High levels of genetic variability in west African Dwarf Crocodiles

Osteolaemus tetraspis getraspis

DAVID A. RAY,L P. SCOTT WHITE,2 HUYEN V. DUONG,l T. CULLEN3 and LLEWELLYN D. DENSMORE1

The African Dwarf Crocodile (Osteolaemus) has been a long-standing problem for crocodilian systematists. Previously divided into separate genera, present forms are currently recognized as two subspecies within the single named species, 0 . tetraspis. We sequenced a 350 bp region of mitochondrial DNA in an attempt to elucidate the relationships within one of these forms, 0. t. tetraspis. Results indicate at least two distinct and well-supported groups with nucleotide sequence divergence levels comparable to those found between species of other crocodilians. These data lay the groundwork for a comprehensive systematic and population study of the genus.

Key words: Osteolaemus, Crocodylia, mtDNA, systematics.

INTRODUCTION

BIRDS and crocodilians represent the only extant descendants of the ancient group known as Archosaurs. Modern crocodilians first appeared about 80 million years ago and radiated into over 125 genera. Of those, only eight survive in the present day. These genera are commonly grouped into three families, the Alligatoridae, the Crocodylidae, and the Gavialidae. The taxonomy and phylogenetics of many of these groups have been well studied (Poe 1996; Brochu 1997). However, with the exception of the American alligator A. mississibbiensis verv little work on crocodilian

1 1 , population genetics has been done. This deficit is currently being remedied by a number of surveys of several members of genus Crocodylus (C. acutus, C. rhombt$e;fel; C. moreletti, C. johnstoni and C. porosus). Studies of several species of caiman have also been proposed.

The genus Osteolaemus, to which the dwarf African crocodile belongs, is generally considered the sister taxon to the genus Crocodylus. Dwarf crocodiles are classified as endangered and virtually nothing is known about the status of wild populations across their range (Fig. 1) (Kofron and Steiner 1994). The animals are used for food and the hides utilized by native people for some products (Ross 1998), but the effects of hunting pressure on dwarf crocodile numbers is unknown. Deforestation may also be taking a toll. One study has suggested that the

number of Osteolaemus tetraspis populations in Liberia has dropped significantly in recent years (Kofron 1992). To complicate matters, the taxonomic status of forms currently placed in the genus has been a source of dis- agreement among crocodilian systematists since the early 20th century.

The genus is identified today as consisting of a single species and two subspecies - 0. t. tetraspis and 0. t. osborni (Brazaitis 1973). Unfortunately, no unequivocal 0. t. osborni are known to exist in collections in the United States and, at the time samples were collected for this study, permits allowing the import of bIood were not in our possession. We were, therefore, forced to limit this study to 0. t. tetraspis. However, as revealed by several previous molecular analyses also involving members of this subspecies (Densmore and Owen 1989; Densmore and White 1991), substantial intraspecific genetic variation appears to be the ~ l e . In a more recent study (White and Densmore, unpubl. data) based on sequence analysis of the ND6-tRNAgIu-Cyt b region of crocodilian mtDNA, considerable nucleotide divergence (0.098) was noted between two individuals of 0. t. tetraspis.

As an extension to the findings of White and Densmore (unpubl. data), the same 350 base pair region of mitochondrial DNA was sequenced for 10 individuals of 0. t. tetraspis as well as for a single individual of Crocodylus rhombifer. This region was chosen because there

'Department of Biological Sciences. Texas Tech University, Lubbock. TX 79409 USA. 'Life Sciences Division, Los Namos National Laboratory. Los Namos. NM 87545 USA. 'Cullen Vivarium. P.O. Box 878. Milwaukee. WI 52301 USA. Pages 58-69 in CROCODILIAN BIOLOGY AND EVOLUTION ed by Gordon C. Crigg. Frank Seebacher and Craig E. Franklin. Surrey Beatiy & Sons. Chipping Norton. 2000.

