Hexon Gene Switch Strategy for the Generation of Chimeric Recombinant Adenovirus

Download Hexon Gene Switch Strategy for the Generation of Chimeric Recombinant Adenovirus

Post on 14-Mar-2017

213 views

Category:

Documents

1 download

Embed Size (px)

TRANSCRIPT

<ul><li><p>HUMAN GENE THERAPY 13:311320 (January 20, 2002)Mary Ann Liebert, Inc.</p><p>Hexon Gene Switch Strategy for the Generation of Chimeric Recombinant Adenovirus</p><p>RIMA YOUIL, TIMOTHY J. TONER, QIN SU, MINCHUN CHEN, AIMIN TANG, ANDREW J. BETT, and DANILO CASIMIRO</p><p>ABSTRACT</p><p>The usefulness of adenovirus as a vehicle for transgene delivery is limited greatly by the induction of neu-tralizing anti-adenoviral immunity following the initial administration, thereby resulting in shorter-term andreduced levels of transgene expression. In this paper, we outline a strategy for the generation of recombinantAd5-based adenovectors that have undergone a complete hexon exchange in an effort to circumvent pre-ex-isting anti-vector humoral immunity. Eighteen different chimeric adenoviral vectors (from subgroups A, B,C, D, and E) have been constructed using a combination of direct cloning and bacterial homologous recom-bination methods. However, only chimeric Ad5-based constructs in which the hexons from Ad1, Ad2, Ad6,and Ad12 are incorporated in place of the Ad5 hexon were successfully rescued into viruses. Despite severalattempts, the remaining fourteen chimeric adenovectors were not rescuable. In vivo rodent studies using trans-genes for human immunodeficiency virus type 1 (HIV-1) gag and secreted human alkaline phosphatase (SEAP)suggest that the Ad5/Ad6-gag chimera (wherein Ad5 hexon was replaced with that of Ad6) is able to evadeneutralizing antibodies generated against Ad5 vector efficiently. However, it appears that cross-reactive cy-totoxic T lymphocytes (CTL) may also play a role in controlling in vivo infectivity of Ad5/Ad6-gag chimera.The Ad5/Ad12 chimera was found to be extremely ineffective in the i.m. delivery and expression of HIV-1gag in mice compared to the Ad5/Ad6 construct. Implications of these results will be discussed.</p><p>311</p><p>OVERVIEW SUMMARY</p><p>Recombinant chimeric adenovectors were constructed by ex-changing the complete hexon gene from an Ad5 vector withhexon genes from alternate adenovirus serotypes. Whereasthe construction of the vectors was possible, many of thesechimeric adenovectors did not rescue. Those that did werehexon exchanges made within the subgroup C viruses as wellas a subgroup A virus (Ad12). These gag-containing chime-ric viruses were analyzed for their ability to circumvent pre-existing Ad5 antibodies in rodents previously vaccinated withfirst generation Ad5 virus. In the background of Ad5 virus,gag expression from the recombinant Ad5-gag vector was to-tally ablated. However, gag expression from the Ad5/Ad6-gag vector was suppressed 10-fold compared with the ex-pression observed from nave (non-preexposed) mice. In aseparate rodent experiment, SEAP expression from anAd5SEAP virus was completely ablated following preincu-bation of the virus with anti-Ad5 containing sera. However,</p><p>SEAP expression was comparable when Ad5SEAP waspreincubated in sera obtained from either nave mice or thoseimmunized with the Ad5/Ad6-gag chimera. This indicatedthat at the level of humoral immunity, Ad5/Ad6-gag chimeracan in fact circumvent neutralization by Ad5 virus.</p><p>INTRODUCTION</p><p>REPLICATION-DEFECTIVE ADENOVIRUSES are efficient vehiclesfor the in vivo delivery of a variety of heterologous pro-teins (Graham, 1990; Robbins et al., 1998; Zheng et al., 2000).Adenoviruses are maintained episomally and do not, suppos-edly, integrate into the host genome. Consequently, turnover ofdifferentiated cells infected with such a recombinant virus willresult in the loss of the viral genome and hence concomitantloss of the transgene. To sustain transgene expression levels,repeat administrations of the respective recombinant adenovi-rus are often required, particularly for genetic therapy applica-</p><p>1Merck &amp; Co., Inc., West Point, PA, 19486.