate rate constants

for interactions of interest but also reveals their entropy, enthalpy and stoichiometry.209

Unlike other methods for protein-carbohydrate interaction analysis it does not require

lectin or ligand to be immobilised. Therefore the potential for unspecific binding with

surfaces is reduced and wash or blocking procedures do not need optimising.

The experimental procedure for ITC is relatively straightforward. A ligand solution of

known concentration is added to a receptor solution of known concentration. The heat

change upon mixing is measured and compared to a reference sample. However the

concentrations of each solution need to be extremely accurate and also the composition

of each solution (e.g. buffer salt concentrations) need to be identical to minimise errors.

For truly accurate measurements the heat change of mixing the two buffers alone and

the heat change of mixing either component with the buffer must also be measured and

subtracted from the heat change from mixing the ligand and receptor solutions.

To obtain meaningful thermodynamic data, a series of injections are made over time

until there is no heat change upon mixing ligand and receptor (indicating the receptor

occupancy it saturated). Figure 6.6.A shows an ideal set of responses to a series of

injections. The first injection of ligand solution into the receptor solution should induce

CHAPTER 6

141

the largest response. Each subsequent injection should induce less of a response as more

of the receptor sites are already occupied, therefore there will be a smaller energy

change upon the addition of more ligand. The experiment is over when the addition of

more ligand induces no energy change.

Figure 6.6 Ideal ITC plots. A) The raw data obtained from an ideal series of injections. B) An ideal plot

of the molar energy changes for a bivalent (N = 2) interaction.

The data obtained from a successful series of injections can be used to plot a graph such

as the one in figure 6.6.B. To do this the data is converted into the relative energy

change per Mole which is why the exact concentrations of each solution are required.

The molar enthalpy change (∆H) can be read directly from such a graph as can the

stoichiometry (N) of the interaction. The binding constant (KB) can be found from the

gradient of the graph at its steepest point. This can then be used to find the dissociation

constant (KD) by taking the inverse of this value (1/ KB). The molar entropy change

(∆S) and molar Gibb’s free energy change (∆G) can then be found using the equations

for ∆G shown in figure 6.7.

Figure 6.7 Equations for calculating Gibb’s free energy. R = The molar gas constant 8.314 J mol-1 K-1,

T = The temperature in Kelvin.

CHAPTER 6

142

6.3.1 Titration of Me-α-Man Against ConA

Initial optimisation of conditions was done using ConA and Me-α-Man to establish the

effect of dilution of both ligand and lectin. Previously published data on this interaction

was acquired using lectin and ligand concentrations in the ranges of 0.2-1 mM and 5-50

mM respectively.201,202

The higher range of these concentrations would be problematic

for proteins such as GFPuv due to its large size when compared to the monosaccharides

used in previously reported experiments. GFPuv mutants with multiple glycosylations

were expected to produce useful data at significantly lower concentrations than these.

However it was still crucial to discover the lower limits of the glycoside concentrations

that were needed on the instruments we had available to conserve our glycosylated

GFPuv samples.

The results achieved using 32 μM ConA and 5 mM Me-α-Man are shown in figure 6.8

(full details in section 8.5.2). Figure 6.8.A shows the raw titration data which shows that

each addition of Me-α-Man caused a smaller energy change when added to the ConA

solution. The decrease in the heat change upon mixing is too rapid over the first few

injections to produce a sigmoidal curve (like the graph shown in figure 6.6) in the plot

shown in figure 6.8.B. This is due to the low concentrations of ConA being used.

However the software can still calculate the desired thermodynamic constants by

extrapolating the rest of the curve. The stoichiometry of binding (N) is given at 3.6 (±

0.209), which is relatively close to the expected value of 4 (for tetrameric ConA), but

has a significant margin of error. The affinity constant (K) was calculated at 1.07 x 104

M-1

(±7.91 x 103) is in very good agreement with Lit. (1.03 x 10

4 M

-1).

202 The relatively

large error margins were likely due to the lack appropriate background calorimetric

curves which we did not undertake for these trail titrations, so could not be subtracted

from the raw data.

CHAPTER 6

143

Figure 6.8 Calorimetric data obtained from titration of native ConA (32 μM) with Me-α-Man (5 mM). A)

Raw data from 30 injections of 1 μL each of Me-α-Man into ConA. B) Integrated curve showing the line

of best fit.

The concentration of 5 mM Me-α-Man used in this experiment is still higher than

practical for GFPuv mutants. However the mutants containing multiple glycosylation

sites effectively increase the concentration of sugar in solution and increasing the

volume of each injection would also decrease the concentration required to induce the

same response. Some polyglycosylated mutants were also expected to show increased

CHAPTER 6

144

binding affinities when compared to Me-α-Man, which would also lower the

concentration required to achieve valid results.

6.3.2 Titration of GFPuv Against ConA

Having established a working concentration range from the ConA-Man interaction we

titrated GFPuv_C5_Man4 samples against ConA at a comparable concentration. We

assumed that there would be an increased binding when compared to monomeric Me-α-

Man and that having four mannosides attached to each protein would reduce the

concentration of ligand required to induce the same response by a factor of at least four.

The results achieved with 22 μM ConA and 240 μM GFPuv_C5_Man4 are shown in

figure 6.9.

Although there is significant baseline noise in this titration the software calculates a

stoichiometry (N) at 0.93 (±0.01), which is relatively close to the expected value of 1.

The affinity constant calculated from this data is 2.6 x 106 M

-1 (±3.85 x 10

5), is over 200

times that of Me-α-Man. However this figure is to be taken as a rough approximation,

due to the large margin of error calculated. This large error is likely due to the low

concentrations used and subsequent high back ground noise. The gradual increase in the

background throughout this titration also indicates that a longer interval should have

been left between injections. Unfortunately there was insufficient GFPuv_C5_Man4

available for further titrations at the time.

CHAPTER 6

145

Figure 6.9 Calorimetric data obtained from titration of native ConA (22 μM) with GFPuv_C5_Man4 (240

μM). A) Raw data from 30 injections of 1 μL each of GFPuv_C5_Man4 into ConA. B) Integrated curve

showing the line of best fit.

To determine what was measured in this titration was not protein-protein interactions or

just the heat change of mixing we performed some control titrations. Figure 6.10.A

shows the titration of the buffer used against itself to determine that there are no

unexpected heat changes for this process. Figure 6.10.B shows the titration of

unglycosylated GFPuv_C5 against ConA at the same concentrations used to obtain

binding data for GFPuv_C5_Man4. This was the control titration needed to determine if

there were significant protein-protein interactions between GFPuv and ConA. Both

titrations showed almost no heat change upon mixing which strongly suggest the heat

changes seen in the titration of glycosylated GFP against ConA were the result of

carbohydrate-protein interactions.

CHAPTER 6

146

Figure 6.10 Raw calorimetric data from 30 injections of 1 μL each of: A) ITC buffer into ITC buffer. B)

GFPuv_C5 (240 μM) into ConA (22 μM).

6.3.3 ITC Summary

The approximate concentration range for a successful ITC titration of GFPuv_C5_Man4

with ConA was established (240 μM and 22 μM respectively) and an approximate

affinity constant was determined (2.6 x 106 M

-1). The affinity constant obtained did

have a relatively large margin of error (approximately 15%) so should be treated with

caution. However this data suggests that GFPuv_C5_Man4 is has a significantly larger

binding constant than Me-α-Man of (1.03 x 104 M

-1)202

, which suggests some kind of

polyvalent interaction is occurring. The negligible heat change which occurs when

titrating unglycosylated GFPuv_C5 strongly suggests that the affinity of mannosylated

GFPuc_C5 is due to the carbohydrates attached. Therefore ITC is a valid method of

quantifying the carbohydrate-protein interactions of our neoglycoproteins.

Unfortunately we could not follow up on these initial results due to a lack of time for

preparing additional neoglycoprotein samples.

If a larger microcalorimeter was used (as is more common), a larger volume of GFPuv

could be titrated and the enthalpy changes measured would be significantly higher. This

CHAPTER 6

147

would improve the accuracy of the data obtained. Our instrument choice for initial

experiments was limited due to the volume of material available.

6.4 Summary

In this chapter a fluorescence base assay for measuring the relative binding of

glycosylated GFPuv mutants with immobilised lectins is described. This assay is

capable of rapidly generating large amounts of qualitative data and identifying

glycoproteins for more detailed analysis. It has been shown to be applicable to a three

lectins (ConA, GNL and jacalin) and has the potential to work with several others. In

the ConA and GNL assays a clear discrimination between to monosaccharides (Man

and Gal) was shown. Jacalin was demonstrated to have little discrimination between

Man and Gal, but did show a clear discrimination between glycosylated and

unglycosylated GFPuv mutants.

The fluorescence based assay described was used to identify some potential mutants of

interest for further investigation such as the F1, G1 and D5 mutants. These mutants

gave significantly higher readings when compared to other glycoproteins with the same

level of glycosylation with each of the lectins tested. This suggests that either the

orientation of the glycans on these mutants was favourable or some additional

favourable protein interactions were responsible.

The use of ITC was then investigated as a method for determining quantitative

thermodynamic data for the interactions of glycosylated GFPuv mutants with lectins.

Initial titrations have shown that a GFPuv mutant with four mannose residues attached

(GFPuv_C5_Man4) has a significantly higher affinity for ConA than Me-α-Man, which

suggests a polyvalent interaction is occurring. Unfortunately we could not follow up on

these initial results due to a lack of time for preparing additional neoglycoprotein

samples. However from these initial titrations we have shown that ITC is a valid method

of quantifying the carbohydrate-protein interactions of our neoglycoproteins.

148

Chapter 7: Conclusions and Future

Experiments

CHAPTER 7

149

7.1 Conclusions

The addition of a hexahistidine tag to GFPuv can provide a simple method for the rapid

purification of any mutant. The addition of the 52 amino acid long sequence containing

the hexahistidine tag to the N-terminus of GFPuv does not seem to hinder its use as a

lectin probe. Very high purities of GFPuv mutants are easily attainable using a IMAC

column and a stepwise imidazole gradient. If further enhancements in purity are

required, size exclusion chromatography can be used as a second purification step at the

expense of yield.

Several GFPuv cysteine mutants were created using site directed mutagenesis, but this

was time consuming and in some cases resulted in inactive mutants. DNA shuffling of

synthetic GFPuv genes (one containing 32 additional cysteine codons) provided a

relatively quick route to several new mutants including some with multiple cysteines.

Three mutants with two reactive cysteines (D5, G1 and G3), one mutant containing

three reactive cysteines (B10) and two mutants containing three reactive cysteines (C5

and S6) were generated in this manner. One mutant containing six reactive cysteines

was also generated by the site directed mutagenesis of C5 to include the E6C and I229C

mutations. The use of a fluorescence based screen of the mutants produced avoids the

sequencing of inactive mutants produced by DNA shuffling. Not only could this

approach be used to rapidly generate a much larger library of GFPuv cysteine mutants,

but could be used on other proteins of interest.

The synthesis of the branched trimannoside (41) was achieved without the use of

protecting groups on the glycosyl acceptor (aminoethyl mannoside (27)). While the

yields achieved were low (≤ 10%), we are confident they could be improved upon. The

complexity of the product and the relatively short length of this synthesis makes this

approach viable. There is also the possibility of using a similar approach for alternative

monosaccharide starting materials. Trimannoside (41) was shown to be accepted as a

substrate for GnT-I, proving the β-mannose linkage is not essential for enzyme

recognition in this case.

CHAPTER 7

150

A range of monosaccharide aminoethyl glycosides (27, 32-34) were synthesised and

fully characterised. These glycosides and aminoethyl lactose (51) (donated by Dr R.

Sardzik, The University of Manchester) can be easily converted to glycosyl

iodoacetamides capable of selective glycosylation of cysteines in a one step reaction

with iodoacetic anhydride. The naturally occurring C48 and C70 residues in GFPuv are

unreactive to iodoacetamides, but all other positions of GFPuv screened (6, 15, 30, 38,

43, 52, 105, 188, 202, 212, 221 and 229) were found to be reactive. Several mutants

with up to four reactive cysteine residues were glycosylated selectively using the

glycosides produced. This demonstrates the potential of glycosylated GFPuv constructs

to present glycosides in a polyvalent manner.

Glycosylated GFPuv mutants are suitable for simple, fluorescence based, lectin assays

in which biotinylated lectins are immobilised on avidin coated 96-well plates.

Glycosides attached via the iodoacetamide linker used are capable of interacting with

lectins bound to a surface and GFPuv’s inherent fluorescence provides a simple method

for qualitative binding analysis. Although the slight variation in fluorescence between

mutants may limit the accuracy of the relative binding strengths observed using the

fluorescence based assay described. The approach described was used to successfully

probe the specificity three lectins (ConA, GNL and jacalin) and has the potential to

work with several others. In the ConA and GNL assays a clear discrimination between

to monosaccharides (Man and Gal) was shown. Jacalin was demonstrated to have little

discrimination between Man and Gal, but did show a clear discrimination between

glycosylated and unglycosylated GFPuv mutants. More information could be gained on

the relative strengths of the carbohydrate-protein interactions of the different

neoglycoproteins produced if a larger range of concentrations was assayed.

ITC shows potential for analysing the thermodynamics of binding interactions between

glycosylated GFPuv mutants and lectins. Initial titrations have shown that a GFPuv

mutant with four mannose residues attached (GFPuv_C5_Man4) has a significantly

higher affinity for ConA than Me-α-Man, which suggests a polyvalent interaction is

CHAPTER 7

151

occurring. If a larger range of neoglycoproteins were rigorously tested in this manner

then a quantitative comparison of binding affinities could be achieved using ITC.

7.2 Future Work

The potential of glycosylated GFPuv mutants in the analysis of carbohydrate binding

protein has been explored, but further research would be needed to fully asses this

potential. A larger library of cysteine mutants would be could easily be generated using

the genes designed (Shuffle 1-3, section 8.1.2) and the DNA shuffling technique

demonstrated. Once these mutants were generated they should be screened with the

existing mutants for their tendency to aggregate when glycosylated. It is likely that

mutants containing several reactive cysteines will form intermolecular disulphide

bonds, but once derivatised they may be more or less inclined to dimerise than GFPuv.

This could have a significant impact on their measured binding constants, therefore

should be investigated for each individual mutant produced.

Once a carbohydrate binding protein of interest is selected for a detailed study using

glycosylated GFPuv a wider range of appropriate glycans should be synthesised. These

should include polyvalent glycans related to those known to bind the protein of interest

in vivo to provide a comparison to the monosaccharides currently used. This would

provide more information on the specificity of the carbohydrate binding protein of

interest. The use of glycans with a higher binding affinity for their target proteins would

also increase the sensitivity of any assays undertaken and potentially facilitate the use of

glycosylated GFPuv as a cell labelling tool.

The DNA shuffling approach described could be applied to different proteins to

facilitate their use as glycoprotein scaffolds. Although the fluorescence of GFPuv

makes it an ideal candidate for a range of applications it also has limitations. A larger

protein for example, will have the potential for the inclusion of far more cysteines and

will be able to interact with more widely spaced binding sites on carbohydrate binding

CHAPTER 7

152

proteins. Homodimers of GFPuv or GFP fusion proteins would provide a suitable

candidate for this approach.

153

Chapter 8: Experimental Details

CHAPTER 8

154

8.1 Experimental Details for Chapter 2

Unless stated otherwise, all chemicals and reagents were of analytical grade and used as

received from Sigma-Aldrich. All competent cell lines used were purchased from

Invitrogen and all enzymes used were purchased from New England Biolabs or

Novagen unless otherwise stated. DNA sequences were performed by MWG Biotech.

PCR reactions were carried out using a Mastercycler Gradient PCR-Cycler (Eppendorf).

Affinity columns used in protein purification were purchased from GE Healthcare and

purifications were carried out using an AKTA Explorer 100 FPLC (GE Healthcare).

Agarose gel electropherisis analyses and purifications were carried out using a Mini Sub

Cell GT gelchamber (Biorad) and the gels were analysed with the aid of a Safe Imager

darklite transluminator (Invitrogen).

8.1.1 General Methods

Isolation of Plasmid DNA from E. coli

A single colony containing the plasmids desired for sequencing, amplification or

transformation was used to seed 7 mL of sterile LB medium containing the appropriate

antibiotic. The culture was incubated for 16 hours at 37°C with shaking (250 rpm). The

cells were collected by centrifugation at 3220 g, for 15 minutes. The plasmids were then

purified using a Quiagen spin column DNA purification kit according to the

manufacturer’s instructions.

Transformation of E. coli strains by heat shock

A 50 μL aliquot of competent cells was transferred into a sterile 1.5 mL eppendorf tube

and placed on ice for 15 minutes. 1 μL of DNA solution or 10 μL of ligation mixture

was added and then the tube swirled gently and then left on ice for another 15 minutes.

The tube was then transferred to a 42°C circulating water bath for exactly 45 seconds

and then put back on ice for 2 minutes. 450 μL of SOC medium (pre heated to 42°C)

was added and the cells incubated at 37°C with shaking (250 rpm) for 1 hour to allow

CHAPTER 8

155

expression of the antibiotic resistance gene. The mixture was then spread on agar plates

containing the appropriate antibiotic. The plate was dried in a laminar flow hood for 5

minutes, before being incubated, inverted, at 37°C for16 hours.

