horizon discovery the cell builders › upload › sponsor... · to 2018, january 2014 visiongain...
TRANSCRIPT
HORIZON DISCOVERY
THE CELL BUILDERS Designing, engineering and applying gene-edited cells to advance human health
2
The information contained in this confidential document (“Presentation”) has been prepared by Horizon Discovery Group plc (the “Company”). It has not been fully verified and is subject to material updating, revision and further amendment. Any person who receives this Presentation should not rely or act upon it. This Presentation should not be re-distributed, re-published, reproduced or disclosed by recipients, in whole or in part.
While the information contained herein has been prepared in good faith, neither the Company, Numis Securities Limited (“Numis") nor any of their respective shareholders, directors, officers, agents, employees or advisers give, have given or have authority to give, any representations or warranties (express or implied) as to, or in relation to, the accuracy, reliability or completeness of the information in this Presentation, or any revision thereof, or of any other written or oral information made or to be made available to any interested party or its advisers (all such information being referred to as “Information”) and liability therefore is expressly disclaimed. Accordingly, neither the Company, Numis nor any of their shareholders, directors, officers, agents, employees or advisers take any responsibility for, or will accept any liability whether direct or indirect, express or implied, contractual, tortious, statutory or otherwise, in respect of, the accuracy or completeness of the Information or for any of the opinions contained herein or for any errors, omissions or misstatements or for any loss, howsoever arising, from the use of this Presentation.
This Presentation may contain forward-looking statements that involve substantial risks and uncertainties, and actual results and developments may differ materially from those expressed or implied by these statements and past performance is no guarantee of future performance. These forward-looking statements are statements regarding the Company's intentions, beliefs or current expectations concerning, among other things, the Company's results of operations, financial condition, prospects, revenue generation, growth, strategies and the industry in which the Company operates. By their nature, forward-looking statements involve risks and uncertainties because they relate to events and depend on circumstances that may or may not occur in the future. These forward-looking statements speak only as of the date of this Presentation and the Company does not undertake any obligation to publicly release any revisions to these forward-looking statements to reflect events or circumstances after the date of this Presentation.
In no circumstances will the Company or Numis be responsible for any costs, losses or expenses incurred in connection with any appraisal or investigation of the Company. In furnishing this Presentation, the Company does not undertake or agree to any obligation to provide the recipient with access to any additional information or to update this Presentation or to correct any inaccuracies in, or omissions from, this Presentation which may become apparent. This Presentation does not constitute an offer or invitation to subscribe for or purchase any securities and neither this Presentation nor anything contained herein shall form the basis of any contract or commitment whatsoever. In particular, this Presentation does not constitute an offer or invitation to subscribe for or purchase any securities in the United States. The securities of the Company have not been and will not be registered under the US Securities Act of 1933, as amended (the “US Securities Act”) or the securities laws of any state or other jurisdiction of the United States and may not be offered or sold in the United States except pursuant to an exemption from, or in a transaction not subject to, the registration requirements of the US Securities Act and in accordance with any applicable state securities laws. There will be no public offering of the securities of the Company in the United States.
Disclaimer
3
The Cell Builders
CCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGG
“I am a cancer patient”
“I am a cancer survivor”
Horizon deploys a powerful and flexible gene editing platform to develop cell models that drive the understanding of disease, to perform genome surgery, and to create novel molecular, cellular and gene therapies
How we do it What we do
4
Horizon, a growth story
December 2015 FY Financial Highlights Investment strategy delivers strong revenue growth
Revenue
£20.2m +69% (FY14: £11.9m)
EBITDA (£6.6m) Cash £25.1m
Products
£7.8m +124% (FY14: £3.5m)
Volume driven expansion of GM to 57%
Services
£12.1m +69% (FY14: £7.2m)
Significant increase in scale
Research Biotech
Up to £208m +32% (FY14: £158m)
RedX and Servier deals Avvinity deal post year end
4
6
• Making specific changes to a gene
• Allows diseases to be reproduced in a laboratory setting
• Empowers researchers to ask important biological questions earlier in the drug discovery process
What is gene editing?
