Available online at www.sciencedirect.com

57 (2008) 150–157www.elsevier.com/locate/parint

Parasitology International

High mobility group box (HMGB) proteins of Plasmodium falciparum:DNA binding proteins with pro-inflammatory activity

Krishan Kumar a, Ankita Singal a, M. Moshahid A. Rizvi b, Virander S. Chauhan a,⁎

a International Centre of Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, New Delhi-110067, Indiab Department of Biosciences, Jamia Millia Islamia, Jamia Nagar, New Delhi-110025, India

Received 21 May 2007; received in revised form 21 November 2007; accepted 23 November 2007Available online 8 December 2007

Abstract

High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highlyconserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequenceanalyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology withSaccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Boxdomain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 andPfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ringstage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both,PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFα from mouse peritoneal macrophages asanalyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible foreliciting/ triggering host inflammatory immune responses associated with malaria infection.© 2007 Elsevier Ireland Ltd. All rights reserved.

Keywords: Plasmodium falciparum; HMGB; TNFα; RT-PCR

1. Introduction

Malaria is caused by protozoan parasite of the genus Plas-modium and the most virulent human malaria parasite, Plas-modium falciparum is responsible for the killing of 1.5–2.7 million people world wide annually [1]. Generation ofresistance to existing anti-malarial drugs [2] is leading to anincreased prevalence of the disease in the developing countries.Genome sequence of P. falciparum was released in 2002 [3],permitting cataloguing of proteome and transcriptome of Plas-modium biology. P. falciparum is believed to employ DNAbinding proteins to regulate gene expression in the host [4].Several transcriptional factors have been annotated in Plasmo-dium [4–7]. However these putative molecules have not yetbeen identified experimentally. A better understanding of the

⁎ Corresponding author. Tel.: +91 11 26742317; fax: +91 11 26742316.E-mail address: virander@icgeb.res.in (V.S. Chauhan).

1383-5769/$ - see front matter © 2007 Elsevier Ireland Ltd. All rights reserved.doi:10.1016/j.parint.2007.11.005

biological processes that Plasmodium uses during the intraerythrocytic development cycle (IDC) should lead to improvedanti-malarial drugs, a goal of extraordinary importance to worldhealth.

Highmobility group box 1 (HMGB1) is a 219 amino acid longprotein that is highly conserved among various species; there ismore then 98% sequence identity between HMGB1 of rodent andhuman [8] HMGB1 proteins have been implicated in a number ofbasic cellular functions including DNA replication, transcriptionand recombination [9]. Mammalian HMGB1 proteins exert theireffect by binding to the minor groove of DNA that facilitates theunwinding and bending of DNA permitting formation ofnucleoprotein complexes to enhance the activity of severaltranscription factors [9]. HMGB1 is also known to modulatestructure of chromatin, stimulation p53 activation and V(D)Jrecombination [10,11]. Recently P. falciparum HMGB(PfHMGB1 and PfHMGB2) proteins have been characterizedand reported as nuclear factors [12].

151K. Kumar et al. / Parasitology International 57 (2008) 150–157

In eukaryotes, HMGB proteins are also implicated in thepathogenesis of several inflammatory disorders like sepsis,arthritis and haemorrhagic shock because of their ability tostimulate macrophages to release cytokines like TNFα [13–15].In humans, HMGB1 has been reported as a potent activator ofmonocytes that stimulates the release of TNF and other productsof activated macrophages [16], whereas in mice, HMGB1 hasbeen shown as late mediator of delayed endotoxin lethality [17].A number of cytokine genes such as β-interferon, Interleukin 2receptor alpha chain, Interleukin 4 receptor as well as herpesand human papilloma viral genes are regulated by HMGB1[18–21]. In this study, we have cloned, expressed andcharacterized P. falciparum HMGB1 and HMGB2 andevaluated their role in eliciting pro-inflammatory functions inin vitro and in vivo conditions.

