HupB, a Nucleoid-Associated Protein of Mycobacterium tuberculosis,Is Modified by Serine/Threonine Protein Kinases In Vivo

Meetu Gupta,a Andaleeb Sajid,a* Kirti Sharma,b Soumitra Ghosh,c Gunjan Arora,a* Ramandeep Singh,d Valakunja Nagaraja,c

Vibha Tandon,e* Yogendra Singha

CSIR-Institute of Genomics and Integrative Biology, Delhi, Indiaa; Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, Martinsried,Germanyb; Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, Indiac; Vaccine and Infectious Disease Research Centre, TranslationalHealth Science and Technology Institute, Haryana, Indiad; Department of Chemistry, University of Delhi, Delhi, Indiae

HU, a widely conserved bacterial histone-like protein, regulates many genes, including those involved in stress response and vir-ulence. Whereas ample data are available on HU-DNA communication, the knowledge on how HU perceives a signal and trans-mit it to DNA remains limited. In this study, we identify HupB, the HU homolog of the human pathogen Mycobacterium tuber-culosis, as a component of serine/threonine protein kinase (STPK) signaling. HupB is extracted in its native state from theexponentially growing cells of M. tuberculosis H37Ra and is shown to be phosphorylated on both serine and threonine residues.The STPKs capable of modifying HupB are determined in vitro and the residues modified by the STPKs are identified for both invivo and the in vitro proteins through mass spectrometry. Of the identified phosphosites, Thr65 and Thr74 in the DNA-embrac-ing �-strand of the N-terminal domain of HupB (N-HupB) are shown to be crucial for its interaction with DNA. In addition,Arg55 is also identified as an important residue for N-HupB–DNA interaction. N-HupB is shown to have a diminished interac-tion with DNA after phosphorylation. Furthermore, hupB is shown to be maximally expressed during the stationary phase in M.tuberculosis H37Ra, while HupB kinases were found to be constitutively expressed (PknE and PknF) or most abundant during theexponential phase (PknB). In conclusion, HupB, a DNA-binding protein, with an ability to modulate chromatin structure is pro-posed to work in a growth-phase-dependent manner through its phosphorylation carried out by the mycobacterial STPKs.

Histone-like proteins (Hlps) are small and basic bacterial pro-teins involved in maintaining DNA architecture and regulat-

ing DNA transactions (1–3). Various Hlps (HU, H-NS, IHF, Dps,Fis, etc.) carry out wrapping, bridging, and bending of the bacte-rial DNA, resulting in its compaction or topological rearrange-ment (4–7). Initial studies on HU, an archetypical Hlp, showedthat it displayed similarities with the eukaryotic histones in itsphysiochemical properties and also in its ability to induce topo-logical changes such as supercoiling (8, 9). HU and other Hlps,however, share marginal similarities with the eukaryotic histonesat the sequence or the structural level (10). These proteins there-fore are now more appropriately termed nucleoid-associated pro-teins (NAPs), a designation primarily reflecting their localization(10).

Most NAPs display broad specificity toward DNA and can thushave a global effect on gene transcription (10, 11). This is achievedby their ability to maneuver the level of DNA compaction andtopology. However, all NAPs do not share a mode of action. Al-though some act as DNA-bridging molecules (H-NS, MukB, andLrp), others produce DNA bends (IHF, HU, and Fis) (5, 6). Theexpression of some of the NAPs also varies with the bacterialgrowth phase. This in turn guarantees that the nucleoid is modu-lated as a function of the bacterial growth phase (12, 13).

Apart from working as global regulators, NAPs such as HU alsowork locally by interacting with other elements of the transcrip-tion machinery in the formation of higher order nucleoproteinstructures (11, 14). The extent of influence HU exerts on geneexpression has been determined for various pathogenic and non-pathogenic bacteria (15–17). In Escherichia coli, HU regulates asmany as 8% of the genes with many involved in bacterial adapta-tion to the environmental shifts and stress response (16). Thesuccess of many pathogens is also attributed to the ability of HU to

manipulate the expression of genes involved in metabolism andvirulence (15, 17). In Mycobacterium sp., the homolog of HU (M-hlp) is implicated in bacterial adaptation to stress conditions, pos-sibly by the inhibition of cellular metabolism and reduction ofbacterial growth rate through nucleoid reorganization (18–21).Various studies have reported the accumulation of M-hlp ingrowth-retarded phases, which is suggestive of a crucial roleplayed by M-hlp in mycobacterial survival during dormancy (19,22). The accumulation of M-hlp is achieved, in part, by the post-translational modifications such as methylation, conferring resis-tance to proteolysis (23).

While HU-DNA communication has been extensively re-ported, studies on the signaling pathways that lead to a posttrans-lational modification on the protein remain limited in number(24–26). Even in eukaryotes, the identification of the cellular roleof histone phosphorylation has been a subject of active investiga-tion in recent years (27).

In this report we identify the NAP of Mycobacterium tubercu-

Received 27 February 2014 Accepted 5 May 2014

Published ahead of print 9 May 2014

Address correspondence to Yogendra Singh, ysingh@igib.res.in.

* Present address: Andaleeb Sajid, National Institute of Allergy and InfectiousDiseases, National Institutes of Health, Bethesda, Maryland, USA; Gunjan Arora,National Institute of Allergy and Infectious Diseases, National Institutes of Health,Bethesda, Maryland, USA; Vibha Tandon, Special Centre for Molecular Medicine,Jawahar Lal Nehru University, Delhi, India.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.01625-14.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.01625-14

2646 jb.asm.org Journal of Bacteriology p. 2646 –2657 July 2014 Volume 196 Number 14

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

losis, HupB, as a bona fide substrate of serine/threonine proteinkinases (STPKs). The identification of HupB as the target of theSTPKs indicates that the NAP acts in alliance with the signal trans-duction machinery to perceive the exogenous cues and carry outnecessary physiological changes essential for cellular survival.

MATERIALS AND METHODSBacterial strains and growth conditions. E. coli strain DH5� (Novagen)was used for cloning, and E. coli strain BL21 (Stratagene) was used for theexpression of recombinant proteins. E. coli cells were grown and main-tained with constant shaking (220 rpm) at 37°C in Luria-Bertani (LB)medium supplemented with 100 �g of ampicillin/ml, when needed. M.tuberculosis H37Ra, cells were maintained in Middlebrook 7H9 broth con-taining 10% albumin-dextrose-catalase (Difco Middlebrook) and 0.05%Tween 80.

Cloning, expression, and purification of HupB, HupB mutants, andSTPKs. The hupB gene (Rv2986c) and its fragment coding for N-HupB(N-terminal domain from residues 1 to 108) were PCR amplified using M.tuberculosis genomic DNA as a template and forward and reverse primers(Table 1), containing BamHI and EcoRI restriction sites, respectively. Theamplified products were digested with restriction enzymes BamHI andEcoRI and ligated into vector pGEX-5X-3 (GE Healthcare Bio-Sciences),previously digested with the same enzymes to yield plasmids pGEX-hupBand pGEX-N-hupB. The pGEX-hupB construct was utilized for generat-ing S163A mutation and pGEX-N-hupB for generating T43A, T45A,