Gene editing enables Personalised Medicine for: improved patient outcomes, deployment of scarce resources, and delivering
increased returns on drug development
7
Gene editing now underpins the pharma value chain
SAM £1.2bn (HZD estimate)
HZD revenue growing from 2%
Share
Rapidly growing market
Markets and Markets Genomics Market by Products Global Forecast
to 2018, January 2014 Visiongain Cell-Based Assays: World Market
Prospects 2013-2023, February 2013 Markets and Markets Genomics
Market by Products Global Forecast to 2018, January 2014 BCC Research
Molecular Diagnostics: Technologies and Global Markets, March
There are many ways to edit a gene
• Access to multiple gene editing tools allows tremendous flexibility for
precision, speed and price
• Broad and deep IP position with emerging position in Tx space
Deep practical experience • A decade of industrial application and know-how and advised
by the global academic opinion leaders in gene editing
• Thousands of genes modified making every possible type of modification
• High-throughput, low cost and proprietary cell line engine has allowed expansion from 2,750 to over 23,000 products in 2015
8
Horizon is a global leader in gene editing
9
Flywheel commercial model for scalable growth
>60% global top 50 pharma • Mid-margin model creation • High-margin applications
Up to £208m milestones Risk managed portfolio • Synthetic lethality, immuno-oncology • Target ID and validation • Gene and cell therapy
Gene editing core platform • Platform, experience, application • Unlocks “Sequence to treatment” value
>23,000 Products >1,400 Customers • Vending machine of models • Product manufacturing engines • High-margin and scalable
PRODUCTS
SERVICES RESEARCH BIOTECH
8
10
Horizon’s Products
By using Horizon’s BRAF V600E cfDNA Reference Standard
Set, we were able to directly compare the sensitivities of two
systems against a known series of controls down to an allelic
frequency of 0.1% - a very important threshold when trying to
detect low abundance markers. Horizon’s reference standard
was more reliable than any patient-derived cfDNA, and
moreover one can exclude genomic DNA contamination, and
so we were able to make our choice of instrument with
confidence.
Dr. Sukirthini Balendran
Medical University of Vienna
Research use cell lines
Diagnostic reference standards
Pre-clinical human disease models
Biomanufacturing cell lines
>23,000 Product Catalogue
Off the Shelf
Value drivers
11
Horizon’s Services
At MISSION Therapeutics, we engage in drug discovery around
the use of deubiquitylating enzymes to address cancer and other
diseases. When we have a promising compound, an important
early part of our validation process is to test those compounds on
cell lines that lack their target. We engaged Horizon to perform
custom cell line engineering in two backgrounds for us for
an important project. The process worked perfectly, with the
cell lines delivered in four months and subsequently validated
as true genetic knockouts. The process was great, with clear
communication around progress, so that we could be relaxed and
trust that we would get what we need and when we needed it.
We have since gone back to Horizon for additional work.
Dr. Yaara Ofir-Rosenfeld
Senior Scientist
MISSION Therapeutics.
Targeted services across drug development
Value drivers
12
Research Biotech
Our collaboration with Vernalis resulted in the discovery of a
number of promising drug candidates that, while exhibiting great
promise for treatment of a range of cancer types based on pre-
clinical data, unfortunately lacked a biomarker immediately
available to help identify the patients most likely to benefit from
them. And so we turned to Horizon. Horizon’s technology
portfolio and expertise made them ideally positioned to progress
these drug candidates into the clinic, and to investigate their
potential for therapeutic efficacy both alone and in combination
therapies. With work now underway we are excited to see the
results of this project.