RAY ET AL.: GENETIC VARIABILITY IN WEST AFRICAN DWARF CROCODILES 5 9

Fig. I . Geographic range o f Osteolaemus tetraspis (Ross 1998).

appears to be sufficient sequence variability among crocodilian species to be sensitive enough for population level studies, while the conserved regions are suitable for outgroup comparison (White and Densmore, unpubl. data). As stated earlier, no 0. t. osborni were available for analysis. However, if large amounts of nucleotide sequence variation exist within the subspecies examined, we can likely assume that larger, more significant differences probably exist between the two currently recognized forms.

MATERIALS AND METHODS

Blood from 10 individuals of 0. t . tetraspis was collected in acid citrate dextrose-B (ACD-B) (Densmore and White 1991) at the Cullen Vivarium (Y4, Y 10, Y 11, Y 13, Y16, Y19, Y20), the St. Augustine Alligator Farm (FT), and from the collection of Bruce Schwedick (1A and 2A). Animals Y10 and Y19 are known to have been collected in the wild from Gabon. Unfortunately, the original collection locales for the remaining Osteolaemw samples are not known. One blood sample from C. rhombifer was obtained from the St Augustine Alligator Farm.

Total DNA was isolated from the blood samples using the SDS-Urea method of White et al. (1998). MtDNA regions including a portion of ND6, the entire tRNAg'" gene, and a portion of cyt b were amplified using two rounds of PCR. The first round yielded a product of -2000 bp. A smaller fragment, -350 bp, was then amplified in the second round using the larger fragment as a template. In either case, a master mix containing 500pl ddH20, lOOpl 10 mM dNTP mix, 90p1 10X Tag buffer (Fisher), and 100 p1 25 mM MgC12 solution (Fisher) was made. To a 0.5 mi PCR reaction tube were added 48p1 of the master mix, 4 p1 of template (7-10pM) DNA, and 3.0 pl of a 20 pM mixture of primers (Table 1). Taq polymerase (2.5 units) was added directly to the reaction vessel just before spinning down the contents in a microcentrifuge.

For both first and second round ampli- fication reactions, samples were overlain with mineral oil, followed by an initial denaturation step at 94°C for three minutes. First round amplification was performed using the follow- ing cycle parameters: 94°C for 1 min., 50°C for 1 min., and 72°C for 90 sec.; 35 cycles. The smaller size of the second round product and a desire to decrease reaction time and increase primer fidelity prompted the follow- ing changes to cycle parameters for the second amplification: 94°C for 15 sec., 53°C for 30 sec., and 72°C for 50 sec.; 35 cycles. A Perkin Elmer-Cetus DNA thermal cycler (Branchburg, New Jersey) was used for both sets of reactions. Amplification was verified on 0.8% agarose gels, after which first and second round products were purified using the Qiagen (Santa Clarita, California) gel purification protocol.

Upon isolation of the -350 bp products, automated sequencing was performed using an ABI PRISM Model 310 and Amplitaq DNA polymerase FS (Perkin Elmer) at the core laboratory of the Texas Tech Institute of Biochemistry. The primary sequencing primers were ND6L and CytB2Hint (Table 1). All sequences were aligned using ClustalW (Thompson et al. 1994) with manual adjust- ments. We included known DNA sequence of A. mississippiensis from White 1992; White and

Table 1. Primer sequences for first and second round amplification reactions (courtesy of White and Densmore (unpubl. data)).

1st Round Primers Primer sequence' CB2H 5'-CCCTCAGAATGATATITGTCCTCA-3' ND5L2 5'-GCCCTACTNCAYTCNAGCACAATAGT-3'

2nd Round Primers CBPHint 5'-TTTCATCATGCNGARATGTTKGATGGGGY KGRAGGTG3' NDGL 5'-TATTTRGGNGGNATGSTGGTNGTNTITG-3'

' Degenerate base codes: R = A,G; Y = C,T; S = C,G; W = A,T; K = G,T; M = A,C; H = A,C.T, B = C,G,T; V = A,C,G; D = A,G,T; N = A,C,G,T

~- -

GKOCODILIAN BIOLOGY AND EVOLUTION

Densmore (submitted) for use as an additional outgroup taxon. PAUP* v. 4.0bl (Swofford 1998) was used to generate genetic distances for phenogram construction and to perform parsimony analyses for estimating phylogeny.