T65A, T68A, T74A, R55E, and R55Q mutations. The PknEK45M mutantwas generated using pGEX-pknE. pGEX-hupB, pGEX-N-hupB, andpGEX-pknE plasmids were subjected to site-directed mutagenesis using aQuikChange XL site-directed mutagenesis kit (Stratagene) and primerpairs carrying the desired mutations (Table 1). The plasmids thus gener-ated are listed in (Table 2). The integrity of the constructs was confirmedby DNA sequencing (TCGA, New Delhi, India). E. coli BL21 cells weretransformed with pGEX-5X-3 vector derivatives expressing HupB, N-HupB, HupB, S163A, N-HupB T43A, N-HupB T45A, N-HupB T65A,N-HupB T68A, N-HupB T74A, N-HupB R55E, and N-HupB R55Q. Foroverexpression, recombinant E. coli strains harboring the pGEX-5X-3 de-rivatives were used to inoculate 1,000 ml of LB medium supplementedwith ampicillin, followed by incubation at 37°C with shaking (220 rpm)until the optical density at 600 nm (OD600) reached 0.4. IPTG (isopropyl-�-D-thiogalactopyranoside) was added to a final concentration of 1 mM,and growth was continued for an additional 1 h at 37°C. Growth for anextended period resulted in the degradation of the recombinant proteins.Cells were harvested and stored at �80°C. Pellets were thawed on ice andresuspended in cell lysis buffer A (50 mM Tris-Cl [pH 8.0], 300 mM NaCl,1 mM dithiothreitol [DTT], 1 mM EDTA, 1� protease inhibitor mixture[Roche Applied Science]) and lysed by sonication. The cell lysates werecentrifuged at 23,430 � g at 4°C for 20 min. The supernatant containingrecombinant proteins was collected and incubated with glutathione-Sep-harose 4B affinity resin (GE Healthcare) preequilibrated with buffer A.After extensive washings with buffers A and B (50 mM Tris-Cl [pH 8.0], 1M NaCl, 1 mM DTT, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride,10% glycerol), elution was carried out in elution buffer E (50 mM Tris-Cl[pH 8.5], 10% glycerol, 150 mM NaCl, 15 mM glutathione). Fractionswere run on a SDS–10% PAGE gel and analyzed by Coomassie blue stain-ing. Pure fractions were dialyzed (20 mM Tris-Cl [pH 8.0], 10% glycerol,150 mM NaCl), divided into aliquots, and stored at �80°C. GlutathioneS-transferase (GST)-tagged PknA (28), PknE, PknF, PknG, PknH, PknI,PknE carrying the mutation K45M (PknEK45M), and His6-tagged PknBwere purified according to the protocols described previously (29).

In vitro kinase assay. In vitro kinase assays were performed with 1 to 2�g of kinase or the kinase-inactive mutant. The kinases and kinase-inac-tive mutant were added, separately, in 15 �l of kinase buffer (20 mMPIPES [pH 7.2], 5 mM MgCl2, 5 mM MnCl2) with 2 to 4 �g of the desiredGST-tagged recombinant protein. Reactions were started with the addi-tion of 2 �Ci of [�-32P]ATP (BRIT, Hyderabad, India) and were incu-bated at 25°C for 20 min. The reaction with PknE and PknEK45M as thekinase was performed in the reaction buffer (25 mM Tris [pH 7.0], 1 mMDTT, 5 mM MgCl2, 1 mM EDTA) at 25°C for 20 min. The reactions wereterminated by the addition of 5� SDS sample buffer, followed by boilingfor 5 min. Samples were resolved by using SDS–12% PAGE. Gels weredried and visualized using a FLA-2000 PhosphorImager (Fuji).

Phosphoamino acid analysis. For phosphoamino acid analysis, N-HupB was phosphorylated by PknE, PknF, and PknB, and the recombi-nant tag was removed by the addition of factor Xa protease (Novagen)after the kinase reaction, followed by an additional incubation for vari-ous time points at 20°C. The reactions were stopped by using 5� SDSbuffer, and the reaction mixture with the cleaved protein was separated bySDS-PAGE and electroblotted onto an Immobilon polyvinylidene diflu-oride (PVDF) membrane (Millipore). The phosphorylated and cleavedN-HupB was detected by autoradiography, and the bands correspondingto the 32P-labeled cleaved N-HupB were excised and hydrolyzed in 6 MHCl for 1 h at 110°C. The hydrolyzed samples containing liberated phos-phoamino acids were lyophilized and redissolved for phosphoamino acidanalysis as described earlier (30).

Phosphorylation site identification. For phosphorylation site identi-fication, 2 �g of N-HupB was incubated with PknE in the presence of 50�M cold ATP at 25°C for 20 min in the reaction buffer containing 25 mMTris [pH 7.0], 1 mM DTT, 5 mM MgCl2, and 1 mM EDTA. Further,sample preparation was performed as described earlier (31). Briefly, theprotein samples were processed by either in-gel or in-solution digestion

TABLE 1 Primers used in this study

Primera Sequence (5=–3=)b

HupB-F CACTGGATCCGGAGGGTTGGGATGAACAAAGCA(BamHI)

HupB-R GCAAAGGGAATTCGTGTGTCTTGACCTATTTGC(EcoRI)

N-HupB-F CACTGGATCCGGAGGGTTGGGATGAACAAAGCA(BamHI)

N-HupB-R TTCTTGAATTCTCAGGCCCCCACACCACGCTT(EcoRI)

N-HupB-R55E-F GTTCGAACAGCGTCGCGAGGCGGCTCGAGTGGCCCN-HupB-R55E-R GGGCCACTCGAGCCGCCTCGCGACGCTGTTCGAACN-HupB-R55Q-F GTTCGAACAGCGTCGCCAGGCGGCTCGAGTGGCCCN-HupB-R55Q-R GGGCCACTCGAGCCGCCTGGCGACGCTGTTCGAACN-HupB-T43A-F CAAAGGCGACAGCGTCGCCATTACCGGGTTCGGTGN-HupB-T43A-R CACCGAACCCGGTAATGGCGACGCTGTCGCCTTTGN-HupB-T45A-F CGACAGCGTCACCATTGCCGGGTTCGGTGTGTTCGN-HupB-T45A-R CGAACACACCGAACCCGGCAATGGTGACGCTGTCGN-HupB-T65A-F GCCCGCAATCCGCGTGCCGGCGAGACAGTAAAGN-HupB-T65A-R CTTTACTGTCTCGCCGGCACGCGGATTGCGGGCN-HupB-T68A-F CCGCGTACCGGCGAGGCAGTAAAGGTGAAGCCGN-HupB-T68A-R CGGCTTCACCTTTACTGCCTCGCCGGTACGCGGN-HupB-T74A-F GTAAAGGTGAAGCCGGCGTCGGTGCCGGCGTTCN-HupB-T74A-R GAACGCCGGCACCGACGCCGGCTTCACCTTTACC-HupB-S163A-F GCTGTCAAGGCCACGAAGGCACCCGCCAAGAAGGTGC-HupB-S163A-R CACCTTCTTGGCGGGTGCCTTCGTGGCCTTGACAGCPknEK45-M-F GCGGATCGTGGCACTAATGCTGATGTCGGAGACGCPknEK45-M-R GCGTCTCCGACATCAGCATTAGTGCCACGATCCGCPknIcat-F GCGGGCCGTGCCGAATTCGGTTACTATCGGCCA

(EcoRI)PknIcat-R TAGCAACACCTCGAGCGCACCGACCTAGATCCGGCG

(XhoI)Rv0884cPromoter region-F TCGAAGCCTCCCCACCGAGGTGTGRv0884cPromoter region-R GCCATCAGGGTAGTGAGGGGTACCRv1230cPromoter region-F TTACCGAGTCGGCCATTGCGCCACRv1230cPromoter region-R TCGACCGTCCTCAGTGTGAGCCPknE-F-RT AACATTCTGGTTAGCGCGGAPknE-R-RT GCCATGTAGTAGAGGGTGCCPknF-F-RT TGTGGCATCCACACATCGTCPknF-R-RT GAAGGGATACGGTGTCGGTGPknB-F-RT GGTGATGGATTTCGGCATCGPknB-R-RT CTGTTCGGGTGACAGGTACTHupB-F-RT GCGCAATTCAAAGCGGTTGTHupB-R-RT GGTGCCTTCTTCGCTACCTT

a F, forward; R, reverse.b Mutagenized codons are indicated in boldface. Restriction sites are underlined, andthe corresponding restriction enzymes are indicated in parentheses.

HupB Is Phosphorylated by STPKs

July 2014 Volume 196 Number 14 jb.asm.org 2647

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

with trypsin or ArgC. The resulting peptides were loaded directly or afterphosphopeptide enrichment on reversed-phase C18 StageTips. The(phospho)peptide mixtures were analyzed using an Easy nLC NanoflowHPLC system (Proxeon Biosystems, Odense, Denmark [now ThermoFisher Scientific]) coupled via a nanoelectrospray ion source (ProxeonBiosystems) to an LTQ Orbitrap Velos mass spectrometer (Thermo FisherScientific). The raw mass spectrometric data were processed and analyzedusing MaxQuant software (v1.2.0.17).

