Proc. Natl. Acad. Sci. USAVol. 84, pp. 6845-6849, October 1987Immunology

Human immunodeficiency virus long terminal repeat responds toT-cell activation signals

(acquired inmunodeficiency syndrome/trans-activator)

SANDRA E. TONG-STARKSEN*, PAUL A. Luciwt, AND B. MATIJA PETERLIN**Howard Hughes Medical Institute, Departments of Medicine and of Microbiology and Immunology, University of California, San Francisco, CA 94143; andtDepartment of Medical Pathology, University of California, Davis, CA 95616

Communicated by Frank Lilly, June 1, 1987 (received for review April 17, 1987)

ABSTRACT Human immunodeficiency virus (HIV), thecausative agent of AIDS, infects and kills lymphoid cellsbearing the CD4 antigen. In an infected cell, a number ofcellular as well as HIV-encoded gene products determine thelevels of viral gene expression and HIV replication. EfficientHIV-replication occurs in activated T cells. Utilizing transientexpression assays, we show that gene expression directed by theHIV long terminal repeat (LTR) increases in response to T-cellactivation signals. The effects of T-cell activation and of theHIV-encoded trans-activator (TAT) are multiplicative. Anal-ysis of mutations and deletions in the HIV LTR reveals that theregion responding to T-cell activation signals is located atpositions -105 to -80. These sequences are composed of twodirect repeats, which are homologous to the core transcrip-tional enhancer elements in the simian virus 40 genome. Ourstudies reveal that these elements function as the HIV enhanc-er. By acting directly on the HIV LTR, T-cell activation mayplay an important role in HIV gene expression and in theactivation of latent HIV.

A lymphocytopathic retrovirus, designated human immunode-ficiency virus (HIV), has been shown to be the cause ofacquired immunodeficiency syndrome (AIDS) in humans (1-4).The CD4 antigen found on the surface of T-helper/inducerlymphoid and monocyte/macrophage cells is, at least in part,the receptor for HIV (5-8). In human T cells derived fromperipheral blood lymphocytes, efficient binding ofHIV and theearly phase of viral infection do not require activation ofT cells(9, 10). However, the extent of viral replication is directlyrelated to the state of T-cell activation (9, 10). Stimulation ofinfected Jurkat cells, a human T-cell line, with phytohemag-glutinin (PHA) increases HIV production (11). Similarly, HIVreplication increases 4-fold in a chronically infected humanT-cell line (Molt4) after stimulation with phorbol ester (12).Thus, intracellular events in activated T cells regulate theproduction ofHIV. In addition to cellularfactors, HIV-encodedfactors such as the trans-activator (TAT) and anti-repressiontrans-activator or trans-acting regulator of splicing (ART/TRS)also affect viral gene expression (13-17). An understanding ofthe molecular mechanisms relating T-cell activation to viralgene expression may provide insight into the elements thatconvert a latent HIV infection into active viral replication,which results in the loss of T-helper/inducer cells and in theappearance of clinical AIDS.To analyze the effects of T-cell activation on specific

events in HIV gene expression, we chose the Jurkat cell line(18). These human T cells are permissive for HIV infection(11, 19). They can be activated by a variety of signals toproduce interleukin-2 (IL-2), IL-2 receptor, and interferon y

(IFN-y) (20). Finally, they can be efficiently transfected withplasmid DNA. Recently, Jurkat cells have been used toanalyze sequences in the IL-2 promoter that respond to T-cellactivation signals (21, 22). In our study, Jurkat cells wereused to analyze the effects ofT-cell activation signals on geneexpression directed by the HIV long terminal repeat (LTR).