2. Materials and methods

2.1. Sequence analysis and molecular cloning of Pfhmgb1 andPfhmgb2

Motif Scan analysis was used to analyse PfHMGB1 andPfHMGB2 in Plasmodium species (P. yoelli, P. vivax, P. berghei,P. knowlesi) and in another hemoparasite, Babesia bovis.Sequence alignment of Plasmodium HMGB proteins withhuman HMGB protein was done by Mac Vector to locate theconserved TNFα stimulating domain.

Plasmid encoding Pfhmgb1 genewas kindly made available byDr. Catherine Vaquero, INSERM, Paris, France. For molecularcloning of Pfhmgb2, the ORF sequence was amplified by PCRfrom genomic DNA of P. falciparum (3D7). PCR was performedusing (A) forward primer with addition of an up stream in-frameBamHI restriction site: 5'-TTGGATCCATGGCTTCAAAATCTC AAA A-3' and (B) reverse primer with 3'-end flanked byKpnI restriction site 5'-ATTGGTACCTTATTCTTGATTTTTCTT TC-3'. The amplified Pfhmgb2 fragment was cloned in pQE-30 expression plasmids using respective endonucleases and theconstruct was transformed intoM15E. coli cells. The recombinantclone was analysed by restriction digestions andDNA sequencing.

2.2. Expression, purification and characterization of recombinantPfHMGB1 and PfHMGB2

Recombinant PfHMGB1 and PfHMGB2 were expressed inE. coliM15cells and proteinswere purified as described previously[12] with some modifications. Briefly, Cells were suspended in25 mMTris–HCl pH 8, 300 mMNaCl, 10 mM imidazole, 10 mMβ-mercaptoethanol, 0.5% Triton X-100 containing lysozyme andprotease inhibitor cocktail (Roche) and sonicated for 3× 30 s at100 W output. Supernatant were resolved on Ni2+-NTA column(Qiagen, Hilden Germany) and fractions containing PfHMGB1/2proteins were pooled for further purification by ion exchangechromatography on SP-Sepharose column. Endotoxin content wasestimated using Limulus Amebocyte Lysate (LAL) gel clot assay(Charles River Endosafe, U.S.A). Purity and integrity ofrecombinant proteins were also confirmed by RP-HPLC and bymass spectroscopy and gel permeation chromatography (GPC).

2.3. Interaction of recombinant PfHMGB proteins with dsDNAby Electrophoretic Mobility Shift Assay (EMSA)

16-mer duplex DNA (synthesized by Sigma) was modifiedwith cisplatin essentially as described previously [22]. Themodified and untreated DNA (16 bp) probes were labeled at 5′end with 32P by T4 polynucleotide kinase using [γ32P]-ATP,chromatographed on Sephadex G25 and then annealed with anequal amount of the complementary strand. The labeled DNAduplex was purified by resolving mixture through Sepharose 4Bcolumn. Gel mobility assays were performed according to apreviously described protocol with some modifications [22].32P labeled cisplatinated and unmodified DNA probes (10 pMeach) were incubated with increasing concentration of proteinsin 10 mM Hepes (pH 7.5), 10 mMMgCl2, 50 mM NaCl, 1 mMspermidine, 0.02% BSA and 0.05% NP40 for 30 min at 37 °C.Reaction mixtures were analyzed by resolving the bound andthe free form on 20% SDS-PAGE (59:1 acrylamide:bisacryla-mide) in 1× TBE at 30 mA for 6 h at 4 °C. Interaction ofPfHMGB1 and PfHMGB2 with cisplatinated and unmodifiedDNA were visualized by phosphorimager.

2.4. Immunization of mice and rabbit with recombinantPfHMGB1 and PfHMGB2

Two 16-weeks-old New Zealand white rabbits were immu-nized with 400 µg each of the purified recombinant proteins,emulsified in complete Freund's adjuvant and delivered by thesubcutaneous route. Both rabbits were boosted twice with 200 µgof the protein formulated in Incomplete Freund's Adjuvant ondays 14 and 29 after the primary immunization. The rabbits werebled before immunization and subsequently two weeks after eachboost and sera were analyzed by ELISA. Sera were separated andstored at −20 °C until used.