</p></li><li><p>tions. However, the efficacy of subsequent doses may be limitedby pre-existing host immunity generated against the adenovirusvector. The humoral responses are largely directed against theviral capsid (Willcox and Mautner, 1976; Adam et al., 1986; Rus-sell et al., 1991; Gahery-Segard et al., 1998), which consists ofthree major structural proteinshexon, penton, and fiber. Thehexon protein forms the major part of the virion coat, account-ing for 240 capsomeres out of the 252 subunits that comprise thecapsid. Several reports have suggested that antibodies directedtoward the hexon coat are the strongest and most neutralizing(Wohlfart, 1988; Toogood et al., 1992). In fact, vaccine devel-oped to prevent adenoviral infections has been based on purifiedhexon protein (Couch et al., 1973).</p><p>The hexon protein contains determinants for both type- andgroup-specific neutralizing antibodies (Toogood et al., 1992). Theneutralizing capacity of the Ad5 hexon protein has been associ-ated with two main regions, Loop 1 (L1) and Loop 2 (L2) (Jorn-vall et al., 1981; Chroboczek et al., 1992; Crompton et al., 1994).Loop 1 contains six specific regions designated as hypervariable(HVR 16) and spans amino acid residues 132320. L2 containsthe seventh hypervariable region (HVR 7) and it spans aminoacids 408459. The remaining regions between these hypervari-able regions are highly conserved within subgroup C; in the caseof Ad2 and Ad5 capsids, these regions are nearly 100% identical.The three-dimensional structures of the Ad2 and Ad5 capsidsshow that the L1 and L2 regions are, in fact, present on the sur-face of the virion and subsequently represent the type-specificantigenic determinants of the hexon protein. The similarity in thethree-dimensional structures of subgroup C adenoviruses suggeststhat it would be plausible to construct Ad 5 hexon chimeras bysimply exchanging hexon genes with members from its own sub-group. Gall et al. (1998) have successfully constructed Ad5chimera where the native hexon has been completely replacedwith an Ad2 hexon, but not with that of Ad7 (subgroup B). Hexonproteins from subgroups A, B, D, E, and F, on the other hand,show lower levels of similarity with Ad 5 hexon (Crawford-Mik-sza et al., 1996). This difference subsequently allows for alternateadenovirus to escape pre-existing immunity to the more prevalentgroup C adenovirus.</p><p>To test whether anti-viral immunity can be largely circum-vented by replacing the hexon gene, we have generated chi-meric recombinant adenoviruses that contain the E1,E3-deletedAd5 backbone and wherein the Ad5 hexon gene was replacedwith the hexon genes of several alternate serotypes from sub-groups A, B, C, D, and E. This strategy tested the feasibility ofpropagating such chimeras in the existing Ad5 E1-transformedcell lines because the majority of the adenoviral backbone isbased on the Ad5 genome. In addition, we were able to assessthe effect of pre-existing anti-Ad5 fiber and penton antibodieswith respect to their neutralizing ability.</p><p>MATERIALS AND METHODS</p><p>Growth and viral DNA extraction of alternate wild-type adenoviruses</p><p>Wild-type (WT) adenoviruses (serotypes 12 and 18 from sub-group A; 7, 11, 16, and 35 from subgroup B; 1, 2, and 6 fromsubgroup C; 9, 10, 13, 15, 17, 19, 27, and 37 from subgroup</p><p>D; 4 from subgroup E) were purchased from the American TypeCulture Collection (ATCC) as lyophilized viruses. Virus waspropagated in HeLa cells and was CsCl purified. Viral DNAwas extracted following protease treatment and phenol/chloro-form extraction.