RESEARCH ARTICLE

Homeobox Gene Sax2 Deficiency Causes anImbalance in Energy HomeostasisRuth Simon,1* Thomas Lufkin,2 and Andrew D. Bergemann1

The brain, in particular the hypothalamus and the brainstem, plays a critical role in the regulation ofenergy homeostasis by incorporating signals from the periphery and translating them into feedingbehavior. Here we show that the homeobox gene Sax2, which is expressed predominantly in the brainstem,in the vicinity of serotonergic neurons, contributes to this physiological balance. Sax2 deficiency results ina decrease of fat and glycogen storage, reduced blood glucose levels, and raised serotonin levels in thehindbrain. Surprisingly, in the brainstem the expression levels of pro-opiomelanocortin and neuropeptideY were indicative of a fasting condition, opposed to the observed high serotonin levels implying satiation.Furthermore, Sax2-directed lacZ expression reveals a dramatic change of the distribution of Sax2-expressing cells in the null mutant occurring during perinatal development. These data strongly suggestthat Sax2 is required for the coordinated crosstalk of factors involved in the maintenance of energyhomeostasis. Developmental Dynamics 236:2792–2799, 2007. © 2007 Wiley-Liss, Inc.

Key words: homeobox gene; brain development; energy homeostasis

Accepted 6 August 2007

INTRODUCTION

Regulation of energy homeostasis in-volves a complex network of neuronsoriginating in the hypothalamus andprojecting to the brainstem and viceversa integrating diverse signals aris-ing from the periphery to regulatefood uptake (Grill and Kaplan, 2001;Berthoud, 2002; Morton et al., 2006).In particular, pro-opiomelanocortin-(POMC) and neuropeptide Y- (NPY)expressing neurons, both of which arelocated in the hypothalamic arcuatenucleus (Friedman, 2004; Cone, 2005;Park and Bloom, 2005) and the nu-cleus of the solitary tract (NTS) of thebrainstem (Ellacott and Cone, 2004;Fan et al., 2004; Thorens and Larsen,

2004; Sutton et al., 2005), have criticalfunctions. Their crosstalk betweeneach other as well as with other neu-rotransmitters like serotonin is cru-cial to balance food intake and energyexpenditure (Ramos et al., 2005). Pe-ripheral signals, adiposity signalsarising from adipose tissue and pan-creas and signals from the gastroin-testinal tract, interact with these spe-cific neurons of the hypothalamus andthe brainstem, respectively (Park andBloom, 2005). While little is knownabout the regulation of energy ho-meostasis in the brainstem, the neu-ral circuitry in the hypothalamus iswell defined. Adiposity signals, likeleptin and insulin, interact specifi-

cally in a reciprocal way with two neu-ron groups located in the arcuate nu-cleus of the hypothalamus, theorexigenic neurons that express boththe NPY and the agouti-related pro-tein (AgRP); and the anorectin neu-rons that express the POMC and co-caine- and amphetamine-regulatedtranscript (CART). High levels of lep-tin and insulin prevent food intake bysuppressing the expression of NPYand AgRP and by activating POMCand CART expression, whereas lowlevels activate NPY and AgRP expres-sion, which in turn inhibit the expres-sion of POMC and CART leading to anincrease in appetite and, potentially,leading to obesity (Friedman, 2004;

1Department of Pathology, Mount Sinai School of Medicine, New York, New York2Stem Cell and Developmental Biology, Genome Institute of Singapore, SingaporeGrant sponsor: NIH; Grant numbers: AR4647 and DE13741; Grant sponsor: Irma T. Hirschl Charitable Trust; Grant sponsor: GaismanFrontiers of Biomedical Sciences Research.*Correspondence to: Ruth Simon, Ph.D., Department of Pathology, Mount Sinai School of Medicine, One Gustave Levy Place,New York, NY 10029. E-mail: ruth.simon@mssm.edu

DOI 10.1002/dvdy.21320Published online 14 September 2007 in Wiley InterScience (www.interscience.wiley.com).

DEVELOPMENTAL DYNAMICS 236:2792–2799, 2007

© 2007 Wiley-Liss, Inc.

Cone, 2005; Park and Bloom, 2005). Inaddition to this level of regulation, arecent report predicts a role for sero-tonin in the regulation of the melano-cortin pathway via specific serotoninreceptors, 5-HT 2CR and 5-HT 1BR,located on POMC and NPY neurons,respectively (Heisler et al., 2006).In turn, melanocortin 4 receptors(MC4-R) as well as NPY receptors arelocated in the midbrain, the pons, andthe ventral medulla further suggest-ing a crosstalk between serotonergicneurons and NPY and POMC neurons(Kishi et al., 2003, 2005). During peri-natal development, this crosstalkmight be occurring predominantly inthe brainstem due to the fact thatNPY neurons of the arcuate nucleusare only developing postnatally(Grove and Smith, 2003).