2.5. Immunofluorescence Assay (IFA)

Plasmodium falciparum (3D7) was grown in RPMI culturemedium with human erythrocytes according to a previouslydescribed protocol [23]. Antibodies to PfHMGB1 and PfHMGB2raised in rabbits were purified on Protein A Sepharose column(Amersham Pharmacia). To reduce non-specific interaction ofanti-HMGBs with RBCs, rabbit sera (anti-HMGB1, anti-HMGB2 and pre-immune sera) in 1:100 dilutions were pre-incubated with RBC for 1 h at room temperature and supernatantwere used for IFA. Multi spot parasite slides were made fromP. falciparum culture, air dried, fixed with an acetone-methanol(9:1) mixture at room temperature for 40 min and incubated withthe antibodies collected from the previous step in a sealed, moistbox for 1 and 1/2 h at room temperature. The slides were washedstringently with PBST (Phosphate buffer saline with 0.05%Tween 20) and incubated with Cy3 conjugated goat anti-rabbitIgG (Sigma) at a 1:500 dilution in PBS with 0.5% bovine serumalbumin for 1 h at room temperature in the dark. After washing,the slides were incubated in 4′, 6′ di-amidino-2-phenylindoledihydrochloride (DAPI) (2 μg/ml in PBS) for nuclear staining.The slides were rewashed, air dried, and mounted with antifade

152 K. Kumar et al. / Parasitology International 57 (2008) 150–157

solution (BioRad) to retard photobleaching. Fluorescence wasexamined by use of a Nikon SE300 microscope with a 100× oilimmersion objective and immunoreactivity was also observedusing a Nikon TE2000-E confocal microscope with a 60× Plan-Apochromat oil immersion objective.

2.6. Stimulation of macrophage with recombinant PfHMGBproteins

Murine macrophage-like Raw 264.7 cell line was cultured inRPMI 1640, 10% FBS and 1% penicillin/ streptomycin in ahumidified atmosphere with 5% CO2 at 37°C. The cells(5×106/well) were stimulated with different concentrations (0,5, 10, 30, 100, and 300 μg/ml) of recombinant PfHMGB1 andPfHMGB2 for different periods of time (0.5, 1, 3, 6, 12, and24 h) in 24 well plates at 37°C under a 5% CO2 atmosphere.Cells with culture medium alone were taken as a negativecontrol (background) and lipopolysaccharide (6 μg/ml) treatedcells were used as a positive control. Polymyxin B (60 μg/ml;Sigma-Aldrich) was also used with PfHMGB1 and PfHMGB2(100 μg/ml for each case) to rule out the possibility of cytokinesecretion due to contaminating endotoxin, if any. The culture

Fig. 1. Multiple alignment of conserved motif of Plasmodium HMGB with Homoseveral Plasmodium species (Pf, Plasmodium falciparum; Pb, Plasmodium berghei;Babesia bovis (Bb) were align with B-domain of Homo sapiens HMGB (Hs.HMGBHMGB proteins of Plasmodium species and NHP1 of B. bovis.

supernatants were collected and pro-inflammatory cytokines,TNFα, IL6. IL8 and IL-1β were estimated by sandwich ELISAkit (CytoLab/Peprotech Asia) according to the manufacturer'srecommendations. Cytokine concentrations were calculatedwith reference to the standard curves. The data presented are theaverage of values collected in duplicate.

2.7. Extraction of RNA and measurement of TNF-α and iNOSmRNA by RT-PCR

Five–six week old Balb/c mice were injected intraperitoneallywith purified recombinant PfHMGB1 and PfHMGB2 and thenspleens were taken out at different time points (0, 0.5, 3 and 6 h).For macrophage isolation, total splenocytes cell suspension wascultured in 6-well plates overnight. After a 24 h culture, non-adherent cells were removed and adherent cells were washedtwice with PBS, and macrophages were removed with a cellscraper. RNAwas extracted from 1×107 macrophages (RNeasymini kit). cDNA was prepared with superscript reverse tran-scriptase II (Invitrogen). PCR were performed with the genespecific primers; TNFα gene was amplified using primers(C) forward: 5' GTT CTA TGG CCC AGA CCC TCA CA-3'

sapiens HMGB (Domain B). Complete sequences of HMGB1 and HMGB2 ofPy, Plasmodium yoelii; Pch, Plasmodium chabaudi) and NHP1 of hemoparasite1_B). Tight box represents “TNF stimulating domain”, which is conserved in