MATERIALS AND METHODSPlasmid Constructions. Plasmid constructions containing

the HIV LTR positioned upstream from the bacterial chlor-amphenicol acetyltransferase (CAT) reporter gene, designat-ed TAR-1, and those containing the HIV TAT, designatedTAT-1, have been described (23). To determine the speci-ficity of T-cell activation, the following promoters andenhancers positioned upstream from the CAT gene weretested: Rous sarcoma virus LTR (pRSVCAT) (24), herpessimplex virus (HSV) thymidine kinase (TK) promoter(ptkCAT) (25), and human T-lymphotropic virus I LTR-(pHTLV-I-LTR-CAT) (26-28).p(-156/+185)CAT is a plasmid derived from TAR-1 and

contains only the sequences between positions -156 and+185 ofthe HIV LTR upstream from the CAT gene. Plasmidsof the p(M) series are derived from TAR-1. Double-strandedoligonucleotides with altered sequences as shown in Fig. 1Cwere synthesized on a Pharmacia gene assembler. Construc-tion of p(M+4/+9)CAT and p(M+14/+18)CAT involveddigestion of TAR-1 with Pvu II (which cleaves at position-17) and Bgl II (position +19) and replacement of thewild-type sequence with the appropriate synthetic oligonu-cleotides. To produce p(M+39/+43)CAT and p(M+45/+49)-CAT, the region between the Sac I site (+38) and the HindIIIsite (+80) was replaced with the appropriate synthetic oli-gonucleotides. p(-451/-156)tkCAT is a plasmid containingthe portion of the HIV LTR between positions -454 and-156 inserted upstream from the HSV TK promoter and theCAT gene. pABtkCAT consists of a double-stranded oligo-nucleotide covering the region of the HIV LTR betweenpositions -105 and -80 (Fig. 1C, shown as regions A and B)inserted in the same transcriptional orientation relative to theHSV TK promoter; in pBAtkCAT, the oligonucleotide is inthe opposite orientation.

Transient Transfection Assays. For assays, 1.5 x 107 Jurkatcells were transfected in a total volume of 2 ml by aDEAE-dextran method (23, 29). In single transfections, 5 ,ugof the indicated plasmid and S ,ug of pUC18 were used. In

Abbreviations: HIV, human immunodeficiency virus; LTR, longterminal repeat; AIDS, acquired immunodeficiency syndrome; TAT,trans-activator; PHA, phytohemagglutinin; IL-2, interleukin-2; IFN-y, interferon-y; TAR, trans-acting responsive element; CAT, chlor-amphenicol acetyltransferase; TK, thymidine kinase; HSV, herpessimplex virus; PMA, phorbol 12-myristate 13-acetate; NRE, nega-tive regulatory element; SV40, simian virus 40; Cm, chloramphen-icol; AcCm, monoacetylated chloramphenicol.

6845

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

May

21,

202

1

6846 Immunology: Tong-Starksen et al.

cotransfections, 5 ug of each test plasmid was used. Trans-fected cells were incubated for 48 hr at 370C and then dividedinto two equal portions. One portion served as resting Jurkatcells. The other portion was treated with PHA (final concen-tration, 1 ,ug/ml) and phorbol 12-myristate 13-acetate (PMA;final concentration, 50 ng/ml) (20). Eight hours after additionof PHA and PMA, cells were harvested and lysed.To determine the time course of viral gene induction, an

aliquot of cells was removed from both the resting and activatedJurkat cell cultures at 1, 2, 3, 4, 8, 12, and 16 hr after additionof PHA and PMA. Cells were harvested for CAT assays.CAT assays were performed in a final volume of 200 tl

containing 0.1 ILCi (3.7 kBq) of [14C]chloramphenicol, 4 mMacetyl-coenzyme A, and 0.25 M Tris HCl (pH 7.4), with the

A

1 2 3 4 5 6+ + +

" Is.I!10

16 16 16 16TAR-1 TAR-1

TAT-1

1 1TAR-1TAT-1

appropriate amount of cell lysate (24). Reaction mixtureswere incubated at 370C for 16 hr or for the times indicated.Results are given in percent conversion of chloramphenicol(Cm) to its monoacetylated forms (AcCm). CAT enzymaticactivity was linear within each assay. Values were normal.ized to 10 ,ug of protein in cell lysates and were the mean ofthree independent transfections.

Determination of Jurkat (T-Ceil) Activation. Culture super-natants from the cells used for determining the time course ofviral gene induction were used for IL-2 assays. IL-2 activitywas detected by using triplicate cultures of CTLL cells (30).