Here we report a novel role for thehomeobox gene Sax2 in the mainte-nance of energy homeostasis. Sax2 de-ficiency causes a dramatic metabolicphenotype as shown by histologicalanalysis of specific tissues. The prox-imity of Sax2-expressing cells to sero-tonergic neurons and the importantrole serotonin plays in food uptake ledus to determine further their interre-lationship. In addition, quantitativereal time RT-PCR assays revealed al-tered expression levels for NPY andPOMC in the hindbrain of Sax2 nullmutants. Our data suggest an impor-tant role for Sax2 in the crosstalk be-tween different factors involved in en-ergy homeostasis.

RESULTS

Analysis of the Sax2 NullMutant Phenotype

The homeobox gene Sax2 is expressedpredominantly in the brain and spinalcord, in particular in the vicinity ofserotonergic neurons, starting at em-bryonic stage E10.5 and coincidingwith the onset of serotonin synthesis(Wallace and Lauder, 1983). Micelacking Sax2 expression are indistin-guishable at birth from their litter-mates, but are easily recognizable atpostnatal day 3 due to their smallersize. Although these mice are runted,they did not show any obvious abnor-mal behavior or motor skills. All Sax2null pups exhibited normal sucklingbehavior and milk was found in their

stomachs. In addition, these miceshowed a high lethality within thefirst 3 weeks postnatally (Simon andLufkin, 2003). Further examination ofanimals at 2 weeks postnatally re-vealed that Sax2 null mice lack sub-cutaneous fat (data not shown) andintra-abdominal epididymal and mes-enteric white adipose tissue (WAT)when compared to controls (Fig. 1A).Wild-type epididymal (Fig. 1A, a) andmesenteric (Fig. 1A, c) WAT exhibitthe typical large transparent adipo-cytes filled with a single lipid dropletsurrounded by a scant ring of cyto-plasm and a flattened and eccentricnucleus, which is in stark contrast toWAT of Sax2 null mutants consistingof small cells lacking any lipid incor-poration (Fig. 1A, b and d). To deter-mine whether the observed lack ofWAT in Sax2 null mutants is due toan overall failure to generate differen-tiated adipose tissues, we examinedinterscapular BAT. Histological anal-ysis of the neck sections of day-1 post-natal mice, consisting of interscapularBAT, muscle, and skin, did not revealany differences between wild-type andSax2 null mutants (Fig. 1B, a and b),suggesting that embryonic adipocytedevelopment occurs normally. Thischanges dramatically during the firstweek postnatally. BAT of wild-typeanimals exhibits increased lipid accu-mulation in the form of multiple lipiddroplets per cell and accumulation ofsubcutaneous WAT (Fig. 1B, c). Incontrast, BAT of Sax2 null mutantshas no lipid incorporation as demon-strated by very densely packed cellsand the absence of subcutaneous WAT(Fig. 2B, d). The absence of Sax2seems to affect specifically the forma-tion of adipose tissue, since there wereno overt differences between the skinof both the wild-type and mutant ani-mals, strongly suggesting that growthretardation exhibited by Sax2 nullmutants is not a general growth de-fect.

Lack of adipose tissue in Sax2 nullmice could be the result of a failure toconvert glucose into triglycerides, adefect in lipid uptake into adipose tis-sue, or a general decrease in glucoseuptake. The liver has a central role inthe storage and distribution of all fu-els within the body, in particular glu-cose. Nearly all carbohydrates in-gested in the diet are converted to

glucose and absorbed by the bloodstream. Increased levels of blood glu-cose stimulate liver and muscle to in-crease glycogen synthesis, which isstored in liver and muscle tissues.Both tissues have only a limited ca-pacity to store glycogen, causing ex-cess glucose to be diverted into syn-thesis of fat, which is stored in adiposetissue. In order to analyze whetherthe lack of fat incorporation in adiposetissue could be a defect in divertingglucose into fat, we examined liversections from 2-week postnatal Sax2null mice and their counterparts. Us-ing Periodic Acid Schiff’s reagent, aglycogen-specific staining method, re-vealed a lack of glycogen storage inliver tissue of Sax2 null mice (Fig. 1C,d) while wild-type tissue exhibitedlarge glycogen storage pads (Fig. 1C,c). In comparison, liver sectionsstained with Hematoxylin and Eosindid not reveal any obvious structuraldifferences besides a more obliquestaining in the Sax2 null mutant (Fig.1C a and b). In addition, blood glucoselevels of Sax2 null mutants werelower in comparison to their litter-mates during the first two weeks post-natally (Fig. 1D). Although overall theblood glucose levels were alreadyclearly lower at day 7, there is no sta-tistical significance due to the randomsuckling behavior of the pups. De-pending on the feeding status of theindividual, animal blood glucose lev-els vary to a great degree. At 2 weekspostnatally, blood glucose levels ofSax2 null mice were significantlylower, independent of the feeding sta-tus. It seems that the lower blood glu-cose levels in Sax2 mutants is due tothe smaller size of the animals butcomparing the postnatal growth rate(Simon and Lufkin, 2003) with theblood glucose levels of Sax2 mutantssuggests otherwise. However, it is pos-sible that Sax2 mutants are growingweaker during postnatal developmentand, therefore, might feed less fre-quently causing the reduced blood glu-cose levels. Taking together the histo-logical data obtained from BAT, WAT,and liver tissues as well as the lowblood glucose levels strongly suggeststhat postnatal growth retardation inSax2 null mutants is caused by animbalance in energy homeostasis.This imbalance could be caused bymetabolic dysfunction due to lack of