153K. Kumar et al. / Parasitology International 57 (2008) 150–157

and (D) reverse: 5' TCC CAG GTATAT GGG CTC ATA CC 3',Inducible nitric oxide synthase (iNOS) gene was amplified usingprimers (E) forward: 5' TGGGAATGGAGACTGTCCCAG3'and (F) reverse: 5' GGG ATC TGA ATG TGATGT TTG 3' andMouse β-actin gene was amplified using primers (G) forward:5' GTG GGC CGC TCT AGG CAC CAA 3' and (H) reverse:5' CTC TTT GAT GTC ACG CAC GAT TTC 3'. The PCRproducts were analysed on 1.5% agarose gel and visualized afterstaining with ethidium bromide.

Fig. 2. Electrophoretic Mobility Shift Assay (EMSA). [A] DNA sequence of the 1contains single pair of guanines which were cross-linked with cisplatin. The 16 bp DNincreasing amount of recombinant PfHMGB1 and PfHMGB2 proteins separately. PPfHMGB2 [C] with 16 bp normal DNA probe (left panel) and ciplatin-modified DNAand ciplatin-modified DNA for respective experiment. Free probes are represented b

3. Results

3.1. Sequence analysis, cloning, expression and purification ofPfHMGB1 and PfHMGB2

Sequence analysis revealed that PfHMGB proteins exhibithigh degree of homology throughout the Plasmodium species;PfHMGB1 showed 57, 72 and 76%, while PfHMGB2 shared87, 69 and 53% homology with P. berghei, P. yoelii, P. vivax

6 bp oligonucleotide used as a probe for DNA binding studies. The top strandA probe and cisplatinated DNAwere 5′ end labeled with 32P and incubated withrotein–DNA complex were analysed by gel shift assay for PfHMGB1 [B] and(right panel). Last lane ( ) shows competitive inhibition with unlabeled DNA

y arrowheads.

154 K. Kumar et al. / Parasitology International 57 (2008) 150–157

respectively. Interestingly, significant homology was also foundwith HMG protein homolog (NHP1) of an apicomplexanhemoparasite B. bovis, which showed 58 and 49% homologywith PfHMGB1 and PfHMGB2 respectively. PfHMGB proteinscontain a single HMG box, similar to the B-box domain ofmammalian HMGB. TNFα stimulating domain identified in

Fig. 3. Localization of PfHMGB1 and PfHMGB2 in 3D7 Plasmodium falciparum pwith anti-HMGB1 [A] and anti-HMGB2 [B] using IFA and confocal microscopy werstaining with DAPI, column III merge of staining with anti-HMGBs and DAPI, colucorresponding parasites is presented. Column V, confocal images are shown. Uninfeobserved.

mammalian HMGB is also well conserved in PlasmodiumHMGB proteins (Fig. 1).

Recombinant PfHMGB1 and PfHMGB2, expressed assoluble proteins, were purified to homogeneity by Ni2+-NTAaffinity chromatography, followed by cation exchange chroma-tography and characterized by mass spectral analysis, RP-

arasite. Immunofluorescence in ring, trophozoite and schizonts of P. falciparume analyzed. In column I, staining with anti-HMGBs is shown, while in column IImn IV, merge of staining by anti-HMGBs and DAPI with the bright field of thected RBCs were represented with arrowhead, where no fluorescence signal was

155K. Kumar et al. / Parasitology International 57 (2008) 150–157

HPLC and gel permeation chromatography. The endotoxincontents in purified PfHMGB1 and PfHMGB2 were found to beless the 30EU per mg of the proteins.

