hyaluronic acid based self-assembled multifunctional …... · 2019-02-13 · amit singh, srinivas...

1

Hyaluronic Acid Based Self-Assembled

Multifunctional Nanosystems to Overcome

Drug Resistance in Lung Cancer

Thesis Presented

by

Shanthi Ganesh

to

The Bouvé Graduate School of Health Sciences

in Partial Fulfillment of the Requirements for the Degree of

DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences

with specialization in Pharmaceutics and Drug Delivery Systems

NORTHEASTERN UNIVERSITY

BOSTON, MASSACHUSETTS

August, 2012

2

ABSTRACT

The main goal of this dissertation project is to develop and evaluate a novel

approach to overcome the multidrug resistance in lung cancer cells/ tumors using a

combination therapeutic strategy that involves silencing multidrug resistance genes and

augmenting the efficacy of a chemotherapeutic agent. Currently, one of the most

challenging aspects of lung cancer therapy is the rapid acquisition of multidrug resistant

(MDR) phenotype. MDR develops due to multiple factors that include poor systemic

drug delivery efficiency, inefficient drug residence at the tumor site, poor intracellular

availability and micro environmental selection pressures that allow certain cells to

survive despite aggressive chemotherapy. Although, the RNA interference therapy has

emerged as a powerful strategy to down-regulate key genes, the intracellular delivery of

siRNA to specific tumor site is still a major challenge that needs to be overcome before

this experimental technique can be routinely used as a clinically-viable therapeutic

strategy for lung cancer patients. To address this need, in the current study, a self-

assembled hyaluronic acid nanoparticle system is designed with different functional

blocks that are expected to circulate longer and specifically reaches the tumor cell by

receptor mediated endocytosis via its receptors that are over expressed in the tumor cell

surface. With efficient delivery of siRNA directed against MDR genes using the HA

based nanoparticle system described, the reversal of drug resistance and enhancement of

sensitivity to chemotherapeutic drugs was achieved. Anti-MDR strategies may thus show

the highest clinical efficacy when administered in combination with conventional

chemotherapeutic regimens.

3

ACKNOWLEDGEMENTS

I would like to express my heartfelt gratitude to my advisor Prof Mansoor Amiji.

With his continuous care, inspiration and guidance, he helped to make research fun for

me. I could not have asked for a better role model than him. I would also like to thank Dr

Heather Clark for her tremendous support. She has been a great mentor for me throughout

the whole time. My sincere thanks to Dr Zhenfeng Duan and Dr Craig Ferris for their

encouragement and insightful comments. It is difficult to overstate my great gratitude to

Dr David Morrissey. I will always be indebted to him for making my dream a reality.

I am very grateful to many of my colleagues at school for providing a stimulating

and fun environment. My special thanks to Dr. Arun Iyer. I couldn’t have done this

without his great chemistry support. I wish to thank my dear friends Shardool Jain,

Aatman Doshi, Sunita Yadav, Lipa Shah, Mayur Kalariya, Faryal Mir and Verbena

Kosovrasti for having great discussions and fun together in Lab 170. Also, I wish to thank

Amit Singh, Srinivas Ganta, Dipti Deshpande, Jing Xu, Ruchi Shah, Ankita Raikar,

Lavanya Thapa, Azizah-Jamal-Allial, Darshna Patel and Kamaljeet Sandhu from Lab 150

for the happy times together. My special thanks to Roger Avelino and Rosalee Robinson

for their great help during the entire time. I also like to thank all my friends at work for

giving unbelievable support and instructive comments.

Lastly and most importantly, I want to thank my brothers and sister for supporting

me unconditionally to get to this point. Also, I want to thank my husband for his

unconditional support, patience and sacrifices. I couldn’t have done this without them.

Finally I would like to dedicate this to my dearest Mom and Dad for loving me all along. I

4

wish they were here with me today to see this happening as this was their dream, more

than mine.

5

Table of Contents

ABSTRACT .............................................................................................................................................................. 2

ACKNOWLEDGEMENTS .......................................................................................................................................... 3

TABLE OF CONTENTS .............................................................................................................................................. 5

LIST OF TABLES ..................................................................................................................................................... 10

LIST OF SCHEMES ................................................................................................................................................. 11

LIST OF FIGURES ................................................................................................................................................... 12

OBJECTIVE AND SPECIFIC AIMS ............................................................................................................................ 14

CHAPTER 1 ........................................................................................................................................................... 16

REVERSING CHEMOTHERAPY MEDIATED DRUG RESISTANCE IN LUNG CANCER BY RNAI APPROACH ................... 16

1.1. LUNG CANCER INCIDENCE AND MORTALITY ................................................................................................................. 16

1.2. DEVELOPMENT OF MDR IN LUNG CANCER ................................................................................................................. 17

1.3. RNA INTERFERENCE IN CANCER ............................................................................................................................... 21

1.4. CHALLENGES IN TUMOR TARGETED AND INTRACELLULAR SIRNA DELIVERY ........................................................................ 23

1.5. NANO-THERAPEUTIC STRATEGY TO OVERCOME TUMOR MDR ........................................................................................ 25

1.5.1. Hyaluronic acid-based nanosystems ........................................................................................................ 26

1.6. RATIONALE FOR COMBINATION RNAI / CHEMOTHERAPY APPROACH ............................................................................... 28

1.7. CONCLUSIONS ...................................................................................................................................................... 29

CHAPTER 2. .......................................................................................................................................................... 30

DESIGNING MULTIFUNCTIONAL BLOCKS FOR INTRA-CELLULAR SIRNA AND CHEMOTHERAPY DELIVERY ............. 30

2.1. INTRODUCTION ..................................................................................................................................................... 30

2.2 MATERIALS AND METHODS ...................................................................................................................................... 31

2.2.1. Preparation and characterization of HA modified functional blocks ....................................................... 31

2.2.1.1. Synthesis of amino lipid-modified HA derivatives ................................................................................. 31

2.2.1.1.1.Modification of HA with monofunctional amino lipids ....................................................................... 31

6

2.2.1.1.2. Modification with polyamines ............................................................................................................ 32

2.2.1.1.3. Modification with poly(ethyleneimine) .............................................................................................. 32

2.2.1.2. Synthesis of Thiol-Modified HA Derivative ............................................................................................ 33

2.2.1.3. Synthesis of PEG-modified HA derivative .............................................................................................. 34

2.2.2. Self assembly and siRNA encapsulation ................................................................................................... 34

2.2.3. Evaluating cell uptake and in vitro gene silencing ................................................................................... 35

2.2.4 Encapsulating doxorubicin and cisplatin ................................................................................................... 37

2.3. RESULTS AND DISCUSSION ...................................................................................................................................... 38

2.4. CONCLUSIONS ...................................................................................................................................................... 58

CHAPTER 3 ........................................................................................................................................................... 61

CHARECTERIZING SENSITIVE AND RESISTANT LUNG CANCER CELLS FOR TARGETED DELIVERY ............................ 61

3.1. INTRODUCTION ..................................................................................................................................................... 61

3.2. MATERIALS AND METHODS ..................................................................................................................................... 61

3.2.1. Measuring CD44 levels in SCLC and NSCLC cells ....................................................................................... 61

3.2.2. Evaluate target knockdown using tool siRNA .......................................................................................... 62

3.3. RESULTS AND DISCUSSION .................................................................................................................................... 62

3.4. CONCLUSIONS ...................................................................................................................................................... 64

CHAPTER 4. .......................................................................................................................................................... 66

IDENTIFYING THE KEY RESISTANT GENES IN SCLC AND NSCLC CELLS .................................................................... 66

AND DESIGNING APPROPRIATE SIRNAS TO TARGET THEM .................................................................................. 66

4.1. INTRODUCTION ..................................................................................................................................................... 66


4.2.1. Identifying resistant genes by RT-PCR ...................................................................................................... 67

4.2.2. Designing siRNA sequences ...................................................................................................................... 68

4.2.3. Screening siRNAs in resistant cells to identify the potent sequence ........................................................ 68

7

4.2.4. Introducing chemical modifications to selected siRNA sequences and identifying the most potent

sequence ............................................................................................................................................................ 68


4.4 CONCLUSIONS ....................................................................................................................................................... 77

CHAPTER 5. .......................................................................................................................................................... 79

COMBINATION STRATEGIES IN RESISTANT CELLS USING SIRNA AND CHEMO DRUG ............................................ 79

5.1. INTRODUCTION ..................................................................................................................................................... 79


5.2.1. Measuring cisplatin/ doxorubicin resistance in lung cancer cells ............................................................ 80

