ORIGINAL ARTICLE

Gradual pediocin PA-1 resistance in Enterococcus faecalis conferscross-protection to diverse pore-forming cationic antimicrobialpeptides displaying changes in cell wall and mannosePTS expression

Rashmi Kumariya & Shiv Kumar Sood &

Yudhishthir Singh Rajput & Anita Kumari Garsa

Received: 5 February 2014 /Accepted: 5 May 2014# Springer-Verlag Berlin Heidelberg and the University of Milan 2014

Abstract Due to innate and acquired resistance inEnterococcusfaecalis against most antibiotics, identification of new alterna-tives has increased interest in diverse populations of potentcationic antimicrobial peptides (CAMPs) for treatment and nat-ural food biopreservation. The CAMPs, after crossing the cellwall to the periplasmic space, kill their target strain by formingpores in the cell membrane. However, reports of resistanceagainst these CAMPs necessitated the understanding of step(s)interfered with while acquiring this resistance, for designingeffective CAMP analogs. In this direction, we selected stableand gradual dose-dependent pediocin PA-1 single exposure re-sistant (Pedr) mutants of E. faecalis, which conferred cross-protection to diverse CAMPs, viz., HNP-1, nisin and alamethicinbut not to polymyxin B, lysozyme and vancomycin. With thesePedr mutants of E. faecalis there was: a gradual neutralization incell wall surface charge involving D-alanylation of wall teichoicacids (WTA) and lipoteichoic acids (LTA), increase in cell-surface hydrophobicity, increased cell aggregation and biofilmformation and ultra-structural changes in the cell wall, and areduction of periplasmic space. In addition, a gradual decreasein expression of mannose PTS two (mpt) operon was alsoobservedwith distinct changes in growth rate achieving the samebiomass production during the stationary phase. These resultsshow that resistance to these CAMPs is not due to mpt directlyacting as a docking molecule but due to changes in the cell wall,which increased the permeability barrier to CAMPs diffusion toreach the periplasmic space.

Keywords Enterococcus faecalis . pediocin PA-1 . cationicantimicrobial peptides . resistance . permeability barrier

Introduction

Enterococci are the third leading cause of hospital associatedinfections and have gained increased importance due to their fastadaptation to the clinical environment by acquisition of antibioticresistance and pathogenicity traits (Gomez et al. 2011). Entero-coccus faecalis, a ubiquitous commensal of mammalian gastro-intestinal flora, is a leading cause of nosocomial infections and agrowing public health concern (McBride et al. 2007). It is alsoused as an indicator of fecal contamination of food. On someoccasions, the commensal relationship with the host is disruptedcausing serious diseases like endocarditis, urosepsis, meningitis,etc. (Koch et al. 2004). Due to its innate and acquired resistanceto most clinically used antibiotics, identification of new alterna-tives for treatment of E. faecalis is a high priority (Arias andMurray 2009). The discovery of a diverse population of non-toxic, non-immunogenic and potent cationic antimicrobial pep-tides (CAMPs), as an essential component of anti-infective de-fence mechanisms in mammals, amphibians, insects, plants,fungi and bacteria offer effective alternative candidates againstbacteria, fungi, viruses and protozoa resistant to natural andsynthetic drugs (Hancock and Chapple 1999; Zasloff 2002). Inhigher organisms, CAMPs such as α-defensins (HNP-1),cathelicidin, thrombocidin, cathepsin G, etc., act on the cellmembrane of target cells to serve as a first defence againstinvading harmful micro-organisms.

Lactic acid bacterial CAMPs, known as bacteriocins, alsoacts on the cell membrane of Gram positive species with lowG + C content (Cotter et al. 2005) such as E. faecalis.

R. Kumariya (*) : S. K. Sood :Y. S. Rajput :A. K. GarsaDivision of Animal Biochemistry, National Dairy Research Institute,Karnal, Haryana 132001, Indiae-mail: rash4787@gmail.com

Ann MicrobiolDOI 10.1007/s13213-014-0912-1

Bacteriocins are generally considered to be safe, and; there-fore, their use as natural food preservatives has been underinvestigation. Nisin, produced by Lactococcus lactis, has beengranted to be generally regarded as safe (GRAS) status forcertain applications (E234) by the Food and Drug Adminis-tration in 1988. Among bacteriocins, pediocin-like bacterio-cins (36-48 residues) are by far the most investigated beingListeria active (Nes et al. 2007) and being the first in line afternisin for potential as food biopreservative. These bacteriocinscontain two structural regions, a conserved cationic N-terminal region that mediates binding of bacteriocins to thetarget cell surface and a less conserved C-terminal region thatpenetrates into the hydrophobic part of the target cell mem-brane and determines the target specificity, thus, the inhibitoryspectrum (Johnsen et al. 2005; Sood et al. 2013). Among thesebacteriocins, pediocin PA-1 was shown to have an extradisulfide bond in the C-terminal region, which improves itspotency at elevated temperatures and widens its antimicrobialspectrum (Fimland et al. 2000). CAMPs used in the presentstudy are pediocin PA-1 (a CAMP from Pediococcus sp.),nisin (a CAMP from Lactococcus lactis), alamethicin (aCAMP from Trichoderma viridae), HNP-1 (a mammalianCAMP) and polymyxin B (a cationic cyclic peptide). AllCAMPs except polymyxin B are effective against gram-positive bacteria and kill by acting on their cell-membraneswhile polymyxin B is effective against gram-negative bacte-ria. Lysozyme and vancomycin are the antimicrobial agentswhich kill gram-positive bacteria by acting on cell-walls.