3.2. Interaction of PfHMGB1 and PfHMGB2 with dsDNA andcisplatinated DNA

The 16-mer duplex DNA (synthesized by Sigma) wasmodified with cisplatin essentially as described previously [22].Binding of PfHMGB1 and PfHMGB2 with both the normal andthe modified DNAwas analysed by electrophoretic gel mobilityshift assays (EMSA). Both proteins interacted with normalDNA and cisplatinated DNA, the binding was competitivelyinhibited upon inclusion of unlabeled DNA in the reactionmixture. Multiple bands indicated that different number ofprotein molecules bind with the DNA. However 750 ng ofPfHMGB1/2 were able to completely suppressed cisplatinatedDNA and formed smearing upon binding, indicating that both

Fig. 4. Measurement of TNFα production by murine macrophage cell line (in vrecombinant PfHMGB1 [A] and PfHMGB2 [B]. Sandwich ELISAwas performed foeach point represents an average value. Maximum level of TNFα was observed at 6

the proteins bound to modified cisplatinated DNA in preferenceto normal DNA (Fig. 2).

3.3. Localization of native PfHMGB1 and PfHMGB2 in theparasite

Antibodies to PfHMGB1 and PfHMGB2 were raised inrabbits and purified on Protein A sepharose column (AmershamPharmacia) twice. Despite the significant sequence homologybetween PfHMGB1 and PfHMGB2, anti-PfHMGB1 and anti-PfHMGB2 antibodies did not show any cross-recognition ofthe two proteins. Analysis for the presence of PfHMGB1 andPfHMGB2 during different development stages of theparasite by IFA and confocal microscopy revealed theirpresence in the nucleus at the ring stage (Fig. 3). However,significant amount of these proteins were also present inthe parasite cytosol at the trophozoite and schizont stages(Fig. 3).

itro). Murine macrophages were stimulated with different concentrations ofr the estimation of TNFα secretion. Experiment was performed in duplicates andh followed by a decline at 24 h of exposure.

156 K. Kumar et al. / Parasitology International 57 (2008) 150–157

3.4. PfHMGB1 and PfHMGB2 induce pro-inflammatorycytokine in macrophages (in vitro) and in Balb/c mice (in vivo)

Extracellularly released Human HMGB1 (HsHMGB1)stimulated release of multiple pro-inflammatory cytokines andthe TNFα-stimulating activity of HMGB1, which was localizedto 20 amino acids of the B-box domain [24,25]. Alignments ofPfHMGB proteins with HsHMGB1 box B showed that theTNFα stimulating domain is well conserved in both PfHMGB1and PfHMGB2 (Fig. 1). This led us to explore if the parasiteproteins will also induce similar pro-inflammatory reaction. Toevaluate this, we stimulated a murine macrophages cell linewith recombinant PfHMGB1 and PfHMGB2 separately andmeasured the release of pro-inflammatory cytokines TNFα,IL6, IL8 and IL-1β. We found that while there was enhancedsecretion of all the cytokine measured, the levels of TNFα wereraised significantly more in comparison with the others. Theamount of TNFα secretion was time and dose dependent. Themaximum secretion was observed at 6 h of exposure ofmacrophages with the recombinant proteins (Fig. 4). Co-addition of LPS-neutralizing agent, polymyxin B failed toinhibit PfHMGB proteins induced cytokine synthesis, ruling outthe possibility of stimulation by small amount of endotoxin thatmay have contaminated the recombinant proteins. The endo-toxin levels were also found to be with the recommended line(b30EU per mg) of the recombinant proteins.

We also investigated the TNFα inducing function ofPfHMGB1 and PfHMGB2 in in vivo conditions. For this,total mRNAwas extracted from the macrophages isolated fromthe spleen of mice following administration of recombinantPfHMGB1 or PfHMGB2, at different time points. Resemblingin vitro observations, the peak of TNFα mRNA level wasobserved after 6 h of administration (Fig. 5). We also measuredthe expression level of inducible nitric oxide synthase (iNOS)and found that, iNOS was co-upregulated with TNFα.Expression levels of mouse β-actin gene served as internalcontrols (Fig. 5).