5.2.2. siRNA+ chemotherapy combination ......................................................................................................... 80


5.4. CONCLUSIONS ...................................................................................................................................................... 87

CHAPTER 6. .......................................................................................................................................................... 88

EVALUATING DELIVERY IN VIVO IN TUMOR-BEARING MICE ................................................................................. 88

6.1 INTRODUCTION ...................................................................................................................................................... 88


6.2.1. Establishing subcutaneous, metastatic and syngeneic tumor models ..................................................... 89

6.2.2. Evaluating target knockdown in tumor types with varied levels of CD44 and vascularity using tool siRNA

........................................................................................................................................................................... 90


6.4. CONCLUSIONS ...................................................................................................................................................... 98

CHAPTER 7. .......................................................................................................................................................... 99

QUANTITATING CISPLATIN AND SIRNA DISTRIBUTION IN TISSUES ....................................................................... 99

7.1. INTRODUCTION ..................................................................................................................................................... 99

7.2 MATERIALS AND METHODS ...................................................................................................................................... 99

8

7.2.1. Nanoparticle distribution using ICG ......................................................................................................... 99

7.2.2 Cisplatin distribution ............................................................................................................................... 100

7.2.3 siRNA distribution ................................................................................................................................... 101

7.3 RESULTS AND DISCUSSION ..................................................................................................................................... 102

7.4. CONCLUSIONS. ................................................................................................................................................... 106

CHAPTER 8. ........................................................................................................................................................ 108

EVALUATION OF COMBINATION EFFICACY IN RESISTANT TUMORS ................................................................... 108

8.1. INTRODUCTION ................................................................................................................................................... 108

8.2. MATERIALS AND METHODS ................................................................................................................................... 109

8.2.1. TARGET KNOCKDOWN WITH THERAPEUTIC SIRNAS ................................................................................................. 109

8.2.2. Cisplatin efficacy in A549 resistant tumors ............................................................................................ 109

8.2.3. Pilot efficacy with survivin knockdown and cisplatin treatment ............................................................ 110

8.2.4. Combination efficacy with 2 siRNAs and cisplatin ................................................................................. 111


8.4. CONCLUSIONS .................................................................................................................................................... 122

CHAPTER 9 ......................................................................................................................................................... 123

EVALUATION OF SAFETY PROFILE OF SINGLE AND COMBINATION THERAPY ..................................................... 123

9.1. INTRODUCTION ................................................................................................................................................... 123

9.2 MATERIALS AND METHODS .................................................................................................................................... 123

9.2.1. Body weight changes ............................................................................................................................. 123

9.2.1. Measuring liver enzyme levels ............................................................................................................... 124

9.2.3. Tissue histopathology ............................................................................................................................ 124


9.4. CONCLUSION ...................................................................................................................................................... 125

CONCLUDING REMARKS..................................................................................................................................... 126

9

REFERENCES ....................................................................................................................................................... 128

10

List of Tables

Table 1: Characteristics of HA derivative/ siRNA particles: ....................................................................................... 42

Table 2: CD44 receptor levels in SCLC and NSCLC cells ......................................................................................... 63

Table 3: siRNA selection process ................................................................................................................................ 71

Table 4: Selected (unmodified) siRNA sequences against 4 resistant genes ............................................................... 72

Table 5: Experimental study design for a pilot efficacy study .................................................................................. 111

Table 6: Combination efficacy study design ............................................................................................................. 112

11

List of Schemes

Scheme 1: Synthetic procedure for the preparation of fatty acid modified HA. .......................................................... 40

Scheme 2: Synthetic procedure for the preparation of................................................................................................. 41

Scheme 3: Synthetic procedure for the preparation of polyamine derivatized HA ..................................................... 44

12

List of Figures

Figure 1: Lung cancer rates in the United States by ethnicity and gender ................................................................... 16

Figure 2: Cellular factors that cause drug resistance ................................................................................................... 18

Figure 3: Mechanisms of RNAi mediated gene silencing ........................................................................................... 22

Figure 4:Fatty acid chains carrying one or more amine groups ................................................................................... 39

Figure 5: Select examples of polyamines used for HA derivatization ......................................................................... 43

Figure 6: Proposed structure of PEI-modified HA following self-assembly with siRNA. .......................................... 45

Figure 7:1H NMR of HA derivatives: HA-PEI (A) and HA-spermine (B) ................................................................ 46

Figure 8: Electrophoretic retardation analysis of siRNA binding by HA-PEI derivatives. ......................................... 48

Figure 9: Confocal microscopy images showing cell uptake of HA-PEI .................................................................... 49

Figure 10: Competition assay to show receptor mediated cell entry ........................................................................... 50

Figure 11:PLK1 gene silencing in the absence and presence of chloroquine .............................................................. 51

Figure 12: HA-SP/ PLK1 siRNA mediated PLK1 gene silencing in MDA MB 468 cells .......................................... 53

Figure 13: HA-PEI/ PLK1 siRNA mediated PLK1 gene silencing in MDA MB 468 cells. ....................................... 55

Figure 14: Optimizing HA/doxorubicin particles ........................................................................................................ 56

Figure 15: Encapsulation of cisplatin in HA-C8 particles ........................................................................................... 57

Figure 16: Encapsulation of cisplatin in HA-ODA particles ....................................................................................... 58

Figure 17: Target (PLK1 and SSB) knockdown in A549/A549DDP and H69/H69AR cells ...................................... 64

Figure 18: Identifying resistant genes in cisplatin/ DOX resistant SCLC and NSCLC cells ...................................... 69

Figure 19: BIRC5 (survivin) mRNA knockdown with survivin siRNAs in resistant A549 lung cells........................ 73

Figure 20: Survivin mRNA knockdown with unmodified vs modified survivin siRNAs in A549DDP

cells. ............... 74

Figure 21: mrp-1 mRNA knockdown with mrp-1 siRNAs in resistant A549 lung cells at 24hrs ............................... 75

Figure 22: Screening mdr1 and bcl2 siRNAs in cells .................................................................................................. 76

Figure 23: bcl2 mediated gene silencing with unmodified and modified bcl2 siRNAs in A549DDP

cells ................... 77

Figure 24: IC50s of doxorubicin and cisplatin in sensitive/resistant lung cells ........................................................... 82

Figure 25: Effect of survivin siRNA combined with cisplatin on cell viability .......................................................... 84

13

Figure 26: Combination effect of survivin, bcl2, mdr1 and mrp1 siRNAs with cisplatin on cell viability. ................ 85

Figure 27: Effect of different combinations of siRNAs with cisplatin on cell viability ............................................. 86

Figure 28: In vivo activity of HA particles .................................................................................................................. 91

Figure 29:PLK1/SSB siRNA mediated target knockdown in resistant sensitive lung tumors .................................... 93

Figure 30: Target knockdown in B16F10 metastatic and subcutaneous lung tumors ................................................. 95

Figure 31: Target knockdown in metastatic and sc A549 tumors................................................................................ 96

Figure 32: Correlating target knockdown with vascularity of the tumors ................................................................... 98

Figure 33: Biodistribution of ICG/HA-PEI/PEG in A549/ A549DDP

tumor bearing mice........................................ 102

Figure 34: Biodistribution of ICG/HA-PEI/PEG in H69/H69AR tumor bearing mice ............................................ 103

Figure 35: Biodistribution of ICG in A549 tumor bearing mice ............................................................................... 104

Figure 36: Tissue distribution of siRNA in A549DDP

tumor bearing mice ................................................................ 105

Figure 37: Survivin knockdown in A549DDP

tumors at different time points ............................................................ 113

Figure 38: Survivin knockdown with unmodified and modified siRNA sequences .................................................. 114

Figure 39: Screening bcl2 siRNA sequences in tumors............................................................................................. 115

Figure 40:Effect of cisplatin and cisplatin encapsulated HA particles on the growth of resistant A549 tumors ....... 116

Figure 41:Combination efficacy with survivin siRNA and cisplatin after first round of treatment ......................... 117

Figure 42: Combination efficacy following 2 rounds of survivin siRNA and cisplatin treatment. ........................... 118

Figure 43: Combination efficacy of 2 siRNAs and cisplatin in resistant A549 tumor .............................................. 120

Figure 44: Elaboration of the efficacy curves in parts ............................................................................................... 121

Figure 45: Monitoring body weight change .............................................................................................................. 125

14

OBJECTIVE AND SPECIFIC AIMS

Lung cancer is the second common malignancy in both men and women and the

leading cause of cancer-related deaths in the United States. More than 220,000

individuals are diagnosed with a form of lung cancer and over 150,000 patients will die

of the disease each year. One of the most challenging aspects of lung cancer therapy is

the rapid acquisition of multidrug resistant (MDR) phenotype1. MDR develops due to

multiple factors that include poor systemic drug delivery efficiency, inefficient drug

residence at the tumor site, poor intracellular availability and microenvironmental

selection pressures that allow certain cells to survive despite aggressive chemotherapy.