SAX2 INVOLVEMENT IN ENERGY HOMEOSTASIS 2793

Sax2 expression in the tissues de-scribed. Staining for lacZ expressionof Sax2 mutant WAT, BAT, and liver

tissues as well as the brain obtainedat postnatal day 7 revealed that Sax2expression occurs only in the brain

(Fig. 1E) suggesting that the Sax2phenotype is caused by deregulationof the central nervous system.

Fig. 1. Analysis of Sax2 null phenotype. A: Hematoxylin and Eosin (H&E)-stained sections of WAT. Epididymal (a, b) and mesenteric (c, d) adiposetissue was collected from 2-week-old wild-type (a, c) and Sax2 null mutants (b, d). 40� magnification. B: H&E stained sections of BAT. Sections ofthe neck region including BAT, muscle, and skin tissues of wild-type (a and c) and Sax2 null mutants (b and d) at day 1 (a and b) and 7 (c and d)postnatal. M, muscle; S, skin; 10� magnification. C: Histological analysis of liver tissue of wild-type and Sax2 null mutants at 2 weeks postnatal.Sections of wild-type (a, c) and Sax2 null mutants (b, d) were either stained with H&E (a, b) for structural analysis or with Periodic acid-Schiff reagent(PAS) for glycogen storage (c, d). H&E staining: cytoplasm, pink; nuclei, blue. PAS staining: Glycogen, magenta; nuclei, blue. 40� magnification. D:Blood glucose levels of wild-type, Sax2 heterozygous, and null mutants were determined at days 1, 3, 7, and 14 postnatally. n, number of animals;data were analyzed using the Student’s t-test. *P � 0.01; **P � 0.001. E: Beta-galactosidase stained sections double-stained with nuclear fast red ofhindbrain (a, b), WAT and BAT (c, d) as well as liver tissues (e, f) of wild-type (a, c, e) and Sax2 homozygous mutants (b, d, f) at day 7 postnatal. 20�magnification. Nuclei, red; lacZ, blue.

2794 SIMON ET AL.

Sax2 Expression Occurs inthe Vicinity of SerotonergicNeurons

As mentioned above, the brain is themajor regulator of energy homeosta-sis. Previously, we reported that Sax2expression occurs predominantly inthe brainstem, in the vicinity of sero-tonergic neurons and the neural tubebut not in the hypothalamus (Simonand Lufkin, 2003). To determine therole Sax2 plays in the regulation ofenergy homeostasis, we examined thepostnatal Sax2 expression pattern byutilizing the lacZ gene, which was tar-geted to the Sax2 locus (Simon andLufkin, 2003). As shown in Figure2A–C, beta-galactosidase staining re-vealed a distinct expression pattern inthe ventral brainstem at least up today 7 postnatally. While in early em-bryonic development the expressionpattern of Sax2 in both Sax2 heterozy-gous and null mutants was similarand differed only in the intensity inthe midbrain/hindbrain boundary (Si-mon and Lufkin, 2003), there was aremarkable difference at perinatalstages in Sax2 null mice (Fig. 2A,C).Sax2-directed lacZ expression in theheterozygous brain is most prominentin the caudal medulla and only weakin the ventral lateral pons and absentin the rostral medulla. In contrast,Sax2 null mutants exhibited robustlacZ expression at the ventral lateralpons and in the ventral midline of themedulla (Fig. 2A,C). During postnataldevelopment, the midline expressionexpanded laterally reaching the lat-eral expression sites of the medulla. Inaddition, the gap of lacZ expression inthe rostral medulla of Sax2 null mu-tants is closed at day 7 postnatally(Fig. 2C). Furthermore, hemi-sectionsof beta-galactosidase-stained Sax2heterozygous brains revealed a spe-cific cluster of cells in the midbrain/hindbrain boundary, which was ab-sent in Sax2 null brains (Fig. 2B,arrow). In contrast, a cluster of lacZ-expressing cells were found in the ven-tral midbrain of Sax2 null mutants(Fig. 2B, asterisk; Simon and Lufkin,2003), suggesting that loss of Sax2 ex-pression causes misguided migrationof lacZ-positive, Sax2 null cells or aderegulation at the transcriptionallevel of Sax2 expression. To furtherdetermine the changes in the pattern