CAMPs, after reaching periplasmic space, kill their targetbacteria by forming pores in the cell membrane. They initiallyinteract with the membrane surface followed by penetration intothe lipid bilayer. However, resistance against pediocin PA-1 hasbeen reported in E. faecalis implicating mannose phosphotrans-ferase system two (mpt) (Hechard et al. 2001). This mpt couldpossibly act as a receptor for interactions with pediocin-likebacteriocins in the cytoplasmic membrane, as heterologousexpression of themptC subunit ofmptACD operon from Listeriamonocytogenes in Lactococcus lactis alone was sufficient toconfer sensitivity to pediocin-like bacteriocins inLactococcus lactis (Ramnath et al. 2004). A slight decrease inmptACD expression in three intermediate resistantL. monocytogenesmutants suggested that the level of sensitivityis correlated to the level of mpt expression (Arous et al. 2004).However, high and intermediate pediocin resistant mutants ofE. faecalis V583 did not show any significant difference in mptexpression but mpt was reported to be involved in global carboncatabolite control in pediocin sensitivity (Opsata et al. 2010).Interestingly, sakacin-P (a bacteriocin from Lactobacillus sakei)resistant mutant of L. monocytogenes with >106-fold resistanceto sakacin-P as compared to wild-type strain showed repressionof mpt expression in contrast to induction of mpt expression inits 103-fold resistant mutant (Tessema et al. 2011). Consequent-ly, studies show that decreasedmpt expression leads to CAMPs

resistance but its role in different levels of sensitivities withCAMPs remains unclear. Several other genes have also beenassociated with this CAMPs resistance acquisition phenomenonwhich include the gene encoding enzymes involved in alterationof a cell-wall including dlt operon responsible for D-alanylationof teichoic acids in E. faecalis (Fabretti et al. 2006),L.monocytogenes (Vadyvaloo et al. 2004a),Clostridium difficile(McBride and Sonenshein 2011) and Streptococcus (Dover et al.2012). In Gram-positive bacteria, four proteins DltA, DltB, DltCand DltD, encoded by the dlt operon, are required for thesynthesis of D-alanyl esters for substitution in teichoic acid.DltA functions as a D-alanine-D-alanyl carrier protein ligase(Dcl), which activates D-alanine by hydrolysis of ATP andtransfers it to the phosphopantetheine cofactor of a specific D-alanine carrier protein (Dcp), which is encoded by dltC. Thehydrophobic DltB is a membrane protein required for D-alanineincorporation into teichoic acids and transfer of activated D-alanine across the cytoplasmic membrane. DltD is responsiblefor the transfer of D-alanine from the membrane carrier DltB toteichoic acids. This results in positive charges being incorporat-ed into the mostly negatively charged cell wall, which has beendemonstrated to increase the bacterial resistance to CAMPs(McBride and Sonenshein 2011). Therefore, it is necessary tounderstand the steps interfered in the development of resistanceagainst CAMPs for designing effective analogs (Mehla andSood 2013). In this direction, we used stable and a graduallydose-dependent panel of pediocin PA-1 single exposure resistant(Pedr) mutants of E. faecalis. These Pedr mutants of E. faecaliswith increasing 50 % inhibitory concentration (IC50) forpediocin, displaying cross-protection to other CAMPs, wereused to analyze their D-alanylation of teichoic acids, cell surfacehydrophobicity, cell aggregation, biofilm formation, ultra-structural changes in cell wall, expression of mpt gene andgrowth rate. Our data suggests that changes in cell wall impartsa permeability barrier for diffusion of CAMPs to the periplasmicspace.

Methods

Bacterial strains, media and pediocin PA-1

Enterococcus faecalis NCDC 114 was used as a target organ-ism and Pediococcus pentosaceous NCDC 273 was used as apediocin PA-1 producer strain (Mehla and Sood 2011). Nutrientbroth and deMan Rogosa Sharpe (MRS) broth was used forculturing E. faecalis NCDC 114 and P. pentosaceous NCDC273, respectively. The cultures were subcultured twice beforeuse to make them physiologically active. MRS broth (100 ml)fermentedwithP. pentosaceouswas centrifuged and supernatantwas collected and heated at 90˚C for 10 min to prevent proteo-lytic degradation of the pediocin. Pediocin produced was puri-fied by ammonium sulfate precipitation (80 % saturation) at its

Ann Microbiol

isoelectric point (pH 8.8), followed by cation-exchange chroma-tography using SP-Sephadex (Vijay Simha et al. 2012). Thepurified fraction was found to contain 57.5 μg/mlpediocin PA-1, quantified using a RP-HPLC peak areacompared to a peak area of standard pedion PA-1(Sigma). This preparation was concentrated using a 3 kDacut-off ultrafiltration membrane. The single band purity (∼340purification fold) of this preparation was checked using SDS-PAGE.

Selection of gradual dose-dependent pediocin PA-1-resistant(Pedr) mutants of E. faecalis

Susceptibility of wild-type and Pedr mutants of E. faecalis topediocin, nisin, alamethicin, HNP-1, polymyxin B and twocell-wall acting antimicrobial agents, viz., lysozyme and van-comycin was quantified by IC50 determination using brothinhibition assay (Cabo et al. 1999). Pedr mutants wereenriched after single pediocin exposure as described byRekhiff et al. (1994). In brief, culture containing 1–5×108 CFU was inoculated in nutrient broth containing pediocinat 5, 6, 8 and 10 fold of IC50 of wild type and incubated at37˚C. After visible growth, the broth culture was seriallydiluted and plated onto nutrient agar without pediocin. Severalcolonies from each nutrient agar plate were picked randomly.The IC50 for each of these colonies was determined. Each ofthe colonies and the wild-type strain were then propagatedthrough ten 16 h sub-culturings and the IC50 of each wasdetermined again. The colony showing the same IC50 asbefore sub-culturing showed that the resistance that developedwas a stable phenotypic character and these colonies werethen used for further studies.

Growth kinetics

To different tubes containing 5 ml of sterile nutrient broth, 1 %inoculum of overnight culture was added and incubated at37˚C till the end of the experiment. Bacterial growth wasmonitored by recording absorbance at 600 nm from 0 to14 h with 1 h intervals, spectrophotometrically using a dualUV-Vis spectrophotometer taking sterile nutrient broth as ablank. The specific growth rate (h−1) for the wild type and Pedr

mutants was determined from A600 data using the followingequation: Specific growth rate (μ)= ln (X2 / X1) / (t2−t1),where, X1 and X2 are A600 at time t1 and time t2 during mid-log phase, respectively.

Microscopic analysis

The bacterial cells were Gram stained and examined under alight microscope (magnification, ×1,000). A scanning electronmicroscope (SEM) was used to visualize the wild-type andPedr mutants of E. faecalis (Park et al. 2006). Mid-log phase

cells were grown for 6 h and collected by centrifugation at7,000 g for 10 min at 4˚C. After washing, the cells wereresuspended in phosphate buffer saline (pH 7.4) and retainedon 0.22 μm nylon membrane filter paper (Axiva ScichemBiotech). The retained cells were fixed in 1.4 % glutaralde-hyde prepared in phosphate buffer saline (pH 7.4) for 6 h at4˚C. After fixation, the filter papers were kept in phosphatebuffer saline (pH 7.4) for 6 h at 4˚C. The filter papers retainedwith cells were then dehydrated by sequential treatments with30 %, 50 %, 70 %, 80 %, 90 % and 100 % ethanol. After goldcoating, the samples were examined under SEM. Transmis-sion electron microscopy (TEM) was used to assess the ultra-structural characteristics of wild-type and Pedr mutants ofE. faecalis using standard methodology (Hayat 2000).