RNA interference therapy has emerged as a powerful strategy to down-regulate key genes

involved in the development of MDR phenotype2. However, delivery of small interfering

RNA (siRNA) to specific tumor site and intracellularly is a major challenge that needs to

be overcome before this experimental technique can be routinely used as a clinically-

viable therapeutic strategy for lung cancer patients.

The main objective of this doctoral dissertation project is to develop a

combinatorial-designed library of nanoparticulate system for multi-pronged therapeutic

approach in treatment of MDR in lung cancer. Hyaluronic acid (HA) a base polymer that

is specifically recognized by CD44+ tumor cells, including those that show stem-cell (or

tumor initiating cell) phenotype has been chosen to do this. The first objective of this

project is to synthesize a series of functionalized HA derivatives having fatty acid chains

with different carbon chain length (C2 to C18), number of amine groups, thiol groups,

PEG chains with controlled degree of functionalization and ease of purity. The second

objective is to generate a self assembled nanoparticle constructs with encapsulated

15

siRNA duplexes against multidrug resistance genes and a chemotherapeutic agent. The

next objective is to screen the derivatives and select the best system and evaluate for

efficient delivery of therapeutic siRNA against the over expressed resistant genes.

Finally, to evaluate the combination efficacy of both siRNA and chemotherapeutic agents

in resistant tumors to see if the resistance can be overcome.

The specific aims of the project are as follows:

Aim 1: Synthesize, purify, and characterize C2 to C18 lipid and amino lipid modified

HA, PEG-modified HA, thiol modified HA and develop self-assembled

nanoparticles encapsulating siRNA duplexes and chemotherapeutic agents

cisplatin/doxorubicin

Aim 2: Evaluate intracellular delivery and gene silencing efficiency of tool siRNAs

(PLK1 etc) and resistant gene siRNAs (mrp-1, survivin etc).

Aim 3: Evaluate cytotoxicity and pro-apoptotic activity of single and combination

siRNA and cisplatin therapeutic strategy in drug resistant lung tumor cells

Aim 4: Establish subcutaneous and metastatic lung cancer tumor xenograft models and/

syngenic models in mice and evaluate biodistribution and tumor targeted

delivery or knockdown of the HA nanoparticles.

Aim 5: Examine the therapeutic efficacy of single (siRNA alone & cisplatin alone) or

combination (siRNA /cisplatin combination) treatment strategies.

Aim 6: Determine the preliminary safety profile of single and combination

therapy by measuring the animal’s body weight changes, blood cell

counts, liver enzyme levels, liver tissue histology.

16

CHAPTER 1

REVERSING CHEMOTHERAPY MEDIATED DRUG RESISTANCE

IN LUNG CANCER BY RNAi APPROACH

1.1. Lung cancer incidence and mortality

Lung cancer is a global problem and is also the primary cause of cancer-related death in

North America. In the United States in 2006 (the most recent year for which statistics are

available), 106,374 men and 90,080 women were told they had lung cancer, and 89,243

men and 69,356 women died from it. Figure 1 shows the incidence rate of lung cancer in

2006 with the rates grouped by race, ethnicity and gender.

Figure 1: Lung cancer rates in the United States by ethnicity and gender

Ref. U.S. Cancer Statistics Working Group. United States Cancer Statistics 1999-2006.

Incidence and Mortality Web-based Report. Atlanta (GA): Department of Health and Human

Services, Centers for Disease Control and Prevention and the National Institutes of Health; 2010.

Available at http://www.cdc.gov/uscs.

Lung cancer is also known to be the most frequent cancer worldwide and

epidemic of this disease is still continuing to increase with a global incidence by 0.5% per

http://www.cdc.gov/uscs

17

year3. In contrast to the significant reduction of mortality from heart disease, the survival

rate of lung cancer patients has been at a plateau for almost 3 decades, with a 5 year

relative survival rate of <18% in most countries. Because of the size and distribution of

lung cancer, the cytoreductive surgery is not very effective for this disease and therefore

chemotherapy and/or radiation are the only treatments of choice. Despite major advances

in patient management, chemotherapy and radiotherapy, nearly 80% of patients still die

within 1 year of diagnosis and long-term survival is obtained in only 5-10% of patients3.

The efficacy of chemotherapy in lung cancer is mainly limited by the

development of multi-drug resistance (MDR) in cancer cells during treatment. To

overcome this resistance, often higher doses of toxic anticancer drugs are administered,

thus resulting in adverse side effects on healthy organs. Successful prevention or reversal

of drug resistance is one of the ways to significantly enhance therapeutic efficacy in lung

cancer. Using the RNA interference (RNAi) approach, one could inhibit the expression of

mdr-1 and mrp-1 genes that are implicated in drug efflux, and restore the sensitivity to P-

glycoprotein (P-gp) transportable drugs or down regulate the expression of anti apoptotic

genes that are involved in resistance and increase the sensitivity of those cells to

apoptosis inducing chemo agents. Therefore, small interfering RNA (siRNA) duplexes

could be utilized to therapeutically modulate the mediated drug resistance

1.2. Development of MDR in lung cancer

The major obstacle in lung cancer chemotherapy is the emergence of inherent and

acquired drug resistance in cancer cells. Cancer cells become resistant to anticancer drugs

18

by several mechanisms4. As described in Figure 2, one of the ways is the increasing

activity of efflux pumps such as ATP transporters which will pump the drugs out of cells.

Alternatively, the resistance can occur by an increase in the cellular apoptotic threshold.

In cases which the drug accumulation is unchanged, activation of detoxifying proteins

such as cytochrome P450 mixed function oxidases can promote drug resistance. Some

cases, cells activate the mechanisms that repair drug-induced DNA repair.

Figure 2: Cellular factors that cause drug resistance

Gottesman, M.M., T. Fojo, and S.E. Bates, Multidrug resistance

in cancer: role of ATP-dependent transporters.Nat Rev Cancer,

2002. 2(1): p. 48-58.

Finally, disruptions in apoptotic signaling pathways also allow cells to become

resistant. Most patients with small lung cancer have an initial response to chemotherapy,

but the majority acquired MDR relapses and their tumors become largely refractory to

further treatment5. Non small lung cancer is inherently resistant and generally non-

responsive to initial chemotherapy.

19

One of the most significant forms of resistance also called pump mediated

resistance is conferred by atleast 2 proteins such as P-gp (encoded by the mdr1 gene) and

the multidrug resistance associated proteins (mrp-1). Although P-gp is implicated in drug

resistance in several tumor types, it is infrequently expressed in lung cancer. In lung

cancer samples, mdr-1 mRNA expression was reported to be increased in 15-50% of

tumors. The incidence of mrp-1 gene expression is much higher (about 80%) in small lung

cancer samples. Considerable efforts have been made over the last several years to affect

MDR for potential improvement in therapeutic outcomes1. Since over-expression of the

ATP binding cassette (ABC) transporters have been shown to be responsible for MDR,

one strategy for reversal of MDR was the combined use of anticancer drugs with chemo

sensitizers6,7

. Inhibiting P-gp or ABC transporters has been studied extensively for more

than 2 decades. Many agents with diverse structure and function that modulate MDR have

been identified and used. However, their affinity was shown to be low for ABC

transporters and necessitated the use of high doses resulting in unacceptable high toxicity,

which ultimately limited the application. Second generation chemo sensitizers were then

designed to reduce the side effects of first generation drugs6-8

. Although these drugs had a

better pharmacological profile than the first generation ones, they still retain some

characteristics that limit the clinical usefulness. Third generation molecules have been

developed to overcome the limitations of the second generation modulators. Many

pharmaceutical companies have been developed number of these drugs and they are

currently undergoing clinical trials in several cancer types8. These trials are ongoing with

the aim for a longer survival in cancer. Although the effort continues, none of them has

found a general clinical use yet. The difficulties encountered with MDR inhibition have

20

then led to several alternative novel approaches to MDR therapy. Down-regulation of

MDR transporters and circumventing MDR mechanisms are two such approaches.