Fig. 2. Analysis of postnatal Sax2 expression pattern. A–C: Ventral (A, C) and lateral (B) view ofbeta-galactosidase-stained brains collected at day 1 (A, B), and day 7 (C) postnatal. Sax2 het-erozygous (�/�) are on the left site and null mutants (�/�) on the right site in A and C and on thetop and bottom in B, respectively. D: Schematic sagittal view of a day-1 postnatal brain indicatinglevels of brain sections for E–P. a, E, F, I–N; b, G, H, O, P; A, anterior; P, posterior. E–L:Beta-galactosidase-stained sections of 1-day-old brains of Sax2 heterozygous and null mutantsdouble-stained with nuclear fast red. E and F show sections in the midbrain/hindbrain boundary (a,as indicated in D). I–L show enlarged views of the midline section of E (I) and F (J) as well as thelateral pons of E (K) and F (L). G and H represent sections of the hindbrain (b, as indicated in D).E–H, 4� magnification; I–L, 20� magnification. Nuclei, red; lacZ, blue. M–P: Immunohistochemistryon beta-galactosidase-stained sections using serotonin antibody. M and N represent sections ofthe midbrain/hindbrain boundary (a in D) and O and P represent sections of the hindbrain (b in D).10� magnification. Serotonin, brown; lacZ, blue. Arrows indicate lacZ expression. Aq, aquaduct;DR, dorsal raphe nucleus; LLv, nucleus of the lateral lemniscus, ventral; Ml, midline; MR, medianraphe nucleus; N3n, nucleus of the third nerve (oculomotor); P, pons; PMR, paramedian raphe; RM,raphe magnus nucleus.

SAX2 INVOLVEMENT IN ENERGY HOMEOSTASIS 2795

of Sax2-expressing cells, cross-sec-tions of beta-galactosidase-stainedbrains were double stained with Nu-clear Fast Red to visualize cell density(Fig. 2E–L). Sections corresponding tothe midbrain/hindbrain boundary asindicated in Figure 2D (a) revealed

two distinct clusters of beta-galactosi-dase-stained cells in the vicinity of themedian raphe nucleus in Sax2 het-erozygous mutants (Fig. 2E,I). InSax2 null mutants, the beta-galactosi-dase-stained cells were no longer or-ganized in distinct clusters but dis-

persed throughout the ventral part ofthe midbrain/hindbrain boundary(Fig. 2F,J) with a cluster of cells found

Fig. 3. Co-expression analysis of Sax2 and serotonin. A: Co-expression analysis of lacZ and serotonin in the hindbrain of Sax2 heterozygous andhomozygous mutants. Sections of beta-galactosidase-stained day-1 postnatal brains of Sax2 heterozygous (a, c) and homozygous (b, d) mutants wereemployed in immunohistochemistry using an antibody recognizing serotonin. Representative data of 3 independent experiments. lacZ expression,blue; serotonin, brown. a,b: 10� magnification; c,d: 40� magnification of the B3 region. Aq, aqueduct; B3, B3 serotonergic cell bodies; RO, rapheoralis; RP, raphe pallidus. B: Confocal microscopy on hindbrain sections of newborn Sax2 homozygous mutants employing antibodies recognizingserotonin (a) and beta-galactosidase (b). 63� magnification. Serotonin, green; lacZ, red.

Fig. 4. Determination of NPY and POMC mRNA levels in the hindbrain. Expression levels of NPYand POMC mRNAs in the hindbrain of newborn pups were determined by quantitative real timeRT-PCR. NPY mRNA expression in Sax2 null mutants increases by a factor 7.95, POMC mRNAexpression decreases to 45.8% compared to wild-type. Four individual hindbrains were used pergroup. *P � 0.05; **P � 0.01.

Fig. 5.

2796 SIMON ET AL.

in the area of the ventral nucleus ofthe lateral lemniscus (LLv) (Fig. 2F,L)where no Sax2 expression was foundin heterozygous mutants (Fig. 2E,K).Sections of more posterior areas of thebrain as indicated in Figure 2D (b)showed lacZ expression in the area ofthe median raphe nucleus and the ra-phe magnus in Sax2 null mutants(Fig. 2H), which was absent in het-erozygous mutants (Fig. 2G).