Eight hours after addition of PHA and PMA, Jurkat cellswere stained with anti-Tac monoclonal antibodies followedby fluorescein isothiocyanate (FITC)-conjugated goat anti-

B 1 2 3 4 5 6- + + +

q~. AcCm

,ft tt Cm

16 16 16 16 16 16 Time (hr)pRSVCAT ptkCAT pHTLV-l

LTR-CAT

CCTGG -451

-450 AAGGGCTAATTTGGTCCCAAAGAAGACAAGAGATCCTTGATCTGTGGATCTACCACACAC -391-390 AAGGCTACTTCCCTGATTGGCAGAATTACACACCAGGGCCAGGGATCAGATATCCACTGA -331

x-330 CCTTTGGATGGTGCTTCAAGCTAGTACCAGTTGAGCCAGAGAAGGTAGAAGAGGCCAATG -271

-270 AAGGAGAGAACAACAGCTTGTTACACCCTATGAGCCTGCATGGGATGGAGGACGCGGAGA -211Ava I (-156)

-210 AAGAAGTGTTAGTGTGGAGGTTTGACAGCAAACTAGCATTTCATCACATGGCCCGAGAGC -151Y A

-150 TGCATCCGGAGTACTACAAAGACTGCTGACATCGAGCTTTCTACAAGGGACTTTCCGCTG -91B III II I

-90 GGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGTCCCTCAGATGCTG -31

-1 +1 M+4/+9 M+14/+18-30 CATATAAGCAGCTGCTTTTTGCCTGTACTG GGTWCTCTCT GTT[GACCAGATCTGAGCCT +30

M+39/+43 M+45/49 TCGCG+31 GGGAGCTCTCTGGCITAACTIAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAG +90- I~~GAGTTI IGCTGI

+91 TGCTTCAAGTAG,TGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGAC +150+151 CCTTTTAGTCAGTGTGGAAAAATCTCTAGCAG

+182

FIG. 1. (A and B) CAT gene expression in resting and activated Jurkat cells. Nonacetylated [14C]chloramphenicol (Cm) and monoacetylatedforms (AcCm) are shown after TLC. The - and + signs over the autoradiographs denote transfections into resting and activated Jurkat cells,respectively. (A) Effects ofTAT on CAT gene expression directed by the HIV LTR in resting and activated Jurkat cells. TAR-1 consists of theHIV LTR (-454 to +185) upstream from the CAT gene (lanes 1 through 6) (32). TAT-1 is a plasmid containing the synthetic HIV-SF2 TATgene (300 base pairs) positioned between the simian virus 40 (SV40) early promoter and polyadenylylation sites (lanes 3-6) (23). (B) CAT geneexpression directed by various promoters in resting and activated Jurkat cells. Rous sarcoma virus LTR (pRSVCAT) is shown in lanes 1 and2 (24). HSV TK promoter (ptkCAT) is shown in lanes 2 and 3 (25). Human T-lymphotropic virus I LTR (pHTLV-I-LTR-CAT) is shown in lanes5 and 6 (26-28). (C) HIV LTR sequence, showing regulatory regions and mutations (32). p(M+4/+9)CAT, p(M+14/+18)CAT,p(M+39/+43)CAT, and p(M+45/+49)CAT denote sites of base substitution mutations in TAR-1; the mutant sequences are shown below thewild-type sequences in each box. Regulatory regions and regions ofhomology are shown as follows: I-III, three binding sites for the transcriptionfactor Spl (33); A and B, core transcriptional enhancer elements (34); X, region homologous to IL-2 distal and proximal control elements (21);Y, region homologous to 5' flanking sequences of IFN--y (21).

Proc. Natl. Acad Sci. USA 84 (1987)

Dow

nloa

ded

by g

uest

on

May

21,

202

1

Proc. Natl. Acad. Sci. USA 84 (1987) 6847

Table 1. Effects of T-cell activation on HIV LTR-directedgene expression

Cm conversion,* %CAT

reaction Fold

Plasmid Control PHA/PMA time, hr activation

ptkCAT 0.11 0.13 16 1.2pRSVCAT 5.7 4.3 16 0.75pHTLV-I-LTR-CAT 0.19 0.27 16 1.4TAR-1 0.79 3.9 16 4.9TAR-1 + TAT-1 14.0 79 1 5.6CAT enzymatic activities were measured in resting and PHA/

PMA-activated Jurkat cells. Results of transfections with variouspromoters directing CAT gene expression are shown. CAT reactionmixtures were incubated for the time indicated for each plasmidconstruction.*Standard errors in this and all subsequent tables are less than 35%of the mean with the exception of values less than 1% Cmconversion. The latter probably overestimate the actual CATactivity because they are near the background counts of the silicaplates.

serum to mouse IgG (31). The indirect immunofluorescentstaining of the IL-2 receptor was measured by fluorescence-activated cell sorter analysis.