Biofilm plate assay

Enterococcus faecalis wild-type and Pedr were tested forproduction of biofilm using the protocol described byBaldassari et al. (2001). Briefly, bacteria were grown over-night at 37˚C in nutrient broth. Polystyrene tissue culture wellplates were filled with 180 μl of nutrient broth and inoculatedwith 20 μl of overnight culture, and the plates were thenincubated at 37˚C for 18 h. The plates were read in anenzyme-linked immunosorbent assay reader at an opticaldensity of 630 nm, the culture medium was thendiscarded, the wells were washed three times with200 μl of phosphate buffer saline (PBS) withoutdisturbing the biofilm on the bottom of the wells. Theplates were dried at 60˚C for 1 h and then stained with2 % crystal violet for 2 min. Excess stain was removedby rinsing the plates under tap water, and the plateswere then dried at 60˚C for 10 min. The optical densityof 630 nm was determined. Biofilm formation wasnormalized to growth with the biofilm index, calculatedas the OD of the biofilm×(0.5/OD of growth).

Cell surface hydrophobicity

The bacterial cell surface hydrophobicity of both wildtype and Pedr mutants of E. faecalis was determinedusing the MATH (Microbial Adhesion To Hydrocarbons)assay as described by Reifsteck et al. (1987) with slightmodifications. The wild-type and Pedr mutants ofE. faecalis were cultured in nutrient broth to stationaryphase at 37˚C. The cells were harvested by centrifuga-tion at 3,000 g for 15 min, washed three times in ice-cold phosphate buffer and finally resuspended in phos-phate buffer to achieve an OD600 of 0.5 at 600 nm. A4.8 ml volume of each bacterial suspension was mixedwith 0.8 ml of n-hexadecane or xylene in a glass tubeand vigorously shaken for 1 min. After 45 min, theaqueous phase was careful ly removed with a

Ann Microbiol

micropipette, and absorbance was recorded at 600 nm,using a UV-Visible spectrophotometer. The affinity ofbacteria for the solvents, i.e., n-hexadecane or xylenewas evaluated as: %Adherence=(1- A/A0)×100, where,A0 and A is the OD600 of the bacterial suspensionbefore and after mixing with the solvents, respectively.

RNA isolation, cDNA synthesis, and RT-PCR

RT-PCR was performed on wild-type and Pedr mutantsof E. faecalis for expression analysis of dltA geneencoding D-alanine-poly(phosphoribitol) ligase subunit1 and mptAB gene encoding EIIman using 16S rRNA asa house-keeping gene. Cells in exponential growth(OD600∼0.5) were harvested by centrifugation andRNA isolation was performed as described byShepard and Gilmore (1999). To remove remnants ofDNA, RNA was treated with RNase-free DNase I(Fermentas Life Sciences). The cDNA was synthesizedusing the RevertAidTM First Strand cDNA SynthesisKit (Fermentas Life Sciences). RT-PCR was carriedout using primers designed during the present study (Table 1).No change in 16S rRNA sequence was observed (GenBankaccession no. KF179518).

Analysis of D-alanine and phosphorus

Wall teichoic acid (WTA) and lipoteichoic acid (LTA) wereisolated from wild-type and Pedr mutants of E. faecalis asdescribed by Peschel et al. (1999). D-Alanine content wasdetermined according to an established method described byPollack and Neuhaus (1994). The phosphorus content inWTAand LTA samples was determined using a method describedby Kahovcova and Odivac (1969).

Statistical analysis

Calculations of IC50, specific growth rates and One-wayANOVAwith Bonferroni post-hoc analysis for percent hydro-phobicity, biofilm formation and D-alanine:phosphorus ratioof WTA and LTAwere done using GRAPHPAD PRISM 3.0(GRAPHPAD software, San Diego, CA, USA).

Results

Selection of gradual dose-dependent pediocin PA-1-resistant(Pedr) mutants of E. faecalis

Gradual dose-dependent pediocin PA-1 resistant (Pedr) mu-tants of E. faecalis were generated for the characterization ofPedr mutants and delineating the mechanism of CAMPs re-sistance in E. faecalis. To achieve this aim, we selected elevendifferent classes of resistant mutants that appeared on nutrientagar medium containing pediocin at different concentrations(8, 9, 12, 15 μM). After 24 h incubation, bacterial coloniesappeared on the plates with pediocin concentrations of 8 and9 μM. The bacterial colonies appeared on the plates withpediocin concentration of 12 μM after 48 h of incubationand of 15 μM concentration after 60 h of incubation. Thenumber of colonies appearing on nutrient agar medium con-taining pediocin at different concentrations were counted todetermine the frequency of appearance of mutants, which wasfound to be 10-6 to 10-7 for all appeared mutants, irrespectiveof the pediocin concentration. These selected mutants exhib-ited IC50 for pediocin varying from 1.87 μM to 8.12 μM(Table 2). These mutants were propagated through ten over-night subculturings and IC50 values were determined again.The mutants that exhibited consistent IC50 values were select-ed and designated as Efm2.1, Efm3.1, Efm3.2, Efm4.1,Efm4.2, Efm5.1, Efm5.2 and Efm5.3, respectively. The des-ignated name signified the fold increase in IC50 values incomparison to wild-type. For example, Efv4.1 signifies thatIC50 of this mutant for pediocin is approximately four timeshigher than the wild-type. The selected Pedr mutants werethen used for further studies.