Antagonists of nuclear steroid and xenobiotic receptors were used in conjunction with anti

cancer agents to cope with the induction of mdr-1 gene. Down regulation of ABC

transporter proteins and enzyme involved in MDR with antisense oligonucleotide was

another novel approach to overcome MDR. In spite of advances in cancer chemotherapy

and developing viable candidates to modulate MDR, it is still not clear to conclude that

these agents could be applied to clinically. In addition, all these attempts have not

demonstrated a high efficiency in terms of their anticancer effect as well.

A growing body of evidence also suggests that the drug resistance not mediated

by pump related genes/ proteins attributed primarily to the mechanisms responsible for

the activation of anti-apoptotic cellular defense. In those resistant cells, the drug induced

anti-apoptotic pathway is blocked. Survivin and bcl2 molecules are key players in this

defense9-12

. Most chemotherapeutic agents, including cisplatin induces cell apoptosis.

Cisplatin, together with a third generation anticancer agents, is the standard regimen used

in the first line treatment of advanced non-small cell lung cancer (NSCLC) and has

shown superior efficiency in multiple trials. It is believed that the DNA damage caused

by the chemotherapeutic drugs induces the release of an enzyme that activates the

caspases. Programmed cell death, or apoptosis, is generally known to be executed by the

activation of caspase family of enzymes that cleave cellular proteins. One class of

molecules that block apoptosis by directly binding to caspases is the inhibitor of

apoptosis proteins such as survivin13

. Bcl2 is also an anti apoptotic gene and over

expressed in variety of human tumors including NSCLC and involved in tumorigenesis

21

and chemoresistance12

. It has been shown that the over expression of bcl2 delays the

onset of apoptosis induced by several chemo drugs. Substantial evidence showed that

down regulation of anti-apoptotic genes such as survivin and bcl2 or pump mediated

genes such as mdr1 and mrp-1, can sensitize cancer cells to anticancer drugs. Post-

transcriptional silencing of MDR related genes thus seems to be a promising strategy.

However, delivering short interfering RNA molecules remains a challenge.

Nano-therapeutics is a rapidly progressing field which may solve several

limitations that conventional drugs have such as non specific bio-distribution, lack of

targeting, lack of aqueous solubility, poor oral bioavailability and low therapeutic indices.

Nanoparticle system can be designed by incorporating multiple strategies to incorporate

siRNAs and chemotherapeutic drugs to reverse the multi-prolonged MDR. Strategies to

enhance systemic drug delivery efficiency, promote residence of the drug at the tumor

site, afford intracellular bioavailability and stability of the agent, and reverse the

phenotypic alterations.

1.3. RNA interference in cancer

As shown in Figure 3, RNA interference (RNAi) is an endogeneous process that

regulates expression of genes and corresponding proteins to maintain homeostasis in

organisms which occurs through production of short double stranded RNA molecules

termed siRNAs and miRNAs14

. The non-coding RNAs are widely expressed and levels

of some specific miRNAs are different in tumor and non-tumor tissues. RNAi has been

invaluable for unraveling critical pathways involved in cancer development, growth and

metastasis and has identified critical tumor specific gene targets for chemotherapy15

.

22

Figure 3: Mechanisms of RNAi mediated gene silencing

Kim, D.H. and J.J. Rossi, Strategies for silencing human disease

using RNA interference. Nat Rev Genet, 2007. 8(3): p. 173-84.

The understanding of the changes in the levels of miRNAs are directly associated

with cancer led to recognition of tumor suppressors and oncogenes16

. Since miRNAs

have global effect on gene expression, it is not surprising that they may modulate cancer

progression. They could act as tumor suppressors by inhibiting oncogenes or function as

oncogenes by inhibiting tumor suppressors. It has been reported that, more than 50%

miRNA genes were localized in cancer associated genomic regions or in fragile site.

23

At present, there are multiple profiling methods available for the analysis of

expression of all known miRNAs across a large number of samples of human normal and

tumor tissues including bladder, breast, follicular lymphoma, kidney, liver, melanoma,

pancreas, prostate, stomach, uterus, leukemia and others15

. The miRNA profiles are

highly informative, they showed a general down regulation of miRNAs in tumors

compared to normal tissues and a differential expression of nearly all miRNAs across

cancer types which suggest that unlike mRNA expression, a small number of miRNAs

might be sufficient to classify human cancers and reflects the differentiation state of the

tumors14

. Since RNAi possesses high specificity and high efficiency in down regulating

gene expression, it was also evaluated as potential therapeutic strategy against human

cancer. As a result, various individual genes have been targeted using RNAi in different

tumor models and their knockdown led to profound biological consequences. siRNA

technology is therefore expected to be an invaluable treatment for number of diseases

including cancer, although the future success of this approach will depend on the

development of effective, specific and safe delivery systems.

1.4. Challenges in tumor targeted and intracellular siRNA delivery

Nucleic acid based drugs such as siRNA have been shown to successfully down

regulate the therapeutically important genes. While they show highly sequence specific

gene silencing behaviors, the in vivo delivery of unfavorable siRNA to appropriate

disease site remains a considerable hurdle. Although some of the current clinical trials

involve direct administration of siRNA to local site, it is necessary to introduce siRNA by

a systemic route to treat most cancers and some other disease. siRNA molecules are

unfavorable for systemic delivery because of its negative charge, large molecular weight,

24

size and instability. They are also degraded easily by serum endonucleases and are

efficiently eliminated by kidney filtration. Because of these reasons, carriers are being

developed and used to deliver siRNA. First, the system should be preferably

biocompatible, biodegradable and non-immunogenic. Second the system should be able

to efficiently deliver siRNA to target cells without being attacked by serum nucleases.

Next, the delivery system should provide target specific distribution/ penetration,

avoiding rapid hepatic or renal clearance. Finally after delivery, the system should help

the efficient endosome release of siRNA into cytoplasm allowing the interaction of

siRNA with the endogenous RNA-induced silencing complex (RISC)17

.

Although the viral vectors are very efficient delivery vehicles, due to the toxicity

associated with this delivery, the non viral/synthetic nanoparticle system has become an

increasingly popular alternative for siRNA delivery. Some of the commonly used such

delivery systems include lipid based carriers, polymer systems, peptides/proteins and

conjugates17

. In the current study, a novel polymer based delivery system is being

developed with the aim of selectively delivering the siRNA to the tumor site with the

above preferable characteristics and ultimately treat cancers. In the past, self assembled

polymer nanoparticles have been investigated for their potential use in cancer therapy.

These are known to passively accumulate in the tumor site due to their leaky vasculature

and lack of the lymphatic drainage system. The passive targeting of tumors, although

seems more efficient than the conventional therapies; the amount of drug delivered at

the site however seems very little. One of the ways to overcome this limitation is to use

the targeting strategy such as attaching targeting moieties such as antibodies, proteins

and various ligands. These targeting moieties recognize, bind and internalize into tumor

25

cells. However, the use of antibodies suffers severely from their immunogenicity and

difficulty in conjugating them without decreasing their binding activity. To address

many of these issues, a novel HA based delivery system is being developed in the

current study to selectively deliver siRNA to the tumors and ultimately treat cancers. HA

itself acts like a targeting moiety and specifically recognizes the CD44 receptors that are

over expressed in many tumors to enter the tumor cells.

1.5. Nano-therapeutic strategy to overcome tumor MDR

As previously suggested, the MDR in tumor cells is a major problem in success

of chemotherapy for many types of cancers. One mechanism proposed involves the

increase of drug efflux out of cells mediated by P-glycoprotein (P-gp) or mrp-1 that uses

the energy released from ATP hydrolysis to pump out cytotoxic drugs from cancer cells,

leading to lower intracellular concentrations of chemotherapeutic drugs. The other

mechanism associated with over expression of anti- apoptotic genes, that ultimately

block the apoptosis pathway mediated by DNA damage caused by the chemo drugs.

Nanoparticulate systems have attracted considerable attention recently because of their

potential use in therapeutic targeting of disease tissues and their lower level of toxicity

against healthy tissue, relative to traditional pharmaceutical drugs18-20.