RESULTST-Cell Activation Increases HIV LTR-Directed Gene

Expression and Is Multiplicative with the Effect of TAT.Transfections with TAR-1 result in low but detectable CATactivities (Fig. 1A, Table 1). Transfecting TAR-i into Jurkatcells that were subsequently activated with PHA and PMAresults in CAT activities increased 5-fold above those seen inunactivated Jurkat cells transfected in parallel (Fig. iA, Table1). Similar increases in CAT activity in comparisons betweenactivated and resting cells are not seen with ptkCAT,pRSVCAT, or pHTLV-I-LTR-CAT (Fig. 1B, Table 1). TheCAT activity is increased 155-fold in experiments in whichTAR-1 and TAT-1 were cotransfected into unstimulatedJurkat cells (Fig. iA, Table 2). TAR-1 and TAT-1 cotrans-fections into activated as compared with resting Jurkat cellsresult in 5-fold increased CAT activities (Fig. 1, Table 1).When the effects ofTAT and T-cell activation are combined,gene expression directed by the HIV LTR increases 880-foldover the basal level seen in resting Jurkat cells, which do notexpress TAT (Table 2). Thus, the effects of TAT and T-cellactivation on the HIV LTR are multiplicative.The Kinetics of Viral Gene Induction Parallels That of IL-2

Production. To determine the time course of viral geneinduction, we measured CAT activity directed by the HIVLTR from 1 to 16 hr after the treatment of Jurkat cells withPHA and PMA (Table 3). At 8 hr after addition ofPHA andPMA, we note the maximal appearance of IL-2 (Table 4),IL-2 receptor (Fig. 2), and HIV LTR-directed CAT activity(Table 3). In transient expression assays, others have found

Table 2. Effects of T-cell activation and viral TAT on HIVLTR-directed gene expression are multiplicative

T-cell Cm conversion, FoldPlasmid stimulus % activation

TAR-1 None 0.09 1.0TAR-1 PHA/PMA 0.45 5.0TAR-1 + TAT-1 None 14.0 155TAR-1 + TAT-1 PHA/PMA 79 880

CAT enzymatic activities for TAR-1 transfections were derived

Table 3. Time course of induction of HIV LTR-directed geneexpression after T-cell activation

Time, Cm conversion, % Foldhr Control PHA/PMA activation

1 0.17 0.20 1.22 0.20 0.37 1.83 0.14 0.45 3.24 0.32 1.31 4.18 0.30 2.1 7.0

12 0.31 1.76 5.716 0.21 1.00 4.8

CAT reaction mixtures were incubated for 16 hr.

that CAT activity directed by the IL-2 promoter also peakswith similar kinetics (21, 22).Core Transcriptional Enhancer Elements in the HIV LTR

Are Sufficient for Response to T-Cell Activation Signals. Tolocalize the HIV LTR sequences that respond to T-cellactivation signals, several additional plasmids containingportions ofthe HIV LTR were constructed. A DNA fragmentencompassing positions -454 to -156 in the HIV LTR waspositioned immediately upstream of the HSV TK promoterand the CAT gene to produce p(-454/-156)tkCAT. Thesequences from -340 to -185 have been described as anegative regulatory element (NRE) (35) in the basal expres-sion ofTAR-1; a short stretch within the U3 region ofthe HIVLTR also has homology to the upstream promoter elementsof the IL-2 gene (Fig. 1C) (34). The results in Table 5 showthat T-cell activation signals do not involve sequences be-tween -454 and -156. These results suggest that the se-quences responding to T-cell activation signals lie down-stream from position -156.