Sax2 Deficiency AltersSerotonin, NPY, and POMCLevels in the Brainstem

The proximity of Sax2 expression toraphe neurons and the important roleserotonin plays in the regulation offood uptake and body weight (Leibow-itz and Alexander, 1998; Ramos et al.,2005) led us to further investigate therelationship between Sax2 and seroto-nin by immunohistochemistry usingbeta-galactosidase-stained sections ofthe brain of newborn pups. This re-vealed continued lacZ expression inthe vicinity of serotonergic neurons, inparticular the paramedian raphe(PMR) (Fig. 2M,N) and the B3 neu-rons (Fig. 3A). Similar results wereobtained using brain sections of em-bryonic stage E18.5 (data not shown).Furthermore, confocal microscopy us-ing antibodies recognizing serotoninand beta-galactosidase demonstratedthat Sax2 expression does not occur inserotonin-positive cells (Fig. 3B).These data further confirmed our pre-vious findings by RNA in situ hybrid-ization experiments on brain sectionsof embryonic stage E16.5 (Simon andLufkin, 2003). Although these data in-dicated that Sax2 is not expressed inserotonergic neurons (Fig. 3A), its de-ficiency causes an increase in seroto-

nin levels most evident in the hind-brain implying satiation (Figs. 3A,5A). Quantitative real time RT-PCRexperiments employing mRNA pre-pared from hindbrains of newbornwild-type and Sax2 null mutants didnot reveal a difference in mRNA levelsfor factors involved in serotonin syn-thesis (brain-specific tryptophan hy-droxylase 2), transport (serotonintransporter), and degradation [mono-amine oxidase A (MAOA) and B(MAOB)], suggesting that Sax2 is notdirectly involved in the serotonin me-tabolism (data not shown). As men-tioned above, NPY and POMC play acrucial role in energy homeostasis. Itwas shown previously by several lab-oratories that NPY and POMC mRNAlevels are indicative of the physiologi-cal status of the animal, e.g., fastingor fed (Mizuno et al., 1998; Luque etal., 2007; Yang et al., 2007). In con-trast to the serotonin levels implyingsatiation, quantitative real time RT-PCR revealed increased NPY and de-creased POMC mRNA levels in Sax2null mutants when compared to wild-type (Fig. 3B) implying a fasting sta-tus that correlates with the phenotypeof the animals (Fig. 4B; Li and Ritter,2004). These data strongly suggestthat Sax2 is required for the crosstalkbetween factors involved in the main-tenance of energy homeostasis.

DISCUSSION

As mentioned above, the regulation ofthe serotonin metabolism and POMCand NPY expression are closely corre-lated, which is achieved by crosstalkthrough specific receptors located onthe reciprocal neurons (Kishi et al.,2005; Heisler et al., 2006). In Sax2null mutants, the proper connectionbetween these systems is distorted asdemonstrated by the contradictingdata we obtained, NPY and POMC ex-pression levels indicating fasting,whereas serotonin levels implying sa-tiation (Fig. 5C). This could be due toreduction of the levels of specific re-ceptors that depend on Sax2 expres-sion. As an example, it has been de-scribed that NPY receptor mRNAs arefound, in addition to others, in theparamedian raphe (Kishi et al., 2005),a Sax2 expression site. In addition, ithas been reported that NPY modu-lates serotonergic neurons in the

brainstem raphe by its Y1 receptor af-fecting feeding and aggressive behav-ior (Karl et al., 2004). Furthermore,Sax2 could be involved in axon guid-ance and loss of Sax2 expression couldprevent specific neurons from findingtheir targets similar to the role of itsparalogue, Sax1, in the formation ofthe early axon scaffold (Schubert andLumsden, 2005). Brainstem NPY neu-rons are projecting to specific nuclei ofthe hypothalamus, further regulatingenergy homeostasis (Grove et al.,2003, 2005; Grove and Smith, 2003; Liand Ritter, 2004; Bouret and Simerly,2006). In particular during early post-natal development, NPY in the hypo-thalamus originates in the brainstem(Grove et al., 2003). Sax2 deficiencymight prevent the development ofthese projections thereby preventingNPY neurons from counteracting highserotonin levels. Quantitative realtime RT-PCR analysis of NPY andPOMC mRNA expression in the fore-brain of newborn pups did not mirrorthe data obtained in the hindbrain(data not shown) further suggestingthat the crosstalk between brainstemand hypothalamus might be inter-rupted.

Brain development is far from com-plete at birth, and significant develop-mental changes occur during the peri-natal period (Grove et al., 2003, 2005;Grove and Smith, 2003; Bouret andSimerly, 2006). It is well establishedthat homeobox genes play a criticalrole during embryogenesis, particu-larly in the development of the ner-vous system (Vollmer and Clerc, 1998;Cepeda-Nieto et al., 2005; Waters andLewandoski, 2006). Correct spatio-temporally regulated expression oftranscription factors is crucial to as-sure normal development as has beenshown for the midbrain/hindbrain re-gion (Brodski et al., 2003; Aroca andPuelles, 2005). Our data demonstratethat loss of Sax2 results in mispat-terned distribution of Sax2-drivenlacZ expression during perinatal de-velopment leading to the severe phe-notype. These alterations might becaused by misguidance during cell mi-gration or transcriptional deregula-tion of Sax2 expression. As we haveshown previously, Sax2 regulates itsown expression in both a positive aswell as a negative feedback mecha-nism (Simon and Lufkin, 2003). Loss