</p><p>PCR amplification of hexon genes from alternateadenovirus serotypes</p><p>In designing the primers to amplify the hexon genes, the re-striction enzymes Cla I and Nae I were selected as convenientcloning sites based on the conserved amino acids at the 59 and39 end of the hexon genes from a number of fully sequencedhexon genes from subgroups A, B, C, D, and E (Crawford-Mik-sza et al., 1996). The Ad5 hexon sequence was obtained fromGenBank accession #AH007403. The following Ad5 specificPCR primers that contain these specific restriction endonucle-ase recognition sites (underlined) were used for amplificationof Ad5 hexon:</p><p>59TTGCCGCCATGGCTACCCC ATCGATGATGC39 (Ad5Forward primer)</p><p>59CGTTATGTTGTGGCGTTGCCGGC C39 (Ad5 Reverseprimer)</p><p>The boldface type signifies the silent nucleotide change to gen-erate the Cla I site:</p><p>The Ad4 hexon sequence was obtained from GenBank ac-cession #AFO65064. The following Ad4-specific primers wereused for the amplification of Ad4 hexon.</p><p>59TTGCCGCCATGGCCACCCCA TCGATGCT39 (Ad4 For-ward primer)</p><p>59CGTTATGTGGTGGCGTTGCCGGC T39 (Ad4 Reverseprimer)</p><p>The Ad12 hexon sequence was obtained from GenBank acces-sion #X73487.</p><p>The following PCR primers were used for amplification ofAd12 hexon:</p><p>59TTGCCGCCATGGCCACTCCATCGATGATGC39(Ad12 Forward primer)</p><p>59CGTTAGGTGGTAGCGTTGC CGGCCG39 (Ad12 Re-verse primer)</p><p>The boldface type signifies the silent nucleotide changes madeto generate the Cla I and the Nae I sites.</p><p>Because complete sequence information does not exist forthe majority of the alternate adenoviral hexons, amplificationof the remaining hexons was performed using primers based onAd 5 hexon sequence. This decision was based on the conservedamino acid sequence at the extreme ends of hexon genes asshown in alignments between a number of fully sequenced al-ternate hexon genes (Crawford-Miksza et al., 1996).</p><p>PCR was conducted using Advantage-HF PCR Kit (Clon-tech Laboratories, Inc., CA) and the following buffers were usedto amplify each DNA sample:</p><p>100% high-fidelity buffer for Ad 1, 2, 4, 5 10, 11, 12, 13, 15,37, 7, 16, 19, 6</p><p>YOUIL ET AL.312</p></li><li><p>60% high-fidelity buffer / 40 % cDNA buffer for Ad 17, 9, 35100% cDNA buffer for Ad18</p><p>Each 50-ml amplification contained , 100 ng viral DNA. Eachreaction also contained , 500 ng of each specific hexon primer(forward and reverse). The PCR conditions were as follows:94C for 15 sec; 94C for 15 sec, and 68C for 3 min (35 cy-cles); the final extension was 68C for 3 min.</p><p>The adenovirus hexon PCR products were gel purified andcloned using Zero Blunt TOPO PCR cloning kit (Invitrogen,CA) following manufacturers instructions.</p><p>Generation of Ad5 shuttle vector containing a unique Cla I site</p><p>The Ad5 shuttle vector was constructed by digesting the first-generation Ad5 backbone with Asp 718 and Hind III and iso-lating the 3870-bp fragment. This fragment, which contains thehexon gene and flanking Ad5 DNA sequences, was cloned di-rectly into Asp 718/Hind III site of pUC18 cloning vector. Thisvector is now referred to as pAd5 hexon shuttle vector.</p><p>The incorporation of a Cla I site within the extreme 59 endof the Ad5 hexon gene in the pAd5 shuttle vector allowed forthe removal of the native Ad5 hexon gene from the shuttle vec-tor by digestion with Cla I and Nae I. To create this Cla I site,an Ad5 hexon-specific 59 primer was designed to include a sin-gle-nucleotide change 12 bp from the start of the hexon codingsequence. This nucleotide change produced the required Cla Isite without altering the amino acid at this position (CCTRCCA). All serotypes amplified with the Ad5-based primer setscontained had 59 Cla I and 39 Nae I sites incorporated into theiramplified hexon genes.</p><p>Ad4 specific 39 primer was made with the base changeGGTR GGC to allow for generation of the Nae I site. Thisbase change did not alter the coding for the amino acid at thisposition.