Fig. 5. Measurement of mRNA level of TNFα and iNOS in Balb/c mice (invivo). RT-PCRwas performed to find the up regulation of TNFα and iNOS at thetranscriptional level in immunized mice with recombinant PfHMGB1 [A] andPfHMGB2 [B]. Expression level of mouse actin served as internal control.

4. Discussion

Investigation of the components of the machinery involvedin DNA metabolism of P. falciparum is an important steptowards understanding the complex process. A large diversityof transcription factors, polymerases and accessory proteinsis required for DNA replication/recombination/repair occurringat distinct developmental stages in the parasite life cycle.Plasmodium HMG box proteins are quite similar to those ofeukaryotic organisms and are present in all Plasmodiumspecies.

To characterize the Plasmodium HMGB proteins we cloned,expressed in E. coli, and purified recombinant PfHMGB1 andPfHMGB2. Our results of electrophoretic gel mobility shiftassays showed that both PfHMGB1 and PfHMGB2 interactedwith cisplatin cross-linked DNA preferentially to normal DNA.Cisplatin cross-linked with pair of guanines of DNA anddistorted normal DNA by bending [22]. PfHMGB proteins havealready been shown to bind strongly and selectively to syntheticfour-way junctions [12].

Plasmodium HMGBs have been reported to be differentiallyexpressed in relation to erythrocytic development and gameto-cyte differentiation [12,26]. Both PfHMGB proteins have beenshown to locate mainly in the nucleus the erythrocyticdevelopment stages of the parasite. Results of IFA experimentin our hands have suggested that while both PfHMGB proteinswere located in the nucleus at the ring stage, substantial amountof PfHMGB1 and PfHMGb2 were also present in the parasitecytosol during the trophozoits and schizonts stages. Theseresults were further confirmed by confocal microscopy.

High levels of HMGB1 were observed in the circulationduring various inflammatory condition including sepsis andrheumatoid arthritis [13,14]. Recent studies have revealed thatextracellular HMGB1 is a potent macrophage stimulating factorand a pro-inflammatory mediator of inflammation [16]. Thereported TNFα stimulating activity of HsHMGB1 has beenlocalized to sequence of 20 amino acids of B-box (residue 89 to108 of HsHMGB1) [25], and although PfHMGB1 (97 aminoacid residues) and PfHMGB2 (99 amino acid residues) areconsiderably smaller than HsHMGB1 (219 amino acidresidues), the TNFα stimulating domain is well conserved inboth PfHMGB1 and PfHMGB2. This led us to investigatewhether these parasite proteins have similar pro-inflammatoryactivity like HsHMGB1. The in vitro stimulation of murinemacrophages with recombinant PfHMGB1 or PfHMGB2showed that TNFα was most significantly up-regulatedamong different pro-inflammatory cytokines (TNFα, IL6. IL8and IL-1β) measured in the study. Thus, in principle, parasiteHMGB protein can also be mediators of pro-inflammatoryresponses in the host.

There is now widespread acceptance that two importantmediators of inflammation, TNFα and iNOS, play an importantrole in pathogenesis of P. falciparum infection [27]. Nitric oxide(NO), generated from macrophages by inducible nitric oxidesynthase (iNOS), play a central role in early immune responses[28], following exposure to certain cytokines, such as TNFαand interferon-γ (IFN-γ) [29]. We wondered whether