Agarose Gel Electrophoresis

Agarose powder was added to 1x TAE Buffer to a final concentration of 1-2% (w/v).

The slurry was heated in a microwave oven until the agarose was completely dissolved.

Any lost volume was replaced with deionised water, the solution cooled to 60°C and

then SYBR Safe was added (10 μL to 100 mL agarose solution). The warm agarose

solution was poured into the tray and a comb was inserted until the gel was set. The gel

was then transferred into the electrophoresis tank and covered with TAE Buffer before

the comb was removed. DNA samples mixed with DNA loading buffer and then loaded

into the wells with a 1kb-ladder reference solution. Electrophoresis was carried out at

110 V for 20 minutes and the gel examined using the Safe ImagerTM

.

DNA Extraction From Agarose Gels

After agarose gel electrophoresis, the required DNA fragments were extracted using a

scalpel and purified using a QIAprep Spin Miniprep kit (Qiagen) as described in

producers manual.

DNA Digestion with Restriction Endonucleases

DNA digestions were carried out according to the manufacturer’s instructions.

Typically 3 μg of DNA was digested with 5 U of restriction enzyme. Specific buffers

provided with the enzymes were used and TE buffer was added to achieve the desired

salt concentrations. Double digestions were preformed when the enzymes optimal

buffer and temperatures were compatible. Restriction digests were generally performed

on a 20-100 μL scale. Although a much larger digest was required prior to the DNA

shuffle PCR (1 mL). Incubation times and temperatures were dependant on the enzymes

CHAPTER 8

156

used. The digested DNA was analysed by agarose gel electrophoresis and isolated by

gel extraction.

Ligation of DNA

A threefold excess of insert DNA was mixed with the digested and purified plasmid to a

final volume of 10 μL (e.g. 3.9 μL insert, 3.9 μL digested plasmid DNA, 1.2 μL of T4

ligase enzyme and 1 μL 10% ligase buffer). T4 ligase enzyme and T4 ligase buffer were

added and the mixture incubated at 16°C for 16 hours.

Amplification of DNA Using PCR

Plasmid DNA were used as templates, DNA polymerase specific buffers were used and

the primers used varied depending on the section of DNA being amplified. 20 μL

reaction mixtures were made up in the appropriate polymerase buffers to the final

concentrations; 1 M Dimethyl Sulfoxide (DMSO), 0.2 mM per dNTP, 1 μM forward

primer, 1 μM reverse primer. PCRs also contained 1-10 ng template plasmid and 0.5-2.5

U of DNA polymerase according to suppliers recommendations. In vitro amplification

PCRs were performed at three different annealing temperature (52°C, 56°C and 60°C)

in a thermocycler using the following temperature-gradient program:

CHAPTER 8

157

Step No. Step Temperature Duration

1 Heating lid 105°C

2 Initial denaturation 95°C 3 minutes

3 Annealing 50°C 30 seconds

4 Elongation 72°C 3 minutes

5 Denaturation 95°C 30 seconds




9 Annealing 52°C/56°C/60°C 30 seconds

10 Elongation 72°C 3.5 minutes


12 9 repeats of steps 9-11

13 Annealing 52°C/56°C/60°C 30 seconds

14 Elongation 3.5 minutes + 5

seconds/cycle


16 24 repeats of steps 13-15 95°C

17 Final elongation 72°C 7 minutes

Table 8.1 The PCR program used for in vitro DNA amplification.

CHAPTER 8

158

8.1.2 Production of GFPuv Mutant Library

Addition of Hexahistidine Tag to GFPuv

The WT GFPuv gene was amplified by PCR with the forward primer

5’AAAAAAGAATTCATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCC

and the reverse primer 5’TTTTTTTTTTTTTGCGGCCGCTTATTTGTAGAGC

TCATCCATGCCATGTG using pGFPuv as a template. The amplified gene was

purified by gel electrophoresis and cloned in to a pET-30a vector using the introduced

NotI and EcoRI restriction sites. The resulting construct was transformed into One

Shot® TOP10 competent cells and sequenced using the T7 and pET-RP primers

(acquired sequence show in appendix 1).

Quickchange Site Directed Mutagenesis

Unlike some methods of site directed mutagenesis the quick change method does not

require any specific restriction sites, purification steps or ligation reactions. It introduces

the mutation in one step and unwanted (original) DNA is digested by DpnI restriction

endonuclease, which only digests methylated DNA. Primers are designed by just

altering the desired codon and producing sufficient over lap either side of the mutation

site so that annealing occurs. The reverse primer is simply the reverse compliment of

the forward primer. Once the PCR reaction mixtures are digested by DpnI they can be

directly transformed into the XL1-Blue super competent cells recommended by the

Quickchange manual. Plasmid DNA was used as the DNA template, the primers were

varied according to the site targeted for mutagenesis, a variety of different polymerase

enzymes were used (pfu, pfu Ultra, KOD, KOD XL) with their corresponding buffers.

The successful site directed mutations were achieved in 20 μL reaction volumes

containing 0.5 U of KOD XL DNA polymerase and 10 μg template plasmid in the

recommended polymerase buffer made up to the final concentrations; 750 mM DMSO,

0.2 mM per dNTP, 0.2 μM forward primer, 0.2 μM reverse primer. To test the

efficiency of the restriction enzyme, control PCRs containing no polymerase enzyme

were also performed. Annealing temperatures were varied (50°C, 55°C, 58°C, 62°C,

64°C, 68°C and 72°C) and different numbers of cycles were tried (18-25) until optimal

CHAPTER 8

159

conditions were discovered. All successful site directed mutations were carried out

using the following PCR program:





4 Annealing/elongation 72°C 6 minutes

5 25 repeats of steps 3 and 4


Table 8.2 The PCR program used for site directed mutagenesis.

Template DNA was removed by addition of DpnI restriction endonuclease and

incubation for 5 hours at 37°C. 1 μL of the mixture was used for transformation into

XL1 Blue super competent cells.

Quickchange Mutation C48A

The C48A mutation was introduced by PCR using GFPuv_WT as the template, forward

primer 5’GGAAAACTTACCCTTAAATTTATTGCCACTACTGGAAAACTACCT

GTTCC and reverse primer 5’GGAACAGGTAGTTTTCCAGTAGTGGCAATAAAT

TTAAGGGTAAGTTTTCC.

CHAPTER 8

160

Quickchange Mutation I229C

The I229C mutation was introduced to both GFPuv_WT and GFPuv_C by a PCR using

the forward primer 5’CTTGAGTTTGTAACTGCTGCTGGGTGTACACATGGCA

TGGGATGAGC and reverse primer 5’GCTCATCCCATGCCATGTGTACA

CCCAGCAGCAGTTACAAACTCAAG.

Quickchange Mutation E6C

The E6C mutation was introduced to GFP_WT, GFPuv_C48A, GFPuv_I229C and

GFPuv_C48A_I229C using forward primer 5’CCGAATTCATGAGTAAAGGAGAA

TGTCTTTTCACTGGAGTTGTCCC and reverse primer 5’GGGACAACTCCA

GTGAAAAGCATTCTCCTTTACTCATGAATTCGG.

Inverse PCR

For the inverse PCR GFPuv_WT was used as the template with the primers previously

reported (forward = 5’CGCGACTACTGGAAAACTACCTGT and reverse =

5’ATAAATTTAAGGGTAAGTTT).1,164

The 50 μL inverse PCR mixtures contained

10-50 μg template plasmid, 2.5 U KOD XL polymerase in the recommended

polymerase buffer made up to the final concentrations; 750 mM DMSO, 0.2 mM per

dNTP, 0.2 μM forward primer, 0.2 μM reverse primer.The following program was used

for amplification:

CHAPTER 8

161









Table 8.3 The PCR program used for inverse PCR site directed mutagenesis.

The PCR product was isolated by agarose gel electrophoresis and purified using a

QIAquick Gel Extraction Kit. The DNA was then phosphorylated using by adding 2 μL

of a polynucleotide kinase enzyme for 1 hour at 37°C before ligation. The resulting

plasmids were transformed into Top10 competent cells and isolated for sequencing.

DNA Shuffling

Three genes were designed for DNA shuffling with condon optimised GFPuv_C48A

(sGFP_C48A). Table 8.4 shows the residues that were substituted for cysteine in each

gene. Shuffle 1 contained cysteines at positions 6, 48 and 229 to provide a comparison

with existing mutants.

CHAPTER 8

162

Shuffle 1 Shuffle 2 Shuffle 3

Shuffle 1

cont.

Shuffle 2

cont.

Shuffle 3

cont.

6 1 2 149 137 140

15 5 7 157 142 146

24 9 12 164 147 151

30 17 19 170 153 156

38 21 26 175 159 162

43 28 32 182 166 168

48 34 39 188 172 173

52 41 45 195 176 178

76 47 49 202 181 183

80 51 73 208 186 190

90 77 79 212 194 197

97 81 86 221 200 204

105 93 96 229 206 210

111 99 101 236 214 215

118 104 107 219 223

124 109 113 225 227

128 117 122 230 232

138 126 129 237 238

144 131 133

Table 8.4 The three genes (Shuffle 1-3) designed for DNA shuffle cysteine screen of GFPuv. Numbers

correspond to the amino acids to be substituted for cysteine in each gene.

CHAPTER 8

163

DNase Digest

Plasmids containing the synthetic genes Shuffle 1 and sGFPuv_C48A (purchased from

GeneArt) were transformed in to XL1 blue super competent cells for DNA production.

An approximately 1 kb fragment containing each gene was obtained by digestion using

EcoRI and NotI and purified by electrophoresis using 2% low melting point agarose. 5

μg of each purified gene was diluted in 70 μL of DNase buffer and incubated at 37°C

for 10 minutes. 0.5 U of DNase was then added and the reaction incubated at 37°C for 1

minute. The digestion was stopped by heating the reaction to 80°C for 15 minutes and a

portion of the mixture removed for analysis by electrophoresis. This method was found

to produce DNA fragments of the desired length (less than 200 bp).

Precipitation of Digested DNA

5 µL of 3 M sodium acetate (pH 5.2), 25 µL of 5 M ammonium acetate and 150 µL of

ethanol were added to a 50 µL sample of quenched DNase digest. The mixture was

stored at -20°C over night, centrifuged at 16100 g for 30 minutes (4°C) and the

supernatant discarded. The precipitated DNA was air dried for 15 minutes before being

resuspended in 50 µL polymerase buffer.

DNA Shuffle PCR

A PCR was conducted using the digested fragments of the synthetic genes Shuffle 1 and

sGFPuv_C48A without primers or template under the same conditions as previously

reported.146,167

The 50 µL PCR mixture contained 8 ng digested Shuffle 1, 4 ng digested

sGFPuv_C48A, 0.5 U Phusion DNA polymerase made up in the appropriate polymerase

buffer to a final concentration of 0.2 mM per dNTP. The following program was used

for the DNA shuffle reaction:

CHAPTER 8

164





4 Elongation 72°C 30 seconds




Table 8.5 The PCR program used for the DNA shuffle.

The products of this reaction were then diluted 40x into a new PCR, using the forward

primer 5’GGAAAACTTACCCTTAAATTTATTGCCACTACTGGAAAACTA

CCTGTTCC and the reverse primer 5’GGAACAGGTAGTTTTCCAGTAGTGGCA

ATAAATTTAAGGGTAAGTTTTCC. This 50 μL PCR mixture contained 1.25 μL of

the DNA suffle reaction mixture and 0.5 U Phusion DNA polymerase made up in the

appropriate polymerase buffer to the final concentrations; 0.2 μM forward primer, 0.2

μM reverse primer and 0.2 mM per dNTP. The following program was used for the

amplification:

CHAPTER 8

165





4 Elongation 72°C 30 seconds




Table 8.6 The PCR program used for the amplification of the DNA shuffle products.

After purification using a PCR cleanup kit (Promega), a restriction digest was

performed on the products using EcoRI and NotI. The 1 kb fragments corresponding to

the shuffled GFPuv genes were purified from 2% low melting point agarose, cloned

back in to pET30a and transformed in to XL1 blue super competent cells. Several

hundred colonies were suspended in 100 mL LB media containing kanamycin (50

ug/mL) and incubated at 37°C for 8 hours. The DNA from this culture was extracted

and transformed in to BL21 (DE3) competent cells for screening. After 16 hours growth

at 37°C the colonies were transferred using a Hybond membrane to expression plates

precoated with dilute IPTG and incubated at 30°C for a further 20 hours. Active mutants

were visibly green after this length of expression (figure 2.8), but were easily detectable

using UV light (659nm) after a few hours.

Preparation of Expression Plates

Agar plates containing 50 μg/mL kanamycin were coated with 100 µL of 25 mM IPTG

and dried for 10 minutes in a laminar flow cabinet immediately before use.

CHAPTER 8

166

8.1.3 Protein Expression and Purification

A single colony was picked from agar plates containing freshly transformed E. coli

BL21(DE3) cells and used to seed 7 mL of sterile LB medium containing the

appropriate antibiotic. This culture was incubated for 16 hours at 37°C with shaking

(250 rpm). 400 μL of this culture was then transferred into 400 mL of sterile LB

medium and incubated at 37°C with shaking (250 rpm) until an OD of 0.6-0.7 was

reached. The culture was then induced using IPTG (final concentration 1 mM) and

incubated for 1-24 hours at varying temperatures (22°C, 30°C and 37°C) with shaking

(250rpm). 100 μL aliquots of the cell suspension were taken at time points to analyze

expression levels and to determine the optimal induction time. Each of these samples

was centrifuged for 10 minutes at 16,000 g and the supernatant discarded. The pellets

formed were frozen to aid cell lysis and stored for SDS-PAGE electrophoresis and

western blot analysis.

Bulk cells cultures were harvested by centrifugation at 11325 g for 15 minutes. After

resuspension in IMAC binding buffer the cells were lysed by sonication (20 minutes 10s

on/ 10s off-cycles). The resulting mixture was centrifuged at 39191 g for 30 minutes

and the supernatant discarded. The pellets formed were resuspended in IMAC binding

buffer then stored at -20°C ready for protein purification.

Gradient Immobilised Metal Affinity Chromatography (IMAC)

A 5 mL His Trap column was washed with 10 mL of filtered H2O, 10 mL of NiSO4

solution (100 mM), again with 10 mL of filtered H2O and then with 10 mL of IMAC

binding buffer (50 mM Tris Base, 500 mM NaCl, 10 mM imidazole, pH 7.4). The

sterile, filtered protein sample was then loaded on to the column using a syringe. The

column was inserted into the AKTA-FPLC purification system. A buffer gradient was

set up so that increasing proportions of IMAC elution buffer (50 mM Tris Base, 500

mM NaCl, 500 mM imidazole, pH 7.4) were passed through the column and the eluent

was collected in 1 mL fractions in 96 deep well plates with a flow rate of 2 mL/min.

The protein containing fractions were analysed by SDS-PAGE and Western blot. After

CHAPTER 8

167

finishing the purification, the column was washed with 10 mL of 0.3 M Na-EDTA

solution, 10 mL of sterile water and 10 mL of 20% ethanol before being stored at 4°C.

Optimised IMAC

The sample and column were prepared in the manner previously described and inserted

into the AKTA-FPLC purification system. After 5 minutes of 4 mL/min IMAC binding

buffer flowing through the column the buffer was altered to include 10% IMAC elution

buffer. After a further 5 minutes the buffer was changed to 100% IMAC elution buffer

until all remaining protein had been eluted (approximately 5 minutes). The column was

washed and stored as previously described. A typical UV trace is shown in appendix 3.

Anionic Affinity Chromatography

A 5 mL Hi Trap Q FF column was washed with 10 mL of filtered H2O and then with 10

mL of anionic affinity binding buffer (20 mM NaH2PO4/Na2HPO4, pH 6). The sterile,

filtered, desalted protein sample was then loaded on to the column using a syringe. The

column was then inserted into the AKTA-FPLC purification system. A buffer gradient

was set up so that increasing proportions of anionic affinity elution buffer (20 mM

NaH2PO4/Na2HPO4, 500 mM NaCl, pH 6) were passed through the column and the

eluent was collected in 1 mL fractions in 96 deep well plates. The protein containing

fractions were analysed by SDS-PAGE and Western blot. After finishing the

purification, the column was washed with 10 mL of sterile water and 10 mL of 20%

ethanol before being stored at 4°C.

Size Exclusion Chromatography

A Hi Load Superdex 200 column was inserted into the AKTA-FPLC purification

system and then equilibrated by washing with 128 mL of size exclusion buffer (20 mM

NaH2PO4/Na2HPO4, pH 6). 1 mL of concentrated protein solution was loaded on to the

column using a filling loop and the eluent was collected in 1 mL fractions in 96 deep

CHAPTER 8

168

well plates as another 128 mL of the size exclusion buffer was passed through the

column. The column was then ready to be stored at 4°C. The protein containing

fractions were analysed by SDS-PAGE and Western blot.

SDS-PAGE of Proteins

SDS-PAGE gels were purchased from Biorad and used in the appropriate gel chambers

manufactured by Biorad. Protein samples were prepared by heating to 90°C for 10

minutes in SDS loading buffer. The samples were then loaded into wells along with a

protein standard solution. Gels were run at 150V for 1 hour. After electrophoresis,

proteins were fixed and stained with EZBlue Staining reagent (Sigma) and the excess

dye was then washed from the gel using H2O.