Fig. 5. Model describing a role for Sax2 in en-ergy homeostasis. A: After food intake, signalsfrom the gastrointestinal tract activate expres-sion of POMC neurons in the nucleus of thesolitary tract and cause an increase in serotoninlevels and low levels of NPY. High levels ofPOMC and serotonin stop food intake. B: Fast-ing causes an increase of NPY and decrease ofPOMC, which reduces serotonin synthesis andinduces food intake. C: In the Sax2 null mutant,POMC and NPY levels reflect a fasting statusbut serotonin levels remain high, which mightprevent food intake and be responsible for theSax2 null phenotype.

SAX2 INVOLVEMENT IN ENERGY HOMEOSTASIS 2797

of Sax2 expression could not only af-fect its own regulation but also lead tochanges in the expression of othergenes, which in turn may be involvedin the regulation of energy homeosta-sis. Although we did not see changesin the mRNA expression levels of fac-tors involved in serotonin synthesis,transport, or degradation, it cannot beexcluded that loss of Sax2 expressionmight allow serotonin synthesis innormally serotonin-negative cells, re-sulting in elevated serotonin levels.Future analysis of the population ofSax2-expressing cells during pre- andpostnatal development and the discov-ery of Sax2 target genes will elucidatefurther the role of Sax2 in the main-tenance of energy homeostasis.

EXPERIMENTALPROCEDURES

Animals

Generation of Sax2 null mutants isdescribed elsewhere (Simon andLufkin, 2003). All experiments wereperformed on animals with a mixedgenetic background of S129/C57BL/6J. Brains were collected at differentages postnatal and stained for lacZexpression as described previously(Frasch et al., 1995). Blood glucoselevels were determined at differentdays postnatally using a One Touchglucose meter (Lifescan, Johnson andJohnson) and data were analyzed ac-cording to the Student’s t-test.

Histological Analysis ofTissues

Animals were sacrificed and tissueswere collected at different ages post-natally. Tissues were fixed in 4%paraformaldehyde overnight, washedin phosphate-buffered saline, dehy-drated through graded ethanol, fol-lowed by two changes of Americlear(Fisher), and embedded in Paraplast(Fisher). Sections of 7 �m thicknesswere cut and floated onto Plus� slides(Fisher), dried and stored at roomtemperature. For Hematoxylin andEosin staining, sections were deparaf-finized and hydrated to water, stainedfor 5 min in Harris Modified Hematox-ylin (Fisher), washed in water, anddifferentiated in 1% acid alcohol, fol-lowed by a brief wash in water, and

dipped in ammonium water until sec-tions turned blue. After a brief rinse inwater, sections were stained for 2 minin Eosin, dehydrated through gradedethanol, cleared in Americlear(Fisher), and mounted with a resinousmedium. Sections for Periodic Acid-Schiff reagent (Sigma-Aldrich) wereprepared as described above followedby staining as recommended by thesupplier. For Nuclear Fast Red stain-ing, beta-galactosidase-stained brainsand tissues were embedded in Para-plast (Fisher) and 15-�m sectionswere prepared. Sections were treatedas described above followed by stain-ing in Nuclear fast Red (Sigma-Al-drich) for 1 to 5 min, rinsed in water,dehydrated through graded ethanol,followed by clearing in Americlear(Fisher), and mounted with a resinousmedium.

Immunohistochemistry

Beta-galactosidase-stained brainswere embedded in Paraplast (Fisher)and 15-�m sections were prepared.Sections were deparaffinized, hy-drated, treated with 0.01M citrate pH6.0, and blocked with 0.1% gelatine,1% BSA in 1� TBS solution contain-ing 5% goat serum. Sections were in-cubated at 4°C for 16 to 24 hr in thepresence of a serotonin-specific anti-body (Immunostar) at a dilution of1:250 in blocking solution. Sectionswere washed in PBS, incubated with asecondary antibody in blocking solu-tion for 1 hr at room temperature,washed in PBS, and stained with Per-oxidase kit from Vector Laboratories.

Immunofluorescence Analysis

Cryostat sections were prepared frombrains of newborn pups, fixed in 4%paraformaldehyde for 20 min at roomtemperature followed by permeabili-zation with methanol for 5 min at�20°C. For antigen retrieval, slideswere immersed in hot 0.01M citricacid pH 6.0 for 10 min. Sections wereincubated with a polyclonal rabbit an-ti-serotonin antibody (Immunostar) ata dilution of 1:50 and a monoclonalanti-beta-galactosidase antibody (Sig-ma-Aldrich) at a dilution of 1:20. Sec-ondary antibodies, Alexa Fluor 488goat anti-rabbit IgG(H�L) and AlexaFlour 568 goat anti-mouse IgG1 (Mo-

lecular Probes) were used at a dilutionof 1:1,000. Confocal laser scanning mi-croscopy was performed at the MSSM-Microscopy Shared Resource Facility,supported with funding from NIH-NCI shared resources grant (5R24CA095823-04), NSF Major Re-search Instrumentation grant (DBI-9724504), and NIH shared instrumen-tation grant (1 S10 RR0 9145-01).