157K. Kumar et al. / Parasitology International 57 (2008) 150–157

PfHMGB1 and PfHMGB2 co-stimulated iNOS along withTNFα. To address this we investigated TNFα and iNOSinducing activity of PfHMGB1 and PfHMGB2 in in vivoconditions. Results of RT-PCR, carried out with mRNAextracted from macrophages from mice indicated that bothTNFα and iNOS were significantly up-regulated. These resultssupported our observations of the ELISA based in vitroexperiments that the PfHMGB1 and PfHMGB2 are potentinducers of TNFα and iNOS. PfHMGB1 and PfHMGB2proteins thus appear to be non-classical pro-inflammatorycytokines because of their ability to induce several cytokinesand mediate a variety of inflammatory reaction. Recently,HMGB1 has been described as a possible amplification signalin the pathogenesis of malaria [30]. Serum from P. falciparummalaria patients contained significantly more HMGB1 than didserum from healthy adults [30]. Whether parasite's ownHMGB, if released in the host's plasma, also contribute to thepathogenicity of the disease in the host, remains to beestablished. It will be interesting to investigate the presence ofparasite's HMGB proteins in the host plasma and to determine ifthey will contribute to pathogenicity in malaria infection.

In summary, we have found that PfHMGB1 and PfHMGB2interact with distorted DNA in preference to normal DNA. Thetwo proteins were localized in the nucleus at ring stage, but alsoin the parasite cytosol during the later stages of erythrocyticcycle. We also found that both PfHMGB1 and PfHMGB2 arepotent inducers of two important mediators of inflammation,TNFα and iNOS, suggesting that these proteins may haveimmunomodulatory role in the pathophysiology of P. falci-parum infection.

Acknowledgements

We would like to thank Dr. Catherine Vaquero, INSERM,Paris, France for gifting plasmid encoding Pfhmgb1 gene andICMR, New Delhi for providing grant for this study. We alsothank CSIR, India, for providing financial assistance to KrishanKumar during the course of this work. We are grateful to AjayKumar for his technical assistance.

References

[1] Breman JG. The ears of the hippopotamus: manifestations, determinants,and estimates of the malaria burden. Am J Trop Med Hyg 2001;64:1–11.

[2] Ridley RG. Medical need, scientific opportunity and the drive forantimalarial drugs. Nature 2002;415:686–93.

[3] Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, et al.Genome sequence of the human malaria parasite Plasmodium falciparum.Nature 2002;419:498–511.

[4] Horrocks P, Dechering K, Lanzer M. Control of gene expression inPlasmodium falciparum. Mol Biochem Parasitol 1998;95:171–81.

[5] Callebaut I, Prat K, Meurice E, Mornon JP, Tomavo S. Prediction of thegeneral transcription factors associated with RNA polymerase II in Plas-modium falciparum: conserved features and differences relative to othereukaryotes. BMC Genomics 2005;6:100.

[6] Bozdech Z, Llinás M, Pulliam BL, Wong ED, Zhu J, Joseph LD. Thetranscriptome of the intraerythrocytic developmental cycle of Plasmodiumfalicparum. PloS Biology 2003;1:1–16.

[7] McAndrew MB, Read M, Sims PF, Hyde JE. Characterisation of the geneencoding an unusually divergent TATA-binding protein (TBP) from the

extremely AT-rich human malaria parasite Plasmodium falciparum. Gene1993;124:165–71.

[8] Ferrari S, Ronfani L, Calogero S, Bianchi ME. The mouse gene coding forhigh mobility group 1 protein (HMG1). J Biol Chem 1994;269:28803–8.

[9] Travers AA. Priming the nucleosome: a role for HMGB proteins? EMBOreports 2003;4:131–6.

[10] Jayaraman L, Moorthy NC, Murthy KG, Manley JL, Bustin M, Prives C.High mobility group protein-1 (HMG-1) is a unique activator of p53.Genes Dev 1998;12:462–72.

[11] Sawchuk DJ, Weis-Garcia F, Malik S, Besmer E, Bustin M, NussenzweigMC, et al. V(D)J recombination: modulation of RAG1 and RAG2 cleavageactivity on 12/23 substrates by whole cell extract and DNA-bendingproteins. J Exp Med 1997;185:2025–32.

[12] Briquet S, Boschet C, Gissot M, Tissandie E, Sevilla E, Franetich JF, et al.High-mobility-group box nuclear factors of Plasmodium falciparum.Eukaryot Cell 2006;5:672–82.