Western Blot Analysis of Proteins

All materials and buffers used for Western blot analysis were purchased from Biorad in

transfer tanks produced by Biorad. After completing SDS-PAGE gel electrophoresis,

the gel was incubated on the orbital shaker for 10 minutes in blotting buffer. Before

assembling the “transfer-sandwich” (bottom-blotting paper-membrane-gel-blotting

paper-top) the blotting paper and nitrocellulose membrane were soaked in blotting

buffer for 5 minutes. Blotting was performed at 15 V for 25 minutes. The membrane

was then incubated on the orbital shaker, with blocking buffer for 1 hour, then

incubated on the orbital shaker for another hour with the anti-His Tag antibody (1/2000

(v/v) diluted in blocking buffer). The membrane was then washed three times by

incubating on the orbital shaker with TTBS buffer for 5 minutes. The blot was then

incubated with aqueous 3,3’-diaminobenzidine solution until staining occurred.

Membranes were rinsed with distilled water, dried and then stored for analysis.

CHAPTER 8

169


Unless stated otherwise, all chemicals were of analytical grade and used as received

from Sigma-Aldrich. All solvents used were from commercial suppliers (Sigma-

Aldrich, Fisher Scientific or Romil). NMR spectra were recorded on Bruker 400

UltrashieldTM

or 600 UltrashieldTM

spectrometers at room temperature and calibrated

according to the chemical shift of tetramethysilane or 3-(trimethylsilyl)propionic-

2,2,3,3-d4 acid sodium salt for samples in D2O (δ = 0 ppm). All compound NMR

spectra were assigned by Dr R. Sardzik (The University of Manchester) using 1H,

13C,

DEPT, COSY, HSQC, HMQC and HMBC NMR experiments as appropriate. Chemical

shifts are given in ppm, coupling constants in Hertz (Hz) and multiplicities indicated

with the appropriate abbreviations: singlet (s), doublet (d), triplet (t), double doublet

(dd), double double doublet (ddd) and multiplet (m). The determination of

diastereomeric ratios are based on comparison of signal intensities of separated signal

pairs in 13

C NMR spectra. ES+ mass spectra were obtained with Waters Micromass

spectrometer. MALDI spectra were obtained using a Bruker Ultraflex TOF/TOF

spectrometer. IR spectra were measured and recorded using a PerkinElmer Sprctrum

RX I FT-IR Spectrometer. Optical activity was measured using an Optical Activity Ltd

AA-1C00 polarimeter. Melting points were measured with a Gallenkamp apparatus and

are not corrected.

8.2.1 General Procedure 1: Peracetylation with Acetic Anhydride and Pyridine177

Glycoside was dissolved in pyridine, 5 mol eq of acetic anhydride was added slowly

and the reaction was monitored by thin layer chromatography (TLC) and more acetic

anhydride was added if required. Most of the pyridine was removed using a rotary

evaporator and the resulting slurry was then dissolved in ethyl acetate. This solution

was washed with CuSO4 (aq), then water, then brine and dried with magnesium

sulphate. The resulting solution was then filtered and the solvent removed to yield the

product.

CHAPTER 8

170

8.2.2 General Procedure 2: Deacetylation with Sodium Methoxide177

Acetylated 2-(benzyloxycarbonyl)aminoethyl glycoside was dissolved in methanol and

NaOMe in methanol (0.33 mol eq) was added. The reaction was then stirred for 16

hours at r.t. The base was neutralised with activated Amberlite IR-120, the resin was

then removed via filtration and the solvent evaporated in vacuo to yield the product.

8.2.3 General Procedure 3: Hydrogenolysis of N-Cbz-protecting Groups177

2-(Benzyloxycarbonyl)aminoethyl glycoside was dissolved in MeOH and Pd/C (10%)

was added. The reaction was then stirred under a H2 atmosphere for 16 hours. The

solution was then filtered through Celite and the solvent removed in vacuo to yield the

free amine.

8.2.4 Synthesis of Aminoethyl Mannoside (27)177

1,2,3,4,6-Penta-O-acetyl-D-mannopyranose (30)177

Figure 8.1 The reaction of mannose (29) with acetic anhydride to form peracetyl mannose (30).

5.00 g of D-(+)-Mannose (29) (27.9 mmol, 1 mol eq) was reacted with 13 mL of acetic

anhydride (138.5 mmol, 5 mol eq) in pyridine as described in general procedure 1

(section 8.2.1) to yield 10.6 g 30 (mixture of both anomers α/β 33:67) as a clear viscous

oil (27.1 mmol, 97%).

1H NMR (400 MHz, CDCl3, mixture of both anomers): signals of β-anomer δ (ppm) =

1.98 (s, 3H, COCH3), 2.07 (s, 3H, COCH3), 2.08 (s, 3H, COCH3), 2.15 (s, 3H, COCH3),

2.19 (s, 3H, COCH3), 3.99–4.05 (m, 1H, 5-H), 4.07 (dd, J = 2.4, 12.4 Hz, 1H, 6-Ha),

4.26 (dd, J = 4.9, 12.4 Hz, 1H, 6-Hb), 5.23 (dd, J = 2.0, 3.1 Hz, 1H, 3-H), 5.31–5.34 (m,

CHAPTER 8

171

2H, 3-H, 4-H), 6.06 (d, J = 2.0 Hz, 1H, 1-H); signals of α-anomer δ (ppm) = 1.98 (s,

3H, COCH3), 2.03 (s, 3H, COCH3), 2.07 (s, 3H, COCH3), 2.15 (s, 3H, COCH3), 2.16 (s,

3H, COCH3), 3.79 (ddd, J = 2.4, 5.3, 9.9 Hz, 1H, 5-H), 4.11 (dd, J = 2.4, 12.4 Hz, 1H,

6-Ha), 4.28 (dd, J = 5.3, 12.4 Hz, 1H, 6-Hb), 5.11 (dd, J = 3.3, 10.0 Hz, 1H, 3-H), 5.27

(t, J = 10.0 Hz, 1H, 4-H), 5.46 (dd, J = 1.2, 3.3 Hz, 1H, 2-H), 5.84 (d, J = 1.2 Hz, 1H, 1-

H); 13

C NMR (101 MHz, CDCl3, mixture of both anomers): signals of β-anomer: δ

(ppm) = 20.7, 20.7, 20.8, 20.8, 20.9 (5 COCH3), 62.2 (C-6), 65.6 (C-4), 68.4 (d, C-2),

68.8 (d, C-3), 70.7 (d, C-5), 90.7 (d, C-1), 168.2, 169.6, 169.8, 170.1, 170.7 (5 COCH3);

signals of α-anomer: δ (ppm) = 20.6, 20.7, 20.8, 20.8, 20.9 (5 COCH3), 62.1 (C-6), 65.4

(C-4), 68.3 (C-2), 70.7 (C-3), 73.4 (C-5), 90.5 (C-1), 168.5, 169.7, 169.9, 170.3, 170.8

(5 COCH3).

2-(Benzyloxycarbonyl)aminoethyl 2,3,4,6-tetra-O-acetyl-α-D-mannopyranoside

(31)177

Figure 8.2 The reaction of peracetylated mannose (30) with benzyl N-(2-hydroxyethyl)-carbamate to

form mannoside (31).

5.62 g of peracetylated mannose (30) (14.41 mmol) and of 8.35 g of benzyl N-(2-

hydroxyethyl)-carbamate (17.29 mmol, 1.2 mol eq) were dissolved in 75 mL of dry

dichloromethane (DCM) under nitrogen. The solution was cooled to 0 °C and 17.9 mL

BF3.Et2O (72.05 mmol, 5 mol eq) was added slowly. The reaction was stirred for 30 min

at 0°C and then for 16 hours at r.t. The reaction was quenched with 10 mL of H2O and

then concentrated in vacuo. The residue was re-dissolved in DCM then washed with sat.

(saturated) NaHCO3, then water and then brine. The organic layers were dried over

MgSO4, the solvent removed under reduced pressure and then purified using column

chromatography on silica (EtOAc/hexane 40:60 to 50:50) to yield 4.22 g 31 as a clear

oil (8.21 mmol, 57%).

CHAPTER 8

172

20

D = +165 (c 1.8, CH2Cl2); 1H NMR (400 MHz, CDCl3): δ (ppm) = 2.00 (s, 3H,

COCH3), 2.04 (s, 3H, COCH3), 2.09 (s, 3H, COCH3), 2.16 (s, 3H, COCH3), 3.36–3.53

(m, 2H, CH2NH), 3.58 (ddd, J = 3.6, 6.8, 10.2 Hz, 1H, CHaHbCH2NH), 3.78 (ddd, J =

3.9, 6.2 10.2 Hz, 1H, CHaHbCH2NH), 3.97 (ddd, J = 2.3, 5.7 9.5 Hz, 1H, 5-H), 4.08 (dd,

J = 2.3, 12.2 H 1H, 6-Ha), 4.26 (dd, J = 5.7, 12.2 Hz, 1H, 6-Hb), 4.82 (d, J = 1.7 Hz, 1H,

1-H), 5.12 (s, 2H, CH2Ph), 5.20 (t, J = 5.8 Hz, 1H, NH), 5.25 (dd, J = 1.7, 3.2 Hz, 1H,

2-H), 5.26 (dd, J = 9.5, 10.1 H), 5.31 (dd, J = 3.2, 10.0 Hz, 1H, 3-H), 7.29–7.39 (m, 5H,

C6H5); 13

C NMR (101 MHz, CDCl3) δ (ppm) = 20.7, 20.8, 20.9 (4 COCH3), 40.7

(CH2NH), 62.5 (C-6), 66.1 (C-4), 66.9 (CH2Ph), 67.8 (CH2CH2NH), 68.8 (C-5), 69.0

(C-3), 69.4 (C-2), 97.8 (C-1), 128.2, 128.6 (o-, m-, p-C from C6H5), 136.4 (i-C from

C6H5), 156.4 (NCOO), 169.8, 170.0, 170.1, 170.7 (4 COCH3); IR: ~ (cm−1

) = 3391 (N-

H stretch), 2936 (C-H stretch), 1748 (C=O stretch), 1531 (C=C aromatic stretch), 1367,

1227, 1140, 1088, 1047, 980; HRMS (ESI+): m/z calcd for C24H31NO12 [M+H]+

526.1925, found 526.1913.

2-(Benzyloxycarbonyl)aminoethyl α-D-mannopyranoside (42)177

Figure 8.3 The deprotection of mannoside (31) with NaOH and MeOH to give mannoside (27).

Aminoethyl mannoside (31) (4.66 g, 8.87 mmol) was deacetylated using NaOMe in

MeOH as described by to General Procedure 2 (section 8.2.2) to yield 3.01 g 42 as a

colourless oil (8.42 mmol, 95%).

20

D = +34.7 (c 2.3, MeOH); 1H NMR (400 MHz, MeOD): δ (ppm) = 3.27–3.39 (m,

2H, CH2NH), 3.47–3.55 (m, 2H, 5-H, CHaHbCH2NH), 3.60 (t, J = 9.5 Hz, 1H, 4-H),

3.68 (dd, J = 5.8, 11.7 Hz, 1H, 6-Ha), 3.69 (dd, J = 3.4, 9.3 Hz, 1H, 3-H), 3.74 (ddd, J =

4.9, 6.4, 10.2 Hz, 1H, CHaHbCH2NH), 3.80 (dd, J = 1.7, 3.4 Hz, 1H, 2-H), 3.81 (dd, J =

2.3, 11.7 Hz, 1H, 6-Hb), 4.75 (d, J = 1.6 Hz, 1H, 1-H), 5.06 (s, 2H, CH2Ph) , 7.24–7.36

CHAPTER 8

173

(m, 5H, C6H5); 13

C NMR (101 MHz, MeOD) δ (ppm) = 41.7 (CH2CH2NH), 62.8 (C-6),

67.5 (CH2Ph, CH2CH2NH), 68.5 (C-4), 72.0 (C-2), 72.5 (C-3), 74.7 (C-5), 101.6 (C-1),

128.8, 129.0, 129.5 (o-, m-, p-C from C6H5), 138.3 (i-C from C6H5), 158.9 (NCOO); IR:

~ (cm−1

) = 3593-3000 (O-H stretch), 2929 (C-H stretch), 1698, 1535 (C=C aromatic

stretch), 1451, 1409, 1335, 1262, 1136, 1094, 1060, 1027, 975, 912, 880; HRMS

(ESI+): m/z calcd for C16H23NO8 [M+Na]+ 380.1321, found 380.1316.

2-Aminoethyl α-D-mannopyranoside (27)177

Figure 8.4 The hydrogenation of mannoside (42) using a Pd/C catalyst and hydrogen gas to give

mannoside (27).

Prepared from aminoethyl glycoside (42) (2.85 g, 7.98 mmol) by hydrogenation using

Pd/C and H2 in MeOH as described in General Procedure 3 (section 8.2.3) to give 1.66

g 27 as a colourless oil (7.44 mmol, 93%).

20

D = +66 (c 2.7, MeOD); 1H NMR (400 MHz, MeOD): δ (ppm) = 2.82–2.86 (m, 2H,

CH2NH2), 3.48 (ddd, J = 4.7, 5.9, 10.2 Hz, 1H, CHaHbCH2NH2), 3.56 (ddd, J = 2.1, 5.8,

9.7 Hz, 1H, 5-H), 3.63 (t, J = 9.4 Hz, 1H, 4-H), 3.73 (dd, J = 5.8, 11.8 Hz, 1H, 6-Ha),

3.74 (dd, J = 3.4, 9.1 Hz, 1H, 3-H), 3.79 (ddd, J = 4.7, 5.9, 10.2 Hz, 1H,

CHaHbCH2NH2), 3.86 (dd, J = 1.7, 3.4 Hz, 1H, 2-H), 3.86 (dd, J = 2.1, 11.8 Hz, 1H, 6-

Hb), 4.80 (d, J = 1.7 Hz, 1H, 1-H); 13

C NMR (101 MHz, MeOD) δ (ppm) = 101.7 (C-1),

74.6 (C-5), 72.5 (C-4), 72.0 (C-2), 70.0 (CH2CH2NH2), 68.6 (C-3), 62.8 (C-6), 42.0

(CH2NH2); IR: ~ (cm−1

) = 3605-3100 (O-H stretch), 2928 (C-H stretch), 1645 (N-H

bend), 1598, 1454, 1418, 1361, 1320, 1258, 1207, 1134, 1062, 975, 877, 805; HRMS

(ESI+): m/z calcd for C8H17NO6 [M+H]+ 224.1134, found 224.1138.

CHAPTER 8

174

8.2.5 Synthesis of Aminoethyl Glucoside (32)177

2-(Benzyloxycarbonyl)aminoethyl 2,3,4,6-tetra-O-acetyl-β-D-glucopyranoside

(39)177

Figure 8.5 The reaction of Peracetyl β-D-glucopyranose (36) and N-Cbz-ethanolamine to produce

glucoside (39).

Peracetyl β-D-glucopyranose (36) (1.00 g, 2.56 mmol) and N-Cbz-ethanolamine (1.2

mol eq) were dissolved in dry acetonitrile under nitrogen. The solution was cooled to

0°C and BF3.Et2O (5 mol eq) was added slowly. The reaction was stirred for 30 min at

0°C and then overnight at r.t. The reaction was quenched with water and concentrated in

vacuo, the residue re-dissolved in dichloromethane then washed once with sat.

NaHCO3, water and then brine. The organic layers were dried using MgSO4, the solvent

removed in vacuo and the product purified using column chromatography on silica

(EtOAc/petroleum ether 40:60) to yield 471 mg 39 as a clear oil (0.90 mmol, 35%).

21

D = −4.1 (c 1.0, CHCl3); 1H NMR (400 MHz, CDCl3): δ (ppm) = 2.00 (s, 6H, 2

COCH3), 2.03 (s, 3H, COCH3), 2.06 (s, 3H, COCH3), 3.37–3.41 (m, 2H, CH2NH), 3.68

(ddd, J = 2.5, 4.8, 9.9 Hz, 1H, 5-H), 3.69–3.74 (m, 1H, OCHaHbCH2), 3.87 (ddd, J =

4.1, 5.5, 10.0 Hz, 1H, OCHaHbCH2), 4.14 (dd, J = 2.4, 12.3 Hz, 6-Ha), 4.14 (dd, J = 4.8,

12.4 Hz, 1H, 6-Hb), 4.48 (d, J = 8.0 Hz, 1H, 1-H), 4.93 (dd, J = 8.0, 9.6 Hz, 1H, 2-H),

5.05 (dd, J = 9.4, 9.7 Hz, 1H, 4-H), 5.09 (s, 2H, CH2Ph), 5.17 (m, 1H, NHCBz), 5.19

(dd, J = 9.4, 9.6 Hz, 3-H), , 7.33–7.36 (m, 5H, C6H5); 13

C NMR (101 MHz, CDCl3) δ

(ppm) = 20.9, 21.0 (4 COCH3), 41.1 (CH2NH), 62.2 (C-6), 67.1 (CH2Ph), 68.7 (C-4),

69.8 (OCH2CH2), 71.6 (C-2), 72.3 (C-5), 73.0 (C-3), 101.4 (C-1), 128.5, 128.5, 128.9

(o-, m-, p-C from C6H5), 136.8 (i-C from C6H5), 156.7 (NCOO), 169.7, 169.8, 170.5,

170.9 (4 COCH3); IR: ~ (cm−1

) = 3379 (N-H stretch), 2946 (C-H stretch), 1755 (C=O

stretch), 1723, 1529 (C=C aromatic stretch), 1431, 1369, 1226, 1039; HRMS (ESI+):

m/z calcd for C24H31NO12 [M+H]+ 526.1925, found 526.1920.