. Compared to

conventional chemotherapy, nanoparticle system has several potential advantages for

cancer treatment, including easy modification of particle surface for targeting purpose,

increased stability in blood, dual delivery such as drug, gene, imaging agents, drug

delivery system responding to environmental stimuli such as temperature, pH, salt and

ultra sound etc21

. Nanoparticles can be designed to encapsulate the appropriate siRNA,

26

circulates longer in the blood stream, while their uptake by the liver is reduced. They

can be modified with active targeting moiety, so the system could be expected to

demonstrate higher accumulation at the tumor site. These systems can be designed with

targeting moieties and pH sensitive blocks that can effectively transport drugs into

cytosol without detection of ABC transporters due to receptor mediated endocytosis and

with the breaking of endosome. The proton sponge effect is thought to be responsible for

early endosome rupture and release of the payload. The proton sponge effect arises from

a large number of weak conjugate bases (with buffering capabilities at pH 5-6), leading

to proton absorption in acidic organelles and an osmotic pressure buildup across the

organelle membrane which leads to disruption of the membrane to release the drug in

the cytoplasm. Using these nanoparticle formulations, siRNAs to target transporters,

survivin and bcl2 can be encapsulated and effectively delivered to the appropriate

location, so they can proceed further to mediate gene silencing. In the current study, a

Hyaluronic acid delivery system is designed, so it targets itself the receptors that are

over expressed in many tumors and internalizes into tumor cells. It is also designed to

have hydrophobic moieties with nitrogens that provide positive charges to promote the

endosomal escape mechanism described above to release the drug into cytoplasm.

1.5.1. Hyaluronic acid-based nanosystems

Hyaluronic acid (HA), also called hyaluronan, is a naturally occurring

polysaccharide present in the extracellular matrix and synovial fluids. This is an anionic

biopolymer composed of alternating disaccharide units of D-glucuronic acid and N-

acetyl D glucosamine with (1-4) interglycosidic linkage.22

27

HA is biodegradable, biocompatible, non-toxic, non immunogenic and non

inflammatory, which makes it ideal for a drug delivery applications23,24

. A relatively

simple chemical structure allows HA to be further modified to create a wide range of

possible drug delivery carriers. HA is a versatile biomaterial that binds to specific cell

receptors such as CD44 and RHAMM. Owing to its various important biological

functions and excellent physiochemical properties, HA and modified HA have been

extensively investigated for biomedical applications such as tissue engineering, drug

delivery and molecular imaging24

. In particular, since HA can specifically binds to

various cancer cells that over-express CD44, studies have been focused on the

applications of HA for anti-cancer therapeutics23-25

. HA conjugates containing anti-

cancer agents such as siRNA therefore expected to exhibit enhanced targeting ability to

the tumor and higher therapeutic efficacy. Based on this concept, various HA functional

blocks have been made in this current study to self assemble and encapsulate siRNA and

ultimately to deliver to the cancer cells efficiently. Since HA has a high negative charge

density, the siRNA encapsulation directly into polymer is difficult. Hydrophobic

modification of HA backbone with fatty acid chain through a coupling reaction with

carboxylic acid group of HA, not only reduces the negative charge on the surface, but

also helps the derivative to self assemble into particles23

. Increasing the number of

nitrogens in the fatty acid chain further neutralizes the negative charge and improves the

encapsulation. It has also been previously published that these modified HA derivatives

preferentially accumulate in liver after systemic administration, In an attempt to address

this, poly(ethylene glycol) (PEG)-modified HA blocks have been used along with the

other HA derivatives. In particular, the PEG surface enables nanoparticles to escape the

28

reticuloendothelial system, thus minimizing their removal at the liver site26

. Thiol

modified version was also included in this system to see if it self-assembles with the

other derivatives and help improve the endosome release27

. Targeted version could also

be added to this system to target tumors that do not express CD44 receptors.

1.6. Rationale for combination RNAi / chemotherapy approach

Despite promising early studies showing that antagonists or inhibitors could

reverse MDR, the clinical goal of restoring drug sensitivity to drug resistant human

cancer has been elusive. Thus a successful new therapeutic strategy to reverse or prevent

drug resistance is a must. As suggested previously, siRNA to target mdr- or mrp-1

gene expression or to target survivin or bcl2 is one such approach28,29

. RNAi is a

conserved biological response to double stranded RNA, which results in sequence

specific gene silencing. The targeted siRNA in drug resistant cells would markedly

inhibit the expression of resistance gene mRNA. Inhibition of pump mediated or non

pump mediated gene expression would then enhance the intracellular accumulation of

and selectively restored sensitivity to drugs. In summary, the siRNA induced

suppression of resistance gens would restore sensitivity to multi drug resistant cancer

cells and thus enhance the cytotoxicity. Thus, the suppression of cellular resistance in

combination with a cell-death induction by an anti-cancer drug is able to significantly

increase the efficacy of chemotherapy against potentially resistant cancers. Such an

objective can be effectively achieved if the agents are delivered by an efficient

multifunctional delivery system to the target cells.

29

1.7. Conclusions

To address MDR in lung cancer, in the current study, a self assembled

nanoparticle system is designed with multiple different functional blocks that are

expected to circulate longer and specifically reaches the tumor cell by receptor mediated

endocytosis via its receptors that are over expressed in the tumor cell surface. Since

these particles are taken up by the cells by a non specific or receptor mediated endocytic

processes and localize in the endosomal-lysosomal compartments, the released drug can

partially evade Pgp mediated efflux or apoptosis blockade. The hydrophobically

modified functional block with partial positive charge would expect to help degrade the

endosomal membrane and help release the drug to the cytoplasm. The PEG modified

block is added to stabilize the particles and to circulate longer until it reaches the

appropriate target site. All these suggest that the reversal of drug resistance can be

achieved by using siRNA directed against the target mRNA with the polymer based

delivery system described. Anti-MDR strategies may thus show the highest clinical

efficacy when administered in combination with conventional chemotherapeutic

regimens.

30

CHAPTER 2.

DESIGNING MULTIFUNCTIONAL BLOCKS FOR INTRA-

CELLULAR siRNA AND CHEMOTHERAPY DELIVERY

2.1. Introduction

As previously discussed, in order to generate self assembled HA nanoparticles,

the hydrophilic HA should be derivatized by chemical conjugation of hydrophobic fatty

acid chains. This amphiphilic HA conjugate could be capable of making self assembled

stable particles in aqueous environment. Since HA has multiple functional groups

available for chemical conjugation, several HA derivatives could be made for the purpose

of encapsulating siRNA along with the chemotherapeutic drugs such as cisplatin,

doxorubicin, etc. With this aim, in this study, a combinatorial library of lipid modified-

HA derivatives were synthesized by varying the carbon chain lengths and nitrogen

content of the polymer to generate a series of novel derivatives that could reduce and/or

shield the negative charge on the anionic HA polymer, thus facilitating oligonucleotide

complexation and encapsulation. These derivatives were synthesized by chemical

conjugation of hydrophobic acid chains to the hydrophilic HA backbone through amide

formation. In addition to siRNA encapsulation, several of these hydrophobically modified

derivatives were also used for chemotherapeutic drug encapsulation. A panel of

derivatives was screened to identify the best one for siRNA and chemotherapeutic drugs.

In addition to those derivatives, the PEG modified and Thiol modified versions of HA

were also made to increase the stability of the particles that are being made from those

hydrophobically modified versions.

31

2.2 Materials and Methods

2.2.1. Preparation and characterization of HA modified functional blocks

2.2.1.1. Synthesis of amino lipid-modified HA derivatives

2.2.1.1.1.Modification of HA with monofunctional amino lipids

Mono-functional lipid amines (e.g., butyl amine C4; hexyl amine C6, or Octyl

amine C8) were chemically conjugated to the backbone of hyaluronic acid by coupling

the end group primary amine of the fatty amine with the carboxylic acid group of

hyaluronic acid in the presence of a coupling agent, 1-ethyl-3-[3

dimethylaminopropyl]carbodiimide hydrochloride (EDC) and n-hydroxy succinimide

(NHS). In brief, sodium hyaluronate (MW 20 kDa, 100 mg, 5 mole) was dissolved in 5

ml of dry formamide in a glass scintillation vial by warming up the reaction mixture at

40C. After obtaining a clear solution the reaction mixture allowed to cool to room

temperature and then ~3.6 mg of the fatty amine (~ 27.5 mole) was added to the

solution. The reaction mixture was then slowly added into a vial containing EDC (200

umol) and NHS (200 mol) in DMF (2 ml). The reaction mixture was allowed to stir for

12 h using a magnetic stirrer. The resulting solution was dialyzed using cellulose dialysis

membranes (MW cut off ~ 12-14 kDa) against deionized water/methanol mixture (1v/3v-

1v/1v) for 24 h and subsequently with deionized water for 48 h. The purified product was

then lyophilized and stored (yield: 85 mg, ~81%, off-white fibrous product). A 3 mg

portion of the lyophilized product was dissolved in 600l of D2O and characterized by

400 MHz 1H-NMR spectroscopy (Varian Inc., CA) for determining the percent lipid

modification.