Electrophoretic mobility shift assay (EMSA). For the protein-DNAbinding assay, Rv0884c promoter region (207bp) was end labeled with[�-32P]ATP using T4 polynucleotide kinase (10 U/20-�l reaction) in ac-cordance with the manufacturer’s instructions (Roche). The labeledprobe was incubated with various concentrations of N-HupB (10 to 100�M), and the mutants of N-HupB at room temperature for 30 min in thebuffer containing 10 mM Tris-HCl (pH 8.0), 50 mM NaCl, 50 �g ofbovine serum albumin (BSA)/ml, 1 mM DTT, 1 mM EDTA, and 5%glycerol in a total volume of 10 �l. The formed complex and free DNAwere resolved using 5% nondenaturing polyacrylamide gels in runningbuffer (0.5� Tris-borate-EDTA). Gels were dried and subjected to auto-radiography. To determine the effect of phosphorylation on the DNA-binding ability of N-HupB, the domain was incubated with PknE for 20min in the presence of cold ATP and assayed with labeled DNA probe asmentioned above. The primers used for amplification of the DNA frag-ments used in EMSAs are listed in Table 1.

Immunoaffinity purification of endogenous HupB protein from M.tuberculosis H37Ra. For immunoaffinity purification of endogenousHupB from M. tuberculosis H37Ra, the cells were grown till mid-log phase

in Middlebrook 7H9 broth containing 10% ADC and 0.05% Tween 80.The cells were harvested and resuspended in phosphate-buffered saline(PBS) containing 5% glycerol, followed by lysis using a French press. Thelysate was centrifuged at 13,000 rpm for 20 min, and the supernatant thusobtained was filtered and loaded onto an anti-HupB immunoaffinity col-umn. The immunoaffinity column was prepared as described previously(32) with minor modifications. Briefly, polyclonal anti-HupB antibody,raised in mice, was affinity purified using HupB-coupled cyanogen bro-mide-activated Sepharose. Purified anti-HupB antibody was covalentlylinked to protein A-Sepharose (1 ml) using 20 mM dimethyl pimelimi-date. The coupled matrix was regenerated with 10 mM glycine–HCl (pH2.8) and equilibrated with PBS. Binding of the endogenous HupB in thefiltered supernatant to antibody-coupled beads was carried out in PBSN(PBS containing 1% Nonidet P-40). The column was washed with 10column volumes of PBSN, followed by 10 column volumes of PBS. BoundHupB was eluted with buffer containing 0.1 M glycine-HCl (pH 2.8) and500 mM NaCl. The protein containing fractions were immediately neu-tralized with 50 mM Tris-HCl (pH 8.0) and dialyzed against storage buffer(10 mM Tris-HCl, 50 mM KCl, 5% glycerol). For Western blot analysis,1.5 �g of the purified endogenous HupB was resolved using SDS–15%PAGE with positive and negative controls when required and probedagainst anti-HupB or anti-phosphothreonine/serine antibodies accordingto the protocol described below.

Immunoblotting. To determine the phosphorylation status of the pu-rified endogenous HupB by Western blot analysis, HupB was resolved bySDS-PAGE, along with positive control (RAW cell lysate) and negativecontrol (KpnI), and transferred onto nitrocellulose membrane (Bio-Rad).

TABLE 2 Plasmids used in this study

Plasmid Descriptiona

Source orreference

pGEX-5X-3 E. coli vector utilized to generate GST fusion proteins and to purifyGST protein (GST)

GE Healthcare

pGEX-5X-3_hupB Full-length HupB This studypGEX-5X-3_N-HupB pGEX-5X-3 derivative used to purify GST-tagged N-terminal domain

(1 to 108 aa) of HupB (N-HupB)This study

pGEX-5X-3_N-HupB_T43A pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe T43A mutation (T43A)

This study

pGEX-5X-3_N-HupB_T45A pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe T45A mutation (T45A)

This study

pGEX-5X-3_N-HupB_T65A pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe T65A mutation (T65A)

This study

pGEX-5X-3_N-HupB_T68A pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe T68A mutation (T68A)

This study

pGEX-5X-3_N-HupB_R55E pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe R55E mutation (R55E)

This study

pGEX-5X-3_N-HupB_R55Q pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe R55Q mutation (R55Q)

This study

pGEX-5X-3_N-HupB_T74A pGEX-5X-3 derivative used to purify GST-tagged N-HupB carryingthe T74A mutation (T74A)

This study

pGEX-5X-3_HupB_S163A pGEX-5X-3 derivative used to purify GST-tagged HupB carrying theS163A mutation (S163A)

This study

pGEX-5X-3_pknI(1-1758) pGEX-5X-3 derivative used to purify GST-tagged PknI (PknI) This studypGEX-5X-3_pknF(1-1431) pGEX-5X-3 derivative used to purify GST-tagged PknF (PknF) 47pGEX-5X-3_pknG(1-2253) pGEX-5X-3 derivative used to purify GST-tagged PknG (PknG) 50pGEX-5X-3_pknE(1-1701) pGEX-5X-3 derivative used to purify GST-tagged PknE (PknE) 28pGEX-5X-3_pknH(1-1881) pGEX-5X-3 derivative used to purify GST-tagged PknH catalytic

domain1-403 (PknHcat)28

ProExHTc_pknE_K45M(1-1701) pGEX-5X-3 derivative used to purify GST-tagged PknE carrying theK45M mutation (PknEK45M)

This study

pProExHTc_pknB(1-1881) pProExHTc derivative used to purify His6-tagged PknB (PknB) 29pProExHTc_pknAcat(1-337) pProExHTc derivative used to purify His6-tagged PknA catalytic

domain1-337 (PknAcat)28

a The name of purified proteins used in the study are indicated in parentheses after the vector description.

Gupta et al.

2648 jb.asm.org Journal of Bacteriology

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

After overnight blocking of the membrane with 3% BSA in PBST (PBS[pH 7.2], 0.1% Tween 20), the blots were incubated with antibodies di-rected against phosphoserine or phosphothreonine (Invitrogen) dis-solved in PBST at a 1:10,000 dilution for 1 h at room temperature. Afterfive washes with PSBT, the blots were incubated for 1 h at room temper-ature with anti-rabbit horseradish peroxidase-conjugated polyclonal an-tibody dissolved in PBST at a 1:10,000 dilution. The blots were developedafter five washes with PBST using an ECL Plus kit (GE Healthcare Bio-Sciences) according to the manufacturer’s instructions. A similar protocolwas followed for the determination of HupB levels in lysates of M. tuber-culosis H37Ra obtained from different growth stages. Anti-HupB antibodywas used as the primary antibody at a dilution of 1:10,000, and anti-mouseantibody was used as the secondary antibody at a dilution of 1:10,000.

Quantitative RT-PCR. For quantitative reverse transcription-PCR(RT-PCR), an M. tuberculosis H37Ra culture was grown to differentgrowth stages: early log phase (OD600 � 0.4), mid-log phase (OD600 �0.8), late log phase (OD600 � 1.5), and stationary phase (OD600 � 2.5).RNA was extracted using TRIzol reagent (Invitrogen Corp., Carlsbad,CA), followed by DNase I treatment using an Ambion DNA-free kit (In-vitrogen). First-strand cDNA synthesis was carried out using randomprimers and Superscript III reverse transcriptase (Invitrogen). The cDNAthus synthesized was used in an RT-PCR supplemented with specificprimer pairs (hupB, pknE, pknF, or pknB as listed in Table 1). The dataobtained were analyzed using the CT method, and the transcript levelswere normalized to that of the housekeeping gene sigA. The mRNA levelsare an average of two biological replicates.

RESULTSHupB domain organization and genomic conservation. The hi-stone-like protein, HU, is a small DNA-binding protein of ca. 9 to

10 kDa. HU exists as a dimer composed of a largely �-helical“body” with two protruding �-ribbon “arms” (33). The �-ribbonarms intercalate with DNA to induce a bend resulting in DNAcompaction (33). The HU homologs in Mycobacterium sp. andsome other members of actinomycetes show unusual two-domainarchitecture. The N-terminal domain displays an atypical HUfold, and the C-terminal extension shows the presence of eukary-otic histone H1-like tetrapeptide repeats (AKKA) (34, 35). Thepresence of histone H1-like repeats is the reason these proteins aredescribed as “histone-like” (10). Figure 1A shows the residuescritical for the interaction of Hlps with DNA and their conserva-tion in HupB (34, 36–38). The tetrapeptide repeats (AKKA) sim-ilar to eukaryotic histone H1 are also marked (Fig. 1B).