Pediocin PA-1 resistance confers cross-protection to othercationic antimicrobial peptides

IC50 of HNP-1, nisin, pediocin, alamethicin, polymyxin B(Fig. 1a), lysozyme and vancomycin (Fig. 1b) for the wild-type strain of E. faecalis NCDC114 was found to be 0.67(2.31), 1.26 (4.22), 1.55 (7.17), 2.36 (4.64), 19.34 (26.8), 2.9(41.49) and 1.1 (1.59) μM (μg/ml), respectively. It was mostsensitive to HNP-1, followed by vancomycin, nisin, pediocin,

Table 1 Primers designed usingannotated genome sequence ofE. faecalis V583 (Paulsen et al.2003)

Gene name (Number) Primer sequence (5′to 3′) Amplified fragment (bp)

mptAB (EF_0020) Forward: GAGGAACACCATTTAACCAAReverse: GCTGGTTGTAACTCTTCTGG

202

dltA (EF_2749) Forward: ACATACCCAATTGGTAAACGReverse: GGTGAACATCTACCAGCACT

203

16S rRNA (EF_16SA) Forward: GGTGGAGCATGTGGTTTAATReverse: CCATTGTAGCACGTGTGTAG

301

Ann Microbiol

alamethicin, lysozyme and least sensitive to polymyxinB. Gradual pediocin resistance also conferred gradualcross-protection to nisin, alamethicin and HNP-1 only,which was most steep in alamethicin, comparable tonisin, and least steep in HNP-1. However, the patternof IC50 of lysozyme, vancomycin and polymyxin Bobserved between wild-type and Pedr mutants were notsignificantly different. This indicates that susceptibilityto CAMPs and lysozyme, vancomycin and polymyxin Bis through different mechanisms. Moreover, it can besaid that NAM-NAG linkage or cross-linking of pepti-doglycan remained unchanged on resistance acquisitionto CAMPs, as revealed by similar sensitivities of wild-type and Pedr mutants towards lysozyme andvancomycin.

Growth kinetics changes

To investigate the physiological implications of acquiringCAMP resistance, growth was followed in wild-type and Pedr

mutants. A delay in the onset of log phase for Pedr mutantswas shifted from 1 h in case of wild-type strain to 2 h in case ofPedr mutants (Fig. 2a). The specific growth rate also decreasedvisibly in all Pedr mutants (Fig. 2b) although not statisticallysignificant. However, comparable biomass concentrationscould be achieved during stationary phase by wild-type andPedr mutants.

Morphological changes and biofilm formation

Upon Gram staining, wild-type cells were found in short,dispersed, straight chains whereas gradual increase in cellaggregation of Pedr mutants was observed, which was con-firmed upon SEM (Fig. 3). The aggregation in Pedr mutantsincreased with increasing degree of resistance. Similarly, therewas an increase in biofilm formation in Pedr mutants (Fig. 4).

Cell-wall changes

A visible difference under TEM was observed in the cell wallof Pedr mutants (Efm5.1) being more dense, thick, tough, andopaque merging with the cell membrane showing reducedperiplasmic space as opposed to the wild-type E. faecalis(Ef) (Fig. 5). However, no significant difference betweensensitivities of wild-type and Pedr mutants towards lysozymeand vancomycin (Fig. 1b) suggests no change in NAM-NAGlinkage as well as between cross-linking of peptidoglycan.This evidence demands further investigation of the peptido-glycan layer of the cell wall of Pedr mutants. The D-alanineand phosphorus content in the isolated WTA and LTA werequantified to calculate the D-alanine:phosphorus ratio. TheWTA and LTA of all Pedr mutants of E. faecalis (Fig. 6) hada gradually increasing D-alanine:phosphorous ratio(P<0.001) than the corresponding wild-type strain. RT-PCRa n a l y s i s o f d l t A g e n e e n c o d i n g D - a l a n i n e -poly(phosphoribitol) ligase subunit 1 in wild-type and Pedr

mutants of E. faecaliswas carried out to analyze the change inexpression level of dlt operon upon resistance acquisition toCAMPs. It revealed only a slight increase in their expressionlevels except five times Pedr mutants (Fig. 7a panel C andFig. 7b). However, sequencing of dltA gene amplified frag-ments from Ef (GenBank Accession No. KF551970) andEfm5.1 (in raw sequence) revealed consecutive mutations intwo amino acids present on the surface in a hydrophilicenvironment, i.e., L315 to K315 and K316 to S316, whichcould be accommodated without inactivating the enzyme.

Cell-surface hydrophobicity changes

The cell-surface hydrophobicity of wild-type and Pedr mu-tants of E. faecalis was determined using the MATH (Micro-bial Adhesion To Hydrocarbons) assay. The percent cell-surface hydrophobicity of Pedr mutants (Fig. 8) was foundto be significantly higher than that of the wild-type strain ofE. faecalis.One way ANOVA revealed significant differencesamong wild-type and Pedr mutants (F(8,18)=436.6,P<0.0001 with n-hexadecane; F(8,18)=145.5, P<0.0001with xylene). After Bonferroni post-hoc analysis, it was foundthat there was a significant increase in cell surface hydropho-bicity of Pedr mutants as compared to wild type strain ofE. faecalis (P<0.001). The cell-surface hydrophobicity of

Table 2 Selection of stable and gradual pediocin-resistant mutants ofE. faecalis using a single exposure of different doses of pediocin

Pediocin dose (μM)* IC50 (μM) ** Ratio† Pedr Designation††

Before After

0 1.55 1.55 1 Ef

8 3.00 3.14 1.9 Efm2.1

9 4.66 4.61 3.0 Efm3.1

9 4.40 4.43 2.8 Efm3.2

12 6.39 6.46 4.1 Efm4.1

12 6.57 6.62 4.2 Efm4.2

15 7.75 7.63 5.0 Efm5.1

15 7.54 7.61 4.9 Efm5.2

15 8.12 8.05 5.2 Efm5.3

*Concentration of pediocin at which wild-type was cultured till visiblegrowth appeared for plating to select colonies.** IC50 of E. faecalis before and after ten sub-culturings for selection ofstable Pedr mutants†Ratio of the IC50 fo Ped

r mutants to that of the wild-type strain.††Designated on the basis of the ratio of the IC50 of pediocin for Pedr

mutants and the wild-type (Ef) strain, i.e., Efm4.2 indicates that it is thesecond Pedr mutant with its IC50 value approximately 4 times of that ofthe wild-type.