Mr Jean Pierre Abastado
Director of Oncology Innovation
Servier
Activate immune system to recognise and destroy cancer
Attack genetic Achilles’ heel of cancer leaving healthy cells alone
Directly target DNA or cell repair or replacement in a patient
Immuno-oncology
Synthetic lethality
Gene and cell therapy
13
Our flywheel in action
MANUFACTURING ENGINE Cell line used to manufacture reference standard products
LEVERAGE OF MODEL Cell and research service expertise drive therapeutic development
APPLICATION OF MODEL Cell line used in range of assay and screening services
CORE BUSINESS ASSET Cell line goes into Horizon’s catalogue of research models
ADVANCED MODELS Expertise and work supports and leads into in vivo disease model generation
• Scientific leadership on K-Ras resistance in cancer (COLTHERES) • Custom engineering (Qiagen) yielded £500k service revenue • Downstream product revenue of >£1m • On-going clinical trial and in-kit sales with Dx partner • Downstream service and grant revenue of >£1M • Deployed in HD-001, SyntheTx research biotech programs
Case Study: K-Ras cell lines
1
2
3 4
5
6
2
3
4
5
6
PAID FOR DEVELOPMENT Customer pays Horizon to develop an engineered cell line
1
14
What to expect from Horizon in 2016
1. Delivery of our strategy
2. Continued commercialisation • Product relationships for scale • Service alliances for scale • Research biotech investment and milestones
3. Investment for scale and delivery of our path-to-profit
Sustainable core revenue growth
Increasing the value of what we do
Scientific leadership Accelerated growth
Follow Horizon: Web: www.horizondiscovery.com Email: sign up to our email list Investor Twitter: @horizonIR General HZD Twitter: @HorizonGenomics
Your Horizon Contact:
t + 44 (0)1223 655580 f + 44 (0)1223 655581 e [email protected] w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Chris Claxton
VP Investor Relations & Corporate Communication
+44 (0)1223 976 000
HORIZON DISCOVERY
APPENDIX
17
Zinc Finger Nucleases (ZFNs) • Good genome coverage • Advantage in certain applications
CRISPR • High Efficiency • Fast • Flexible
rAAV (Recombinant Adeno-Associated Virus) • Most precise approach • No potential for off-target effects • Broadest range of targeting
We use multiple gene editing technologies
Technology agnostic: “Using the best tool for the
job at hand”
18
First knock-out rat First knock-in rat
First conditional knock-out rat
Scientific leadership and innovation in gene editing 2016 Nature Communications: Gene Editing / Genomics SAB:
Dr. Feng Zhang MIT/Broad Institute Inventor and world
expert on CRISPR/Cas9 Founder EDITAS
Dr. Emmanuelle Charpentier Max Planck Institute
Inventor of CRISPR/Cas9 Founder CRISPR Tx
Dr. J. Keith Joung Harvard/Mass General
Expert in gene editing platforms, including ZFNs and CRISPR
Founder EDITAS
Professor David Russell Univ. of Washington
Founder - Universal Stem Cells Inventor of rAAV
Professor Eric Hendrickson Univ. of Minnesota
World expert on DNA repair mechanisms and gene editing
Dr. S. Nijman University of Oxford
Expert in gene editing and functional genomics
Founder Haplogen GmbH
Dr. Eric Rhodes Horizon CTO
Nuclease Gene Editing VP at Sangamo Bioscience
for IPO on NASDAQ
Dr. Jon Moore Horizon CSO
Gene editing and Oncology Expert, former
Head of Biology at Vernalis plc
19
Board and key management
Dr Paul R Morrill President Products
Dr Ed Weinstein President Services
Mr Jeb Ledell COO