Endogenous HupB from the avirulent strain of M. tubercu-losis, H37Ra, is phosphorylated on threonine and serine resi-dues. In eukaryotes, histones have long been identified as targetsof the serine/threonine/tyrosine protein kinases (27). Hence, weset out to determine whether prokaryotic STPKs also identifyHupB as their target. To determine this, endogenous HupB fromthe exponentially growing cells of M. tuberculosis H37Ra strain wasimmunoaffinity purified using polyclonal anti-HupB antibody asdescribed in Materials and Methods. Notably, HupB of H37Ra, anattenuated strain of H37Rv, displays 100% similarity with its or-tholog in H37Rv (see Fig. S1 in the supplemental material). Thatthe protein purified from H37Ra corresponded to HupB wasascertained by Western blot analysis with anti-HupB antibody(Fig. 2A). Of note, HupB and its orthologs purified from various

FIG 1 Sequence alignment of N-terminal and C-terminal domains of HupB. (A) Sequence alignment of the HU fold (1-90 aa) of N-terminal domain of M.tuberculosis H37Rv HupB was performed with the representative members of the bacterial HU-like proteins using the CLUSTAL W program. Residues implicatedin HU interaction with DNA and largely conserved in HU homologs are boxed. Among the conserved residues, the residue chosen for mutagenesis in N-HupBis indicated by a star. HU�, E. coli HU beta subunit; HU�, E. coli HU alpha subunit; HUBst, HU homolog of B. stearothermophilus; N-HupB, 1 to 90 residuesrepresenting the HU fold of the N-terminal domain of M. tuberculosis HupB. (B) Sequence alignment of C-HupB (108 to 214 aa) with the C-terminal region ofhuman histone H1.5 (103 to 226 aa). The AKKA tetrapeptide repeats are boxed.

HupB Is Phosphorylated by STPKs

July 2014 Volume 196 Number 14 jb.asm.org 2649

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

mycobacterial species have been reported to migrate around 30kDa owing to the highly basic nature of the protein, resulting inaberrant migration during electrophoresis (34, 35, 39).

The purified protein was analyzed for its phosphorylation statuswith anti-phosphothreonine/serine antibody. As shown in Fig. 2Band C, endogenous HupB was found to be phosphorylated on boththreonine and serine residues. These results indicated that HupB waseither autophosphorylated or was a target of the STPKs in vivo.

HupB is phosphorylated by STPKs in vitro. To determinewhether HupB was modified on serine and threonine residues as aresult of autophosphorylation or phosphotransfer by the STPKs,HupB was purified as a recombinant GST-tagged full-length pro-tein and incubated with [�-32P]ATP with or without STPKs. Asshown in Fig. 3A, panel I, GST-HupB failed to label itself whenincubated with [�-32P]ATP. However, when incubated in thepresence of the STPKs (PknE, PknF, and PknB), GST-HupB wasefficiently labeled, indicating that the mycobacterial histone-likeprotein was indeed targeted by the STPKs (Fig. 3A, panels II, III,and IV). However, the levels of phosphotransfer by the kinases,added in equimolar concentrations, varied (PknE � PknF �PknB). Faint phosphotransfer was observed on HupB when PknAand PknH were used as the kinases, whereas PknG and PknI com-pletely failed to phosphorylate HupB (data not shown). To ascer-tain that the observed phosphotransfer on HupB was carried outby the purified mycobacterial kinase and not by a contaminatingE. coli protein, a kinase-inactive mutant of PknE, PknEK45M, wasgenerated and used as a control. As seen in Fig. 3B, when HupBwas incubated with PknEK45M, no phosphotransfer was ob-

served. This result showed that the modification on HupB wasPknE specific.

Further, since HupB protein was purified with a recombinantGST tag, GST alone was used as control to ensure that the ob-served phosphorylation was on HupB protein and not on the re-combinant tag (Fig. 3B, lane 1). Taken together, these resultsshowed that the observed phosphorylation on HupB was a resultof phosphotransfer by the STPKs.

Identification of the phosphorylation site(s) in HupB. Toidentify the sites targeted by the STPKs, immunoaffinity-purifiedendogenous HupB from M. tuberculosis H37Ra was subjected toliquid chromatography-tandem mass spectrometry (LC-MS/MS)analysis. Since HupB is composed of a large number of lysine andarginine residues, it was prone to degradation and also showedhigh susceptibility to the proteases used for digestion during MSanalysis. After multiple attempts, only a singly phosphorylatedpeptide was obtained from the endogenous phosphorylated pro-tein. The peptide comprised two phosphorylatable residues(Thr43 and Thr45), one of which represented the potential phos-phosite. However, the exact residue on which phosphorylationoccurred could not be defined based on fragmentation spectra. Nophosphosites could be mapped on the C-terminal domain due toexcessive cleavage with the proteases used and hence a limitedpeptide coverage. Since the endogenous protein was shown to bephosphorylated on serine residues also (Fig. 4), the presence ofother residues modified by the STPK cannot be ruled out.

Identification of phosphorylation site(s) in the N-terminaldomain of HupB. Since phosphosites could not be mapped on the

FIG 2 Endogenous HupB of M. tuberculosis H37Ra is phosphorylated on threonine and serine residues. (A) Endogenous HupB was purified using polyclonalanti-HupB antibody raised in mice. The purified protein was probed against anti-HupB antibody to ensure that the protein thus purified represented theendogenous HupB. The purified protein was resolved using SDS–15% PAGE, electroblotted onto PVDF membrane, and subjected to Western blot analysis. Theleft panel shows the Ponceau blue-stained PVDF membrane, and the right panel is the corresponding blot. (B and C) To determine the phosphorylation statusof the purified protein, endogenous HupB was probed against anti-phosphothreonine and anti-phosphoserine antibodies. RAW cell lysate was included as thepositive control (lanes 1) and KpnI was used as the negative control (lanes 3). The left panels show the Ponceau-stained PVDF membrane, and the right panelsshow the corresponding blot in the respective panels.

Gupta et al.

2650 jb.asm.org Journal of Bacteriology

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

C-terminal domain and the presence of the C-terminal repeatsresulted in the degradation of full-length protein during purifica-tion (40, 41), further studies were conducted on the prokaryoticHU-like N-terminal domain (N-HupB, amino acids 1 to 108).N-HupB was cloned, expressed, and purified as a GST-tagged pro-tein. Purified recombinant GST-N-HupB was less susceptible todegradation than was the full-length GST-HupB (data notshown). As for full-length HupB, N-HupB was assayed with var-ious kinases and was shown to be phosphorylated by PknE, PknB,and PknF, with PknE displaying the most efficient phosphotrans-fer (Fig. 5A). The PknE phosphorylated GST-N-HupB was sub-jected to LC-MS/MS for identification of the phosphorylationsites. However, in N-HupB multiple sites were found to be phos-phorylated (Thr11, Thr22, Thr31, Thr43, Thr45, Thr65, Thr68, Thr74,Ser75, and Ser90). The presence of multiple phosphorylation siteson the N-terminal domain can partially be attributed to the avail-ability of the residues in the absence of C-terminal domain. Also,going by the analogy with the eukaryotic histones known to bephosphorylated at multiple residues (27), the presence of multiplephosphorylation sites in prokaryotic histone-like protein HupBcannot be ruled out.

Since one of the residues, i.e., Thr43 or Thr45, was found to bephosphorylated on the native protein and also on the in vitro-phosphorylated N-HupB, these residues were individually mu-tagenized to alanine (GST-N-HupB-T43A and GST-N-HupB-T45A). However, no major loss of phosphorylation was observedon any of the mutants (Fig. 5B). This was apparently due to thepresence of other phosphorylatable serine and threonine residuespresent in N-HupB, as shown previously (data not shown).

Further, among the identified phosphosites the phospholabelwas shown to be localized primarily on the threonine residues asshown by two-dimensional thin-layer electrophoresis experi-ments. Moreover, as with PknE, PknF and PknB preferred threo-nine over serine for phosphorylation (Fig. 5C). In conclusion, theN-HupB kinases followed a similar phosphorylation pattern onN-HupB, with threonine as the preferred phosphorylated aminoacid.