Ann Microbiol

Ef Efm2.1 Efm3.1 Efm3.2 Efm4.1 Efm4.2 Efm5.1 Efm5.2 Efm5.30

5

10

15

20

25

30 Pediocin Nisin Alamethicin HNP-1 Polymyxin B

E. faecalis

IC

50

(M

)

Ef Efm2.1 Efm3.1 Efm3.2 Efm4.1 Efm4.2 Efm5.1 Efm5.2 Efm5.30

1

2

3

4Lysozyme Vancomycin

E. faecalis

IC5

0 (

M)

(a)

(b)

Fig. 1 IC50 of (a) pediocin, nisin,alamethicin, HNP-1 andpolymyxin B (b) lysozyme andvancomycin for wild-type andPedr mutants of E. faecalis. Thedata are the means of threeindependent experiments, witherror bars representing the SD

0 2 4 6 8 10 12 14 16

0.0

0.2

0.4

0.6

0.8

1.0Ef

Efm2.1

Efm3.1

Efm3.2

Efm4.1

Efm4.2

Efm5.1

Efm5.2

Efm5.3

Time (h)

Ba

cte

ria

l g

ro

wth

(Ab

sorb

an

ce 6

00

nm

)

Ef Efv2.1 Efv3.1 Efv3.2 Efv4.1 Efv4.2 Efv5.1 Efv5.2 Efv5.30.0

0.1

0.2

0.3

0.4

E. faecalis

Sp

ecif

ic g

row

th r

ate

()

(a)

(b)

Fig. 2 (a) Growth curves ofE. faecalis and Pedr mutants innutrient broth. (b) Comparison ofthe specific growth rates of thewild type (Ef) and Pedr mutants ofE. faecalis. The data are themeans of three independentexperiments, with error barsrepresenting the SD

Ann Microbiol

A

B

C

D

E

Fig. 3 Gram-staining lightmicrographs (×1000) andscanning electron micrographs(×15000) of wild-type strain Ef(A) and Pedr mutants Efm2.1 (b),Efm3.1 (c), Efm4.1 (d) andEfm5.1 (e) of E. faecalis. Increasein aggregates formation with theincrease in degree of resistance ishighlighted by yellow ovals frompanel A to E in SEM. Some largecells with rod shapes are alsovisible in panel B (yellow arrows)

Ann Microbiol

Pedr mutants of E. faecalis increased gradually with the in-crease in degree of resistance to pediocin.

mpt expression analysis

A gradual reduction in expression ofmptACD operon (Fig. 7apanel D and Fig 7b) in 2, 3, 4 and 5 times Pedr mutants withrespect to wild-type was 3.5, 19.1, 24.8 and 40.6 %, respec-tively. However, there was no sequence change between wild-type (Ef) and Pedr mutant (Efm5.1) (GenBank accession no.KF179519). There was no correlation observed betweenmptAB and dltA expression levels (Fig 7b).

Discussion

CAMPs cross cell walls to reach periplasmic space and killtheir target strains by forming pores in the cell membrane.CAMPs initially interact with the membrane surface followedby penetration into the lipid bilayer as proposed for nisin(Moll et al. 1997), pediocin-like bacteriocins (Sood and

Sinha 2003) and alamethicin (Sansom 1991; Yang et al.2001). However, a pre-requisite step for CAMPs is to crossthe cell wall to reach the periplasmic space, for subsequentinteractions with the cell membrane. In the cell membrane,Mpt (Dalet et al. 2001; Hechard et al. 2001; Gravesen et al.2002b; Opsata et al. 2010) and phospholipid head-groups andfatty acid tails (Thippeswamy et al. 2009; Mehla and Sood2011; Mishra et al. 2012) have been studied for their rolesduring pore formation in E. faecalis. In the present study,using a series of gradual E. faecalis Pedr mutants, simulta-neously conferring cross-protection to diverse CAMPs, weinvestigated the role of cell wall surface charge (as a perme-ability barrier to CAMPs diffusion to reach periplasmic space)and Mpt (as a receptor in the cell membrane) towards resis-tance development.

An important aspect of resistance is whether the samemechanism is acquired by gradual resistant mutants (as select-ed in the present study) to different CAMPs. As observed inthe present study, gradual E. faecalis Pedr mutants are resistantto nisin, alamethicin and HNP-1, but not to polymyxin B. Thissuggests that they might be having a similar mechanism ofresistance development, which is supported by several studies(Sakayori et al. 2003; Naghmouchi et al. 2007; Calvez et al.2007; Mehla and Sood 2011).

Display of gradual cross-resistance to diverse CAMPs toall Pedr mutants, in the present study revealed the non-specificinteractions with the target in the cell membrane and therebyrules out involvement of Mpt acting as a receptor for deter-mination of observed Pedr phenotype. This indicates that thePedr phenotype is not the determinant for regulation of themptexpression, therefore, pediocin resistance and down regulationof the mpt gene expression in the present study are not thecause or effect of each other. Contrasting up and down regu-lation in low and high sakacin-P resistant mutants ofL. monocytogenes (Tessema et al. 2011), respectively, clearlyrules out the involvement of Mpt as receptor, which supportsour result.

Although, then, discrete increases in fitness costs betweenwild-type strain and Pedr mutants in terms of reduced growth

Ef Efm2.1 Efm3.1 Efm3.2 Efm4.1 Efm4.2 Efm5.1 Efm5.2 Efm5.30.0

0.1

0.2

0.3

0.4

E. faecalis

Bio

film

in

dex

ns nsns

a**

a**

a*

a** a

**

Fig. 4 Biofilm index of wild-type and Pedr mutants of E. faecalis. Thedata are the means of three independent experiments with error barsrepresenting SD. ns, no significant difference from their respective Efvalue, a* (P<0.01) and a** (P<0.001), significantly different from theirrespective Ef value

Ef Efm5.1Fig. 5 Transmission electronmicrograph of E. faecalis (wild-type, Ef and Pedr mutant, Efm5.1)Bar=100 nm

Ann Microbiol

rate do not correspond to the observed gradual Pedr pheno-type. This fitness cost was thought to be due to energy-expensive metabolic pathways in resistant strains (Dykesand Hastings 1998). In fact, it is due to loss of mptA expres-sion (Gravesen et al. 2002a), which is supposed to be the

major transporter of glucose for L. monocytogenes. Thus, theclear explanation for the reduced specific growth rate inresistant variants is the reduced consumption rate of glucose.Also, lower activity of glucose-transporting enzymes causingthis decrease in the glucose consumption rate is responsible

Ef Efm2.1 Efm3.1 Efm3.2 Efm4.1 Efm4.2 Efm5.1 Efm5.2 Efm5.30.00

0.25

0.50

0.75 WTA LTA

E. faecalis

D-A

lan

ine:

Ph

osp

ho

rus

rati

o

a**

a**

b**

b*

bns

b**

b** b

**b

**

a**

a**

a** a

**a

**

a**

Fig. 6 Comparison of D-alanine:phosphorus ratio of wallteichoic acid (WTA) andlipoteichoic acid (LTA) of wild-type and Pedr mutants ofE. faecalis, showing increase inD-alanine content in both WTAand LTA in all Pedr mutants ofE. faecalis. Data represents means(+SD). a** (P<0.001); ns(P>0.05) no significantdifference; b (P<0.05), b*

(P<0.01), b** (P<0.001)

(b)

16S rRNA

mptAB

23S

16S

A

B

C

dltA

D

Ef Efm2.1 Efm3.1 Efm3.2 Efm4.1 Efm4.2 Efm5.1 Efm5.2 Efm5.3(a)Fig. 7 (a) Agarose gel

electrophoresis of the total RNAisolated (A) and amplifiedfragments of, 16S rRNA(GenBank accession no.KF179518) (B), dltA (GenBankaccession no. KF551970) (C),and mptAB (GenBank accessionno. KF179519) (D), obtainedfrom the RT-PCR of total RNAisolated from the wild-type andPedr mutants of E. faecalis. (b)Changes in expression of mptABand dltA genes during growth ofwild-type and Pedr mutantsmeasured from RT-PCR bandintensities of panel C & D ofFig. 7(a)

Ann Microbiol

for the decrease in specific growth rate (Vadyvaloo et al.2004b).

The clumps formation or aggregation observed in Pedr

mutants of E. faecalis may be the prime mechanism of resis-tance and cross-resistance to other antimicrobial peptides. Itcould be a very important protective mechanism, because asmall overall cell surface is exposed to CAMPs in clumped oraggregated cells. The inner cells remain fully protected andsurvive; therefore, the larger the aggregates, the more cellssurvive (Mehla and Sood 2011). This aggregation phenome-non has revealed the protective power of large cell densities towithstand exposure to otherwise lethal antibiotic concentra-tions (Butler et al. 2010).

Cell-surface hydrophobicity was found to increase with thecell-aggregation, which may be responsible for formation oflarge aggregates. The increase in cell-surface hydrophobicitywas found to be collinear with the degree of resistance ac-quired against pediocin. Carnobacteriocin-resistant strains ofEnterococcus faecium LMA 63 were also found to have morehydrophobic surfaces than the other sensitive Enterococcusstrains tested (Jacquet et al. 2012). The increase in cell surfacehydrophobicity in alamethicin-resistant variants of E. faecalishas a collinearity with the degree of resistance acquiredagainst alamethicin (R2=0.909), which may be responsiblefor the formation of large clumps of resistant cells (Mehla andSood 2011). From these results, it can be concluded thataggregation and cell-surface hydrophobicity are interrelated.Further, biofilm formation was found to be concomitant withthe aggregation and cell-surface hydrophobicity and also withthe degree of resistance. The reduced anionic nature of thebacterial cell envelope has also been exploited by differentmicrobes as a resistance strategy against CAMPs. A decreasein anionic charge reduces the interactions of CAMPs with thebacterial membrane and contributes to antimicrobial molecule

resistance in microbes (Peschel and Sahl 2006). The increasein D-alanylation of teichoic acids resulted in neutralization oftheir negative charge, thereby increasing cell-surface hydro-phobicity to cause cell aggregation and biofilm formation. Theobserved non-conserved mutation in DltA protein inEfm5.1 at position 315 changing small hydrophobic leucineto the basic residue lysine, being present on the surface inhydrophilic environment, could be accommodated withoutinactivating the enzyme. Consequently, these allowed muta-tions may be enhancing the enzyme activity involved in D-alanylation of teichoic acids. Therefore, a slight increase inexpression levels and two mutations in dltA gene in Pedr

mutants when compared with wild-type may be contributingtowards the observed increased D-alanine:phosphorus ratio inboth WTA and LTA of Pedr mutants of E. faecalis.

The observed ultra-structural changes in the cell wall ofEfm5.1 being more dense, thick, tough, and opaque mergewith the cell membrane showing a reduced periplasmic space.However, this could not be ascribed to change in NAM-NAGlinkage or cross-linking of peptidoglycan, as revealed bysimilar sensitivities of wild-type and Pedr mutants towardslysozyme and vancomycin , bu t changes in D-alanine:phosphorus ratio of WTA and LTA may be contribut-ing to these ultrastructural changes. Similarly, marked alter-ations appeared in the cell envelope with the increased cell-wall thickness in the daptomycin-resistant E. faecalis (Ariaset al. 2011) and E. faecium (Mishra et al. 2012), when com-pared with the sensitive strain.

Thus, observed gradual cell aggregation and ultra-structural changes along with the neutralization of cell-surface charge may be the contributing factors in deter-mining the gradual Pedr phenotype in E. faecalis. Thisin turn imposes a permeability barrier to reduce effec-tive concentration of CAMPs in the reduced periplasmicspace. Therefore, it can be concluded that the cell wallmay be contributing as a permeability barrier to CAMPsdiffusion to reach a periplasmic space to form poresusing non-specific interactions with phospholipid head-groups and fatty acids tails of the cell membrane ofE. faecalis. The analysis of phospholipids from wild-type and Pedr mutants and their use in the preparationof biomimetic membranes for an in vitro biochemicalassay, to elucidate their role during pore formation, areunder investigation.

Acknowledgments The authors thank the Director, National DairyResearch Institute, Karnal, India for providing general support duringthis period of research study. The study was supported by the NationalInitiative on Climate Resilient Agriculture (NICRA) Project, ICAR. Wethank Dr. S. K. Tomar, Principal Scientist, Dairy Microbiology Division,NDRI, Karnal, India for helping us in carrying out scanning electronmicroscopy, and we are also thankful to All India Institute of MedicalSciences, India for allowing us to use the central facility for transmissionelectron microscopy.