CHAPTER 8

175

2-(Benzyloxycarbonyl)aminoethyl β-D-glucopyranoside (64)177

Figure 8.6 The deprotection of glucoside (39) with NaOH in MeOH to produce glucoside (64).

Aminoethyl glucoside (39) (370 mg, 0.705 mmol) was deacetylated as described in

general procedure 2 (section 8.2.2) to yield 227 mg 64 as clear oil, (0.635 mmol, 90%).

21

D = −11.7 (c 1.0, MeOD); 1H NMR (400 MHz, MeOD): δ (ppm) = 3.17 (dd, J = 7.9,

9.0 Hz, 1H, 2-H), 3.22–3.29 (m, 3H, 4-H, 5-H, CHaHbNH), 3.32–3.38 (m, 1H,

CHaHbNH), 3.34 (t, J = 8.7 Hz, 3-H), 3.58 (ddd, J = 4.2, 6.9, 10.4 Hz,, 1H,

CHaHbCH2NH), 3.62 (dd, J = 5.2, 12.0 Hz, 1 H, 6-Hb), 3.81 (dd, J = 2.0, 11.9 Hz, 1H, 6-

Hb), 3.86 (ddd, J = 5.6, 7.7, 10.2 Hz, 1H, CHaHbCH2NH), 4.22 (d, J = 7.8 Hz, 1H, 1-H),

5.02 (s, 2H, CH2Ph), 7.23–7.29 (m, 5H, C6H5); 13

C NMR (101 MHz, MeOD) δ (ppm) =

42.7 (CH2NH), 63.3 (C-6), 68.2 (CH2Ph), 70.7 (CH2CH2NH), 72.2 (C-5), 75.7 (C-2),

78.5 (C-3, C-4), 105.1 (C-1), 128.2, 128.7, 129.6 (o-, m-, p-C from C6H5), 138.9 (i-C

from C6H5), 159.6 (NCOO); IR: ~ (cm−1

) = 3592-3000 (O-H stretch), 2946 (C-H

stretch), 1702, 1535 (C=C aromatic stretch), 1454, 1337, 1262, 1076, 1031; HRMS


2-Aminoethyl β-D-glucopyranoside (32)177

Figure 8.7 The hydrogenation of glucoside (39) using a Pd/C catalyst and hydrogen gas to produce

glucoside (32).

CHAPTER 8

176

2-Benzyloxycarbonylaminoethyl-glucopyranoside (39) (182 mg, 0.51 mmol) was

hydrogenated overnight as described in general procedure 3 (section 8.2.3) to yield 110

mg 32 as a white solid (0.49 mmol, 96%).

21

D = +7.2 (c 1.0, MeOH); 1H NMR (400 MHz, MeOD): δ (ppm) = 2.84–2.86 (m, 2H,

CH2NH2), 3.15 (dd, J = 7.8, 9.2 Hz, 1H, 2-H), 3.21–3.24 (m, 2H, 4-H, 5-H), 3.31 (dd, J

= 9.0, 9.1 Hz, 1H, 3-H), 3.58–3.63 (m, 2H, 6-Ha, CHaHbCH2NH), 3.81 (dd, J = 1.3,

11.9 Hz, 1H, 6-Hb), 3.88 (ddd, J = 5.0, 7.7, 9.9 Hz, 1H, CHaHbCH2NH), 4.22 (d, J =

7.8 Hz, 1H, 1-H); 13

C NMR (101 MHz, MeOD) δ (ppm) = 42.7 (CH2NH2), 63.5 (C-6),

71.5 (CH2CH2NH2), 72.4 (C-5), 75.9 (C-2), 78.7 (C-3), 78.8 (C-4), 105.2 (C-1); IR: ~

(cm−1

) = 3584-3000 (O-H stretch), 2945 (C-H stretch), 1645 (N-H bend), 1319, 1078,

1039, 614; HRMS (ESI+): m/z calcd for C8H17NO6 [M+H]+ 224.1134, found 224.1135.

8.2.6 Synthesis of Aminoethyl Galactoside (33)177

2-(Benzyloxycarbonyl)aminoethyl 2,3,4,6-tetra-O-acetyl-β-D-galactopyranoside

(40)177

Figure 8.8 The reaction of peracetyl β-D-galactose (37) with N-Cbz-ethanolamine to produce galactoside

(40).

Peracetyl β-D-Gal (37) (1.95 g, 5.00 mmol) and N-Cbz-ethanolamine (6 mmol, 1.2 mol

eq) were dissolved in dry acetonitrile under nitrogen. The solution was cooled to 0°C

and BF3.Et2O (25 mmol, 5 mol eq) was added slowly. The reaction was stirred for 30

min at 0°C and then overnight at r.t. The reaction was quenched with water and

concentrated in vacuo, the residue re-dissolved in DCM then washed once with sat.

NaHCO3, water and brine. The organic layers were dried using MgSO4, the solvent

removed in vacuo and the product purified using column chromatography on silica

(ethyl acetate/hexane 50:50) to yield 1.58 g 40 as a clear oil (3 mmol, 60% yield).

CHAPTER 8

177

21

D = −1.4 (c 1.0, CHCl3), Lit.210

22

D = +4.4 (c 1.2, CH2Cl2), Lit.211

20

D = +20.7 (c

1, CH2Cl2); 1H NMR (500 MHz, CDCl3): δ (ppm) = 1.90 (s, 3H, COCH3), 1.93 (s, 3H,

COCH3), 1.95 (s, 3H, COCH3), 2.07 (s, 3H, COCH3), 3.32 (m, 2H, CH2NH), 3.62 (ddd,

J = 3.6, 7.1, 10.2 Hz, 1H, CHaHbCH2NH), 3.80–3.82 (m, 2H, 5-H, CHaHbCH2NH),

4.06 (d, J = 6.6 Hz, 2H, 6-H2), 4.38 (d, J = 7.9 Hz, 1H, 1-H), 4.93 (dd, J = 3.4, 10.5 Hz,

1H, 3-H), 5.02 (s, 2H, CH2Ph), 5.10 (dd, J = 8.0, 10.4 Hz, 1H, 2-H), 5.19 (t, J = 5.4 Hz,

1H, NH), 5.31 (dd, J = 0.7, 3.4 H, 1H, 4-H), 7.22–7.30 (m, 5H, C6H5); 13

C NMR

(126 MHz, CDCl3) δ (ppm) = 20.5–20.7 (4 COCH3), 40.8 (CH2NH), 61.3 (C-6), 66.7

(CH2Ph), 67.0 (C-4), 68.8 (C-2), 69.4 (OCH2CH2NH), 70.7 (C-3, C-5), 101.5 (C-1),

128.1, 128.5 (o-, m-, p-C from C6H5), 136.5 (i-C from C6H5), 156.3 (NCOO), 169.6,

170.1, 170.2, 170.4 (4 COCH3); IR: ~ (cm−1

) = 3393 (N-H stretch), 2947 (C-H stretch),

1743 (C=O stretch), 1714, 1524 (C=C aromatic stretch), 1371, 1222, 1048; HRMS


2-(Benzyloxycarbonyl)aminoethyl β-D-galactopyranoside (65)177

Figure 8.9 The deprotection of galactoside (40) using NaOH in MeOH to form galactoside (65).

Aminoethyl galactoside 40 (1.62 g, 3.08 mmol) was deacetylated using general

procedure 2 (section 8.2.2) to yield 1.10 g 65 (3.08 mmol, 90%) as a clear oil.

21

D = +1.8 (c 1.0, MeOH); 1H NMR (400 MHz, MeOD): δ (ppm) =3.30 (ddd, J = 4.2,

6.8, 14.2 Hz, 1H, CHaHbNH), 3.40 (ddd, J = 4.1, 6.2, 14.2 Hz, 1H, CHaHbNH), 3.46 (dd,

J = 3.2, 9.7 Hz, 1H, 3-H), 3.50 (ddd, J = 1.0, 5.3, 6.8 Hz, 1H, 5-H), 3.52 (dd, J = 7.3,

9.8 Hz, 1H, 2-H), 3.63 (ddd, J = 4.0, 6.8, 10.5 Hz, 1H, CHaHbCH2NH), 3.70 (dd, J =

5.3, 11.4 Hz, 1H, 6-Ha), 3.75 (dd, J = 6.9, 11.3 Hz, 1H, 6-Hb), 3.82 (dd, J = 1.0, 3.2 Hz,

1H, 4-H), 3.91 (ddd, J = 4.2, 6.2, 10.4 Hz, 1H, CHaHbCH2NH), 4.22 (d, J = 7.3 Hz, 1H,

1-H), 5.06 (s, 2H, CH2Ph), 7.24–7.37 (m, 5H, C6H5); 13

C NMR (101 MHz, MeOD) δ

CHAPTER 8

178

(ppm) = 42.0 (CH2NH), 62.4 (C-6), 67.4 (CH2Ph), 69.9 (CH2CH2NH), 70.2 (C-4), 72.5

(C-2), 74.8 (C-3), 76.6 (C-5), 105.0 (C-1), 128.8, 129.0, 129.5 (o-, m-, p-C from C6H5),

138.3 (i-C from C6H5), 158.9 (NCOO); IR: ~ (cm−1

) = 3580-3000 (O-H stretch), 2945

(C-H stretch), 1532 (C=C stretch), 1073,1042; HRMS (ESI+): m/z calcd for C16H23NO8

[M+Na]+ 380.1316, found 380.1308.

2-Aminoethyl β-D-galactopyranoside (33)177

Figure 8.10 The hydrogenation of galactoside (65) using a Pd/C catalyst and hydrogen gas to produce

galactoside (33).

Aminoethyl galactoside 65 (1.00 g, 3.89 mmol) was hydrogenated as described in

general procedure 3 (section 8.2.3) to yield 806 mg 33 as a colourless oil (3.62 mmol,

93%).

20

D = −12.9 (c 2.4, MeOH), Lit.212

20

D = −11.3 (c 0.23, MeOH); 1H NMR

(400 MHz, MeOD): δ (ppm) = 2.80 (ddd, J = 4.2, 6.3, 13.4 Hz, 1H, CHaHbNH2), 2.84

(ddd, J = 4.4, 5.5, 13.4 Hz, 1H, CHaHbNH2), 3.45 (dd, J = 3.3, 9.7 Hz, 1H, 3-H), 3.49

(ddd, J = 1.0, 5.3, 7.0 Hz, 1H, 5-H), 3.52 (dd, J = 7.5, 9.7 Hz, 1H, 2-H), 3.61 (ddd, J =

4.4, 6.3, 10.5 Hz, 1H, CHaHbCH2NH2), 3.69 (dd, J = 5.3, 11.3 Hz, 1H, 6-Ha), 3.73 (dd, J

= 7.0, 11.3 Hz, 1H, 6-Hb), 3.80 (dd, J = 1.0, 3.3 Hz, 1H, 4-H), 3.91 (ddd, J = 4.2, 5.5,

10.3 Hz, 1H, CHaHbCH2NH2), 4.21 (d, J = 7.5 Hz, 1H, 1-H); 13

C NMR (101 MHz,

MeOD) δ (ppm) = 42.2 (CH2NH2), 62.5 (C-6), 70.3 (C-4), 71.9 (CH2CH2NH2), 72.6 (C-

2), 74.9 (C-3), 76.7 (C-5), 105.1 (C-1); IR: ~ (cm−1

) = 3575-3100 (O-H stretch), 2929

(C-H stretch), 1644 (N-H bend), 1264, 1077; HRMS (ESI+): m/z calcd for C8H17NO6

[M+H]+ 224.1134, found 224.1133.

CHAPTER 8

179

8.2.7 Synthesis of Aminoethyl N-Acetyl glucosamine (34)177

2-(Benzyloxycarbonyl)aminoethyl 2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-β-D-

gluco-pyranoside (38)177

Figure 8.11 The reaction of β-D-Glucosamine pentaacetate (35) with of N-Cbz-ethanolamine to produce

glucoside (38).

1.00 g of β-D-Glucosamine pentaacetate (35) (Acros Organics, 2.57 mmol) and 1.25 g

of N-Cbz-ethanolamine (6.43 mmol, 2.5 mol eq) were dissolved in 10 mL of dry DCM,

under nitrogen. The reaction was cooled to 0°C and 360 µL of SnCl4 (3.08 mmol, 1.2

mol eq) was added slowly. The reaction was heated to 75°C for 16 h. The reaction was

then allowed to cool to r.t., quenched with 2 mL Et3N and concentrated in vacuo. The

residue was dissolved in DCM and washed with water. The organic phase was then

dried over MgSO4 and reduced in vacuo. The product was isolated using column

chromatography on silica (EtOAc/hexane 80:20), yielding a white solid which was

recrystallised from chloroform/ethyl acetate to obtain 512 mg 38 as colourless crystals

(2.44 mmol, 38%).

m.p. = 124–127 °C; 20

D = −70.1 (c 2.1, CH2Cl2), Lit.213

24

D = −15 (c 1.0, CHCl3);

1H NMR (500 MHz, CDCl3): δ (ppm) = 1.82 (s, 3H, COCH3), 1.96 (s, 6H, 2 COCH3),

1.98 (s, 3H, COCH3), 3.21–3.29 (m, 1H, CHaHbNH), 3.33–3.42 (m, 1H, CHaHbNH),

3.61 (m, 2H, 5-H, CHaHbCH2NH), 3.80 (ddd, J = 3.5, 5.9, 9.9 Hz, 1H, CHaHbCH2NH),

3.84 (dt, J = 8.6, 10.2 Hz, 1H, 2-H), 4.06 (dd, J = 2.0, 12.3 Hz, 1H, 6-Ha), 4.16 (dd, J =

4.8, 12.3 Hz, 1H, 6-Hb), 4.54 (d, J = 8.3 Hz, 1H, 1-H), 4.98 (dd, J = 9.5, 9.8 Hz, 1H, 4-

H), 5.02 (s, 2H, CH2Ph), 5.12 (dd, J = 9.8, 10.2 Hz, 1H, 3-H), 5.31 (t, J = 5.2 Hz, 1H,

CH2NH), 5.87 (d, J = 8.8 Hz, 1H, 2-NH), 7.23–7.31 (m, 5H, C6H5); 13

C NMR

(126 MHz, CDCl3) δ (ppm) = 20.7, 20.7, 20.8, 23.2 (4 COCH3), 40.7 (CH2NH), 54.4

(C-2), 62.1 (C-6), 66.7 (CH2Ph), 68.5 (C-4), 69.1 (CH2CH2NH), 71.8 (C-5), 72.4 (C-3),

CHAPTER 8

180

101.1 (C-1), 128.1, 128.2, 128.6 (o-, m-, p-C from C6H5), 136.6 (i-C from C6H5), 156.6

(NCOO), 169.5, 170.7, 170.9, 171.0 (4 COCH3); IR: ~ (cm−1

) = 3317 (N-H stretch),

2949 (C-H stretch), 1743 (C=O stretch), 1701, 1660, 1547 (C=C aromatic stretch),

1433, 1377, 1243, 1171, 1150, 1047; HRMS (ESI+): m/z calcd for C24H32N2O11 [M+H]+

525.2084, found 525.2077.

2-(Benzyloxycarbonyl)aminoethyl 2-acetamido-2-deoxy-β-D-glucopyranoside

(66)177

Figure 8.12 The deprotection of glucoside (38) using NaOH and MeOH to produce glucoside (66).

Aminoethyl pyranoside 38 (4.14 g, 7.89 mmol) was deacetylated as described by

general procedure 2 (section 8.2.2) to yield 3.11 g 66 as a white foam (7.81 mmol,

99%).

m.p. = 71-74 °C 20

D = −9.6 (c 2.1, MeOH), Lit.213

24

D = −21.5 (c 1.0, CHCl3); 1H

NMR (400 MHz, MeOD): δ (ppm) = 1.93 (s, 3H, COCH3), 3.23–3.34 (m, 4H, 4-H, 5-H,

CH2NH), 3.43 (dd, J = 8.4, 10.3 Hz, 1H, 3-H), 3.58 (ddd, J = 5.4, 5.6, 10.6 Hz, 1H,

CHaHbCH2NH), 3.65 (dd, J = 8.4, 10.3 Hz, 1H, 2-H), 3.66 (dd, J = 5.6, 11.9 Hz, 1H, 6-

Ha), 3.84 (m, 1H, CHaHbCH2NH), 3.86 (dd, J = 2.2, 12.0 Hz, 1H, 6-Hb), 4.38 (d, J =

8.4 Hz, 1H, 1-H), 5.05 (s, 2H, CH2Ph), 7.35–7.25 (m, 5H, C6H5); 13

C NMR (101 MHz,

MeOD) δ (ppm) = 23.0 (COCH3), 41.9 (CH2NH), 57.2 (C-2), 62.7 (C-6), 67.4 (CH2Ph),

69.5 (CH2CH2NH), 71.9 (C-4), 75.9 (C-3), 77.9 (C-5), 102.8 (C-1), 128.9, 129.0, 129.5

(o-, m-, p-C from C6H5), 138.2 (i-C from C6H5), 158.8 (NCOO), 174.0 (COCH3); IR:

~ (cm−1

) = 3612–3000 (O-H stretch), 2938 (C-H stretch), 2886 (C-H stretch), 1700

(C=O stretch), 1644, 1546 (C=C stretch), 1459, 1421, 1372, 1312, 1258, 1149, 1111,

CHAPTER 8

181

1073, 1035; HRMS (ESI+): m/z calcd for C18H26N2O8 [M+Na]+ 421.1587, found

421.1583.