Residues critical for N-HupB–DNA interaction. To deter-mine the residues critical for N-HupB interaction, the activity ofthe purified GST-N-HupB was first subjected to an EMSA. TheEMSA was carried out with increasing concentrations of N-HupB(10 to 100 nM) and the promoter region of the Rv0884c gene.Notably, M. tuberculosis HupB and a shorter version of its N-ter-minal domain (1 to 95 amino acids [aa]) have been previouslyreported to interact with various forms of DNA in a non-se-quence-specific manner (42, 43). Hence, the DNA probe used inthe present study was selected randomly and was the promoterregion previously shown to be targeted by cyclic AMP receptorprotein (CRP) (44). As shown in Fig. 6A. GST-N-HupB showedefficient interaction with double-stranded DNA (dsDNA) andwith a higher affinity than previously reported (42). The promoterregion of the Rv1230c gene, another member of CRP regulon, alsodisplayed a similar binding affinity with HupB (data not shown).

Next, of the identified phosphosites, Thr65, Thr68, and Thr74

positioned in the DNA interchalating �-arm (45) were mu-tagenized to alanine to elucidate their role in the interaction withDNA, if any. The residue corresponding to Thr65 of HupB hasbeen shown to be located in the bend of the �-ribbon arm inBacillus stearothermophilus (46) and the residues corresponding toThr68 and Thr74 in the return arm of the �-ribbon. Of the threeresidues, Thr65 and Thr74 showed conservation or conservativesubstitution to serine in HupB homologs in actinomycetes (seeFig. S2 in the supplemental material). Thr65 was found to be con-served not only in HupB homologs in actinomycetes but also inHU homologs across various species in the bacterial kingdom(data not shown). Interestingly, the mutation of Thr65 and Thr74

compromised the DNA-binding ability of N-HupB, whereas themutation of Thr68 to alanine showed no effect (Fig. 6B). Theseresults showed that the conserved Thr65 and Thr74 situated at thestrategic location are crucial for the DNA-binding ability of N-HupB. These residues were, however, not the primary phospho-sites since their mutation did not result in an apparent loss ofphospholabeling by PknE (Fig. 6C).

In addition, Arg55 was also identified as a residue critical for

FIG 3 HupB is phosphorylated by serine/threonine protein kinases in vitro (A) Recombinant GST-HupB was incubated in the presence of [�-32P]ATP for 20 minat 25°C. The reaction was run on an SDS-PAGE gel, and the gel was autoradiographed after drying. As shown in panel I, HupB was incapable of undergoingautophosphorylation. In panels II, III, and IV, 1 to 2 �g of purified STPKs PknE, PknF, or PknB were incubated alone (lane 1) or with 2 �g of recombinant GSTHupB (lane 2) in the presence of [�-32P]ATP for 20 min at 25°C. As shown, transphosphorylation on HupB was visualized in the presence of the STPKs, withPknE displaying most efficient phosphotransfer (panel II, lane 2). (B) PknE and PknEK45M were incubated with GST or GST-HupB. No phosphorylation wasobserved on GST alone when incubated with PknE (lane 1). PknEK45M, the kinase-inactive mutant, displayed a lack of autophosphorylation ability (lane 2). Nophosphotransfer was observed on GST-HupB when incubated with PknEK45M (lane 4).

HupB Is Phosphorylated by STPKs

July 2014 Volume 196 Number 14 jb.asm.org 2651

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

N-HupB–DNA interaction. Arg55 of B. stearothermophilus his-tone-like protein (HUBst) has been reported to mediate the inter-action of its �-arm with DNA by forming electrostatic contactswith the negatively charged DNA (38). In multiple sequence align-ment of various prokaryotic Hlps, Arg55 was indeed found to beone of the highly conserved residues (see Fig. S3 in the supplemen-tal material). Arg55 was thus mutagenized to negatively chargedamino acid Glu (R55E) or neutral amino acid Gln (R55Q) and,using EMSA, we demonstrated that the complex was lost whenArg55 was replaced with either Glu (R55E) or Gln (R55Q) (Fig.6D). Hence, Arg55 seemingly plays a common role in HU-DNAinteraction across various species. Interestingly, when the N-HupB Arg55 mutants Glu(R55E) or Gln(R55Q) were assayed withHupB kinases, a loss in phosphorylation on the mutants was ob-served (Fig. 6E). This result raises the possibility that the N-HupB� arm is involved in the interaction of the domain with the kinasesas well.

Phosphorylation negatively regulates the DNA-binding abil-ity of N-HupB. Since N-HupB was found to be phosphorylated bythe STPKs and has been shown to interact with DNA, it was per-tinent to believe that the posttranslational modification would actas an important determinant for the regulation of its DNA-bind-ing ability.

The effect of phosphorylation on the DNA-binding ability ofN-HupB was determined. EMSA was performed at lower HupBconcentrations (20 nM) to avoid the formation of aggregates.Then, 20 nM N-HupB was incubated with PknE in the presence ofcold ATP, prior to its interaction with DNA. The phosphorylatedprotein was then incubated with 32P-labeled DNA probe. Reac-tions carried out in the absence of PknE or cold ATP was includedas the controls. As shown in Fig. 7, compared to the unphospho-rylated N-HupB, the phosphorylated N-HupB showed a signifi-cant decrease in its ability to form a complex with the labeledDNA. That the added N-HupB was phosphorylated by PknE wasascertained by Western blotting with anti-phosphothreonine an-tibody (data not shown). Therefore, the phosphorylation of theN-terminal domain by PknE resulted in the negative regulation ofits DNA-binding ability.

Growth phase-dependent expression of hupB and pknE,pknF, and pknB kinases. It has been shown that the pknB kinase,one of the identified HupB kinases, is maximally expressed duringthe exponential phase (47). Also, the HupB homologs from M.bovis and M. smegmatis have been shown to be upregulated and/oraccumulated during the stationary phase of bacterial growth at theprotein level (19, 21, 22). The data available for different strainsindicate that the levels of HupB and at least one of the HupB

FIG 4 Identification of the phosphorylation site(s) in HupB and N-HupB using high-accuracy measurements at both the precursor mass and the fragment levels(a “high-high” strategy) on the LTQ Orbitrap Velos. (A) Heated capillary dissociation-based MS/MS spectrum of a tryptic peptide (GDSVTITGFGVFEQR) ofendogenous HupB phosphorylated on either Thr43 or Thr45. (B) In vitro phosphorylation by PknE allows identification and localization of phosphorylation onThr43 (left spectra) and Thr45 (right spectra).

Gupta et al.

2652 jb.asm.org Journal of Bacteriology

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

kinases (the pknB kinase) reach a maximum at different stages ofgrowth.

To validate this and to have a systematic view on the levels ofhupB and HupB kinases at different stages of the bacterial growthcycle, quantitative RT-PCR was performed on the RNA samplesprepared from in vitro grown M. tuberculosis H37Ra cultures. Asshown in Fig. 8A, the expression levels of hupB declined in theexponential phase and then showed a steady increase, peakingtoward the stationary phase. Among the kinases, the mRNA levelsof pknB steadily declined from the exponential phase to the sta-tionary phase (Fig. 8C). The levels of pknE and pknF mRNA re-mained relatively constant throughout the bacterial growth cycle(Fig. 8D and E, respectively). In addition, the changes in hupBmRNA levels were also shown to correlate with the levels of HupBprotein. The cell lysates prepared from different stages were sub-jected to Western blotting with anti-HupB antibody. As seen inFig. 8B, the intracellular concentration of HupB increased steadilypeaking at the stationary phase, a result in agreement with dataobtained from quantitative RT-PCR analysis.

DISCUSSION

In this study, we show that the endogenous M. tuberculosis his-tone-like protein HupB is phosphorylated on serine and threo-

nine residues in vivo and is a bona fide substrate of the STPKs. Thisis the first report in which a mycobacterial nucleoid associatedprotein has been shown to be targeted by the kinases and the firstto describe the effect of the phosphorylation determined on itsDNA-binding ability. Even in other bacterial species, the conceptof kinase-mediated regulation of nucleoid-associated proteins(NAPs) is relatively new, with only a few reports validating thesame (24–26). Since NAPs can modulate the expression of a largenumber of genes (15–17), the phosphorylation-related changes intheir activity can serve as a tool for bacterium to transmit theenvironmental cue to a large number of genes and bring aboutadaptive changes.