Ef Efv 2.1 Efv 3.1 Efv 3.2 Efv 4.1 Efv 4.2 Efv 5.1 Efv 5.2 Efv 5.30

10

20

30n-Hexadecane Xylene

E. faecalis

% H

yd

ro

ph

ob

icit

y

aa

a

aa

a

a

b

ab

b

bb

bb

b

Fig. 8 Comparison of percent hydrophobicity of the wild-type and Pedr

variants of E. faecalis. The data are the means of three independentexperiments, with error bars representing the SD. a, significantly different(P<0.001) from their respective Ef value (n-hexadecane) and b, signifi-cantly different (P<0.001) from their respective Ef value (xylene)

Ann Microbiol

References

Arias CA,Murray BE (2009) Antibiotic-resistant bugs in the 21st century- a clinical super-challenge. N Engl J Med 360:439–443

Arias CA, Panesso D, McGrath DM, Qin X, Mojica MF, Miller C, DiazL, Tran TT, Rincon S, Barbu EM, Reyes J, Roh JH, Lobos E,Sodergren E, Pasqualini R, Arap W, Quinn JP, Shamoo Y, MurrayBE, Weinstock GM (2011) Genetic basis for in vivo daptomycinresistance in enterococci. New Engl J Med 365:892–900

Arous S, Dalet K, Hechard Y (2004) Involvement of the mpo operon inresistance to class IIa bacteriocins in Listeria monocytogenes. FEMSMicrobiol Lett 238(1):37–41

Baldassarri L, Cecchini R, Bertuccini L, AmmendoliaMG, Iosi F, ArciolaCR, Montanaro L, Di Rosa R, Gherardi G, Dicuonzo G, Orefici G,Creti R (2001) Enterococcus spp. produces slime and survives in ratperitoneal macrophages. Med Microbiol Immunol (Berlin) 190:113–120

Butler MT, Qingfeng W, Harshey RM (2010) Cell density and mobilityprotect swarming bacteria against antibiotics. Proc Natl Acad Sci US A 107:3776–3781

Cabo ML, Murado MA, Gonzalez MP, Pastoriza L (1999) A method forbacteriocin quantification. J Appl Microbiol 87:907–914

Calvez S, Rince A, Auffray Y, Prevost H, Drider D (2007) Identificationof new genes associated with intermediate resistance ofEnterococcus faecalis to divercin V41, a pediocin-like bacteriocin.Microbiology 153:1609–1618

Cotter PD, Hill C, Ross P (2005) Bacteriocins: developing innate immu-nity for food. Nat Rev Microbiol 3(10):777–788

Dalet K, Cenatiempo Y, Cossart P, Hechard Y (2001) A σ54-dependentPTS permease of the mannose family is responsible for sensitivity ofListeria monocytogenes to mesentericin Y105. Microbiology 147:3263–3269

Dover RS, Bitler A, Nezer R, Shmuel-Galia L, Firon A, Shimoni E,Trieu-Cuot P, Shai Y (2012) D-Alanylation of lipoteichoic acidsconfers resistance to cationic peptides in Group B Streptococcus byincreasing the cell wall density. PLoS Pathog 8(9):e1002891

Dykes GA, Hastings JW (1998) Fitness costs associated with class IIabacteriocin resistance in Listeria monocytogenes B73. Lett ApplMicrobiol 26(1):5–8

Fabretti F, Theilacker C, Baldassari L, Kaczynski Z, Kropec A, Holst O,Huebner J (2006) Alanine esters of enterococcal lipoteichoic acidplay a role in biofilm formation and resistance to antimicrobialpeptides. Infect Immun 74(7):4164–4171

Fimland G, Johnsen L, Axelsson L, Brurberg MB, Nes IF, Eijsink VGH,Nissen-Meyer A (2000) A C-terminal disulfide bridge in pediocin-like bacteriocins renders bacteriocin activity less temperature depen-dent and is a major determinant of the antimicrobial spectrum. JBacteriol 198(9):2643–2648

Gomez JAL, Hendrickx APA, Willems RJ, Top J, Sava I, Huebner J,Witte W, Werner G (2011) Intra- and interspecies genomic transferof the Enterococcus faecalis pathogenicity island. PLoS One 6(4):e16720

Gravesen A, Jydegaard Axelsen AM, Mendes da Silva J, Hansen TB,Knochel S (2002a) Frequency of bacteriocin resistance developmentand associated fitness costs in Listeria monocytogenes. ApplEnviron Microbiol 68:756–764

Gravesen A, RamnathM, Rechinger KB, Andersen N, Jansch L, HechardY, Hastings JW, Knochel S (2002b) High-level resistance to class IIabacteriocins is associated with one general mechanism in Listeriamonocytogenes. Microbiology 148:2361–2369

Hancock RE, Chapple DS (1999) Peptide antibiotics. Antimicrob AgentsChemother 43:1317–1323

Hayat MA (2000) Principles and techniques of electron microscopy:biological applications, 4th edn. Cambridge University Press,Cambridge, United Kingdom

Hechard Y, Pelletier C, Cenatiempo Y, Frere J (2001) Analysis of σ54-dependent genes inEnterococcus faecalis: a mannose PTS permease(EIIMan) is involved in sensitivity to a bacteriocin, mesentericinY105. Microbiology 147:1575–1580

Jacquet T, Cailliez-Grimal C, Borges F, Gaiani C, Francius G, Duval JFL,Waldvogel Y, Revol-Junelles (2012) Surface properties of bacteriasensitive and resistant to the class IIa carnobacteriocin Cbn BM1. JAppl Microbiol 112(2):372–382

Johnsen L, Fimland G, Nissen-Meyer J (2005) The C-terminal domain ofpediocin-like antimicrobial peptides (class IIa bacteriocins) is in-volved in specific recognition of the C-terminal part of cognateimmunity proteins and in determining the antimicrobial spectrum.J Biol Chem 280(10):9243–9250

Kahovcova J, Odavic R (1969) A simple method for the quantitativeanalysis of phospholipids separated by thin layer chromatography. JChromatogr A 40:90–96

Koch S, Hufnagel M, Theilacker C, Huebner J (2004) Enterococcalinfections: host response, therapeutic, and prophylactic possibilities.Vaccine 22:822–830

McBride SM, Sonenshein AL (2011) The dlt operon confers resistance tocationic antimicrobial peptides in Clostridium difficile.Microbiology 157:1457–1465

McBride SM, Fischetti VA, LeBlanc DJ, Moellering RC, Gilmore MS(2007) Genetic diversity amongEnterococcus faecalis. PLoSOne 7:e582