2-Aminoethyl 2-acetamido-2-deoxy-β-D-glucopyranoside (34)177

Figure 8.13 The hydrogenation of glucoside (66) using a Pd/C catalyst and hydrogen gas to produce

glucoside (34).

Aminoethyl pyranoside 66 was hydrogenated as described by general procedure 3

(section 8.3.3) to yield 1.78 g 34 as a pale yellow foam (6.74 mmol, 96%).

m.p. = 83–86 °C 20

D = −28.3 (c 1.87, MeOH); 1H NMR (400 MHz, D2O): δ (ppm) =

2.05 (s, 3H, COCH3), 2.69–2.85 (m, 2H, CH2NH2), 3.34–3.52 (m, 2H, 4-H, 5-H), 3.52–

3.59 (m, 1H, 3-H), 3.59–3.67 (m, 1H, CHaHbCH2NH2), 3.71–3.80 (m, 2H, 2-H, 6-Ha),

3.87–4.01 (m, 2H, 6-Hb, CHaHbCH2NH2), 4.53 (d, J = 8.4 Hz, 1H, 1-H); 13

C NMR

(101 MHz, D2O) δ (ppm) = 25.0 (COCH3), 43.0 (CH2NH2), 58.5 (C-2), 63.6 (C-6), 72.8

(C-5), 74.6 (CH2CH2NH2), 76.6 (C-3), 78.7 (C-4), 104.3 (C-1), 177.6 (COCH3); IR: ~

(cm−1

) = 3610-3100 (O-H stretch), 2929 (C-H stretch), 2876 (C-H stretch), 2361, 1698

(C=O stretch), 1651 (N-H bend), 1551, 1451, 1430, 1372, 1315, 1262, 1152, 1115,

1073, 1036, 947, 900; HRMS (ESI+): m/z calcd for C10H20N2O6 [M+H]+ 265.1400,

found 265.1404.

CHAPTER 8

182

8.2.8 Activation of Glycosides for Glycosylation of Cysteines130

Figure 8.14 Activation of aminoethyl mannoside (27), for reaction with cysteines, via reaction with

iodoacetic anhydride to produce glycosyl iodoacetamide (28).

The aminoethyl glycoside was dissolved in 1 M sodium bicarbonate (pH 8) and

iodoacetic anhydride (2 mol eq) was added. The reaction was stirred at r.t., in the dark

and additional 1 M sodium bicarbonate was added if the pH of the reaction fell below 7.

The reaction was monitored by MS after 30 minutes and more iodoacetic anhydride was

added if required. When complete the reaction mixture was desalted by passing over

acidic ion exchange resin (DOWEX® 50WX8-100) followed by basic ion exchange

resin (DOWEX®

1x8-100(Cl)). The eluent was collected and lyophilise to yield the

glycosyl iodoacetamide in over 90% yield as a white powder. Due to the reactivity of

the products produced they were generally contaminated with the hydrolysis product so

a full characterisation was not undertaken. Product formation was verified by HRMS,

the details of which are shown in table 3.1.

8.2.9 Synthesis of Polymannosides178

2,3,4,6-Tetra-O-acetyl-α-D-mannopyranosyl Bromide (23)178

Figure 8.15 The reaction of peracetyl mannose (30) with HBr to produce acetobromo mannoside (46).

2 g (5.12 mmol) of peracetylated mannose (30) was dissolved in 15 mL DCM and

cooled to 0°C. 200 μL of acetic acid anhydride was added, followed by 4 mL of HBr

CHAPTER 8

183

(33% in acetic acid) dropwise. After 30 minutes the reaction was allowed to warm to

room temperature and was left stirring overnight. The reaction mixture was then diluted

with DCM, washed with sodium bicarbonate (until neutral), then water and then brine.

The organic phase was the dried with MgSO4, filtered and the solvent removed in vacuo

to give the product 46 in over 90% yield.

19

D = +122.0 (c 1, CHCl3), Lit.214 20

D = +118.3 (c 1, CHCl3); 1H NMR (400MHz,

CDCl3): δH 2.02 (s, 3H, COCH3), 2.08 (s, 3H, COCH3), 2.11 (s, 3H, COCH3), 2.18 (s,

3H, COCH3), 4.14 (dd, J = 2.0, 12.4 Hz, 1H, 6-Ha) 4.23 (ddd, J = 2.0, 4.8, 10.0 Hz, 1H,

5-H) 4.34 (dd, J = 4.8, 12.4 Hz, 1H, 6-Hb) 5.37 (dd, J = 10.4, 10.4 Hz, 1H, 4-H) 5.45

(dd, J = 1.6, 3.6 Hz, 1H, 2-H) 5.71 (dd, J = 3.6, 10.4 Hz, 1H, 3-H) 6.32 (d, J = 1.6 Hz,

1H, 1-H). 13

C NMR (400MHz, CDCl3) δ (ppm) = 20.5, 20.6, 20.7 (3s, 4 x COCH3),

61.3 (s, CH2, C-6), 65.2 (s, CH, C-4), 67.8 (s, CH, C-3), 72.0 (s, CH, C-5), 72.7 (s, CH,

C-2), 83.0 (s, CH, C-1), 169.4, 169.6, 170.4 (3s, 4 x COCH3). IR: ~ (cm−1

) = 2927 (C-

H stretch), 1749 (C=O stretch), 1368, 1220, 1128, 1051, 908; HRMS (ESI+): m/z calcd

for C14H20BrO9 [M+H]+ 411.0291, found 411.0286.

2-(Benzyloxycarbonyl)aminoethyl 3,6-di-O-(2,3,4,6-tetra-O-acetyl-α-D

mannopyranosyl)-α-D-mannopyranoside (43)

Figure 8.16 The reaction of acetobromo mannoside (46) and mannoside (42) to produce trimannoside

(43).

CHAPTER 8

184

0.5 g (1.4 mmol) of 2-(Benzyloxycarbonyl)aminoethyl -D-mannopyranoside (42) was

dissolved in dry acetonitrile by heating the solution to 35°C and sonicating , under

nitrogen. 2 g of 4 Å molecular sieves was added and the solution stirred for 10 minutes.

Then HgBr2 (1.01 g, 2.8 mmol, 2 mol eq), Mg(CN)2 (709 mg, 2.8 mmol, 2 mol eq) and

a solution of acetobromo mannoside (46) (1.15 g, 2.8 mmol, 2 mol eq) in dry

acetonitrile were added sequentially. The reaction mixture was stirred at 35C for 1

hour then filtered through celite. Evaporation of the solvent gave a residue, which was

extracted 3 times with DCM. The extracts were combined and washed successively with

sat. KCl (aq), sat. NaHCO3 (aq), and water. The organic layer was dried, filtered, and

then concentrated in vacuo to yield syrup containing a mixture of glycosides. The purity

of this syrup was enhanced by column chromatography on silica (EtOAc/cyclohexane

80:20 to 90:10) to give a trimannoside rich fraction.

This mixture was dissolved in 5 mL methanol, mixed with an aqueous solution of

sodium periodate (250 mg) and stirred for 48 hours at r.t. The reaction mixture was

diluted with water and then extracted with DCM three times. The combined organic

layers were then washed with water, dried with MgSO4, filtered and concentrated in

vacuo to yield 192 mg pale yellow syrup. 58 mg (57 μmol) of a clear syrup was isolated

by column chromatography on silica (EtOAc/cyclohexane 60:40 to 80:20), giving 4.1%

yield of trimannoside (43) with respect to aminoethyl mannoside (42).

Due to the increased challenge in characterising this product compared to the

monosaccharide glycosides produced, NMR spectra were obtained in CDCl3 at 293 K

on a Bruker AVANCE 600 MHz spectrometer. Correlations were determined using

HSQC_TOCSY and HMBC spectra (appendices 6 and 7 respectively), whilst chemical

shift assignments were made using multiplicity edited HSQC (figure 8.18) and 13

C

spectra by Dr. Robert Sardzik (The University of Manchester). A full assignment of the

carbon and proton chemical shifts of each mannose moiety in trimannoside (43) is given

in table 8.7 and the numbering scheme used for the assignment is shown in figure 8.1.7.

CHAPTER 8

185

20

D = +42 (c 1.4, CH2Cl2); 1H NMR (600 MHz, CDCl3): δH (ppm) = 1.98 (3H,

COCH3), 2.01 (3H, COCH3), 2.04 (3H, COCH3), 2.07 (3H, COCH3), 2.08 (3H,

COCH3), 2.11 (3H, COCH3), 2.15 (3H, COCH3), 2.16 (3H, COCH3), 3.40 (1H,

CHaHCH2NH), 3.46 (1H, CHHbCH2NH), 3.55 (1H, CH2HaHNH), 3.75 (1H,

CH2HHbNH), 5.10 (H2, CH2Ph), 5.58 (1H, NH), 7.35, 7.36 (5H, C6H5); 13

C NMR (50

MHz, CDCl3): δC (ppm) = 20.7, 20.7, 20.9, 20.9 (8 COCH3), 40.5 (CH2CH2NH), 66.8

(CH2Ph), 67.0 (CH2CH2NH), 128.1, 128.2, 128.5, 136.5 (6 C6H5), 156.4 (NCOO),

169.8, 169.8, 170.1, 170.1, 170.2, 170.6, 170.9 (8 COCH3). IR: ~ (cm−1

) = 3570-3000

(O-H stretch), 2926 (C-H stretch), 2854 (C-H stretch), 1746 (C=O stretch), 1528 (C=C

aromatic stretch), 1434, 1370, 1224, 1136, 1045, 979, 939, 912; HRMS (ESI+): m/z

calcd for C44H59NO26 [M+Na]+ 1040.3223, found 1040.3203.

Figure 8.17 The numbering scheme used for the assignment of NMR spectra of trimannoside (43).

CHAPTER 8

186

Sugar

Residue

1H/

13C Chemical Shifts (ppm)

1 2 3 4 5 6a 6b

Man 4.81 4.10 3.83 3.93 3.75 3.80 3.91

99.95 69.76 81.78 65.59 71.50 66.43

Man’

(α-1,3-Man)

5.12 5.35 5.37 5.25 4.32 4.14 4.25

99.04 69.50 69.05 66.35 69.18 63.05

Man”

(α-1,6-Man)

4.93 5.25 5.35 5.28 4.12 4.16 4.26

97.24 69.78 69.00 66.19 68.55 62.54

Table 8.7 1H and

13C chemical shifts of the atoms found in the carbohydrate constituent of trimannoside

(43). Additional signals are listed below a long with the remaining characterisation undertaken.

Figure 8.18 A section of a multiplicity edited HSQC of trimannoside (43).

CHAPTER 8

187

The regiochemistry of the product could be confirmed by the coupling of C3 to H1’ in

the HMBC spectrum (figure 3.12). Similarly the stereochemistry of the product could

be confirmed by the interactions of the anomeric protons with their respective carbons

in a non-decoupled HSQC (Figure 3.9).

2-(Benzyloxycarbonyl)aminoethyl 3,6-di-O-(α-D-mannopyranosyl)-α-D-

Mannopyranoside (47)

Figure 8.19 The deprotection of trimannoside (43) with NaOH and MeOH to produce trimannoside (47).

50 mg aminoethyl trimannoside (43) (0.49 mmol) was deacetylated using NaOMe in

MeOH as described by General Procedure 2 (section 8.2.2) to yield 33 mg 47 (0.45

mmol, 92%) as a clear syrup.

20

D = +61.4 (c 1.4, CH2Cl2); 1H NMR (400 MHz, CDCl3): δH (ppm) = 8.39 (s, 1H),

7.47-7.36 (m, 5H), 5.17-5.06 (m, 3H), 4.10-4.05 (m, 2H), 3.95-3.91 (m, 2H), 3.90-3.85

(m, 5H), 3.84-3.80 (m, 1H), 3.79-3.71 (m, 5H), 3.70-3.63 (m, 4H), 3.62-3.54 (m, 2H);

13C NMR (50 MHz, CDCl3): δC (ppm) = 171.0, 158.3, 136.3, 128.8, 128.3, 127.6,

102.3, 100.0, 99.7, 99.4, 78.5, 73.3, 72.6, 71.2, 70.5, 70.3, 70.0, 69.9, 69.6, 66.8, 66.6,

66.4, 65.5, 60.9, 48.8, 40.1; IR: ~ (cm−1

) = 3612-3000 (O-H stretch), 2933 (C-H

stretch), 2821 (C-H stretch), 1703 (C=O stretch), 1596 (C=C aromatic stretch), 1455,

1352, 1266, 1134, 1062, 1029, 980; HRMS (ESI+): m/z calcd for C28H43NO18 [M+Na]+

704.2378, found 704.2393.

CHAPTER 8

188

3,6-di-O-(α-D-mannopyranosyl)-α-D-mannopyranoside (41)

Figure 8.20 The hydrogenation of trimannoside (47) using a Pd/C catalyst and hydrogen gas to produce

trimannoside (41).

33 mg (48 mmol) of 2-(Benzyloxycarbonyl) aminoethyl mannoside (47) was dissolved

in water and Pd/C (10%) was added. The reaction was then stirred under a H2

atmosphere for 16 hours. The solution was then filtered through Celite and the solvent

removed in vacuo to yield 31 mg aminoethyl glycoside 41 as a clear syrup (46 mmol,

95%).

m.p. 68-71°C; 20

D = +78.9 (c 1.4, CH2Cl2); 1H NMR (400 MHz, CDCl3): δH (ppm) =

8.31 (s, 2H), 4.99-4.97 (m, 1H), 4.77-4.75 (m, 1H), 4.04-3.97 (m, 1H), 3.95-3.92 (m,

1H), 3.92-3.46 (m, 19H), 3.03-2.97 (m, 1H); 13

C NMR (50 MHz, CDCl3): δC (ppm) =

171.0, 102.5, 100.0, 99.3, 78.5, 73.3, 72.7, 71.2, 70.5, 70.3, 69.9, 69.8, 69.5, 66.8, 66.6,

65.4, 65.2, 65.1, 61.0, 60.9, 39.2; IR: ~ (cm−1

) = 3620-3000 (O-H stretch), 2937 (C-H

stretch), 2923 (C-H stretch), 2844 (C-H stretch), 2360, 2343, 1591 (N-H bend), 1346,

1132, 1055, 1033, 979; HRMS (ESI+): m/z calcd for C20H37NO16 [M+H]+ 548.2191,

found 548.2178.

CHAPTER 8

189

Synthesis of 2-(Benzyloxycarbonyl)aminoethyl 3,4,6-tri-O-(2,3,4,6-tetra-O-acetyl-α-

D-mannopyranosyl)-α-D-mannopyranoside (48), 2-(Benzyloxycarbonyl)aminoethyl

2,3,6-tri-O-(2,3,4,6-tetra-O-acetyl-α-D-mannopyranosyl)-α-D-mannopyranoside

(49), and 2-(Benzyloxycarbonyl)aminoethyl 2,3,4,6-penta-O-(2,3,4,6-tetra-O-acetyl-

α-D-mannopyranosyl)-α-D-mannopyranoside (50)

Figure 8.21 The structures of polymannoside side products 48, 48 and 50.

2.12 g (5.94 mmol) of mannoside (42) was dissolved in dry acetonitrile by heating the

solution to 35°C and sonicating , under nitrogen. 10 g of 4 Å molecular sieves was

added and the solution stirred for 10 minutes. Then HgBr2 (14.93 g, 41.58 mmol, 7 mol

eq), mercuric cyanide (10.58 g, 41.58 mmol, 7 mol eq) and a solution of acetobromo

mannoside (46) (17.04 g 41.58 mmol, 7 mol eq) in dry acetonitrile were added

sequentially. The reaction mixture was stirred at 35C for 1 hour then filtered through

celite. Evaporation of the solvent gave a residue, which was extracted three times with

DCM. The extracts were combined and washed successively with sat. KCl (aq), sat.

CHAPTER 8

190

NaHCO3 (aq), and water. The organic layer was dried, filtered, and then concentrated in

vacuo to yield syrup containing a mixture of glycosides. The purity of this syrup was

enhanced by column chromatography on silica (EtOAc/cyclohexane 80:20 to 90:10) to

give a tetramannoside rich fraction.

This mixture was dissolved in 25 mL methanol, mixed with an aqueous solution of

sodium periodate (750 mg) and stirred for 48 hours at r.t. The reaction mixture was

diluted with water and then extracted with DCM three times. The combined organic

layers were then washed with water, dried with MgSO4, filtered and concentrated in

vacuo to yield 3.76 g syrup. This was purified by reverse phase HPLC using a Luna

C18 250 x 15 mm column.