Our results showed that the endogenous HupB extracted fromthe exponentially growing cells of M. tuberculosis H37Ra was phos-phorylated on both serine and threonine residues. These resultswere in line with the data available on eukaryotic histones knownto be phosphorylated on serine and threonine residues. Interest-ingly, the HupB C-terminal domain showed the presence of amotif (159KATKSPAK166) similar to the one in histone H1.5(184KATKSPAK191). The motif has been shown to be phosphory-lated by cyclin-dependent kinases (48). Mutation of Ser163 toAla163 in the full-length GST-HupB, however, did not result in adetectable decrease in the phosphorylation signal on the protein

FIG 5 Identification of phosphorylation site(s) in the prokaryotic HU-like N-terminal domain of HupB. (A) In vitro phosphorylation of HupB N-terminaldomain by STPKs (left panel, autoradiogram; right panel, corresponding Coomassie blue-stained gel). Although PknE-phosphorylated GST-N-HupB appearedas a single phosphorylated species (panel I, lane 2), PknF and PknB phosphorylated an additional slower-migrating species, possibly an isoform of N-HupB,indicated by arrows. (B) PknE mediated comparative phosphorylation of the wild-type GST-N-HupB (lane 1) with threonine mutants GST-N-HupB T43A (lane2) and T45A (lane 3). (C) Analysis of the phosphoamino acid content of cleaved N-HupB phosphorylated by PknE (panel I), PknF (panel II), and PknB (panelIII). Amino acid standards, phosphoserine (pSer), phosphothreonine (pThr), and phosphotyrosine (pTyr) were added in the radiolabeled sample and visualizedby ninhydrin staining (right panel) prior to autoradiography (left panel).

HupB Is Phosphorylated by STPKs

July 2014 Volume 196 Number 14 jb.asm.org 2653

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

(data not shown). Hence, Ser163 may not represent a genuinephosphorylation site in the mycobacterial HupB or, alternatively,the presence of multiple phosphorylation sites may have maskedthe effect produced by the mutation.

In vitro-expressed and -purified GST-HupB was shown to bephosphorylated by the STPKs PknE, PknF, and PknB. PknE dis-played maximal phosphorylation on GST-HupB. The site markedby the kinases on endogenous HupB was identified and was situ-ated on a singly phosphorylated peptide in the N-terminal domaincomprising of two phosphorylatable residues Thr43 and Thr45.However, no phosphosites could be mapped on the C-terminaldomain of HupB. The C-terminal domain (aa 108 to 214) whichhas a high content of Lys (32.1%) and Arg (5.7%) residues showedhigh susceptibility to proteases, resulting in low peptide coverage.Recently, Jang et al. reported the phosphorylation of numerouspeptides by an M. tuberculosis STPK, PknJ, identified on the basis

of its similarity to the consensus sequence derived from the auto-phosphorylation sites targeted by the kinase (49). Thr43 and Thr45

residues in the peptide sequence derived from HupB (DSVTITGF) were proposed to be the putative target sites of the STPK.Although the prediction of substrates on the basis of phosphory-lation of a peptide is highly speculative in nature, our results are inagreement with the results obtained by Jang et al.

Since we could not locate the phosphorylation sites on theC-terminal domain and the presence of the C-terminal domainrendered the protein highly susceptible to proteolytic degradation(data not shown), further studies were carried out on the N-ter-minal domain.

HupB is a 214-aa protein, and residues 1 to 90 show homologyto the prokaryotic histone-like proteins (34, 40). It has beenshown that the residues following the conventional HU fold arerequired for an efficient interaction of HU and HU-like proteins

FIG 6 DNA-binding activity of GST-N-HupB and identification of Thr65, Thr74, and Arg55 as important residues for N-HupB–DNA interaction. (A) 32P-labeledDNA was incubated with increasing concentrations of GST-N-HupB (10 to 100 nM). As shown, multiple complexes were formed (C1, C2, and C3), primarily dueto the nonspecific interaction of N-HupB at multiple sites on the labeled probe. (B) Thr65 and Thr74, the well-conserved residues on the “return” strand of the�-arm, were mutagenized to alanine to generate GST-N-HupB T65A and GST-N-HupB T74A, respectively. Both mutants displayed defective DNA-bindingabilities. Lane 1, control; lane 2, GST-N-HupB; lane 3, GST-N-HupB T65A; lane 4, GST-N-HupB T74A. Mutation of T68 residue to alanine had no effect on theDNA-binding efficiency of GST-N-HupB (lane 5). (C) GST-N-HupB T65A and GST-N-HupB T74A mutants were assayed with PknE in the presence of[�-32P]ATP. (Upper panel) Autoradiogram; (lower panel) corresponding Coomassie blue-stained gel. (D) The surface-exposed Arg55 on the “outgoing” strandof �-arm was mutagenized to Gln (R55Q) and Glu (R55E). The proteins (20 nM) were incubated with 32P-labeled DNA probe. A decrease in the DNA-bindingability of the mutants was observed, clearly indicating at the role of a positively charged residue for the interaction of N-HupB with DNA. (E) The mutantsGST-N-HupB R55E and GST-N-HupB R55Q were incubated with PknE in the presence of [�-32P]ATP. After separation by SDS-PAGE, the gels were dried, andsignals were detected using a PhosphorImager. An apparent decrease in phosphorylation on GST-N-HupB R55Q (lane 2) and on GST-N-HupB R55E (lane 3)are visible. (Upper panel) autoradiogram; (lower panel) corresponding Coomassie blue-stained gel.

Gupta et al.

2654 jb.asm.org Journal of Bacteriology

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

with DNA (40). These residues have been proposed to form an�-helix which is required for a stable interaction of the intercha-lating �-arms with DNA. Therefore, the N-terminal domain con-struct (1 to 108 aa) used in the present study was generated withthe region encompassing these residues ending just before the first

C-terminal domain repeat. Previously, the N-terminal domain(1 to 95 aa) has been shown to interact with DNA, albeit at a lowerefficiency compared to the full-length HupB, leading to specula-tion that the C-terminal domain acts as a DNA clasp (43). We,however, observed that the N-terminal domain (1 to 108 aa) used

FIG 7 Phosphorylation negatively regulates the DNA-binding ability of N-HupB (A) GST-N-HupB was incubated with PknE and 32P-labeled promoter regionin the presence (lane 1) or absence (lane 2) of cold ATP. The visible decrease in complex formation shows that the phosphorylated GST-N-HupB had diminishedinteraction with DNA. GST-N-HupB incubated with ATP was included as a control to ensure that the observed effect was not because of added ATP (lane 3). (B)Bar diagram showing a quantitative analysis of the complex formed, represented as phosphorimager units. Lane numbers correspond to those of panel A.

FIG 8 Growth-phase-dependent expression of hupB and pknE, pknF, and pknB kinases. (A) Total RNA was harvested from M. tuberculosis H37Ra cells fromdifferent phases of growth (early log phase [OD600 � 0.4], mid-log phase [OD600 � 0.8], late log phase [OD600 � 1.5], and stationary phase [OD600 � 2.5]). hupBmRNA levels were measured using quantitative RT-PCR and normalized to sigA expression. The standard deviations of duplicate measurements are shown fromthree independent experiments (*, P � 0.05). (B) Cell lysates were prepared from the M. tuberculosis H37Ra cells derived from the growth stages described above.Immunoblot analysis was carried out with anti-HupB antibody (upper panel), and GroEL2 was used as a loading control (lower panel). (C to E) The mRNA levelsof pknE, pknF, and pknB at various stages of growth are shown in panels C, D, and E, respectively. The standard deviations of duplicate measurements are shownfrom three independent experiments (*, P � 0.05).

HupB Is Phosphorylated by STPKs

July 2014 Volume 196 Number 14 jb.asm.org 2655

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

in the present study demonstrated a higher affinity to dsDNAcompared to a shorter fragment of the N-terminal domain (1 to 95aa) used previously (42). This could partially be attributed to thelength of the N-terminal domain and shows that the residues be-yond the HU fold may be critical for N-HupB–DNA interaction.

Furthermore, there have been no reports on the identificationof the residues that play an important role in the interaction of thisdomain with DNA. We showed here that the interaction of theN-terminal domain with DNA was indeed dependent on the con-served residue (Arg55), previously shown to be critical for theDNA-binding activity of HU homolog in B. stearothermophilus. InHUBst, of the four arginine residues in the � arm (Arg53, Arg55,Arg58, and Arg61), Arg55 had previously been identified as themost essential amino acid required for maintaining the contactwith DNA once the HU-DNA complex had formed (38). Thepositively charged surface-exposed residues on the �-arm formssalt bridges with the phosphate backbone of DNA (33, 38). Ourresults also established that the conserved residues Thr65 andThr74 are crucial for the N-HupB–DNA interaction.