RESULTS

Using the NDGL primer, we were able to consistently produce sequences that were clear and repeatable; other sequencing primers proved less reliable. Aligned DNA sequences are presented in the appendix.

The aligned sequences were used to estimate several of the measures of genetic distance available through PAUP (Tajima-Nei, Jukes- Cantor, Kimura 3-parameter, and Tamura- Nei). All produced similar distance matrices. We chose to use the algorithm of Tajima and

Nei (1984) in order to allow comparisons with genetic distances calculated for sequence data from the same region from other crocodilians studied by White 1992; White and Densmore (submitted). Pairwise genetic distances from this analysis are presented in Table 2. Using the Tajima-Nei distance matrix, a neighbour- joining analysis was performed yielding one tree (Fig. 2).

In addition, a maximum parsimony (phylo- genetic) analysis was performed. Of the 297 total characters, 36 were determined to be phylogenetically informative. An exhaustive search was performed and 17 equally parsimonious trees (score = 123) resulted. A strict consensus phylogram of these produced one unresolved polytomy. Bootstrap analysis with 1 000 replications produced a single tree with the same topology (Fig. 3).

Table 2. Genetic distance matrix for all sequences. Distances were calculated using the algorithm of Tajima and Nei (1984). All OTU's are 0. t. tetraspis except AM (Alligator mississippiensis) and CR (Crocodyks rhombifer).

YlO Y19 FT Y13 1 A Y4 Y11 Y16 Y20 2A CR AM

Y10 - Y19 0.00342 - FT 0.01039 0.00686 - Y13 0.08278 0.07779 0.07873 - 1A 0.08278 0.07779 0.07873 0 - Y4 0.09891 0.0938 0.0947 0.01389 0.01389 - Y11 0.0989 0.09385 0.09475 0.01387 0.01387 0.02097 - Y16 0.09481 0.0898 0.09067 0.01037 0.01037 0.02093 0.0209 - Y20 0.08662 0.08163 0.08255 0.00344 0.00344 0.0139 0.01389 0.0069 - 2A 0.08579 0.08184 0.08186 0.00343 0.00343 0.01734 0.01734 0.01381 0.00687 - CR 0.24245 0.23653 0.23674 0.23674 0.23674 0.24598 0.24683 0.23636 0.23182 0.23123 - AM 0.32285 0.31613 0.30214 0.30214 0.30214 0.3139 0.31028 0.30881 0.30229 0.29542 0.30297 -

Fig. 2 (below left). Neighbour-joining phylogram of relationships calculated from distance data. Branch lengths are indicative of relative amounts of evolution- ary change. All terminal OTU's are 0. t . tetraspis except AM (Alligator mississippiensis) and CR (Crocodylus rhombifer). r ....

I Y19 Fig. 3 (right). Strict consensus dadogram of 17 equally parsimonious trees based

on unweighted character analysis of 297 characters from the amplified 100

region. Numbers at nodes correspond to the percentage of 1000 bootstrap FT replicates supporting that node. All terminal OTU's are 0. t. tetraspis except AM (Alligator mississippiensis) and CR (Crocodylus rltombifcr).

100 H 0.01

RAY ET AL.: GENETIC VARIABILITY IN

Osteolaemus tetraspis invariably formed a monophyletic grouping. In all of the parsimony analyses and in the Neighbour- Joining tree, three individuals, FT, Y10 and Y19, were placed on a branch together, separate from the other members of the ingroup (Figs 2 and 3). All other sequences were placed on a separate branch with several equally parsimonious subgroups. However, a number of patterns are evident.

Individuals 1A and Y 13 had .identical sequences and therefore grouped together in all analyses. Specimens Y4 and Y11 formed a clade in all trees as did Y16 and Y20. Individual 2A was isolated on most (12) of the trees but was joined with Y13 and 1A in the others. However, none of the above nodes was supported by a bootstrap value greater than 50%, resulting in the somewhat unresolved consensus tree shown (Fig. 3). Note, however, the sharp and strongly supported division between the branch formed by samples m, Y10, and Y19 and all other 0. t. tetraspis sequences.