HPLC methods were run at 4 mL/minute flow rate with a gradient of 20% acetonitrile

(aq) to 60 % acetonitrile (aq) over 5 minutes, followed by a gradient of 60 %

acetonitrile (aq) to 95 % acetonitrile (aq) over 20 minutes. A period of 10 minutes at 95

% acetonitrile (aq) to fully clean the column followed by 10 minutes of 20 %

acetonitrile (aq) to reequilibrate the system was added to the end of each run giving a

total run time of 50 minutes. All solvents used contained 0.1 % formic acid and were of

HPLC grade. Fractions were collected at elution times 21.25-22.15 minutes, 24.10-

25.30 minutes and 26.70-27.35 minutes. The fractions were reduced in vacuo then

lyophilised to yield purified 43, 48/49 and 50 respectively, each appearing as a

colourless foam. Typically 65 µL of 100 mg/mL polymannoside mixture was injected

per run. From 1 g of the polymannoside mixture purified in this way 228 mg of 43, 383

mg of 48/49 and 101 mg of 50 was isolated, corresponding to yields in relation to

aminoethyl mannoside (42) of 10.2%, 12.9% and 2.7% respectively.

Characterization of Side Products

Due to the complexity of the side products 48, 49 and 50 and the fact that 48 and 49

were isolated as a mixture, a full NMR assignment was not undertaken. However it was

CHAPTER 8

191

deemed prudent to include as much data as possible on these products for future

reference.

2-(Benzyloxycarbonyl)aminoethyl 2,3,6-tri-O-(2,3,4,6-tetra-O-acetyl-α-D-

mannopyranosyl)-α-D-mannopyranoside (49) and 2-

(Benzyloxycarbonyl)aminoethyl 3,4,6-tri-O-(2,3,4,6-tetra-O-acetyl-α-D-

mannopyranosyl)-α-D-mannopyranoside (48) mixture

m.p. 69-87°C; 20


7.31-7.21 (m, 5H), 5.31-5.12 (m, 10H), 2.02 (s, 2H), 4.97-4.69 (m, 2H), 4.32-3.61 (m,

16H), 3.51-3.27 (m, 3H), 2.11-1.86 (m, 36H); 13

C NMR (50 MHz, CDCl3): δC (ppm) =

170.8, 170.6, 170.4, 170.1, 170.1, 169.9, 169.9, 169.9, 169.9, 169.8, 169.8, 169.7,

156.5, 136.5, 128.5, 128.2, 128.1, 99.2, 99.0, 98.3, 97.2, 79.0, 78.4, 71.5, 69.8, 69.7,

69.6, 69.3, 69.2, 69.0, 68.9, 68.8, 68.5, 67.1, 67.0, 66.7, 66.6, 66.2, 66.1, 66.1, 62.9,

62.7, 62.4, 40.4, 20.9, 20.9, 20.8, 20.8, 20.8, 20.7, 20.7, 20.7; IR: ~ (cm−1

) = 3560-

3000 (O-H stretch), 2925 (C-H stretch), 1744 (C=O stretch), 1526 (C=C aromatic

stretch), 1434, 1369, 1220, 1136, 1043, 978, 939, 916; HRMS (ESI+): m/z calcd for

C58H77NO35 [M+H]+ 1348.4354, found 1348.4337.

2-(Benzyloxycarbonyl)aminoethyl 2,3,4,6-penta-O-(2,3,4,6-tetra-O-acetyl-α-D-

mannopyranosyl)-α-D-mannopyranoside (50)

m.p. 74-79°C; 20


7.30-7.22 (m, 5H), 5.32-5.12 (m, 17H), 5.07-4.99 (m, 4H), 4.86 (s, 1H), 4.26-4.17 (m,

3H), 4.13-3.90 (m, 12H), 3.85-3.65 (m, 5H), 3.53-3.34 (m, 3H), 2.11-1.86 (m 48H); 13

C

NMR (50 MHz, CDCl3): δC (ppm) = 170.6, 170.4, 170.2, 170.0, 170.0, 169.8, 169.7,

169.6, 169.5, 169.3, 128.5, 128.1, 96.9, 69.7, 69.4, 69.3, 68.9, 68.8, 68.5, 67.3, 66.7,

66.2, 65.9, 62.7, 62.0, 53.5, 29.7, 20.9, 20.8, 20.7, 20.7, 20.7; IR: ~ (cm−1

) = 2955 (C-

H stretch), 2924 (C-H stretch), 2853 (C-H stretch), 1743 (C=O stretch), 1543 (C=C

aromatic stretch), 1524, 1457, 1369, 1217, 1136, 1039, 977, 937, 917; HRMS (ESI+):

m/z calcd for C72H95NO44 [M+H]+ 1678.5305, found 1678.5288.

CHAPTER 8

192


Initial analysis of the GFPuv mutants produced was carried out on a Waters®

Micromass LTC, TOF-MS, using MassLynx™ 4.0 software for the data analysis.

Calibrations were made using commercially available HHM (Sigma) dissolved in

deionised water (0.25 mg/mL) and protein masses generally measured to 1 d.p. A

sample spectrum acquired for HHM is shown in figure 4.2.A and the corresponding

deconvoluted spectrum, produced by the software is also shown (figure 4.2.B). For

monitoring protein derivatisation reactions, calibrations were accepted in the range

16951-16952 for HHM (m/z 16951.49185

).

8.3.1 Glycosylation of GFPuv Mutants

GFPuv_WT purified by step wise IMAC (details in section 8.1.3) was diluted to a final

concentration of 0.1 mM in IMAC elution buffer (concentrations determined by BCA

assay). TCEP was then added to a final concentration of 0.1 mM per free cysteine and

the pH checked by spotting 1 µL of the reaction mixture on pH paper. If the pH was

below 7 then 10x IMAC elution buffer was added. If the pH was satisfactory the

solution was mixed using a rotary mixer for 15 minutes at r.t. Glycosyl iodoacetamide

was then added to a final concentration of 1 mM per free cysteine and the reaction

incubated for 2 hours at 20°C, in the dark with shaking. After 2 hours a 10 µL sample

was taken from the reaction and diluted in 20 µL deionised water before being analysed

by LCMS using method 8.3.2. If the reaction was found to be complete then the protein

sample would be passed through a Pd-10 column to quench the reaction and buffer

exchange in to the desired assay buffer. If the reaction was incomplete then additional

glycosyl iodoacetamide would be added according to the progress of the reaction and

the mixture reanalysed by LCMS after a further hour.

Glycosylation of Lysines

DTSSP (final concentration 5 mM) was added to a solution of the GFPuv_WT mutant

to be modified (50 µmol in PBS). This solution was mixed on a rotary mixer for 30

minutes at r.t. 10 % volume of 10x IMAC elution buffer was then added to the protein

CHAPTER 8

193

suspension before the addition of TCEP (final concentration 10 mM). The pH of the

mixture was checked and if found to be bellow 7 then additional buffer was added.

After a further 15 minutes mixing on the rotary mixer at r.t. the protein was redissolved

and could be passed through a Pd-10 column to remove unwanted small molecules and

buffer exchange into IMAC elution buffer ready for glycosylation.

8.3.2 MS Analysis of Proteins

Precipitation of GFPuv Mutants for ESI-MS Analysis

Initially samples of GFP were prepared by precipitation with 15 volumes of

acetone/methanol (1:1) followed by 1 hour at -20°C. These samples were centrifuged

and the solvent removed before being resuspended in deionised water to a final

concentration of 2 mg/mL before being analysed by mass spectrometry.

LCMS Analysis of Proteins

All LCMS analysis was conducted using an Agilent 1100 series HPLC system fitted

with a C4 Supelcosil LC-304 column, coupled to an Agilent 1100 LC/MSD SL

quadrupole mass spectrometer. Solvents used were HPLC grade or above and had 0.1 %

formic acid added upon opening.

Methods were run at 0.5 mL/minute flow rate with a gradient of 10% acetonitrile (aq) to

60 % acetonitrile (aq) over 15 minutes, followed by a gradient of 60 % acetonitrile (aq)

to 90 % acetonitrile (aq) over 5 minutes. A period of 5 minutes at 90 % acetonitrile (aq)

to fully clean the column followed by 5 minutes of 10 % acetonitrile (aq) to

reequilibrate the system was added to the end of each run giving a total run time of 30

minutes. MS measurements were only collected between 10 and 20 minutes in to the

run to avoid unnecessary contamination of the detector. Typically 1 µL of 0.5 mg/mL

protein sample was injected per run. However if this was insufficient to obtain a clear

CHAPTER 8

194

spectrum 2-5 µL could be tried. After every 5-10 runs it was beneficial to run a blank

sample (deionised water) to minimise the MS back ground.

MALDI-TOF Analysis of GFP Sample

All MALDI-TOF spectra were obtained using a Ultraflex TOF/TOF (Bruker) and

samples were analysed in linear positive mode. Aqueous GFP samples (1-3 mg/mL)

were mixed with Sinapinic acid (15 mg/mL, acetonitrile, 0.1 % formic acid) solution in

a 1:1 ratio. 1 µL of this mixture was spotted on a MALDI plate and left to dry naturally.


8.4.1 Enzymatic Screening of Mannosides

Alkanethiol spacers (HS-(CH2)17-EG3-OH) and linkers (HS-(CH2)17-EG6-OCH2COOH)

used for SAM formation, were purchased from Prochimia Surfaces (Poland). THAP

solutions were prepared by dissolving 5 mg of THAP in 300 µL water/acetone (1:1).

These solutions were prepared fresh weekly and stored in the fridge between uses.

SAM Formation on Gold Coated Plates

Gold plates were washed with Piranha solution (3:1, 96% H2SO4 (aq): 30% H2O2 (aq))

by submerging for 15 minutes, followed by thorough rinsing with deionised water,

rinsing with ethanol and drying with N2 gas. 0.2 mg/mL solutions of carboxylic acid-

terminated (SAM linker) and tri(ethylene glycol) (SAM spacer) alkanethiols were

prepared in DMSO. These solutions were mixed in a 1:4 (linker:spacer) ratio and 1 µL

of this mixture was spotted on to each well of the gold coated plate. The plate was

sealed in a Petri dish with Parafilm and left overnight in the dark to form a mixed SAM.

The plate was then washed with ethanol and dried with N2 gas. Sample wells were then

spotted with 1 µL THAP solution, allowed to dry and then analysed by MALDI-TOF

MS to determine effective SAM formation. After analysis the plates were again washed

with ethanol and dried with N2 gas.

CHAPTER 8

195

Activation and Glycosylation of SAMs on Gold

A 0.1 M EDC/NHS solution was prepared in dry DMF. 1 µL of this solution was

spotted on each well of the gold coated plate. The plate was sealed in a Petri dish and

left for 2 hours before washing with ethanol and drying with N2 gas. 25 mM solutions of

each glycoside to be immobilised were made up in PBS (pH 7.4) and 1 µL of each

solution was spotted on to the desired wells. The plate was sealed in a Petri dish and left

overnight before being washed with ethanol and dried with N2 gas. Sample wells were

then spotted with 1 µL THAP solution, allowed to dry and then analysed by MALDI-

TOF MS to determine the effectiveness of the glycosylations. After analysis the plates

were again washed with ethanol and dried with N2 gas.

GnT-I Reaction on Trimannoside (41)

GnT-I and POMGnT-I reactions were carried out in 50 mM MES buffer containing 2

mM UDP-GlcNAc, 10 mM MnCl and 25% enzyme preparation. 2 µL of this solution

was spotted on each well, the plate placed on a damp paper towel, sealed in a Petri dish

and left overnight at 37°C. The plates were washed with ethanol, acetone and DCM

sequentially before being dried with N2 and spotted with THAP solution and analysed

by MALDI-TOF MS as previously described.

Screening of Mannosides Against Yeast Microsomal Extracts

Yeast microsomes (from P. Pastoris G5115) were prepared by Dr P. Both (The

University of Manchester). A 400 mL cell culture was harvested, by centrifugation (600

g, 20 minutes, 4°C) during the exponential growth phase. Cells were then washed twice

with ice cold buffer (50 mM Tris/HCl, 5 mM MgCl2, 10 mM 2-mercaptoethanol, pH

7.5) and resuspended in 100 mL of the same buffer. Cells were then disrupted in a

French Press (276 MPa) and deoxyribonuclease I (10 µg/mL) was added. Cells were

centrifuged again (600 g, 20 minutes, 4°C) and the supernatant removed for further

centrifugation (18500 g, 50 minutes, 4°C) to yield a microsome rich fraction, which was

flash frozen and stored at -80°C.195

CHAPTER 8

196

Microsome Activity Assay

Mannosides were screened using solutions containing UDP-GlcNAc, UDP-Glucose and

GDP-Mannose separately and with all three glycosyl donors together. For all screens

undertaken the microsomal extract was diluted 50% in to a pH 7.5 buffered solution to

the final concentrations; 25 mM Tris.HCl, 50 µM Swainsonine, 2.5 mM MgCl2, 5 mM

MnCl2, 2 mM per glycosyl donor.

2 µL of this solution was spotted on each well, the plate placed on a damp paper towel,

sealed in a Petri dish and left overnight at 37°C. The plates were washed with ethanol,

acetone and DCM sequentially before being dried with N2 and spotted with THAP

solution and analysed by MALDI-TOF MS as previously described.

8.4.2 Transialidase (TcTs) Reactions

Reactions were carried out on a 1 mL scale or less, facilitating the direct loading of the

reaction mixture on to the size exclusion column. All reactions were carried out in 50

mM phosphate buffer (pH 7.4) with lactosylated GFP concentrations of 0.1 mM. For

singly and doubly lactosylated GFP samples (0.1-0.2 mM lactose), 5 % TcTs solution

was added to the reaction mixture followed by 10 mg of fetuin. For polylactosylated

GFP samples 10 % TcTs solution was added to the reaction mixture followed by 20 mg

fetuin. Reactions were left shaking (250 rpm) at 30°C for 1 hour, centrifuged for 5

minutes at 16100 g and then directly loaded on to a SephadexTM

size exclusion column.

Purifications were performed as described in section 8.2.2.


Unless stated otherwise, all chemicals were of analytical grade and used as received

from Sigma-Aldrich. Fluorescence measurements were carried out using a M200

infinite plate reader (TECAN). Streptavidin coated 96-well plates were purchased from

Thermo scientific and all lectins used were purchased from Vector Laboratories. ITC

measurements were carried out using an ITC-200 microcalorimeter from microcal.

CHAPTER 8

197

8.5.1 Lectin 96-Well Plate Assay

Streptavidin coated 96-well plates (Thermo Scientific) were stored a 4°C until use. Each

well was first washed three times with 200 μL wash buffer (25 mM Tris, 150 mM NaCl,

0.1 % BSA, 0.05 % Tween® -20, pH 7.2) before the addition of 100 μL of the

appropriate biotinylated lectin (20 μg/mL). 100 μL of wash buffer was added to each

control well and the plates incubated for 2 hours with shaking (150 rpm). Each well was

again washed three times with wash buffer (200 μL) and then 100 μL of the appropriate

protein samples were added to each well. Non glycosylated and singly glycosylated

samples were used at 10 μM, whereas multiply glycosylated mutants’ concentrations

were altered so that the concentration of glycoside was 10 μM. Plates were then

incubated for 1 hour in the dark with shaking (150 rpm). After washing wells 10 times

with wash buffer (200 μL) and twice with deionised water (200 μL), 200 μL of

deionised water was added to each well for the fluorescence measurements. The

fluorescence was measured at 508 nm when exited at 395 nm. Blank measurements,

from wells containing lectins but not incubated with GFP samples were subtracted.

8.5.2 ITC Measurements

The calorimeter cell held a volume of 200 μL and had a maximum injection capacity of

35 μL. All lectin and ligand solutions were made using ITC buffer (10 mM HEPES, 154

mM NaCl, 1 mM MnCl2, 1 mM CaCl2, pH 7.5), which had been filtered and degasses.

For all titrations the lectin was placed in the cell and ligand was injected. Typically 30

injections of 1 μL, 1 second in duration, were made with 2 minute intervals. After each

titration the cell was washed three times with SPR buffer and three times with deionised

water. If this was insufficient then the cell was filled with 1 M NaOH (aq) and heated to

65°C for 30 minutes before washing.

References

198

REFERENCES

(1) Suzuki, M.; Ito, Y.; Savage, H. E.; Husimi, Y.; Douglas, K. T. Chem. Lett. 2003,

306-307.

(2) Eylar, E. H. J. Theor. Biol. 1966, 10, 89-113.

(3) Varki, A. Glycobiology 1993, 3, 97-130.

(4) Moremen, K. W.; Tiemeyer, M.; Nairn, A. V. Nature Rev. Mol. Cell Biol. 2012,

13, 448-462.

(5) Gamblin, D. P.; Scanlan, E. M.; Davis, B. G. Chem. Rev. 2009, 109, 131-163.

(6) Taylor, M. E.; Drickamer, K. Introduction to Glycobiology; Oxford university

press: New York, 2006; Vol. 255.

(7) Gagneux, P.; Varki, A. Glycobiology 1999, 9, 747-755.