The phosphorylation of N-HupB resulted in the inhibition ofthe DNA-binding activity of the domain. We further conductedquantitative RT-PCR analysis to estimate the relative mRNAabundance of the kinases and hupB at different stages of mycobac-terial growth. The expression of the kinases either remained sim-ilar (pknE and pknF) or decreased significantly (pknB) at the sta-tionary phase. However, the levels of hupB reached a maximumduring the stationary phase.

Given the role of HupB and its homologs in nucleoid conden-sation, these results lead us to suggest that the phosphorylation ofHupB during the exponential phase by the HupB kinases wouldlimit its interaction with DNA and, as the bacteria transitions intothe stationary phase, the abundant nonphosphorylated form ofHupB capable of interacting with the genome would bring aboutits compaction and condensation.

ACKNOWLEDGMENTS

We thank Matthias Mann (Department of Proteomics and Signal Trans-duction, Max Planck Institute of Biochemistry, Martinsried, Germany)for access to his proteomic facility for mass spectrometric analysis. The M.tuberculosis H37Ra strain was kindly provided by V. K. Nandicoori (Na-tional Institute of Immunology, New Delhi, India). We thank H. K.Prasad (All India Institute of Medical Sciences, Delhi, India) for providingthe antibodies for HupB.

Financial support for the work was provided by Council of Scientificand Industrial Research (BSC-0123).

We thank Anshika Singhal (CSIR-IGIB, Delhi, India) for helping withstatistical analysis.

REFERENCES1. Drlica K, Rouviere-Yaniv J. 1987. Histone-like proteins of bacteria. Mi-

crobiol. Rev. 51:301–319.2. Dorman CJ, Deighan P. 2003. Regulation of gene expression by histone-

like proteins in bacteria. Curr. Opin. Genet. Dev. 13:179 –184. http://dx.doi.org/10.1016/S0959-437X(03)00025-X.

3. Hayat MA, Mancarella DA. 1995. Nucleoid proteins. Micron 26:461–480. http://dx.doi.org/10.1016/0968-4328(95)00022-4.

4. Pettijohn DE. 1988. Histone-like proteins and bacterial chromosomestructure. J. Biol. Chem. 263:12793–12796.

5. Dame RT. 2005. The role of nucleoid-associated proteins in the organi-zation and compaction of bacterial chromatin. Mol. Microbiol. 56:858 –870. http://dx.doi.org/10.1111/j.1365-2958.2005.04598.x.

6. Luijsterburg MS, Noom MC, Wuite GJ, Dame RT. 2006. The architec-tural role of nucleoid-associated proteins in the organization of bacterial

chromatin: a molecular perspective. J. Struct. Biol. 156:262–272. http://dx.doi.org/10.1016/j.jsb.2006.05.006.

7. Dorman CJ. 2009. Nucleoid-associated proteins and bacterial physiology.Adv. Appl. Microbiol. 67:47– 64. http://dx.doi.org/10.1016/S0065-2164(08)01002-2.

8. Rouviere-Yaniv J, Gros F. 1975. Characterization of a novel, low-molecular weight DNA-binding protein from Escherichia coli. Proc. Natl.Acad. Sci. U. S. A. 72:3428 –3432. http://dx.doi.org/10.1073/pnas.72.9.3428.

9. Rouviere-Yaniv J, Yaniv M, Germond JE. 1979. Escherichia coli DNAbinding protein HU forms nucleosome-like structure with circular dou-ble-stranded DNA. Cell 17:265–274. http://dx.doi.org/10.1016/0092-8674(79)90152-1.

10. Dillon SC, Dorman CJ. 2010. Bacterial nucleoid-associated proteins,nucleoid structure and gene expression. Nat. Rev. Microbiol. 8:185–195.http://dx.doi.org/10.1038/nrmicro2261.

11. Browning DF, Grainger DC, Busby SJ. 2010. Effects of nucleoid-associated proteins on bacterial chromosome structure and gene expres-sion. Curr. Opin. Microbiol. 13:773–780. http://dx.doi.org/10.1016/j.mib.2010.09.013.

12. Rimsky S, Travers A. 2011. Pervasive regulation of nucleoid structure andfunction by nucleoid-associated proteins. Curr. Opin. Microbiol. 14:136 –141. http://dx.doi.org/10.1016/j.mib.2011.01.003.

13. Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A. 1999. Growthphase dependent variation in protein composition of the Escherichia colinucleoid. J. Bacteriol. 181:6361– 6370.

14. Kar S, Adhya S. 2001. Recruitment of HU by piggyback: a special role ofGalR in repressosome assembly. Genes Dev. 15:2273–2281. http://dx.doi.org/10.1101/gad.920301.

15. Mangan MW, Lucchini S, Cróinín T, Fitzgerald S, Hinton JC, DormanCJ. 2011. Nucleoid-associated protein HU controls three regulons thatcoordinate virulence, response to stress and general physiology in Salmo-nella enterica serovar Typhimurium. Microbiology 157:1075–1087. http://dx.doi.org/10.1099/mic.0.046359-0.

16. Oberto J, Nabti S, Jooste V, Mignot H, Rouviere-Yaniv J. 2009. The HUregulon is composed of genes responding to anaerobiosis, acid stress, highosmolarity, and SOS induction. PLoS One 4:e4367. http://dx.doi.org/10.1371/journal.pone.0004367.

17. Priyadarshini R, Cugini C, Arndt A, Chen T, Tjokro NO, Goodman SD,Davey ME. 2013. The nucleoid-associated protein HU� affects globalgene expression in Porphyromonas gingivalis. Microbiology 159:219 –229.http://dx.doi.org/10.1099/mic.0.061002-0.

18. Matsumoto S, Yukitake H, Furugen M, Matsuo T, Mineta T, Yamada T.1999. Identification of a novel DNA-binding protein from Mycobacteriumbovis bacillus Calmette-Guérin. Microbiol. Immunol. 43:1027–1036. http://dx.doi.org/10.1111/j.1348-0421.1999.tb01232.x.

19. Lee BH, Murugasu-Oei B, Dick T. 1998. Upregulation of a histone-likeprotein in dormant Mycobacterium smegmatis. Mol. Gen. Genet. 260:475–479. http://dx.doi.org/10.1007/s004380050919.

20. Shires K, Steyn L. 2001. The cold-shock stress response in Mycobacteriumsmegmatis induces the expression of a histone-like protein. Mol. Micro-biol. 39:994 –1009. http://dx.doi.org/10.1046/j.1365-2958.2001.02291.x.

21. Matsumoto S, Furugen M, Yukitake H, Yamada T. 2000. The gene encod-ing mycobacterial DNA-binding protein I (MDPI) transformed rapidlygrowing bacteria to slowly growing bacteria. FEMS Microbiol. Lett. 182:297–301. http://dx.doi.org/10.1111/j.1574-6968.2000.tb08911.x.

22. Katsube T, Matsumoto S, Takatsuka M, Okuyama M, Ozeki Y, NaitoM, Nishiuchi Y, Fujiwara N, Yoshimura M, Tsuboi T, Torii M, OshitaniN, Arakawa T, Kobayashi K. 2007. Control of cell wall assembly by ahistone-like protein in mycobacteria. J. Bacteriol. 189:8241– 8249. http://dx.doi.org/10.1128/JB.00550-07.

23. Pethe K, Bifani P, Drobecq H, Sergheraert C, Debrie AS, Locht C,Menozzi FD. 2002. Mycobacterial heparin-binding hemagglutinin andlaminin-binding protein share antigenic methyl-lysines that confer resis-tance to proteolysis. Proc. Natl. Acad. Sci. U. S. A. 99:10759 –10764. http://dx.doi.org/10.1073/pnas.162246899.

24. Udo H, Lam CK, Mori S, Inouye M, Inouye S. 2000. Identification of asubstrate for Pkn2, a protein Ser/Thr kinase from Myxococcus xanthus by anovel method for substrate identification. J. Mol. Microbiol. Biotechnol.2:557–563.

25. Jin H, Pancholi V. 2006. Identification and biochemical characterization of aeukaryotic-type serine/threonine kinase and its cognate phosphatase in Strep-

Gupta et al.