32

2.2.1.1.2. Modification with polyamines

To an aqueous solution solution of sodium hyaluronate (MW 20 kDa, 100 mg, 5

mole) was added a 30-fold molar excess of the diamine (namely 1,4 diaminobutane, C4;

1,6 diaminohexane C6 or 1,8 diaminoocatne, C8). The pH of the reaction mixture was

adjusted to 7.5 with 0.1M NaOH/0.1M HCl and was added slowly into a mixture of 1-

Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, 1mmol) and N-

hydroxysulfosuccinimide o(sulfo-NHS,1mmol) 1 ml deionized water. After mixing using

with a magnetic stirrer, the pH of the reaction was maintained at 7.5 by the addition of

0.1 M NaOH for about 2 h and the reaction was allowed to proceed for 12 h. The HA-

lipid modified derivatives were purified by extensively dialysis using celluose

membrance (MW cut off~ 12-14 kDa) against deionized water for 48 h with frequent

replacement of deionized water. The purified product was then lyophilized and stored

(yield: 90 mg, ~86.5 %, off-white fibrous product). A 3 mg portion of the lyophilized

product was dissolved in 600l of D2O and characterized by 400 MHz 1H-NMR

spectroscopy (Varian Inc., CA) for determining the % lipid modification.

2.2.1.1.3. Modification with poly(ethyleneimine)

Hyaluronic acid was chemically modified with polyethyleneimine (PEI, MW 10

kDa) by using a coupling agent, 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide

hydrochloride (EDC). In brief, sodium hyaluronate (MW 20 kDa, 100 mg, 5 mole) was

dissolved in 5 ml of dry formamide in a glass scintillation vial by warming up the

reaction vial up to 40C. After obtaining a clear solution the reaction mixture allowed to

cool to room temperature and then ~3.3 mg of the PEI (~ 0.33 mole) was added to the

33

solution. Then EDC (10 umole) was added into the reaction mixture and stirred for 12 h

using a magnetic stirrer. The resulting solution was dialyzed using cellulose dialysis

membranes (MW cut off ~ 12-14 kDa) against deionized water for 96 h. The purified

product was then lyophilized and stored (yield: 90 mg, ~86%, off-white fibrous product).

A 3 mg portion of the lyophilized product was dissolved in 600l of D2O and

characterized by 400 MHz 1H-NMR spectroscopy (Varian Inc., CA) for determining the

% lipid modification.

2.2.1.2. Synthesis of Thiol-Modified HA Derivative

Thiol functionalized HA was synthesized by dissolving 5 g of HA (mwt 20 kDa,

10mmol) in 250ml of PBS solution (pH 7) and mixed well until no aggregation was

observed. Three molar excess amounts of EDC (37.5mmol) and HoBt (37.5mmol) were

added and stirred for 2 h, and then cystamine dihydrochloride (37.5mmol) was added

drop wise and mixed overnight. The reaction mixture was dialysed thoroughly using

cellulose dialysis membranes (MW cut off ~ 12-14 kDa) for 48 h to remove unreacted

cystamine and by products. Subsequently, the thiol modified crosslinked hyaluronic acid

polymer was treated with five molar excess of DTT and stirred for 24 h to cleave the

disulfide bond in the conjugated cystamine yield the water soluble conjugate. Thiol

functionalized HA (HA-SH) was dialyzed against deionized water at pH 3.0 for 96 h

(mwt cutoff: 12-14 kDa). The final product was lyophilized and stored at -20C until use.

The percent thiolation was determined by 400 MHz 1H-NMR spectroscopy (Varian Inc.,

CA) and by Elman’s assay.

34

2.2.1.3. Synthesis of PEG-modified HA derivative

For the preparation of the PEG modified hyaluronic acid conugate a amine

functional PEG (PEG-NH2) was chemically conjugated to the backbone of HA in the

presence of a coupling angen, 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide

hydrochloride (EDC) (EDC) and n-hydroxysuccinimide (NHS In brief, sodium

hyaluronate (MW 20 kDa, 100 mg, 5 mole) was dissolved in 5 ml of dry formamide in

a glass scintillation vial by warming up the reaction mixture at 40C. After obtaining a

clear solution the reaction mixture allowed to cool to room temperature and then ~5.5

mg of the PEG-NH2 (~ 2.75 mole) was added to the solution. The reaction mixture was

then slowly added into a vial containing EDC (200 umol) and NHS (200umol) in dry

DMF (2 ml). The reaction mixture was stirred for 24 h and then dialysed using cellulose

dialysis membranes (MW cut off ~ 12-14 kDa) against deionized water/methanol mixture

(1v/3v- 1v/1v) for 24 h and subsequently with deionized water for 48 h. The purified

product was then lyophilized and stored (yield: 80 mg, ~79 %, off-white fibrous product).

A 3 mg portion of the lyophilized product was dissolved in 600l of D2O and

characterized by 400 MHz 1H-NMR spectroscopy (Varian Inc., CA) for determining the

% PEG modification.

2.2.2. Self assembly and siRNA encapsulation

Lipid modified HA derivatives (HA-C4, C8, C12, C18, choline, spermine and

PEI) were suspended in distilled water at different concentrations (1-10 mg/ml) and let

the solution sit at room temperature for ~15 minutes. The freshly made particles were

allowed to sit at room temperature for 30 minutes. Their average diameters and size

35

distribution were estimated by dynamic light scattering using Malvern Zetasizer. Zeta

potential of the prepared complex was evaluated by using the same machine (Table 1).

The HA-lipid/ siRNA complexes were prepared by mixing 10 l of 0.1-0.5mg/ml

siRNA (pH 4.0 or 7) with 90 l of 1-5mg/ml HA-L solution. Mixed and vortexed well for

a min and incubated at room temperature for 15 min. The complexes were prepared at

several polymer: siRNA weight ratios, ranging from 6:1 to 450:1 to ensure the complete

binding of siRNA by the polymers. To determine the average particle size and

distribution of the siRNA encapsulated HA-NPs, dynamic light scattering (DLS)

measurements were performed using Malvern Zetasizer 3000 at 25oC. Zeta potential of

the prepared complex was also evaluated by the same instrument.

The ability of these complexes to release siRNA was then determined by treating

these samples with competing polyanionic, polyacrylic acid. First, a 5 l complex was

diluted to 10 l with water. Then 10 l of 2% PAA was added to this mixture and

vortexed. These samples were then run on gel along with the PAA untreated samples (5

l to 20 l) to compare the ability of complexation by monitoring free siRNA band.

2.2.3. Evaluating cell uptake and in vitro gene silencing

To assess the ability of the polymer NPs to release the siRNA into cells, the Cy3

labeled siRNA was formulated in the nanoparticles at 54:1 polymer: siRNA weight ratio

according to the above mentioned method. These particles were then incubated with 2 x

104 MDA-MB-468 cells containing 100nM siRNA at 37 C. After incubation for 12 hours,

the cells were washed with PBS, trypsinized and uptake of Cy3 labeled siRNA was

determined by Becton-Dickinson flow cytometer. The data was analyzed with Cell Quest

36

software. In parallel, the same complexes were incubated with cells grown on the glass

cover slips for 12 hours to assess the intracellular trafficking of siRNA. At the end of the

incubation period, the cells were washed three times with PBS, fixed in

paraformaldehyde in PBS for 10 minutes. Localization of the siRNA in cells was

visualized by a Zeiss confocal microscope (Carl Zeiss microscope systems). To

determine if the NPs enter the cells by receptor mediated pathway, competitive inhibition

studies were performed. The medium was replaced with serum free medium containing

HA polymer (10 mg/ml) for an hour. Then the Cy3 labeled siRNA/ HA-NP was added to

MDA-MB468 cells, followed by incubation for 12 hours. In parallel, another set of same

cells were treated with Cy3 siRNA encapsulated HA-NP alone. The cells were then

washed with PBS and visualized under the fluorescence microscope. Also, cells were

harvested as described previously and ran the flow cytometer to quantitate the positive

cells. In another instant, another type of cells that do not express CD44 (or at a very

lower level) were also treated with Cy3 siRNA/HA-NP particles. Localization of the

complexes in cells was visualized by fluorescence microscope.