[13] Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M,et al. High mobility group box chromosomal protein 1 plays a role in thepathogenesis of rheumatoid arthritis as a novel cytokine. Arthritis Rheum2003;48:971–81.

[14] Ombrellino M, Wang H, Ajemian MS, Talhouk A, Scher LA, FriedmanSG, et al. Increased serum concentrations of high-mobility-group protein 1in haemorrhagic shock. Lancet 1999;354:1446–7.

[15] Lotze MT, Tracey KJ. High-mobility group box 1 protein (HMGB1):nuclear weapon in the immune arsenal. Nat Rev Immunol 2005;5:331–42.

[16] AnderssonU,WangH, Palmblad K, Aveberger AC, BloomO, ErlandssonH,et al. High Mobility Group 1 Protein (HMG-1) stimulates proinflammatorycytokine synthesis in human monocytes. J Exp Med 2000;192:565–70.

[17] Wang H, BloomO, ZhangM, Vishnubhakat JM, Ombrellino M, Che J, et al.HMG-1 as a late mediator of endotoxin lethality in mice. Science1999;285:248–51.

[18] Thanos D, Maniatis T. Virus induction of human IFNβ gene expressionrequires the assembly of an enhanceosome. Cell 1995;83:1091–100.

[19] John S, Reeves RB, Lin JX, Child R, Leiden JM, Thompson CB, et al.Regulation of cell-type-specific interleukin-2 receptor-chain gene expres-sion: potential role of physical interactions between Elf1, HMG-I(Y) andNF-kB family proteins. Mol Cell Biol 1995;15:1786–96.

[20] Klein-Hessling S, Schneider G, Heinfling A, Chuvpilo S, Serfling E. HMGI(Y) interfereswith theDNAbinding ofNF-AT factors and the induction of theinterleukin-4 promoter in Tcells. Proc Natl Acad Sci USA 1996;93:15311–6.

[21] French SW, Schmidt MC, Glorioso JC. Involvement of a high-mobility-group protein in the transcriptional activity of herpes simplex viruslatency-active promoter 2. Mol Cell Biol 1996;16:5393–9.

[22] Wong B, Masse JE, Yi-Meng Y, Petros G, Feigon J, Johnson RC. Bindingto cisplatin-modified DNA by the Saccharomyces cerevisiae HMGBprotein Nhp6A. Biochemistry 2002;41:5404–14.

[23] Trager W, Jensen JB. Human malaria parasites in continuous culture.Science 1976;193:673–5.

[24] Andersson U, Helena EH, Yang H, Tracey KJ. HMGB1 as a DNA-bindingcytokine. J Leukoc Biol 2002;72:1084–91.

[25] Li J, Kokkola R, Tabibzadeh S, Yang R, Ochani M, Qiang X, et al.Structural basis for the proinflammatory cytokine activity of high mobilitygroup box 1. Mol Med 2003;9:37–45.

[26] Le Roch KG, Zhou Y, Blair PL, Grainger M, Moch JK, Haynes JD, et al.Discovery of gene function by expression profiling of the malaria parasitelife cycle. Science 2003;301:1503–8.

[27] Clark IA, Alleva LM, Mills AC, Cowden WB. Pathogenesis of Malariaand Clinically Similar Conditions. Clin Microbiol Rev 2004;17:509–39.

[28] Liew FY, Li Y, Millott S. Tumour necrosis factor (TNF-a) in leishmaniasis.II. TNF-a induced macrophage leishmanicidal activity is mediated by nitricoxide from l-arginine. Immunology 1990;71:556–9.

[29] Fehr T, Schoedon G, Odermatt B, Holtschke T, SchneemannM, BachmannMF, et al. Crucial role of interferon consensus sequence binding protein,but neither of interferon regulatory factor 1 nor of nitric oxide synthesis for,protection against murine listeriosis. J Exp Med 1997;185:921–31.

[30] Alleva LM, Yang H, Tracey KJ, Clark IA. High mobility group box 1(HMGB1) protein: possible amplification signal in the pathogenesis offalciparum malaria. Trans R Soc Trop Med Hyg 2005;99:171–4.