Quantitative Real TimeRT-PCR

Total RNA was prepared from hind-brains of newborn wild-type and Sax2null mutants using RNeasy Minikit(Qiagen), treated with RNA freeDNAse (Qiagen) and reverse tran-scribed with SuperScript™II ReverseTranscriptase (Invitrogen). Quantita-tive real time PCR was performed us-ing QuantiTect™ SYBRR Green PCRkit (Qiagen) in an ABI Sequence De-tection System using oligonucleotidesrecognizing NPY 5�GCTTGAAGAC-CCTTCCATTGG and 5�GGCG-GAGTCCAGCCTAGTGG, POMC5�CATTAGGCTTGGAGCAGGTC and5�GAATGAGAAGACCCCTGCAC,GAPDH 5�CCAGAGCTGAACGG-GAAG and 5�TGCTGTTGAAGTCG-CAGG. The relative copy number ofGAPDH RNA was quantified and usedfor normalization. Data were analyzedas described previously (Livak andSchmittgen, 2001).

Statistical Analysis

Results are expressed as mean �s.e.m. Comparisons between groupswere made by an unpaired two-tailedStudent’s t-test (blood glucose levels)or analyzed using the 2-��C

T methodas described previously (Livak andSchmittgen, 2001; quantitative realtime RT-PCR). P � 0.05 was consid-ered statistically significant.

ACKNOWLEDGMENTSThis work was supported in part byNIH grants AR4647 and DE13741 toT.L. and by the Irma T. Hirschl Char-itable Trust and the Gaisman Fron-tiers of Biomedical Sciences ResearchAward to A.D.B. We thank Dr. E.Watson for initial help with WATpreparations and Drs. AshwiniDhume, Ulla Gaio, Jong-Sun Kang,Susanne Radke, Sue Saunders, and

2798 SIMON ET AL.

Martina Schwarzkopf for many help-ful discussions, and Mirna Perez-Moreno for carefully reading themanuscript.

REFERENCES

Aroca P, Puelles L. 2005. Postulatedboundaries and differential fate in thedeveloping rostral hindbrain. Brain ResBrain Res Rev 49:179–190.

Berthoud HR. 2002. Multiple neural sys-tems controlling food intake and bodyweight. Neurosci Biobehav Rev 26:393–428.

Bouret SG, Simerly RB. 2006. Develop-mental programming of hypothalamicfeeding circuits. Clin Genet 70:295–301.

Brodski C, Weisenhorn DM, Signore M,Sillaber I, Oesterheld M, Broccoli V,Acampora D, Simeone A, Wurst W. 2003.Location and size of dopaminergic andserotonergic cell populations are con-trolled by the position of the midbrain-hindbrain organizer. J Neurosci 23:4199–4207.

Cepeda-Nieto AC, Pfaff SL, Varela-Echa-varria A. 2005. Homeodomain transcrip-tion factors in the development of sub-sets of hindbrain reticulospinal neurons.Mol Cell Neurosci 28:30–41.

Cone RD. 2005. Anatomy and regulation ofthe central melanocortin system. NatNeurosci 8:571–578.

Ellacott KL, Cone RD. 2004. The centralmelanocortin system and the integrationof short- and long-term regulators of en-ergy homeostasis. Recent Prog Horm Res59:395–408.

Fan W, Ellacott KL, Halatchev IG, Taka-hashi K, Yu P, Cone RD. 2004. Cholecys-tokinin-mediated suppression of feedinginvolves the brainstem melanocortin sys-tem. Nat Neurosci 7:335–336.

Frasch M, Chen X, Lufkin T. 1995. Evolu-tionary-conserved enhancers direct re-gion-specific expression of the murineHoxa-1 and Hoxa-2 loci in both mice andDrosophila. Development 121:957–974.

Friedman JM. 2004. Modern science ver-sus the stigma of obesity. Nat Med 10:563–569.

Grill HJ, Kaplan JM. 2001. Interoceptiveand integrative contributions of fore-brain and brainstem to energy balancecontrol. Int J Obes Relat Metab Disord25(Suppl 5):S73–77.

Grove KL, Smith MS. 2003. Ontogeny ofthe hypothalamic neuropeptide Y sys-tem. Physiol Behav 79:47–63.

Grove KL, Allen S, Grayson BE, Smith MS.2003. Postnatal development of the hy-pothalamic neuropeptide Y system. Neu-roscience 116:393–406.