In p(-156/+185)CAT, the portion of the HIV LTR from-156 to + 185 is located immediately upstream from the CATgene. Expression of CAT is stimulated in activated T cellstransfected with p(-156/+185)CAT (Table 5). Several cis-acting regulatory elements involved in HIV gene expressionare present in the region of the HIV LTR downstream frompositions -156. The enhancer for HIV has been reported toreside between positions -135 to -17 (35). There are twodirect repeats 10 base pairs in length at positions -105 to -80that have homology to the SV40 core transcriptional enhanc-er element (29). To further localize the enhancer element inthe HIV LTR and to determine whether or not it is requiredfor T-cell activation, we cloned both orientations of asynthetic oligonucleotide representing positions -105 to -80immediately upstream from the HSV TK promoter, whichlacks an endogenous enhancer. The resulting plasmids,pABtkCAT and pBAtkCAT, contain the sense and antisenseorientations of the candidate HIV enhancer, respectively.Both of these plasmids direct CAT expression 3- to 5-foldover that measured for ptkCAT (Table 5). These resultsestablish that the region in the HIV LTR from positions - 105to -80 has properties consistent with a transcriptionalenhancer element. Activation of T cells increases CATexpression 7- to 14-fold when cells transfected with pAB-

Table 4. IL-2 activity in supernatants of activated Jurkat cells

IL-2 activity, Rate, units/ml perTime, hr units/ml hr in preceding 4 hr

4 5 1.28 20 3.8

12 26 1.516 30 1.0

Supernatants from unstimulated cells yielded no detectable IL-2activity (data not shown). The values shown represent the averagesof three independent experiments.

from data obtained from 4-hr reactions. CAT activities for TAR-1 +TAT-1 cotransfections were obtained from 1-hr reactions. Valuesshown are normalized for 1 hr.

Immunology: Tong-Starksen et al.

Dow

nloa

ded

by g

uest

on

May

21,

202

1

6848 Immunology: Tong-Starksen et al.

1500

E

C-cD

Mean fluorescence intensity

FIG. 2. Indirect immunofluorescent staining and fluorescence-activated cell sorter analysis of IL-2 receptors on Jurkat cells. Thesolid line represents staining of resting Jurkat cells; the dotted linerepresents staining of activated Jurkat cells. For activation, Jurkatcells were incubated at 37°C with PHA (1 ,g/ml) and PMA (50 ng/ml)for 8 hr.

tkCAT and pBAtkCAT are compared to resting T cellstransfected in parallel (Table 5). These results show that theregion -105 to -80 in the HIV LTR is sufficient forresponding to T-cell activation signals.TAR Sequences Essential for TAT Trans-Activation Are Not

Required for Response to T-Cell Activation Signals. To determineif sequences in TAR (positions -17 to +80) play a role in T-cellactivation, we tested four substitution mutants in TAR[p(M+4/+9)CAT, p(M+14/+18)CAT, p(M+39/+43)CAT,and p(M+45/+49)CAT; see Fig. 1C]. Some of these cannot betrans-activated by TAT. We observed that in all four TARsubstitution mutants, T-cell activation leads to increased CATactivity (Table 5). Thus, these data show that T-cell activationsignals act on the HIV enhancer and not on other regulatoryelements such as Spl sites, TAR, or the NRE.

DISCUSSIONActivation of HIV-infected peripheral blood lymphocytes isrequired for high-level viral replication (36). The target DNAsequences of T-cell activation signals are located in the HIVLTR. We demonstrated that T-cell activation increases HIVLTR-directed gene expression. We have also shown that thetrans-activating effects ofTAT and of T-cell activation on the

HIV LTR are multiplicative; sequences in the HIV LTR thatare essential for trans-activation by TAT are not required forthe T-cell activation response. In Jurkat cells, the TAT geneproduct trans-activates the HIV LTR over 100-fold, whichextends our previous observations on TAT trans-activationin human T-lymphoid tumor (HUT-78) and carcinoma(HeLa) cells, as well as in Syrian hamster cells (HIT) (23).Our data show that the two tandemly repeated core

transcriptional enhancer elements that make up the HIVenhancer are sufficient for the response to T-cell activationsignals. The upstream promoter elements-i.e., the three Splsites and a "TATA box," as well as the 5' NRE and the IL-2and IFN-y homology regions, do not respond to T-cellactivation signals. The significance of the homologous re-gions remains to be determined; however, this 5' region didnot behave as a NRE (35).