(8) Dwek, R. A. Chem. Revs. 1996, 96, 683-720.

(9) Singh, R.; Barden, A.; Mori, T.; Beilin, L. Diabetologia 2001, 44, 129-146.

(10) Masterson, W. J.; Raper, J.; Doering, T. L.; Hart, G. W.; Englund, P. T. Cell

1990, 62, 73-80.

(11) Apweiler, R.; Hermjakob, H.; Sharon, N. Biochim. Biophys. Acta. 1999, 1473,

4-8.

(12) Helenius, A.; Aebi, M. Science 2001, 291, 2364-2369.

(13) Gibbs, B. S.; Coward, J. K. Bioorg. Med. Chem. 1999, 7, 441-447.

(14) Schwarz, F.; Aebi, M. Curr. Opin. Struc. Biol. 2011, 21, 576-582.

(15) Lizak, C.; Gerber, S.; Numao, S.; Aebi, M.; Locher, K. P. Nature 2011, 474,

350-355.

(16) Gavel, Y.; Heijne, G. Protein Eng. 1990, 3, 433-442.

(17) Hammond, C.; Braakman, I.; Helenius, A. PNAS 1994, 91, 913-917.

(18) Klausner, D.; Sitia, R. Cell 1990, 62, 611-614.

(19) Kopito, R. R. Cell 1997, 88, 427-430.

(20) Balch, W. E.; McCaffery, J. M.; Plutner, H.; Farquhar, M. G. Cell 1994, 76,

841-852.

(21) Helenius, A. Mol. Biol. Cell 1994, 5, 253-265.

(22) Imperiali, B.; O'Connor, S. E. Curr. Opin. Chem. Biol. 1999, 3, 643-649.

(23) Beintema, J. J. Biosci. Rep. 1986, 6, 709-714.

(24) Bosques, C. J.; Tschampel, S. M.; Woods, R. J.; Imperiali, B. J. Am. Chem. Soc.

2004, 126, 8421-8425.

(25) Jensen, P. H.; Kolarich, D.; Packer, N. H. FEBS J. 2010, 277, 81-94.

(26) Chen, Y.; Tang, Y.; Sheng, Z.; Zhang, Z. Bioinformatis 2008, 101, 1471-1483.

References

199

(27) Harris, R. J.; Ling, V. T. Glycobiology 1993, 3, 219-225.

(28) Steen, P. V. d.; Rudd, P. M.; Dwek, R. A.; Opdenakker, G. Crit. Rev. Anal.

Chem. 1998, 33, 151-208.

(29) Hang, H. C.; Bertozzi, C. R. Bioorgan. Med. Chem. 2005, 13, 5021-5034.

(30) Gill, D. J.; Clausen, H.; Bard, F. Trends Cell. Biol.2011 , 21, 149-158.

(31) Hounsell, E. F.; Davies, M. J.; Renouf, D. V. Glycoconjugate J. 1996, 13, 19-26.

(32) Ismail, M. N.; Stone, E. L.; Panico, M.; Lee, S. H.; Luu, Y.; Ramirez, K.; Ho, S.

B.; Fukuda, M.; Marth, J. D.; Haslam, S. M. Glycobiology, 2011, 21, 82-98.

(33) Kufe, D. W. Nat. Revs. Cancer 2009, 9, 874-885.

(34) Kozarsky, K. F.; Call, S. M.; Dower, S. K.; Krieger, M. Mol. Cell. Biol. 1988, 8,

3357-3363.

(35) Guzman-Aranguez, A.; Argueso, P. Ocul. Surf. 2010, 8, 8-17.

(36) Bao, M.; Booth, J. L.; Elmendorf, B. J.; Canfield, W. M. J. Biol. Chem. 1996,

271, 31437-31445.

(37) Dwek, R. A. Chem. Rev. 1996, 96, 683-720.

(38) Pang, P. C.; Chiu, P. C. N.; Lee, C. L.; Chang, L. Y.; Panico, M.; Morris, H. R.;

Haslam, S. M.; Khoo, K. H.; Clark, G. F.; Yeung, W. S. B. Science 2011, 333,

1761-1764.

(39) Wong, C. H.; Bryan, M. C.; Nyffeler, P. T.; Liu, H.; Chapman, E. Pure Appl.

Chem. 2003, 75, 179-186.

(40) Campos, V. R.; dos Santos, E. A.; Ferreira, V. F.; Montenegro, R. C.; de Souza,

M. C. B. V.; Costa-Lotufo, L. V.; de Moraes, M. O.; Regufe, A. K. P.; Jordao,

A. K.; Pinto, A. C. RSC Advances 2012, 2, 11438-11448.

(41) Henkel, T.; Ciesiolka, T.; Rohr, J.; Zeeck, A. J. Antibiot. 1989, 42, 299.

(42) Nativi, C.; Francesconi, O.; Gabrielli, G.; De Simone, I.; Turchetti, B.; Mello,

T.; Mannelli, L. D. C.; Ghelardini, C.; Buzzini, P.; Roelens, S. Chem-Eur J.

2012, 18, 5064-5072.

(43) Verez-Bencomo, V.; Fernandez-Santana, V.; Hardy, E.; Toledo, M. E.;

Rodriguez, M. C.; Heynngnezz, L.; Rodriguez, A.; Baly, A.; Herrera, L.;

Izquierdo, M. Science 2004, 305, 522-525.

(44) Mandal, M.; Dudkin, V. Y.; Geng, X.; Danishefsky, S. J. Angew. Chem. Int.

Edit. 2004, 43, 2557-2561.

(45) Schofield, L.; Hewitt, M. C.; Evans, K.; Siomos, M. A.; Seeberger, P. H. Nature

2002, 418, 785-789.

(46) Zhu, J.; Wan, Q.; Ragupathi, G.; George, C. M.; Livingston, P. O.; Danishefsky,

S. J. J. Am. Chem. Soc. 2009, 131, 4151-4158.

(47) Beddoe, T.; Paton, A. W.; Le Nours, J. R. M.; Rossjohn, J.; Paton, J. C. Trends

Biochem. Sci. 2010, 35, 411-418.

(48) Spicer, C. D.; Davis, B. G. Chem. Commun. 2013, 49, 2747-2749.

References

200

(49) Pearce, O. M. T.; Fisher, K. D.; Humphries, J.; Seymour, L. W.; Smith, A.;

Davis, B. G. Angew. Chem. Int. Edit. 2005, 44, 1057-1061.

(50) Zhang, H.; Ma, Y.; Sun, X. L. Med. Res. Rev. 2010, 30, 270-289.

(51) Ashwell, G.; Morell, A. G. Adv. Enzymol. 1974, 41, 99-127.

(52) Krantz, M. J.; Holtzman, N. A.; Stowell, C. P.; Lee, Y. C. Biochem. J. 1976, 15,

3963-3969.

(53) Egrie, J. C.; Dwyer, E.; Browne, J. K.; Hitz, A.; Lykos, M. A. Exp. Hemato.

2003, 31, 290-299.

(54) Wadhwa, M. S.; Rice, K. G. J. Drug Target. D. 2003, 11, 255-268.

(55) Garnier, P.; Wang, X. T.; Robinson, M. A.; van Kasteren, S.; Perkins, A. C.;

Frier, M.; Fairbanks, A. J.; Davis, B. G. J. Drug Target. 2010, 18, 794-802.

(56) Robinson, M. A.; Charlton, S. T.; Garnier, P.; Wang, X. T..; Davis, S. S.;

Perkins, A. C.; Frier, M.; Duncan, R.; Savage, T. J.; Wyatt, D. A. P. Natl. Acad.

Sci. USA 2004, 101, 14527-14532.

(57) Minko, T. Adv. Drug Deliver. Rev. 2004, 56, 491-509.

(58) Zhu, Y.; Li, X.; McVie-Wylie, A.; Jiang, C.; Thurberg, B. L.; Raben, N.;

Mattaliano, R. J.; Cheng, S. H. Biochem. J. 2005, 389, 619-628.

(59) Opanasopit, P.; Higuchi, Y.; Kawakami, S.; Yamashita, F.; Nishikawa, M.;

Hashida, M. BBA-Biomembranes 2001, 1511, 134-145.

(60) Van Patten, S. M.; Hughes, H.; Huff, M. R.; Piepenhagen, P. A.; Waire, J.; Qiu,

H.; Ganesa, C.; Reczek, D.; Ward, P. V.; Kutzko, J. P. Glycobiology 2007, 17,

467-478.

(61) Ikehara, Y.; Niwa, T.; Biao, L.; Ikehara, S. K.; Ohashi, N.; Kobayashi, T.;

Shimizu, Y.; Kojima, N.; Nakanishi, H. Cancer Res. 2006, 66, 8740-8748.

(62) Malam, Y.; Loizidou, M.; Seifalian, A. M. Trends Pharmacol. Sci. 2009, 30,

592-599.

(63) Jones, M. N. Adv. Drug Deliver. Rev. 1994, 13, 215-249.

(64) Jain, K.; Kesharwani, P.; Gupta, U.; Jain, N. K. Biomaterials 2012, 33, 4166-

4186.

(65) Seeberger, P. H.; Werz, D. B. Nature 2007, 446, 1046-1051.

(66) Jefferis, R. Nat. Rev. Drug Discov. 2009, 8, 226-234.

(67) Ghazarian, H.; Idoni, B.; Oppenheimer, S. B. Acta Histochem. 2011, 113, 236-

247.

(68) Lis, H.; Sharon, N. Chem. Rev. 1998, 98, 637-674.

(69) Pieters, R. J. Org. Biomol. Chem. 2009, 7, 2013-2025.

(70) Chervenak, M. C.; Toone, E. J. Biochemistry 1995, 34, 5685-5695.

(71) Collins, B. E.; Paulson, J. C. Curr. Opin. Chem. Biol. 2004, 8, 617-625.

References

201

(72) Reichelt, S.; Elsner, C.; Prager, A.; Naumov, S.; Kuballa, J.; Buchmeiser, M. R.

Analyst 2012, 137, 2600-2607.

(73) Polizzotti, B. D.; Maheshwari, R.; Vinkenborg, J.; Kiick, K. L. Macromolecules

2007, 40, 7103-7110.

(74) Kane, R. S. Langmuir 2010, 26, 8636-8640.

(75) Schwefel, D.; Maierhofer, C.; Beck, J. G.; Seeberger, S.; Diederichs, K.; Moller,

H. M.; Welte, W.; Wittmann, V. J. Am. Chem. Soc. 2010, 132, 8704-8719.

(76) Mortell, K. H.; Weatherman, R. V.; Kiessling, L. L. J. Am. Chem. Soc. 1996,

118, 2297-2298.

(77) Liang, R.; Loebach, J.; Horan, N.; Ge, M.; Thompson, C.; Yan, L.; Kahne, D.

PNAS 1997, 94, 10554-10559.

(78) Seeberger, P. H.; Werz, D. B. Nature 2007, 446, 1046-1052.

(79) Ladmiral, V.; Melia, E.; Haddleton, D. M. Eur. Polym. J. 2004, 40, 431-449.

(80) Kainthan, R. K.; Hester, S. R.; Levin, E.; Devine, D. V.; Brooks, D. E.

Biomaterials 2007, 28, 4581-4590.

(81) Parry, A. L.; Clemson, N. A.; Ellis, J.; Bernhard, S. S. R.; Davis, B. G.;

Cameron, N. R. J. Am. Chem. Soc. 2013, 135, 9362-9365.

(82) Imberty, A.; Chabre, Y. M.; Roy, R. Chem-Eur. J. 2008, 14, 7490-7499.

(83) Kitov, P. I.; Mulvey, G. L.; Griener, T. P.; Lipinski, T.; Solomon, D.;

Paszkiewicz, E.; Jacobson, J. M.; Sadowska, J. M.; Suzuki, M.; Yamamura, K.

PNAS 2008, 105, 16837-16842.

(84) Sinha, R.; Kim, G. J.; Nie, S.; Shin, D. M. Mol. Cancer Ther. 2006, 5, 1909-

1917.

(85) Kikkeri, R.; Lepenies, B.; Adibekian, A.; Laurino, P.; Seeberger, P. H. J. Am.

Chem. Soc. 2009, 131, 2110-2112.

(86) Lin, C. C.; Yeh, Y. C.; Yang, C. Y.; Chen, G. F.; Chen, Y. C.; Wu, Y. C.; Chen,

C. C. Chem. Commun. 2003, 2920-2921.

(87) Baenziger, J. U.; Fiete, D. Cell 1980, 22, 611-620.

(88) Stambach, N. S.; Taylor, M. E. Glycobiology 2003, 13, 401-410.

(89) Taylor, M. E. Mammalian Carbohydrate Recognition Systems; Springer: Berlin,

2001, p 105-121.

(90) Galan, M. C.; Dumy, P.; Renaudet, O. Chem. Soc. Rev. 2013, 42, 4599-4612.

(91) Wang, H.; Huang, W.; Orwenyo, J.; Banerjee, A.; Vasta, G. R.; Wang, L. X.

Bioorgan. Med. Chem. 2013, 21, 2037-2044.

(92) Chalker, J. M.; Bernardes, G. J. L.; Davis, B. G. Accounts Chem. Res. 2011, 44,

730-741.

(93) Avery, O. T.; Goebel, W. F. J. Exp. Med. 1929, 50, 533-550.

(94) Kuchler, S.; Graff, M. N.; Gobaille, S.; Vincendon, G.; Roche, A. C.; Delaunoy,

J. P.; Monsigny, M.; Zanetta, J. P. Neurochem. Int. 1994, 24, 43-55.

References

202

(95) Lew, D. B.; Songu-Mize, E.; Pontow, S. E.; Stahl, P. D.; Rattazzi, M. C. J. Clin.

Invest. 1994, 94, 1855.

(96) Felin, M.; Doyennette, Moyne, M. A. S.; Hadj-Sahraoui, Y.; Aubery, M. l.;

Hubert, J.; Seve, A. P. J. Cell. Biochem. 1994, 56, 527-535.

(97) Kitamura, K.; Stockert, E.; Garin-Chesa, P.; Welt, S.; Lloyd, K. O.; Armour, K.

L.; Wallace, T. P.; Harris, W. J.; Carr, F. J.; Old, L. J. PNAS 1994, 91, 12957-

12961.

(98) Kerehgyarto, M.; Fekete, A.; Szurmai, Z.; Kerehgyarto, J.; Takacs, L.; Kurucz,

I.; Guttman, A. Electrophoresis 2013, 34, 2379-2386.

(99) Kent, S. B. H. Chem. Soc. Rev. 2009, 38, 338-351.

(100) Harpaz, Z.; Siman, P.; Kumar, K. S.; Brik, A. ChemBioChem, 2010, 11, 1232-

1235.

(101) Shang, S.; Tan, Z.; Danishefsky, S. J. PNAS 2011, 108, 5986-5989.

(102) Asahina, Y.; Kamitori, S.; Takao, T.; Nishi, N.; Hojo, H. Angew. Chem. Int.

Edit. 2013, 52, 9733-9737.

(103) Wang, P.; Dong, S.; Brailsford, J. A.; Iyer, K.; Townsend, S. D.; Zhang, Q.;

Hendrickson, R. C.; Shieh, J.; Moore, M. A. S.; Danishefsky, S. J. Angew.

Chem. Int. Edit. 2012, 124, 11744-11752.

(104) Kumar, K. S. A.; Spasser, L.; Ohayon, S.; Erlich, L. A.; Brik, A. Bioconjugate

Chem. 2011, 22, 137-143.

(105) Dang, B.; Kubota, T.; Mandal, K.; Bezanilla, F.; Kent, S. B. H. J. Am. Chem.

Soc., 2013, 135, 11911-11919.

(106) Kajihara, Y.; Izumi, M.; Hirano, K.; Murase, T.; Macmillan, D.; Okamoto, R.

Isr. J. Chem. 2011, 51, 917-929.

(107) Dawson, P. E.; Muir, T. W.; Clark-Lewis, I.; Kent, S. B. H. Science 1994, 266,

776-776.

(108) Wong, C. T. T.; Tung, C. L.; Li, X. Mol. BioSyst. 2013, 9, 826-833.

(109) Yan, L. Z.; Dawson, P. E. J. Am. Chem. Soc. 2001, 123, 526-533.

(110) Wan, Q.; Danishefsky, S. J. Angew. Chem. Int. Edit. 2007, 46, 9248-9252.

(111) Whitney, C. G.; Farley, M. M.; Hadler, J.; Harrison, L. H.; Bennett, N. M.;

Lynfield, R.; Reingold, A.; Cieslak, P. R.; Pilishvili, T.; Jackson, D. New Engl.

J. Med. 2003, 348, 1737-1746.

(112) Grayson, E. J.; Bernardes, G. a. J. L.; Chalker, J. M.; Boutureira, O.; Koeppe, J.

R.; Davis, B. G. Angew. Chem. Int. Edit. 2011, 50, 4127-4132.

(113) Seeberger, P. H. Chem. Soc. Rev. 2008, 37, 19-28.

(114) Zhu, X.; Schmidt, R. R. Angew. Chem. Int. Edit. 2009, 48, 1900-1934.

(115) Lee, Y. C.; Stowell, C. P.; Krantz, M. J. Biochemistry 1976, 15, 3956-3963.