PLK1 siRNA was complexed with HA-NPs (HA-C8, C12, C18, 1-6 diamine and

1-8diamine, HA-SP, HA-PEI) at mass ratios of 90:1, 54:1, 45:1 and 27:1 (polymer:

siRNA) as previously described. These complexes were then reverse transfected into

MDA-MB-468 cells and incubated for 48hrs at siRNA concentrations of 300, 200 and

100nM. After incubation, cells were harvested and the RNA was extracted. RNA was

used to run quantitative PCR to assess the message levels. mRNA knockdown was

determined by normalizing the PLK1 expression levels to the endogenous GAPDH

levels. To determine if chloroquine, the endosome disrupter helps release the particles

37

that are stuck in the endosome, the MDA-MB-468 cells were incubated with HA-PEI/

PLK1 or HA-SP/PLK1 complexes made at a mass ratio of 27:1 in the presence and

absence of 100 M chloroquine in the medium and incubated for 48hrs. After the

incubation, as previously described, RNA was extracted from the cells and PCR was run

to determine the PLK1 mRNA knockdown

2.2.4 Encapsulating doxorubicin and cisplatin

Encapsulation of cisplatin and doxorubicin were tried in variety of HA

derivatives. C4, C6, C8, C12, C18 and poly(ethyleneimine) (PEI) modified versions were

used initially to encapsulate doxorubicin (Figure 9). Ninety-l of 3 mg/ml HA derivative

was mixed with 10 l of 0.5 mg/ml doxorubicin solution. After vortexing well and

keeping it at RT for 15-20 minutes, it was dialysed over night in 10K dialysis cassettes

against PBS to get rid of the un-encapsulated drug. Following that, the particle

characterization was done and determined the percent drug encapsulated by disrupting

the particles and measuring the absorbance at 705 nm. In parallel, a standard curve was

also run with doxorubicin alone to quantitate the doxorubicin content. Once they were

characterized, they were incubated with H69AR cells at a range of drug concentration. 5

days post incubation, the MTS reagent was added to the cells and determined the percent

viability. Likewise, the cisplatin was also encapsulated in different derivatives. 90ul of

10mg/ml HA derivative was mixed with 10 l of 10 mg/ml cisplatin solution (in

DMSO). As described for doxorubicin, the complex was kept at RT for 15 min and

dialysed against water to get rid of the un-encapsulated cisplatin. A calorimetric method

was developed to determine encapsulated cisplatin concentration using O-phenyl

38

diamine. These particles were then added to A549DDP

cells along with cisplatin solution

at a concentration range of 500 M to 1 M to determine the IC50. In addition to HA-

ODA/ cisplatin particles, another set of particles were also made including HA-PEG. 90

l of HA-ODA (10mg/ml) was initially mixed with 90 l of HA-PEG (10 mg/ml) and

kept it for few minutes at RT. Then 10 l of cisplatin (10 mg/ml) was added to the

above mixture and vortexed well. After dialysing and characterizing, these particles

were also added to cells along with the others to compare the cell viability.

2.3. Results and Discussion

As described before, a combinatorial library of lipid modified-HA derivatives

were synthesized by varying the carbon chain lengths and nitrogen content of the

polymer to generate a series of novel derivatives that could reduce and/or shield the

negative charge on the anionic HA polymer, thus facilitating oligonucleotide

complexation and encapsulation. As reported, these derivatives were synthesized by

chemical conjugation of hydrophobic acid chains to the hydrophilic HA backbone

through amide formation. By varying the molar ratio of the reagents, the degree of

modification was controlled in the range of 5-20% when the reactions were carried out

in aqueous solvents. As described in detail, several different approaches were taken to

synthesize a series of derivatives that vary in carbon chain lengths, number of amine

groups, and other variables to understand the structure-activity relationship.

In the first approach of making lipid modified HA derivatives, primary amine

containing fatty acid chains from C4 to C18 (butylamine, hexylamine, octylamine,

39

dodecylamine and stearylamine) (Figure 4), were reacted with HA in the presence of

EDC/NHS in dimethyformamide (DMF).

The product was purified by dialysis. Diamines were reacted with HA in the

presence of EDC/sulfoNHS to selectively react with one of the amines (Scheme 1).

Alternatively, the reaction was also carried out in such a way that one of the amines in

the diamine was protected with BOC group before reacting with HA.

Figure 4:Fatty acid chains carrying one or more amine groups

40

Scheme 1: Synthetic procedure for the preparation of fatty acid modified HA.

The reactions was carried out using organic solvent (formamide) (A), or in aqueous

conditions (B) to achieve different products

After the EDC coupling reaction was completed, the BOC group was deprotected

to free the primary amine. Similarly, with the help of a spacer, the N containing chain

was extended by sequentially reacting with another diamine (Scheme 2). Fatty acid chain

incorporations help self assembly of particles. Derivatives with chain lengths from C6 to

C18 with no free nitrogens (HA, OA, DDA and SA) generated good size particles (Table

1) but did not encapsulate siRNA efficiently. Addition of extra nitrogen to the fatty acid

chain (diamines) enhanced the encapsulation the siRNA and facilitated the self assembly

into nano-sized structures.

A B

41

Scheme 2: Synthetic procedure for the preparation of

HA derivatives with varying nitrogen content.

This reaction was carried out by sequential addition of fatty amines.

However, the particles formed were still negatively charged and unable to

show siRNA activity in cells. This may be due to lack of entry into cells or lack of

release from the endosomes or the combination of both. To address this issue, the

42

second approach was taken to react and incorporate fatty acid chains with

polyamines.

HA Derivative siRNA encapsulation

Size (nm) +siRNA

Charge (mV) + siRNA

HA- butylamine in water C4

- - -

HA- hexylamine in water C6

- >1000 ± 1 -20

HA- octylamine in water C8

- 200 ± 0.3 -20

HA-stearylamine in water C18

- 190 ± 0.3 -15

HA- 1,6 diaminohexane in water + 320 ± 0.5 -8

HA-1,8 octadiamine in water + 142 ± 0.2 -10

HA- choline in water + 175 ± 0.4 0

HA-spermine in water + 190 ± 0.3 +16.5

HA-PEI in water + 180 ± 0.1 -22.8

HA-PEI in PBS + 50 ± 0.9 -6.5

HA-PEI/HA-PEG in PBS + 85 ± 0.9 -5.5

HA-PEI/HA-PEG/ HA-SH in PBS + 90 ± 1.2 -8.5

Table 1: Characteristics of HA derivative/ siRNA particles:

Illustrative examples from each class of lipid chain that was used for derivatization

In the second approach, with the aim of introducing multiple nitrogens to

HA surface, polyamines were reacted with HA in the presence of EDC and

sulfoNHS (Figure 5). Different ratios of the reagents were used to optimize the

reaction conditions. Although the idea of introducing multiple amines to the HA

43

backbone seems to be very attractive, the reaction conditions are not that straight

forward. As it is important to react with only one of the primary amines to get the

benefit from the rest of the free amines, the conditions have to be chosen carefully.

Figure 5: Select examples of polyamines used for HA derivatization

In the extreme case, the reactions could occur with all the amines and end up as a

cross linked product. Each of the above components was evaluated for self assembly,

siRNA encapsulation and activity in cells. To react specifically with one of the primary

amines, the sulfo-NHS/ EDC reactions conditions were used in the aqueous medium

(Scheme 1). Instead of having two primary amines at both sides of the fatty acid chain,

one of them was converted into quaternary amines, to reduce the competition of those

two amines towards HA. First, the carboxylic acid end of the fatty acid was reacted with

a quaternary amine containing group. This was further reacted with the carboxylic acid

group of the HA to generate the modified version with a permanent charge.

44

Although the ideal situation would be to have ionizable nitrogen, which becomes

positively charged at lower pH and encapsulates siRNA which then becomes neutral at

the physiological pH, we evaluated this strategy to address the issues with the reactions

involving multiple amines.

As we started obtaining some level of activity in cells with spermine derivatized

HA, we wanted to improve the percentage modification of spermine on the surface of HA

by altering the reaction conditions. To address this, the polymer is reacted with

polyamines in THF in the presence of DCC/NHS (Scheme 3) with the assumption that

the modifications be increased without additional cross linkings and that would further

overcome the negative charges on the HA surface and thereby enhance the encapsulation,

cell entry and endosome escape to ultimately show improved silencing.

Scheme 3: Synthetic procedure for the preparation of polyamine derivatized HA

45

In the last approach, with the intention of increasing the encapsulation/ endosome

release and activity, the HA backbone was modified with an extreme polyamine,

poly(ethyleneimine) (PEI) under limited reaction conditions without getting any cross

linkings. PEI has multiple amine groups that seem to efficiently condense with siRNA

and form a core within self assembled particles (Figure 6). On the complexation with

siRNA, the zeta potential was inverted from positive for the PEI to negative for the

siRNA/HA-PEI, reflects the core-shell structure of the HA-PEI/siRNA complex with HA

backbone exposed in the shell and the PEI grafted chains complexed with RNA

molecules in the core.