Since the effects of T-cell activation and trans-activationare multiplicative, they are expected to be mediated bydifferent mechanisms. T-cell activation may result in a directtranscriptional effect. This is supported by the observationthat treatment with phorbol esters results in increased ratesof transcriptional initiation from promoters containing theSV40 core transcriptional enhancer elements (37). Trans-activation by TAT, which results in increased steady-statelevels of mRNA, may be mediated by post-transcriptionalmechanisms (unpublished results). A model proposing twodifferent pathways ofHIV gene regulation is more consistentwith multiplicative rather than additive effects observed forT-cell activation and trans-activation by TAT.

T-cell activation results from presentation of antigen in thecontext of self major histocompatibility determinants (MHC)or from administration of lectins (PHA, concanavalin A),calcium ionophores (ionomycin), or anti-CD3 and anti-clonotypic antibodies concomitantly with PMA (20). Thesestimuli lead to expression of previously silent cellular genesas well as to cell growth and proliferation (20). T-cellactivation can be blocked by administration of cyclosporin Aand the protein synthesis inhibitor cycloheximide (38, 39). Atpresent, we do not know whether protein synthesis isrequired for HIV LTR gene activation and whether theadministration of cyclosporin A can block this activation.However, we have preliminary evidence that T-cell growthand proliferation influence viral gene expression. The effectsof T-cell activation on the HIV LTR were dramaticallyincreased in Jurkat cells grown in medium containing 0.5%

Table 5. Localization of the CIS-acting elements in the HIV LTR that respond to T-cellactivation signals

Cm conversion, % CAT reaction Fold

Plasmid Control PHA/PMA time, hr activation

p(-451/-156)tkCAT 0.52 0.45 16 0.87p(-156/+185)CAT 0.33 1.6 16 4.8p(-156/+185)CAT + TAT-1 6.0 55 4 9.2pABtkCAT 0.49 6.6 16 14pBAtkCAT 0.43 2.8 16 6.6p(M+4/+9)CAT 0.15 0.45 16 3.0p(M+4/+9)CAT + TAT-1 4.5 47 4 10p(M+14/+18)CAT 0.12 0.40 16 3.3p(M+14/+18)CAT + TAT-1 0.48 3.2 16 6.7p(M+39/+43)CAT 0.075 0.29 16 3.9p(M+39/+43)CAT + TAT-1 0.28 1.05 16 3.8p(M+45/+49)CAT 0.27 1.1 16 4.1p(M+45/+49)CAT + TAT-1 3.4 43 4 13

Results are shown of transfections of plasmid constructions containing deletion or substitutionmutations in the HIV LTR and of plasmid constructions containing portions of the HIV LTR upstreamfrom a heterologous promoter. p(M+4/+9)CAT and p(M+45/+49)CAT are trans-activated by TAT toa similar extent as TAR-1, whereas p(M+14/+18)CAT and p(M+39/+43)CAT show very littletrans-activation by TAT. CAT reaction mixtures were incubated for the time indicated for each plasmidconstruction.

Proc. Natl. Acad. Sci. USA 84 (1987)

Dow

nloa

ded

by g

uest

on

May

21,

202

1

Proc. Natl. Acad. Sci. USA 84 (1987) 6849

instead of 10% fetal calf serum. Such serum-starved Jurkatcells stop dividing and may mimic nondividing resting pe-ripheral blood T cells. When transfected Jurkat cells wereserum starved for 24 hr, and then treated with serum, PHA,and PMA for 8 hr, up to 50-fold induction of CAT activitydirected by the HIV LTR was seen (data not shown). Theindividual contributions to regulation of HIV LTR-directedgene expression by serum, PHA, and PMA, as well as otherT-cell agonists and mitogens, require further investigation.