2656 jb.asm.org Journal of Bacteriology

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

tococcus pyogenes: their biological functions and substrate identification. J.Mol. Biol. 357:1351–1372. http://dx.doi.org/10.1016/j.jmb.2006.01.020.

26. Burnside K, Lembo A, de Los Reyes M, Iliuk A, Binhtran NT, ConnellyJE, Lin WJ, Schmidt BZ, Richardson AR, Fang FC, Tao WA, RajagopalL. 2010. Regulation of hemolysin expression and virulence of Staphylococ-cus aureus by a serine/threonine kinase and phosphatase. PLoS One 11:e11071.

27. Banerjee T, Chakravarti D. 2011. A peek into the complex realm ofhistone phosphorylation. Mol. Cell. Biol. 31:4858 – 4873. http://dx.doi.org/10.1128/MCB.05631-11.

28. Sajid A, Arora G, Gupta M, Singhal A, Chakraborty K, Nandicoori VK,Singh Y. 2011. Interaction of Mycobacterium tuberculosis elongation fac-tor Tu with GTP is regulated by phosphorylation. J. Bacteriol. 193:5347–5358. http://dx.doi.org/10.1128/JB.05469-11.

29. Gupta M, Sajid A, Arora G, Tandon V, Singh Y. 2009. Forkhead-associated domain-containing protein Rv0019c and polyketide-associatedprotein PapA5, from substrates of serine/threonine protein kinase PknBto interacting proteins of Mycobacterium tuberculosis. J. Biol. Chem. 284:34723–34734. http://dx.doi.org/10.1074/jbc.M109.058834.

30. Boyle WJ, van der Geer P, Hunter T. 1991. Phosphopeptide mappingand phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates. Methods Enzymol. 201:110 –149. http://dx.doi.org/10.1016/0076-6879(91)01013-R.

31. Sharma K, Kumar C, Kéri G, Breitkopf SB, Oppermann FS, Daub H.2010. Quantitative analysis of kinase-proximal signaling in lipopolysac-charide-induced innate immune response. J. Proteome Res. 9:2539 –2549.http://dx.doi.org/10.1021/pr901192p.

32. Manjunatha UH, Dalal M, Chatterji M, Radha DR, Visweswariah SS,Nagaraja V. 2002. Functional characterisation of mycobacterial DNAgyrase: an efficient decatenase. Nucleic Acids Res. 30:2144 –2153. http://dx.doi.org/10.1093/nar/30.10.2144.

33. Tanaka I, Appelt K, Dijk J, White SW, Wilson KS. 1984. 3-A resolutionstructure of a protein with histone-like properties in prokaryotes. Nature310:376 –381. http://dx.doi.org/10.1038/310376a0.

34. Prabhakar S, Annapurna PS, Jain NK, Dey AB, Tyagi JS, Prasad HK.1998. Identification of an immunogenic histone-like protein (HLPMt) ofMycobacterium tuberculosis. Tuberc. Lung Dis. 79:43–53. http://dx.doi.org/10.1054/tuld.1998.0004.

35. Shimoji Y, Ng V, Matsumura K, Fischetti VA, Rambukkana A. 1999. A21-kDa surface protein of Mycobacterium leprae binds peripheral nervelaminin-2 and mediates Schwann cell invasion. Proc. Natl. Acad. Sci.U. S. A. 96:9857–9862. http://dx.doi.org/10.1073/pnas.96.17.9857.

36. Grove A, Saavedra TC. 2002. The role of surface-exposed lysines inwrapping DNA about the bacterial histone-like protein HU. Biochemistry41:7597–7603. http://dx.doi.org/10.1021/bi016095e.

37. Rice PA. 1997. Making DNA do a U-turn: IHF and related proteins. Curr.Opin. Struct. Biol. 7:86 –93. http://dx.doi.org/10.1016/S0959-440X(97)80011-5.

38. Saitoh F, Kawamura S, Yamasaki N, Tanaka I, Kimura M. 1999.Arginine-55 in the beta-arm is essential for the activity of DNA-bindingprotein HU from Bacillus stearothermophilus. Biosci. Biotechnol.Biochem. 63:2232–2235. http://dx.doi.org/10.1271/bbb.63.2232.

39. de Melo Marques MA, Mahapatra S, Nandan D, Dick T, Sarno EN,Brennan PJ, Vidal Pessolani MC. 2000. Bacterial and host-derived cat-ionic proteins bind �2-laminins and enhance Mycobacterium leprae at-tachment to human Schwann cells. Microbes Infect. 2:1407–1417. http://dx.doi.org/10.1016/S1286-4579(00)01294-6.

40. Mukherjee A, Bhattacharyya G, Grove A. 2008. The C-terminal domainof HU-related histone-like protein Hlp from Mycobacterium smegmatismediates DNA end-joining. Biochemistry 47:8744 – 8753. http://dx.doi.org/10.1021/bi800010s.

41. Mukherjee A, DiMario PJ, Grove A. 2009. Mycobacterium smegmatishistone-like protein Hlp is nucleoid associated. FEMS Microbiol. Lett.291:232–240. http://dx.doi.org/10.1111/j.1574-6968.2008.01458.x.

42. Sharadamma N, Khan K, Kumar S, Patil KN, Hasnain SE, Muni-yappa K. 2011. Synergy between the N-terminal and C-terminal do-mains of Mycobacterium tuberculosis HupB is essential for high-affinitybinding, DNA supercoiling and inhibition of RecA-promoted strand ex-change. FEBS J. 278:3447–3462. http://dx.doi.org/10.1111/j.1742-4658.2011.08267.x.

43. Kumar S, Sardesai AA, Basu D, Muniyappa K, Hasnain SE. 2010. DNAclasping by mycobacterial HU: the C-terminal region of HupB mediatesincreased specificity of DNA binding. PLoS One 5:e12551. http://dx.doi.org/10.1371/journal.pone.0012551.

44. Bai G, McCue LA, McDonough KA. 2005. Characterization of Mycobac-terium tuberculosis Rv3676 (CRPMt), a cyclic AMP receptor protein-likeDNA binding protein. J. Bacteriol. 187:7795–7804. http://dx.doi.org/10.1128/JB.187.22.7795-7804.2005.

45. Rao A, Ram G, Saini AK, Vohra R, Kumar K, Singh Y, Ranganathan A.2007. Synthesis and selection of de novo proteins that bind and impedecellular functions of an essential mycobacterial protein. Appl. Environ.Microbiol. 73:1320 –1331. http://dx.doi.org/10.1128/AEM.02461-06.

46. Boelens R, Vis H, Vorgias CE, Wilson KS, Kaptein R. 1996. Structureand dynamics of the DNA binding protein HU from Bacillus stearother-mophilus by NMR spectroscopy. Biopolymers 40:553–559. http://dx.doi.org/10.1002/(SICI)1097-0282(1996)40:5�553::AID-BIP13�3.0.CO;2-I.

47. Kang CM, Abbott DW, Park ST, Dascher CC, Cantley LC, Husson RN.2005. The Mycobacterium tuberculosis serine/threonine kinases PknA andPknB: substrate identification and regulation of cell shape. Genes Dev.19:1692–1704. http://dx.doi.org/10.1101/gad.1311105.

48. Sarg B, Helliger W, Talasz H, Förg B, Lindner HH. 2006. Histone H1phosphorylation occurs site-specifically during interphase and mitosis:identification of a novel phosphorylation site on histone H1. J. Biol.Chem. 281:6573– 6580. http://dx.doi.org/10.1074/jbc.M508957200.

49. Jang J, Stella A, Boudou F, Levillain F, Darthuy E, Vaubourgeix J, WangC, Bardou F, Puzo G, Gilleron M, Burlet-Schiltz O, Monsarrat B,Brodin P, Gicquel B, Neyrolles O. 2010. Functional characterization ofthe Mycobacterium tuberculosis serine/threonine kinase PknJ. Microbiol-ogy 156:1619 –1631. http://dx.doi.org/10.1099/mic.0.038133-0.

50. Koul A, Choidas A, Tyagi AK, Drlica K, Singh Y, Ullrich A. 2001.Serine/threonine protein kinases PknF and PknG of Mycobacterium tuber-culosis: characterization and localization. Microbiology 147:2307–2314.

HupB Is Phosphorylated by STPKs

July 2014 Volume 196 Number 14 jb.asm.org 2657

on March 28, 2021 by guest

http://jb.asm.org/

Dow

nloaded from