Dr Darrin M Disley CEO *
* Board member
SIGNIFICANT EXPERIENCE IN • Building sustainable international businesses
in biotech, diagnostics and pharma • Private and public companies in UK and US • Successful M&A transactions
Dr Vishal Gulati Non-Exec Director*
Independent
Mrs Susan Searle Non-Exec Director*
Ex CEO Innovations Plc
Dr Susan Galbraith Non-Exec Director* SVP AstraZeneca Plc
Mr. Grahame Cook Non-Executive Director*
Mr Richard Vellacott CFO*
Dr Ian Gilham Non-Exec Chairman* Ex CEO Axis Shield Plc
Dr Jonathan Milner Non-Exec Director* ex- CEO Abcam Plc
INDUSTRY ACADEMIA
FY15 customers: Over 1,400 unique organisations in more than 50 countries
19
21
Income statement
Strong product growth, scale of services, research bio upside
RESULT IN LINE • Margin maintained at 49% as expected • Investing for growth • Investment in FY16 to drive future scale
Milestones
Services
Products
• EBITDA margin remains at 33% • Full year effect of acquisitions • Operational scale up in line with strategy • 2 year £10m investment in Research Bio
INVESTMENT FOR SCALE
STRONG REVENUE GROWTH
+124%
+69%
+32%
FY15 FY14 FY13
£'000 £'000 £'000
Audited Audited Audited
Revenue 20,156 11,905 6,646
Cost of Sales (10,192) (5,351) (3,208)
Gross Profit 9,964 6,554 3,438
Sales and marketing (5,078) (2,671) (2,195)
Research and development (5,296) (2,158) (1,266)
Other operating income 806 615 404
Corporate (7,367) (5,502) (2,391)
Exceptional Items 391 (801) 0
EBITDA (6,580) (3,963) (2,010)
Depreciation and amortisation (3,708) (2,147) (920)
Operating Loss (10,288) (6,110) (2,929)
Investment income (256) 37 (114)
Loss Before Tax (10,544) (6,073) (3,043)
Tax 661 149 73
Loss for the year (9,883) (5,924) (2,970)
Loss per share (pence) (11.20) (9.20) (7.50)
22
Cash flow Capital efficient model with funds raised invested in M&A, IP and operations to drive scale
INVESTMENT IN M&A AND SCALABLE INFRASTRUCTURE
• £3m of cash consideration for Haplogen
• £3.9m investment in IP and capex
STRONG CASH POSITION
Fundraise £25m
0
5,000
10,000
15,000
20,000
25,000
30,000
2012 2013 2014 2015
Cash £'000
FY15 FY14 FY13
£'000 £'000 £'000
Audited Audited Audited
Operating activities (10,953) (6,473) (2,222)
Acquisitions (2,946) (8,853) -
Intangibles (1,212) (6,255) (134)
Property, plant and equipment (2,688) (1,842) (897)
Interest 70 46 12
Investing activities (6,776) (16,904) (1,019)
Financing activities 24,328 37,643 3,738
Forex 15 0 0
Cash flow 6,614 14,266 497
Cash b/f 18,453 4,187 3,691
Cash c/f 25,067 18,453 4,187
23
Balance sheet Robust balance sheet remains strong through capital raising and investment
FY15 FY14 FY13
£'000 £'000 £'000
Unaudited Audited Audited
Goodwill 30,778 22,821 48
Intangibles 13,619 10,094 514
Other non-current assets 7,962 7,014 3,569
Non-Current Assets 52,359 39,929 4,131
Inventories 1,793 1,307 453
Trade and other receivables 9,652 6,046 2,107
Cash and cash equivalents 25,067 18,453 4,187
Current Assets 36,512 25,806 6,748
Current Liabilities (6,779) (5,870) (2,748)
Net Current Assets 29,733 19,936 4,000
Non-Current Liabilities (2,235) (1,296) (271)
Net Assets 79,857 58,569 7,860
Equity 79,857 58,569 7,860
ACQUISITIONS AND IP
• Haplogen goodwill of £6.5m • Haplogen intangibles of £3.7m • Intangibles of £13.7m includes portfolio of IP
LEAN WORKING CAPITAL MODEL
• >23,000 products in catalogue (FY14 c. 2,750)
• Inventory remains lean
• Net working capital of £4.7m
EXPANSION CAPITAL
• £25m funds to drive further scale