(116) McBroom, C. R.; Samanen, C. H.; Goldstein, I. J. Methods Enzymol. 1972, 28,

212-219.

References

203

(117) Yoshida, T.; Lee, Y. C. Carbohyd. Res. 1994, 251, 175-186.

(118) Sletten, E. M.; Bertozzi, C. R. Angew. Chem. Int. Ed. 2009, 48, 6974-6998.

(119) Wang, L.; Brock, A.; Herberich, B.; Schultz, P. G. Science 2001, 292, 498-500.

(120) Liu, H.; Wang, L.; A.Brock; Wong, C.; Schultz, P. G. J. Am. Chem. Soc. 2003,

125, 1702-1703.

(121) Sletten, E. M.; Bertozzi, C. R. Angew. Chem. Int. Ed. 2009, 48, 6974-6998.

(122) Baskin, J. M.; Bertozzi, C. R. QSAR & Comb. Sci. 2007, 26, 1211-1219.

(123) Plass, T.; Milles, S.; Koehler, C.; Szymanski, J.; Mueller, R.; Wiebler, M.;

Schultz, C.; Lemke, E. A. Angew. Chem. Int. Ed. 2012, 51, 4166-4170.

(124) Xie, J.; Schultz, P. G. Nat. Rev. Mol. Cell Bio. 2006, 7, 775-782.

(125) Chalker, J. M.; Bernardes, G. J. L.; Lin, Y. A.; Davis, B. G. Chem. Asian J.

2009, 4, 630-640.

(126) Harpp, D. N.; Gleason, J. G.; Snyder, J. P. J. Am. Chem. Soc. 1968, 90, 4181-

4182.

(127) Bernardes, G. J. L.; Chalker, J. M.; Errey, J. C.; Davis, B. G. J. Am. Chem. Soc.

2008, 130, 5052-5053.

(128) Zhang, Y.; Bhatt, V. S.; Sun, G.; Wang, P. G.; Palmer, A. F. Bioconjug. Chem.

2008, 19, 2221-2230.

(129) Goddard, D. R.; Michaelis, L. J. Biol. Chem. 1935, 112, 361-371.

(130) Macmillan, D.; Bill, R. M.; Sage, K. A.; Fern, D.; Flitsch, S. L. Chem. Biol.

2001, 8, 133-145.

(131) Davis, N. J.; Flitch, S. L. Tetrahedron Lett. 1991, 32, 6793-6796.

(132) Bhat, S.; Vaino, A. R.; Szarek, W. A. Isr. J. Chem. 2000, 40, 335-341.

(133) Shimomura, O.; Johnson, F. H.; Saiga, Y. J. Cell. Compar. Phyl. 1962, 59, 223-

239.

(134) Inouye, S.; Tsuji, F. I. FEBS Lett. 1994, 341, 277-280.

(135) Prasher, D. C.; Eckenrode, V. K.; Ward, W. W.; Prendergast, F. G.; Cormier, M.

J. Gene 1992, 111, 229-233.

(136) Ormö, M.; Cubitt, A. B.; Kallio, K.; Gross, L. A.; Tsien, R. Y.; Remington, S. J.

Science 1996, 273, 1392-1395.

(137) Yang, F.; Moss, L. G.; Phillips, G. N. Nat. Biotech. 1996, 14, 1246-1251.

(138) Wang, S.; Hazelrigg, T. Nature 1994, 369, 400-403.

(139) Zimmer, M. Chem. Rev. 2002, 102, 759-782.

(140) Koike, M.; Yutoku, Y.; Koike, A. FEBS Open Bio 2013, 3, 46-50.

(141) Miura, H.; Inoko, H.; Inoue, I.; Tanaka, M.; Sato, M.; Ohtsuka, M. Anal.

Biochem. 2011, 416, 237-239.

References

204

(142) Manicassamy, B.; Manicassamy, S.; Belicha-Villanueva, A.; Pisanelli, G.;

Pulendran, B.; Garca-Sastre, A. PNAS 2010, 107, 11531-11536.

(143) Weimer, R. M.; Hill, T. C.; Hamilton, A. M.; Zito, K. Cold Spring Harbor P.

[online] 2012, 7, pdb. prot070029, (accessed March 5, 2013).

(144) Siemering, K. R.; Golbik, R.; Sever, R.; Haseloff, J. Curr. Biol. 1996, 6, 1653-

1663.

(145) Yang, T.-T.; Cheng, L.; Kain, S. R. Nucleic Acids Res. 1996, 24, 4592-4593.

(146) Crameri, A.; Whitehorn, E. A.; Tate, E.; Stemmer, W. P.; Kitts, P. A. Nat.

Biotechnol. 1996, 14, 315-319.

(147) Pédelacq, J. D.; Cabantous, S.; Tran, T.; Terwilliger, T. C.; Waldo, G. S. Nat.

biotechnol. 2005, 24, 79-88.

(148) Day, R. N.; Davidson, M. W. Chem. Soc. Rev. 2009, 38, 2887-2921.

(149) Hanson, G. T.; Aggeler, R.; Oglesbee, D.; Cannon, M.; Capaldi, R. A.; Tsien, R.

Y.; Remington, S. J. J. Biol. Chem. 2004, 279, 13044-13053.

(150) Spergel, D. J.; Kruth, U.; Shimshek, D. R.; Sprengel, R.; Seeburg, P. H. Prog.

Neurobiol. 2001, 63, 673-686.

(151) Day, R. N.; Schaufele, F. J. Biomed. Opt. 2008, 13, 1-6.

(152) Suzuki, M.; Ito, Y.; Savage, H. E.; Husimi, Y.; Douglas, K. T. Chem. Lett. 2003,

32, 306-398.

(153) Baffour-Awuah, N. Y.; Fedeles, F.; Zimmer, M. Chem. Phys. 2005, 310, 25-31.

(154) Sohn, E. J.; Rojas-Pierce, M.; Pan, S.; Carter, C.; Serrano-Mislata, A.; Madueao,

F.; Rojo, E.; Surpin, M.; Raikhel, N. V. PNAS 2007, 104, 18801-18806.

(155) Bulbarelli, A.; Sprocati, T.; Barberi, M.; Pedrazzini, E.; Borgese, N. J. Cell Sci.

2002, 115, 1689-1702.

(156) Warner, J. B.; Thalhauser, C.; Tao, K.; Sahagian, G. G. J. Biol. Chem. 2002,

277, 41897-41905.

(157) Paris, N.; Saint-Jean, B.; Faraco, M.; Krzeszowiec, W.; Dalessandro, G.;

Neuhaus, J.-M.; Di Sansebastiano, G. P. Plant Cell Rep. 1998, 29, 79-86.

(158) Richardson, J. P.; Chan, C.-H.; Blanc, J.; Saadi, M.; Macmillan, D. Org. Biomol.

Chem. 2010, 8, 1351-1360.

(159) Ding, S.; Xu, Q.; Ali, M. K.; Baker, J. O.; Bayer, E. A.; Barak, Y.; Lamed, R.;

Sugiyama, J.; Rumbles, G.; Himmel, M. E. Biotechniques 2006, 41, 435.

(160) Snapp, E. L. Trends Cell Biol. 2009, 19, 649-655.

(161) Li, Y.; Agrawal, A.; Sakon, J.; Beitle, R. R. J. Chromatogr. A 2001, 909, 183-

190.

(162) Zhou, X.; Shi, Q.; Xing, X.; Sun, Y. Chinese J. Chem. Eng. 2006, 14, 229-234.

(163) Yakhnin, A. V.; Vinokurov, L. M.; Surin, A. K.; Alakhov, Y. B. Protein Expres.

Purif. 1998, 14, 382-386.

References

205

(164) Imai, Y.; Matsushima, Y.; Sugimura, T.; Terada, M. Nucleic Acids Res. 1991,

19, 2785.

(165) Stemmer, W. P. PNAS 1994, 91, 10747-10751.

(166) Crameri, A.; Raillard, S.-A.; Bermudez, E.; Stemmer, W. P. C. Nature 1998,

391, 288-291.

(167) Stemmer, W. P. C. Nature 1994, 370, 389-391.

(168) Bejugam, M.; Flitsch, S. L. Org. Lett. 2004, 6, 4001-4004.

(169) Blixt, O.; Han, S.; Liao, L.; Zeng, Y.; Hoffmann, J.; Futakawa, S.; Paulson, J. C.

J. Am. Chem. Soc. 2008, 130, 6680-6681.

(170) Hartmann, M.; Horst, A. K.; Klemm, P.; Lindhorst, T. K. Chem. Commun. 2009,

46, 330-332.

(171) Huflejt, M. E.; Vuskovic, M.; Vasiliu, D.; Xu, H.; Obukhova, P.; Shilova, N.;

Tuzikov, A.; Galanina, O.; Arun, B.; Lu, K.; Bovin, N. Mol. Immunol. 2009, 46,

3037-3049.

(172) Zhi, Z.-L.; Laurent, N.; Powell, A. K.; Karamanska , R.; Fais , M.; Voglmeir, J.;

Wright, A.; Blackburn, J. M.; Crocker, P. R.; Russell, D. A.; Flitsch, S.; Field ,

R. A.; Turnbull, J. E. ChemBioChem 2008, 9, 1568-1575.

(173) Chernyak, A. Y.; Sharma, G. V. M.; Kononov, L. O.; Krishna, P. R.; Levinsky,

A. B.; Kochetkov, N. K.; Rama Rao, A. V. Carbohyd. Res. 1992, 223, 303-309.

(174) Park, S.; Shin, I. Org. Lett. 2007, 9, 1675-1678.

(175) Cheshev, P. E.; Khatuntseva, E. A.; Tsvetkov, Y. E.; Shashkov, A. S.; Nifantiev,

N. E. Russ. J. Bioorg. Chem. 2004, 30, 60-70.

(176) Orlandi, S.; Annunziata, R.; Benaglia, M.; Cozzi, F.; Manzoni, L. Tetrahedron

2005, 61, 10048-10060.

(177) Šardzík, R.; Noble, G. T.; Weissenborn, M. J.; Martin, A.; Webb, S. J.; Flitsch,

S. L. Beilstein J. Org. Chem. 2010, 6, 699-703.

(178) Kaur, K.; Hindsgaul, O. Glycoconjugate J. 1991, 8, 90-94.

(179) Kaur, K. J.; Alton, G.; Hindsgaul, O. Carbohyd. Res. 1991, 210, 145-153.

(180) Vella, G. J.; Paulsen, H.; Schachter, H. Can. J. Biochem. Cell B. 1984, 62, 409-

417.

(181) Davis, N. J.; Flitsch, S. L. Tetrahedron Lett. 1991, 32, 6793-6796.

(182) Goddard, D. R.; Michaelis, L. J. Biol. Chem. 1935, 112, 361-371.

(183) Nielsen, M. L.; Vermeulen, M.; Bonaldi, T.; Cox, J. r.; Moroder, L.; Mann, M.

Nat. Methods 2008, 5, 459-460.

(184) Wong, S. Y.; Guile, G. R.; Dwek, R. A.; Arsequell, G. Biochem. J. 1994, 300,

843.

(185) Zaia, J.; Annan, R. S.; Biemann, K. Rapid Commun. Mass Sp. 1992, 6, 32-36.

(186) Eggler, A. L.; Liu, G.; Pezzuto, J. M.; van Breemen, R. B.; Mesecar, A. D. P

Natl. Acad. Sci. USA 2005, 102, 10070-10075.

References

206

(187) Getz, E. B.; Xiao, M.; Chakrabarty, T.; Cooke, R.; Selvin, P. R. Anal. Biochem.

1999, 273, 73-80.

(188) Shafer, D. E.; Inman, J. K.; Lees, A. Anal. Biochem. 2000, 282, 161.

(189) Fujiyama, K.; Ido, Y.; Misaki, R.; Moran, D. G.; Yanagihara, I.; Honda, T.;

Nishimura, S.-I.; Yoshida, T.; Seki, T. J. Biosci. Bioeng. 2001, 92, 569-574.

(190) Voglmeir, J.; Kaloo, S.; Laurent, N.; Meloni, M. M.; Bohlmann, L.; Wilson, I.

B. H.; Flitsch, S. L. Biochem. J. 2011, 436, 447-455.

(191) Sardzik, R.; Sharma, R.; Kaloo, S.; Voglmeir, J.; Crocker, P. R.; Flitsch, S. L.

Chem. Commun. 2011, 47, 5425-5427.

(192) Zhang, Y. N.; Le, X. C.; Dovichi, N. J.; Compston, C. A.; Palcic, M. M.;

Diedrich, P.; Hindsgaul, O. Anal. Biochem. 1995, 227, 368-376.

(193) Trimble, R. B.; Byrd, J. C.; Maley, F. J. Biol. Chem. 1980, 255, 11892-11895.

(194) Wilson, I. B.; Webberley, M. C.; Revers, L.; Flitsch, S. L. Biochem. J. 1995,

310, 909.

(195) Wilson, I. B.; Taylor, J. P.; Webberley, M. C.; Turner, N. J.; Flitsch, S. L.

Biochem. J. 1993, 295, 195.

(196) Crocker, P. R.; Paulson, J. C.; Varki, A. Nat. Rev. Immunol. 2007, 7, 255-66.

(197) Sperandio, M.; Gleissner, C. A.; Ley, K. Immunol. Rev. 2009, 230, 97-113.

(198) Amaya, M. F.; Watts, A. G.; Damager, I.; Wehenkel, A.; Nguyen, T.;

Buschiazzo, A.; Paris, G.; Frasch, A. C.; Withers, S. G.; Alzari, P. M. Structure

2004, 12, 775-84.

(199) Green, N. M. Biochem. J. 1963, 89, 585-591.

(200) Ofek, I.; Courtney, H. S.; Schifferli, D. M.; Beachey, E. H. J. Clin. Microbiol.

1986, 24, 512-516.

(201) Mandal, D. K.; Kishore, N.; Brewer, C. F. Biochemistry 1994, 33, 1149-1156.

(202) Kizhakkedathu, J. N.; Creagh, A. L.; Shenoi, R. A.; Rossi, N. A. A.; Brooks, D.

E.; Chan, T.; Lam, J.; Dandepally, S. R.; Haynes, C. A. Biomacromolecules

2010, 11, 2567-2575.

(203) Dam, T. K.; Roy, R.; Page, D.; Brewer, C. F. Biochemistry 2002, 41, 1359-1363.

(204) Hester, G.; Wright, C. S. J. Mol. Biol. 1996, 262, 516-531.

(205) Smith, E. A.; Thomas, W. D.; Kiessling, L. L.; Corn, R. M. J. Am. Chem. Soc.

2003, 125, 6140-6148.

(206) Arockia Jeyaprakash, A.; Jayashree, G.; Mahanta, S. K.; Swaminathan, C. P.;

Sekar, K.; Surolia, A.; Vijayan, M. J. Mol. Biol. 2005, 347, 181-188.

(207) Bourne, Y.; Astoul, C.; Zamboni, V. r.; Peumans, W.; Menu-Bouaouiche, L.;

Van Damme, E.; Barre, A.; Rouge, P. Biochem. J. 2002, 364, 173-180.

(208) Dalmau, S. R.; Freitas, C. S. Braz. J. Med. Biol. Res. 1989, 22, 601.

(209) Freyer, M. W.; Lewis, E. A. Method. Cell Biol. 2008, 84, 79-113.

References

207

(210) Orlandi, S.; Annunziata, R.; Benaglia, M.; Cozzi, F.; Manzoni, L. Tetrahedron

2005, 61, 10048-10060.

(211) Denoyelle, S. v.; Polidori, A.; Brunelle, M. l.; Vuillaume, P. Y.; Laurent, S.;

Eiazhary, Y.; Pucci, B. New journal of chemistry 2006, 30, 629-646.

(212) Susaki, H.; Suzuki, K.; Ikeda, M.; Yamada, H.; Watanabe, H. K. Chem. Pharm.

Bull. 1994, 42, 2090-2096.

(213) King, R. R.; Cooper, F. P.; Bishop, C. T. Carbohyd. Res. 1977, 55, 83-93.

(214) Micheel, F.; Micheel, H. Ber. Dtsch. Chem. Ges. 1930, 63, 386-393.

Appendices

208

APENDICIES

Appendix 1: DNA Sequences of GFPuv_WT and GFPuv_C48A_I229C

Appendices

209

Appendix 2: The DNA Sequences of sGFPuv_C48A and Shuffle 1

Appendices

210

Appendix 3: Screen Capture of a Typical Stepwise IMAC GFPuv_WT Purification

Blue = UV 280 nm, Brown = conductance, Green = % of elution buffer.

Appendices

211

Appendix 4: The Fluorescence Spectra of GFPuv Mutants

Appendices

212

Appendix 5: Screen Capture of a Typical Polymannoside Purification

Blue = UV 280 nm. Peak 1 = fraction collected containing trimannoside (43). Peak 2 = fraction collected

containing teteramannosides (48 and 49). Peak 3 = fraction collected containing pentamannoside (50).

Peak 1 Peak 2 Peak 3

Appendices

213

Appendix 6: HSQC-TOCSY of Trimannoside (43)

Appendices

214

Appendix 7: HMBC of Trimannoside (43)

glycosylated green fluorescent protein for carbohydrate

Documents