DISCUSSION

Nucleotide variation within Osteolaemus tetraspis tetraspis is considerable with a tendency toward specific subgroups most likely representing different geographic localities. The individuals coded as Y10 and Y 19 were collected in Gabon, which occupies much of the southern range of 0. t. tetraspis. In all analyses, these two individ- uals, along with FT, form a clade separate from the other, presumably more northern or western, forms. Bootstrap support for this division is very strong (100%; see Fig. 3).

Tnbh 3. Genetic distances between selected crocodilians. Distances listed are determined by the method of Tajima and Nei (1984). Cross species comparisons from White 1992; White and Densmore (submitted).

Crocodylus acutus vs. Cz intermedius 0.074 ! Cr. cataphractus vs. Osteolaemus tetraspis 0.179 Cr. johnstmi vs. Cz niloticus 0.094 Cr. mindoremis vs. Cr nouaeguineae 0.064 / Caiman crocodilus crocodilus vs. Ca. c. fim 0.007 1 lbmktoma schlegelii vs. Caviulis gangeticus 0.22 1 Average value of the two Gabon 0.087

individuals + FT vs. all other / 0. t. tetrasbis in study

The average genetic distance between these three individuals versus the other 0 . t. tetraspis represented in the study (0.087) is at least comparable to that found between universally recognized species in other crocodilian genera (Table 3). However, based on morphology alone, all of the individuals whose DNA was sequenced in this study represent members of one subspecies, 0 . t . tetraspis, regardless of their respective origins. Further study is clearly warranted before we consider elevating

WE= AFRICAN DWARF CROCODILES 6 1

any current subspecies to species status, but the data presented here suggest that the genus Osteolaemus requires much greater attention than it has received to date.

The data presented here will serve as a basis for broadening our study of the dwarf crocodile. The goal first will be to resolve the taxonomic confusion surrounding the species (whether there are one, two, or three). The taxonomy of the dwarf crocodiles has been in flux for over 60 years. When first described by Schmidt (1919), 0 . t . osborni was, in fact, placed in a separate genus, Osteoblepharon. This genus was discarded after examination of skulls by Werner (1933) and Mertens (1943). Both authors suggested that the two forms should be considered distinct species within the genus Osteolaemus, and this view was upheld by Inger (1948). This classification remained in place until Wermuth (1953) recognized the two forms as subspecies, 0. t. tetraspis and 0 . t . osborni. There is still not complete agreement among crocodilian systematists and this group of crocodiles is in need of further study to determine the taxonomic standing of its members.

Our second goal will be to gather baseline data on the population genetics of dwarf crocodiles. The species and populations within Osteolaemus may be the least understood of all the crocodilians. The most recent edition of the Status Survey and Conservation Plan for Crocodiles published by IUCN/SSC Crocodile Specialist Group (Ross 1998) lists Osteolaemus and C. cato$hractus (the African slender- snouted crocodile) as the only two crocodilians with "extremely poor" quantitative population survey data. According to this document, there is currently insufficient data to adequately determine the status of the dwarf crocodile in any part of its range.

The first step will be to survey populations in an effort to determine what population substructure exists and to elucidate the proper taxonomic status of the organism. *A compre- hensive population study is being initiated across most of the range with blood samples being collected from Senegal eastward to Gabon, the Congo, and the Democratic Republic of Congo. For the first time, we will be able to include representatives of both currently recognized subspecies.

Once this information has been collected, we should have a better picture of both the taxonomic and ecological status of these animals. The effects of hunting and deforest- ation can be better assessed. With additional data, the implementation of species survival plans for these animals should be enhanced. Reproductive studies of the dwarf African

U L LKULUUILIAN BIOLOGY AND EVOLUTION

crocodile have shown that captive breeding is probably possible (Kofron and Steiner 1994). Successful programmes implemented to enhance recruitment and allow management of natural populations, such as those involving the American alligator Uoanen and McNease 1987), often profit from molecular data.