Mehla J, Sood SK (2011) Substantiation of Enterococcus faecalis ofdose-dependent resistance and cross-resistance to pore-forming an-timicrobial peptides by use of a polydiacetylene-based colorimetricassay. Appl Environ Microbiol 77(3):786–793

Mehla J, Sood SK (2013) Connecting membrane fluidity and surfacecharge to pore-forming antimicrobial peptides resistance by anANN-based predictive model. Appl Microbiol Biotechnol 97(10):4377–4384

Mishra NN, Bayer AS, Tran TT, Shamoo Y, Mileykovskaya E, DowhanW, Guan Z, Arias CA (2012) Daptomycin resistance in enterococciis associated with distinct alterations of cell membrane phospholipidcontent. PLoS One 7(8):e49358

Moll GN, Clark J, Chan WC, Bycroft BW, Roberts GC, Konings WN,Driessen AJ (1997) Role of transmembrane pH gradient and mem-brane binding in nisin pore formation. J Bacteriol 179(1):135–140

Naghmouchi K, Kheadr E, Lacroix C, Fliss I (2007) Class I/class IIabacter iocin cross-resis tance phenomenon in Listeriamonocytogenes. Food Microbiol 24:718–727

Nes IF, Diep DB, Holo H (2007) Bacteriocin diversity in Streptococcusand Enterococcus. J Bacteriol 189(4):1189–1198

Opsata M, Nes IF, Holo H (2010) Class IIa bacteriocin resistance inEnterococcus faecalis V583: The mannose PTS operon mediatesglobal transcriptional responses. BMC Microbiol 10:224

Park SC, Kim JY, Shin SO, Jeong CY, Kim MH, Shin SY, Cheong GW,Park Y, Hahm KS (2006) Investigation of toroidal pore and oligo-merization by melittin using transmission electron microscopy.Biochem Biophys Res Commun 343:222–228

Paulsen IT, Banerjei L, Myers GS, Nelson KE, Seshadri R, Read TD,Fouts DE, Eisen JA, Gill SR, Heidelberg JF, Tettelin H, Dodson RJ,Umayam L, Brinkac L, BeananM, Daugherty S, DeBoy RT, DurkinS, Kolonay J, Madupu R, Nelson W, Vamathevan J, Tran B, UptonJ, Hansen T, Shetty J, Khouri H, Utterback T, Radune D, KetchumKA, Dougherty BA, Fraser CM (2003) Role of mobile DNA in theevolution of vancomycin-resistant Enterococcus faecalis. Science299:2071–2074

Peschel A, Sahl HG (2006) The co-evolution of host cationic antimicrobialpeptides and microbial resistance. Nat Rev Microbiol 4:529–536

Peschel A, Otto M, Jack RW, Kalbacher H, Jung G, Gotz F (1999)Inactivation of the dlt operon in Staphylococcus aureus conferssensitivity to defensins, protegrins and other antimicrobial peptides.J Biol Chem 274:8405–8410

Ann Microbiol

Pollack JH, Neuhaus FC (1994) Changes in wall teichoic acid during therod-sphere transition of Bacillus subtilis. J Bacteriol 176:7252–7259

Ramnath M, Arous S, Gravesen A, Hastings JW, Hechard Y (2004)Expression of mptC of Listeria monocytogenes induces sensitivityto class IIa bacteriocins in Lactococcus lactis. Microbiology 150(8):2663–2668

Reifsteck F, Wee S, Wilkinson BJ (1987) Hydrophobicity-hydrophilicityof staphylococci. J Med Microbiol 24:65–73

Rekhif N, Atrih A, Lefebvre G (1994) Selection and properties ofspontaneous mutants of Listeria monocytogenes ATCC 15313 re-sistant to different bacteriocins produced by lactic acid bacteriastrains. Curr Microbiol 28:237–241

Sakayori Y, Muramatsu M, Hanada S, Kamagata Y, Kawamoto S, Shima J(2003) Characterization of Enterococcus faecium mutants resistant tomundticin KS, a class IIa bacteriocin. Microbiology 149:2901–2908

Sansom MS (1991) The biophysics of peptide models of ion channels.Prog Biophys Mol Biol 55:139–235

Shepard BD, Gilmore MS (1999) Identification of aerobically andanaerobically induced genes in Enterococcus faecalis by ran-dom arbitrarily primed PCR. Appl Environ Microbiol 65(4):1470–1476

Sood SK, Sinha PR (2003) Analysis of structure of YGNGV motifcontaining bacteriocins: A model for pore formation. Ind JBiotechnol 2:227–235

Sood SK, Vijay Simha B, Kumariya R, Garsa AK, Mehla J, Meena S,Lather P (2013) Highly specific culture-independent detection of

YGNGV motif-containing pediocin-producing strains. ProbioticsAntimicrob Prot 5:37–42

Tessema GT, Moretro T, Snipen L, Axelsson L, Naterstad K (2011)Global transcriptional analysis of spontaneous sakacin P-resistantmutant strains of Listeria monocytogenes during growth on differentsugars. PLoS One 6(1):e16192

Thippeswamy HS, Sood SK, Venkateswarlu R, Raj I (2009) Membranesof five-fold alamethicin-resistant Staphylococcus aureus,Enterococcus faecalis and Bacillus cereus show decreased interac-tions with alamethicin due to changes in membrane fluidity andsurface charge. Ann Microbiol 59:593–601

Vadyvaloo V, Arous S, Gravesen A, Hechard Y, Chauhan-Haubrock R,Hastings JW, RautenbachM (2004a) Cell-surface alterations in classIIa bacteriocin-resistant Listeria monocytogenes strains.Microbiology 150(9):3025–3033

Vadyvaloo V, Snoep JL, Hastings JW, Rautenbach M (2004b)Physiological implications of class IIa bacteriocins resistance inListeria monocytogenes. Microbiology 150(2):335–340

Vijay Simha B, Sood SK, Kumariya R, Garsa AK (2012) Simple and rapidpurification of pediocin PA-1 from Pediococcus pentosaceus NCDC273 suitable for industrial application. Microbiol Res 167:544–549

Yang L, Harroun TA,Weiss TM, Ding L, Huang HW (2001) Barrel-stavemodel or toroidal model? A case study on melittin pores. Biophys J81:1475–1485

Zasloff M (2002) Antimicrobial peptides of multicellular organisms.Nature 415(6870):389–395

Ann Microbiol