</p><p>The Ad 12 specific 59 primer included the base changeCCCR CCA for generation of the Cla I site. The 39 primer in-cluded two base changes GCGGGTR GCCGGC for genera-tion of the Nae I site. These base alterations did not result inany amino acid changes.</p><p>Insertion of the Cla I site at the 59 end of the Ad5 hexongene in pAd5 hexon shuttle vector required amplification oftwo PCR products that spanned the Ad559 hexon region us-ing the following primer sets:</p><p>Fragment A: Forward primer: 59-CTGGTGACGCAAATAGA-CGAReverse primer: 59-TCATCGATGGGGTAGCCAT</p><p>Fragment B: Forward primer: 59-CCCATCGATGATGCCGCAReverse primer: 59-CTTGCTCGTCTACTTCGTCT</p><p>PCR conditions for fragment A and B were as follows:</p><p>Clontech (high fidelity) PCR kit was used as per the manufac-turers instructions. The WT Ad5 viral DNA was used as thetemplate (100 ng). Amplification was 95C for 5 min fol-lowed by, 35 cycles at 94C for 50 sec, 60C for 50 sec, 68Cfor 50 sec. A final 7-min extension was performed at 68C.</p><p>Fragment A PCR product (440 bp) and fragment B PCRproducts (481 bp) were each cloned directly into TOPO PCRBlunt II (Invitrogen). The TOPO clone containing fragment Awas digested with Cla I and EcoRV and treated with calf in-testinal phosphatase. This digestion resulted in the removal ofa 28 bp fragment. The remaining 4321 fragment was gel puri-fied. TOPO containing fragment B was digested with Cla I andEco RV and the 487-bp fragment was purified. This 487-bpfragment (which is the fragment B product) was then ligatedinto the 4321 bp vector fragment to produce the TOPO (frag-ment A 1 B) plasmid. This plasmid was then digested with EcoRI and the 918-bp fragment containing the A 1 B region wasgel purified. The pAd5 hexon shuttle vector was digested withBss HII and Bsg I enzymes and the 7093-bp fragment was gelpurified. A total of 100 ng of the 7093-bp and the 918-bp frag-ments were co-infected into BJ5183 cells (Chartier et al., 1996;Youil et al., 2001). Positive clones were identified by screen-ing with Cla I and Nae I. This is the shuttle vector designatedpAd5 hexon(Cla I/Nae I) that was used for all subsequentcloning manipulations with alternate hexon genes.</p><p>Construction of shuttle vectors containing alternate hexon genes</p><p>Each of the alternate hexon genes were removed from theTOPO cloning vectors using the following combination of re-striction digestions and then gel purified:</p><p>Nae I TURBO (Promega)/Cla I for Ad 1, 2, 4, 12, 7, 11NgoM IV/Cla I for Ad 16, 35NgoM IV (partial)*/Cla I for Ad 10, 13, 27, 37, 9, 15, 19, 17,</p><p>18</p><p>(*Note: Because there was no available full sequence informa-tion on these hexon genes, it was not possible to predict Nae Isites, until they were cloned into the TOPO vector. To removethese particular hexon genes, partial digestion using NgoM IVwas required.) Each full-length hexon gene fragment was thencloned directly into pAd5 hexon (Cla I/Nae I) shuttle vector,which had been digested with either Nae I TURBO/Cla I orwith the combination NgoM IV / Cla I, to remove the nativeAd5 hexon. NgoM IV was used as an alternative to Nae I fordigestion convenience. The sizes of the hexons were around the2.8- to 3.2-kb range. The hexon genes were each ligated withthe appropriately digested pAd5 shuttle vector (4398-bp frag-ment). Each shuttle vector was screened to determine insertionof the correct-sized fragment and was then sequenced 300500bp into each end of the hexon genes (at the 59 and 39Ad5/hexongene flanking region) to confirm correct sequence and readingframe. Where possible, sequences were confirmed with Gen-Bank published sequences. However, as only partial sequenceinformation exists for many of the hexon genes, it was not pos-sible to make such comparisons for all hexon genes. Sequenceor amino acid homologies were made with hexon genes fromwithin the same subgroup as obtained through our personal se-quencing effort...</p></li></ul>