In conclusion, this preliminary study reveals substantial levels of sequence variation within 0. t. tetraspis. Considering that a second "subspecies" is recognized and has yet to be examined, it is likely that the current taxonomic standing is in need of revision. Our proposed survey of dwarf crocodile populations should not only aid in providing data to elucidate the relationships among the various taxa, but should also contribute to the ultimate survival of this endangered and poorly studied animal.

ACKNOWLEDGEMENTS

We would like to thank the following individuals and organizations for contributing samples to this study: Bruce Schwedick, the Miami Zoo, the Memphis Zoo, and the St Augustine Alligator Farm. Steve Reichling from the Memphis Zoo and Bruce Schwedick of Reptile Discovery Programmes were extremely helpful in our attempts to collect locality data. Thanks also go out to Jennifer Dever, Jeff Wickliffe, and Rhonda Ray for their comments on earlier drafts. This work was partially supported by funds provided to D.A.R., P.S.W., and L.D.D. by the Depart- ment of Biology a t Texas Tech University and by the Clark Foundation Scholarship (H.V.D). Additional support was provided by the National Science Foundation to L.D.D (BSR-8607420).

APPENDIX Aligned sequence data for 297 characters ranging from ND6L through tRNAdu to cyt b. All OTU's are 0. t . telraspis except AM (Alligator mississippiensis) and C R (Crocodylw rhombifer).

....................................................................................................

........................................................... A ........................................

.............. A .................................................... A..T..T... ............... C..... A.

.............. A....... ............................................. A..T .. T .................. C. .... A.

.............. A. ................................................... A .. T..T.......... ........ C ..... A.

.............. A...... .............................................. A..T..T... ............... C.. ... A.

.............. A .................................................... A..T .. T.. ................ C.. ... A. A... ................................................. A T..T.......... C A. .............. .. ........ .....

.............. A..... ............................................... A .. T..T..C.......... ..... C ..... A. T .. TGC...G .. A.A ..... C..............................G....-.CA.....G.C.....T..C..C..T.....C...C..... A. ..... C ...... G.A..CAACTA ....... T.....T.....GG..A.......TA-.T.AA.TTGCC.......TC.TCG...A..C.A..-..C.. A.

....................................................................................................

.G .. G . . . . . . . . . . . . . . . C C . . . . . . . A . . . . . . . . . . . . C . . . . . . . . . . . . . . . . A . . G . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . .

.G .. G..... .......... CC.. ..... A.. .......... C........... ..... A..G .....................................

.G .. G....... . . C . . . . . C C . . . . . . . A . . . . . . . . . . . . C . G . . . . . . . . . . . . . . A . . G . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . .

.G .. G. .............. CC... .... A.... ........ C... ............. A..G..... ................................

.G .. G..... .......... CC..... .. A. ........... C.. ...... T. ...... A..G..... ................................

.G .. G.... ........... CC ....... A. ........... C.............. .. A..G... ..................................

.G .. G... ............ CC.......A ............ C........ ........ A . . G . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . .

......... G ....... G..A.. ...... A..C.C..C....C.- .. G.. ........ G. ... T ....... A. .. CT.T.....C..... ..........

.......---... C .. CG. .AA....... A......T....CC..C-......A....GA..T.T-.....A...CT.T.......-.............

TCAACAATTAGm-TGATCCACCAACTACT~TCCAACCCGCT-ATTAAAATTGATA~TAATTCCCTAATTGACCTCCCAACCCCATCAAA A G....;........................................................... ................ ...............

.........- A. .... A....... ........ G..... ...........................................................

.... T ....- A..TT.A.. ............. G . . . . . . . . . . . . C A . . . . . . . . . C . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . T ....- A..TT.A...............G............CA.........C..............A......................... ....

.... T ....- A. .TT. A . . . . . . . . . . . . . . . G . . . . . . . . . . . . C A . . . . . . . . . C . . . . . . . . . . . . . . A . . . . . . . . . . . . . G . . . A . . . . . . .

.... T....-A..TT.A.. ..... T ....... G.... ........ CA ......... C....... ....... A. ............ G..A.....C..

.... T. . . . - A ..TT. A.......... ..... G........ .... CA... ...... C...... ........ A........ ..... CG....... ...