Grove KL, Grayson BE, Glavas MM, XiaoXQ, Smith MS. 2005. Development ofmetabolicsystems.PhysiolBehav86:646–660.

Heisler LK, Jobst EE, Sutton GM, Zhou L,Borok E, Thornton-Jones Z, Liu HY, Zig-man JM, Balthasar N, Kishi T, Lee CE,Aschkenasi CJ, Zhang CY, Yu J, Boss O,Mountjoy KG, Clifton PG, Lowell BB,Friedman JM, Horvath T, Butler AA,Elmquist JK, Cowley MA. 2006. Seroto-nin reciprocally regulates melanocortinneurons to modulate food intake. Neuron51:239–249.

Karl T, Lin S, Schwarzer C, Sainsbury A,Couzens M, Wittmann W, Boey D, vonHorsten S, Herzog H. 2004. Y1 receptorsregulate aggressive behavior by modu-lating serotonin pathways. Proc NatlAcad Sci USA 101:12742–12747.

Kishi T, Aschkenasi CJ, Lee CE, MountjoyKG, Saper CB, Elmquist JK. 2003. Ex-pression of melanocortin 4 receptormRNA in the central nervous system ofthe rat. J Comp Neurol 457:213–235.

Kishi T, Aschkenasi CJ, Choi BJ, LopezME, Lee CE, Liu H, Hollenberg AN,Friedman JM, Elmquist JK. 2005. Neu-ropeptide Y Y1 receptor mRNA in rodentbrain: distribution and colocalizationwith melanocortin-4 receptor. J CompNeurol 482:217–243.

Leibowitz SF, Alexander JT. 1998. Hypo-thalamic serotonin in control of eatingbehavior, meal size, and body weight.Biol Psychiatry 44:851–864.

Li AJ, Ritter S. 2004. Glucoprivation in-creases expression of neuropeptide YmRNA in hindbrain neurons that inner-vate the hypothalamus. Eur J Neurosci19:2147–2154.

Livak KJ, Schmittgen TD. 2001. Analysisof relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–408.

Luque RM, Park S, Kineman RD. 2007.Severity of the catabolic condition differ-entially modulates hypothalamic expres-sion of growth hormone-releasing hor-mone in the fasted mouse: potential roleof neuropeptide Y and corticotropin-re-

leasinghormone.Endocrinology148:300–309.

Mizuno TM, Kleopoulos SP, Bergen HT,Roberts JL, Priest CA, Mobbs CV.1998. Hypothalamic pro-opiomelano-cortin mRNA is reduced by fasting and[corrected] in ob/ob and db/db mice, butis stimulated by leptin. Diabetes 47:294 –297.

Morton GJ, Cummings DE, Baskin DG,Barsh GS, Schwartz MW. 2006. Centralnervous system control of food intakeand body weight. Nature 443:289–295.

Park AJ, Bloom SR. 2005. Neuroendocrinecontrol of food intake. Curr Opin Gastro-enterol 21:228–233.

Ramos EJ, Meguid MM, Campos AC,Coelho JC. 2005. Neuropeptide Y, alpha-melanocyte-stimulating hormone, andmonoamines in food intake regulation.Nutrition 21:269–279.

Schubert FR, Lumsden A. 2005. Transcrip-tional control of early tract formation inthe embryonic chick midbrain. Develop-ment 132:1785–1793.

Simon R, Lufkin T. 2003. Postnatal lethal-ity in mice lacking the Sax2 homeoboxgene homologous to Drosophila S59/slouch: evidence for positive and nega-tive autoregulation. Mol Cell Biol 23:9046–9060.

Sutton GM, Duos B, Patterson LM,Berthoud HR. 2005. Melanocortinergicmodulation of cholecystokinin-inducedsuppression of feeding through extracel-lular signal-regulated kinase signalinginratsolitarynucleus.Endocrinology146:3739–3747.

Thorens B, Larsen PJ. 2004. Gut-derivedsignaling molecules and vagal afferentsin the control of glucose and energy ho-meostasis. Curr Opin Clin Nutr MetabCare 7:471–478.

Vollmer JY, Clerc RG. 1998. Homeoboxgenes in the developing mouse brain.J Neurochem 71:1–19.

Wallace JA, Lauder JM. 1983. Develop-ment of the serotonergic system in therat embryo: an immunocytochemicalstudy. Brain Res Bull 10:459–479.

Waters ST, Lewandoski M. 2006. A thresh-old requirement for Gbx2 levels in hind-brain development. Development 133:1991–2000.

Yang XJ, Mastaitis J, Mizuno T, MobbsCV. 2007. Glucokinase regulates repro-ductive function, glucocorticoid secre-tion, food intake, and hypothalamic geneexpression. Endocrinology 148:1928–1932.

SAX2 INVOLVEMENT IN ENERGY HOMEOSTASIS 2799