T-cell activation may be significant with respect to theonset of clinical AIDS. In an individual infected with HIV,AIDS pathogenesis appears to be a stepwise process (36, 40).After exposure to HIV, the symptoms of AIDS-relatedcomplex (ARC) may ensue. This illness can subside and anasymptomatic phase lasting months to years may follow. Onthe cellular level, it appears that HIV establishes a latentinfection in T cells, monocytes, macrophages, and perhapsother cell types (36, 40). It has been proposed that agents thatstimulate the immune system such as infection with anothervirus (e.g., cytomegalovirus) can function to stimulate HIVreplication and, consequently, lead to the development ofAIDS (41). Here we present data to support the notion thatT-cell activation by itself increases gene expression directedby the HIV LTR. Others have shown that T-cell activationincreases viral replication (9, 10). Viral replication is furtherescalated by viral TATs and, consequently, CD4' lymphoidcells are killed. The affected individual, now immuno-compromised by loss of T-helper/inducer cells, is prone tofatal opportunistic infections and, in some cases, neoplasia.Therapies directed at blocking T-cell activation at appropri-ate times may prevent viral gene expression and thus prolongthe state of viral latency. Such therapeutic approaches areexpected to modulate the clinical expression of AIDS.

Note. After submission of this manuscript, a report by Nabel andBaltimore (42) appeared that reached similar general conclusions.

We thank Irvin S. Y. Chen for the pHTLV-I-LTR-CAT plasmid,Art Weiss and Michael D. Walker for helpful discussions, andMichael Armanini for expert secretarial assistance as well as prep-aration of this manuscript. We gratefully appreciate the contributionsof Karen Shaw in cloning and oligonucleotide synthesis. This workwas supported in part by grants from the California UniversitywideTaskforce on AIDS to P.A.L. and B.M.P.

1. Barre-Sinoussi, F., Chermann, J. C., Rey, F., Nugeyre,M. T., Chamaret, S., Gruest, J., Dauguet, C., Axler-Blin, C.,Vezinet-Brun, F., Rouzioux, C., Rozenbaum, W. &Montagnier, L. (1983) Science 220, 868-871.

2. Gallo, R. C., Salahuddin, S. Z., Popovic, M., Shearer, G. M.,Kaplan, M., Haynes, B. F., Palker, T. J., Redfield, R.,Oleske, J., Safai, B., White, G., Foster, R. & Markham, P. D.(1984) Science 224, 500-503.

3. Levy, J. A., Hoffman, A. D., Kramer, S. M., Landis, J. A.,Shimabukuro, J. M. & Oshiro, L. S. (1984) Science 225,840-842.

4. Wong-Staal, F. & Gallo, R. C. (1985) Nature (London) 317,395-403.

5. Dalgleish, A. G., Beverly, P. C. L., Clapham, P. R., Craw-ford, D. H., Greaves, M. F. & Weiss, R. A. (1984) Nature(London) 312, 763-767.

6. Klatzman, D., Champagne, E., Chamaret, S., Gruest, J.,Guetard, D., Hercend, T., Gluckman, J.-C. & Montagnier, L.(1984) Nature (London) 312, 767-768.

7. McDougal, J. S., Kennedy, M. S., Sligh, J. M., Cort, S. P.,Mawle, A. & Nicholson, J. K. A. (1986) Science 231, 382-385.

8. Maddon, P. J., Dalgleish, A. G., McDougal, J. S., Clapham,P. R., Weiss, R. A. & Axel, R. (1986) Cell 47, 333-348.

9. McDougal, J. S., Mawle, A., Cort, S. P., Nicholson, J. K. A.,Cross, G. D., Scheppler-Campbell, J. A., Hicks, D. & Sligh, J.

(1985) J. Immunol. 135, 3151-3162.10. Folks, T., Kelly, J., Benn, S., Kinter, A., Justement, J., Gold,

J., Redfield, R., Sell, K. W. & Fauci, A. S. (1986) J. Immunol.136, 4049-4053.

11. Zagury, D., Bernard, J., Leonard, R., Cheynier, R., Feldman,M., Sarin, P. S. & Gallo, R. C. (1986) Science 231, 850-853.

12. Harada, S., Koyanagi, Y., Nakashima, H., Kobayashi, N. &Yamamoto, N. (1986) Virology 154, 249-258.

13. Arya, S. K., Guo, C., Josephs, S. F. & Wong-Staal, F. (1985)Science 229, 69-73.

14. Sodroski, J., Patarca, R., Rosen, C., Wong-Staal, F. &Haseltine, W. (1985) Science 229, 74-77.

15. Chen, I. S. Y. (1986) Cell 47, 1-2.16. Rosen, C. A., Sodroski, J. G., Goh, W. C., Dayton, A. I.,

Lippe, J. & Haseltine, W. A. (1986) Nature (London) 319,555-559.