.... T....-A..TT.A ............... G... ......... CA ......... C .............. A.. ........... C...... .....

.... T.. A ..TT. A. .............. G . . . . . . . . . . . . C A . . . . . . . . . C . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . -....-... A..C .. A..GC... ........ G... .... C .... A...C......C.AG....CC.C..TT.............CT.....CT---

.... C...... ..... G ....... C....AA.C......-C.C.. C CC.--...--------------

ng ng he St "g .ck :re :ct ;er :or ~ r k to rt- ity lip by 1.D

RAY ET A L : GENETIC VARIABILITY IN WEST AFRICAN DWARF CROCODILES . 63

REFERENCES Brazaitis, P., 1973. The identification of living

Crocodilians. Zoologica 59: 59-88.

Brochu, C. A., 1997. Morphology, fossils, divergence timing and the phylogenetic relationships of Gavialis. Syst. Biol. 46(3): 479-52 1.

Densmore, L. D. and Owen, R. D., 1989. Molecular systematics of the Order Crocodilia. Arne?: Zool. 29: 831-41.

Densmore, L. D. and White, P. S., 1991. The systematics and evolution of the Crocodylia as suggested by restriction endonuclease anaylsis of mitochondria1 and nuclear ribosomal DNA. Copeia 1991(3): 602-15.

Hurchzermeyer, F. and Penrith, M., 1995. Geographical races of the Dwarf Crocodile? CTOC. Special. Group News1 12(2): 4.

Inger, R. F., 1948. The systematic status of Osteoblepharon osborni. Copeia 1948(1): 15-19.

Joanen, T. and McNease. L., 1987. T h e management of alligators in Louisiana. Pp. 33-42 in Wildlife Management: Crocodiles and Alligators ed by G . J. W. Webb, S. C. Manolis and P. J. Whitehead. Surrey Beatty & Sons: Chipping Norton.

Kofron, C. P., 1992. Status and habitats of the three African crocodiles in Liberia. J. Trop. Ecol. 8: 265-73.

Poe, S., 1996. Data set incongruence and the phylogeny of the crocodilians. Syst. Biol. 45: 393-414.

Ross, J. P. (ed), 1998. Crocodiles. Status Survey and Conservation Action Plan. 2nd Edition. IUCNISSC Crocodile Specialist Group. IUCN: Gland, Switzerland and Cambridge, UK. viii+96 Pp.

Schmidt, K. P., 1919. Contributions to the herpetology of the Belgian Congo based on the collection of the American Museum Congo Expedition, 1905-1915. Part I. Turtles, crocodiles, lizards and chameleons. Bull. Amex Mus. Nut. Hist. 39: 385-624.

Swofford, D. L., 1998. PAUP (Phylogenetic Analysis Using Parsimony), version 4.01b.

Tajima, F. and Nei, M., 1984. Estimation of evolutionary distances between nucleotide sequences. Mol. Biol. Evol. 1: 269-85.

Thompson, J. D., Higgins, D. G. and Gibson, T. J., 1994. ClustalW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22: 4673480.

Wermuth, H., 1953. Systematik der Rezenten Krokodile. Mitteil. Zoo1.-Mus. Berlin 28(2): 375-5 14.

White, P. S., 1992. Relationships of Extant Crocodylia as Inferred by Sequence Analysis of Mitochondria1 DNA. Ph.D. diss. Texas Tech University, Lubbock, TX, USA (Diss. Abstra. 93-12533).

~ ~ f ~ ~ , P. and steiner, c., 1994. observations on the White. P. S., Tatum. 0. L., Tegelstrom. H. and Densmore, African Dwarf Crocodile, Osseolaemw letraspis. Cop& L. D. 111. 1998. Mitochondria1 DNA Isolation, 1994(2): 533-35. separation, and detection of fragments. Pp. 65-102

in Molecular Genetic Analysis of Populations: A Mertens, R., 1943. Die rezenten Krokodile des Natur- Practical Approach ed by A. R. Hoelzel. Oxford

Museums Senkenberg. Senkenbergiana 26: 252-3 12. University Press: New York.