The Human Genome Project

Watson and Crick, May 1953Watson and Crick, May 1953

Human Genome Project

The Human Genome Project (HGP) is a

genetic project designed to help us

push through the field of genetics to more

understand the how our bodies function

genetically

History• Begun in 1990, the U.S.

Human Genome Project was a 13-year effort coordinated by the U.S. Department of Energy and the National Institutes of Health.

• The project originally was planned to last 15 years, but rapid technological advances accelerated the completion date to 2003

Goals • identify all the approximately 20,000-25,000

genes in human DNA • determine the sequences of the 3 billion chemical

base pairs that make up human DNA• store this information in databases • improve tools for data analysis• transfer related technologies to the

private sector• address the ethical, legal, and social

issues (ELSI) that may arise from the project

US HUMAN GENOME PROJECT

How does the human genome stack up?

Organism Genome Size (Bases) Estimated Genes

Human (Homo sapiens) 3 billion 30,000

Laboratory mouse (M. musculus) 2.6 billion 30,000

Mustard weed (A. thaliana) 100 million 25,000

Roundworm (C. elegans) 97 million 19,000

Fruit fly (D. melanogaster) 137 million 13,000

Yeast (S. cerevisiae) 12.1 million 6,000

Bacterium (E. coli) 4.6 million 3,200

Human immunodeficiency virus (HIV) 9700 9

An Individual’s Genome Differs from the DNA of:

• Siblings by 1 to 2 million bases, ~99.98% identical, with coding regions 99.99999% identical

• Unrelated humans by 6 million bases, ~99.8% identical overall, with coding regions 99.9999% identical

• Chimpanzees by about 100 million base pairs ~98% identical• Baboons by about 300 million base pairs ~92% identical• Mice by about 2.8 billion bases, but coding regions are ~90%

identical• Leaf spinach by about 2.9 billion bases, but coding regions

are ~40% identical

Human Chromosome No.3

• A summary map

Human Chromosome No.3

Human gene maps and mapping of human inherited diseases

• The genetic maps initially involved the production of fairly low-level resolution index, skeleton or framework maps, which were based on polymorphic variable number di-,tri- and tetranucleotide tandem repeats spaced approximately 10cM intervals throughout the genome. The most recent high-level resolution maps have polymorphic markers that are, on average, spaced at intervals of less than 1 cM.

• The mapping information from these genetic maps has been integrated with high-resolution physical maps.

• The information for the latter maps comes from a variety of sources using a number of different technologies that include FISH, somatic cell and radiation hybrids, and YAC or cosmid contigs.

Concerns

• Availabilty – Employers using

genetic information to discriminate over whom they will hire or when current employees will be laid off or forced into retirement

– 80-90% Americans believe their genetic information should be private & obtained or accessed only with their permission

• Rush to Patent Human Genes– the National

Institutes of Health, has made all its information freely available and intends to patent nothing.

– However, there are several patent requests pending on human genes from the time before the HGP was completed.

Medical Benefits

• There are many benefits with the Human Genome Project

• Disease Interventionexploration into the function of each human gene will shed light on how faulty genes play a role in disease causation. With this knowledge we can start developing medicines to help prevent the defect.

Diagnosing and Predicting Disease and Disease Susceptibility

• the successes of the HGP have even enabled researchers to pinpoint errors in genes the smallest units of heredity that cause or contribute to disease.

• The ultimate goal is to use this information to develop new ways to treat, cure, or even prevent the thousands of diseases that afflict humankind

Changes occur in DNA sequences = mutations

SNPs• A mutation that causes a single base change is known as a Single Nucleotide Polymorphism (SNP)

• Other kinds of mutations include insertions and deletions

• Large breaks and rearrangement of chromosomes also occur (translocations)

GATTTAGATCGCGATAGAGGATTTAGATCTCGATAGAG

^

We describe a map of 1.42 million single nucleotide polymorphisms (SNPs) distributed throughout the human genome, providing an average density on available sequence of one SNP every 1.9 kilobases. These SNPs were primarily discovered by two projects: The SNP Consortium and the analysis of clone overlaps by the International Human Genome Sequencing Consortium. The map integrates all publicly available SNPs with described genes and other genomic features. We estimate that 60,000 SNPs fall within exon (coding and untranslated regions), and 85% of exons are within 5 kb of the nearest SNP. Nucleotide diversity varies greatly across the genome, in a manner broadly consistent with a standard population genetic model of human history. This high-density SNP map provides a public resource for defining haplotype variation across the genome, and should help to identify biomedically important genes for diagnosis and therapy.

Ethical & Legal Issues

• There are a lot of issues that come up when talking about the Human Genome Project and when figuring ways how to use it.

• Many people of our society are concerned about how this will affect people around us and if it could cause a new idea for gene racism

• Also there could be fighting over the use of a particular part of a gene and how it can or cannot be used.

• Who should have access to personal genetic information, and how will it be used?

• How do we prepare the public to make informed choices?

• Where is the line between medical treatment and enhancement?

• How does personal genetic information affect an individual and society's perceptions of that individual?

Then• Just a half-century ago very little was

known about the genetic factors that contribute to human disease.

• The Human Genome project spurred a revolution in biotechnology innovation around the world and played a key role in making the U.S. the global leader in the new biotechnology sector.

Now• The Human Genome Project has already fueled the

discovery of more than 1,800 disease genes. • As a result of the Human Genome Project, today’s

researchers can find a gene suspected of causing an inherited disease in a matter of days, rather than the years it took before the genome sequence was in hand.

• There are now more than 1,000 genetic tests for human conditions. These tests enable patients to learn their genetic risks for disease and also help healthcare professionals diagnose disease.

• At least 350 biotechnology-based products resulting from the Human Genome Project are currently in clinical trials.

• Having the complete sequence of the human genome is similar to having all the pages of a manual needed to make the human body. The challenge now is to determine how to read the contents of these pages and understand how all of these many, complex parts work together in human health and disease.

• The increasing ability to connect DNA variation with non-medical conditions, such as intelligence and personality traits, will challenge society, making the role of ethical, legal and social implications research more important than ever.