17. Feinberg, M. B., Jarrett, R. F., Aldovini, A., Gallo, R. C. &Wong-Staal, F. (1986) Cell 46, 807-817.

18. Schneider, U., Schwenk, H. U. & Bornkamm, G. (1977) Int. J.Cancer 19, 621-626.

19. Lifson, J. D., Reyes, G. R., McGrath, M. S., Stein, B. S. &Engleman, E. G. (1986) Science 232, 1123-1127.

20. Weiss, A., Imboden, J., Hardy, K., Manger, B., Terhorst, C.& Stobo, J. (1986) Annu. Rev. Immunol. 4, 593-619.

21. Fujita, T., Shibuya, H., Ohashi, T., Yamanishi, K. &Taniguchi, T. (1986) Cell 46, 401-407.

22. Durandt, D. B., Bush, M. R., Morgan, J. G., Weiss, A. &Crabtree, G. R. (1987) J. Exp. Med. 165, 395-407.

23. Peterlin, B. M., Luciw, P. A., Barr, P. J. & Walker, M. D.(1986) Proc. Natl. Acad. Sci. USA 83, 9734-9738.

24. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I.& Howard, B. H. (1982) Proc. Natl. Acad. Sci. USA 79,6777-6781.

25. Walker, M. D., Edlund, T., Boulet, A. M. & Rutter, W. J.(1983) Nature (London) 306, 557-561.

26. Cann, A. J., Rosenblatt, J. D., Wachsman, W., Shah, N. P. &Chen, I. S. Y. (1985) Nature (London) 318, 571-574.

27. Sodroski, J. G., Rosen, C. A. & Haseltine, W. A. (1984)Science 225, 381-385.

28. Fujisawa, J., Seiki, M., Koyokawa, T. & Yoshida, M. (1985)Proc. Natl. Acad. Sci. USA 82, 2277-2281.

29. Gluzman, Y. & Shenk, T. (1983) Enhancers and EukaryoticGene Expression (Cold Spring Harbor Laboratory, ColdSpring Harbor, NY).

30. Mosmann, T. (1983) J. Immunol. Methods 65, 55-63.31. Loken, M. R. & Stall, A. M. (1982) J. Immunol. Methods 50,

R85-R112.32. Sanchez-Pescador, R., Power, M. D., Barr, P. J., Steimer,

K. S., Stempien, M. M., Brown-Shimer, S. L., Gee, W. W.,Renard, A. R., Randolph, A., Levy, J. A., Dina, D. & Luciw,P. A. (1985) Science 227, 484-492.

33. Jones, K. A., Kadonaga, J. T., Luciw, P. A. & Tjian, R.(1986) Science 232, 755-759.

34. Starcich, B., Ratner, L., Josephs, S. F., Okamoto, T., Gallo,R. C. & Wong-Staal, F. (1984) Science 227, 538-540.

35. Rosen, C. A., Sodroski, J. G. & Haseltine, W. A. (1985) Cell41, 813-823.

36. Klatzmann, D. & Gluckman, J. C. (1986) Immunol. Today 7,291-2%.

37. Imbra, R. J. & Karin, M. (1986) Nature (London) 323, 555-557.

38. Reed, J. C., Alpers, J. D., Nowell, P. C. & Hoover, R. G.(1986) Proc. Natl. Acad. Sci. USA 83, 3982-3986.

39. f(ronke, M., Leonard, W. J., Depper, J. M., Arya, S. K.,Wong-Staal, F., Gallo, R. C., Waldmann, T. A. & Greene,W. C. (1984) Proc. Natl. Acad. Sci. USA 81, 5214-5218.

40. Ho, D. D., Rota, T., Schooley, R., Kaplan, J., Allan, J.,Groopman, J., Resnick, L., Felsenstein, D., Andrews, C. &Hirsch, M. (1985) N. Engl. J. Med. 313, 1493-1497.

41. Rando, B. F., Pellet, P., Luciw, P. A. & Srinivasan, A. (1987)Oncogene 1, 13-18.

42. Nabel, G. & Baltimore, D. (1987) Nature (London) 326, 711-713.

Immunology: Tong-Starksen et al.

Dow

nloa

ded

by g

uest

on

May

21,

202

1