Figure 6: Proposed structure of PEI-modified HA following self-assembly with siRNA.

By designing the complexes to include the HA molecules in the outer

shell, we will exploit the targeting properties of HA. Moreover, the negative

HA

(-ve charge) PEI

(+ve charge)+

HA-PEI/siRNA (nanoparticle)

PEI modified HAsiRNA (-ve charge)

46

charges present on the surface of HA can effectively shield the positive charges of

the RNA/PEI complex, which leads to a decrease of the toxicity that is normally

associated with positively charged molecules. The structures of the derivatives

were confirmed with 1H NMR. (Figure 7)

Figure 7:1H NMR of HA derivatives: HA-PEI (A) and HA-spermine (B)

In order to produce the HA nanoparticles, the modified derivatives were dissolved

in water at concentrations ranging from 1-10mg/ml. It was noted that a critical

concentration required to make good size particles varied for different classes of lipids. A

slightly higher concentration (5mg/ml) was needed for lipids with one or 2 nitrogens

(HA-C6, C8, C12, C18, 1-6 diamine and 1-8 diamine derivatives). However, a 3mg/ml

polymer concentration was found to be the ideal concentration for most of the polyamine

modified HA (HA-choline, spermine and PEI). The derivatives with C4 did not make any

assembled particles. Derivatives with C6 chain started to make particles but at larger size.

C6 chain with 2 amines or C8 chains with one amine and above self assembled to form

PEI in HA-PEI (10%) HA-Spermine (30%)

A B

47

good size particles suggest that certain hydrophobicity is necessary for self assembly and

stable particle formation (Table 1)

Once the lipid modified HA was shown to self assemble into nanoparticles, the

next step was to determine if these particles can take up siRNA. siRNA was complexed

with fatty acid modified HA at a mass ratios of 450:1, 270:1, 180:1, 90:1, 54:1, , 45:1,

27:1 and 9:1 (polymer: siRNA) at different polymer concentrations (1-10mg/ml).

Derivatives with different degree of modification and different number of nitrogens

needed individual optimization. Again, a maximum encapsulation and a reasonable

particle size in the range of 150-300nm were seen only at a particular mass ratio of

polymer to siRNA, and this was changed from one class of lipid to the other, probably

because of the charge contribution from nitrogens. Zeta potential values were also

changed from one set of formulation to the other (from -20mV to +16mV). The best

polymer-to-siRNA mass ratio for class 1 lipids (1-6 diamine, 1-8 diamines and choline)

was seemed to be 450:1, where as the ratio for the polyamine derivatives (spermine and

PEI) was at 54:1. It was also interesting to note that the encapsulation of siRNA was

possible only at lower pH for all but PEI derivative. siRNA was encapsulated nicely in

the HA-PEI derivative at neutral pH. When particles were made in PBS, the particle

sizes were small as ~60nm. Derivatives that made good size particles ranging from 150-

300nm in size were tested for siRNA encapsulation and activity in cells.

To confirm if the particles encapsulated siRNA, an agarose gel electrophoresis

was utilized. The polymer/ siRNA complex was prepared by mixing HA derivative with

siRNA at different mass ratios (54:1, 27:1 and 9:1) and incubating at RT for 30min.

48

These complexes were run on gel and determined the mean density of siRNA bands

(Figure 8).

Figure 8: Electrophoretic retardation analysis of siRNA binding by HA-PEI derivatives.

This gel results corresponds to different polymer/ siRNA

mass ratios (90:1, 54:1, 45:1). The release of intact siRNA by polyacrylic

acid was shown in each case.

The binding percentage was calculated based on the relative intensity of free

siRNA band in each well with respect to wells with free siRNA (in the absence of any

polymers). Upon complete complexation, the free band completely disappeared. In cases

when there was complete complexation and there was no free band on gel, an alternate

method was utilized to confirm that there was siRNA encapsulation. Complexes were

treated with a polyanionic poly acrylic acid and run on gel. This anionic poly (acrylic

acid) (PAA) would compete with the anionic polymer and release the siRNA which then

appears as a free band in the gel. The ability of complexes to release siRNA after a

challenge with the competing polyanionic PAA was determined by measuring the mean

density of siRNA band that appear after the treatment. When particles were treated with

poly acrylic acid, complex with and without PAA were run on gel to confirm that the

siRNA was intact when it was complexed. At the suggested mass ratios, the

encapsulation efficiency for all the derivatives was 100% by gel retardation assay.

+PAA +PAA +PAA

49

The derivatives that made suitable size particles and demonstrated efficient

siRNA encapsulation were taken forward to evaluate the activity in cells. The prepared

Cy3siRNA/polymer complexes were reverse transfected into cells expressing CD44

(MDA MB-468) at 50nM siRNA concentration and incubated for 12 hours. Clear

fluorescent signals were observed in cytoplasm of cells that were treated with siRNA

formulated with HA-PEI derivative (Figure 9). Cy3 siRNA encapsulated HA-C8, C18,

choline, spermine derivatives also demonstrated cell uptake when tested in the same cells.

No detectable signals were detected in Hep3B cells that do not or minimally express

CD44 receptors.

Figure 9: Confocal microscopy images showing cell uptake of HA-PEI

MDA MB-468 cells after treatment with HA-PEI/Cy3 siRNA at 50nM for

12hrs. The internalized siRNA appears as red.

In order to determine if these HA particles enter into the CD44 expressing cells by their

receptors, a competition assay was performed. The cells were pre-treated with 2ml of

serum free culture medium containing HA at 10mg/ml before treating with Cy3 labeled

HA-PEI nanoparticles to possibly block all the receptors expressed on the cell surface. A

large reduction in cell uptake was noticed (Figure 10) in the cells that were pre-treated

50

with excess HA, suggests that these particles traffic into cells by receptor mediated

pathway (Figure 1B). No activity was detected in cells that do not express CD44 again

confirming that this is a receptor specific cell entry.

Figure 10: Competition assay to show receptor mediated cell entry

MDA-MB468 cells were incubated with HA-PEI/Cy3 siRNA in the presence and

absence of excess ree HA.

Cell uptake studies showed that the hydrophobically modified derivatives of HA,

despite their resultant negative charge, entered into cells but gave no cellular activity. It

has been demonstrated previously that the cell entry was receptor mediated and it is

independent of the charge on the surface. The presence of positive charge was most likely

to help the complex to get out of the endosome. All the HA derivatives demonstrated cell

uptake but showed no gene down regulation except the HA-SP and HA-PEI derivatives at

a specific ratio. In order to confirm that these complexes and complexes made with HA-

PEI and HA-SP with siRNA at ratios other than 54:1, are stuck in the endosome without

being released, the transfection was done in the presence of a weak base chloroquine. As

literature suggests30

, this small molecule helps to disrupt the endosome in addition to

inhibit the endosome-lysosome fusion. Treatment of cells with HA-PEI/ siRNA at 27:1

HA-PEI/Cy3 HA-PEI/Cy3 + HA

51

ratio and chloroquine demonstrated activity in cells (Figure 11) whereas the same

complex without chloroquine failed to show cell activity. Similarly, the particles made at

45:1 and 9:1 ratio did not show activity but showed activity in the presence of

chloroquine. Particles made with HA derivatives other than HA-PEI and HA-SP such as

HA-choline also showed activity in the same cells in the presence of chloroquine, again

suggesting that these particles enter the cells and stay in the endosome without being

released.

Figure 11:PLK1 gene silencing in the absence and presence of chloroquine

HA-SP (A) HA-PEI/ PLK1 siRNA (B) mediated PLK1 gene silencing was carried out in the

presence and absence of chloroquine in MDA MB 468 cells at 27:1 ratio. Cells treated with

PLK1 siRNA formulated HA-SP or HA-PEI or CTL siRNA formulated HA-SP or HA-PEI in the

presence or absence of chloroquine for 48 hours. The PLK1 gene expression was measured by

qPCR. Data represented as a mean ± SD (n=3). * P = 0.01 compared to PBS and CTL treatment

groups

After confirming the cell uptake, the ability of this complex to deliver a functional

siRNA was evaluated using PLK1 targeted siRNA to inhibit PLK1 gene expression in

CD44 expressing cells. Cells were transfected with different HA derivative/ siRNA at

0

0.2

0.4

0.6

0.8

1

1.2

1.4

PLK

1/h

GA

PD

H

100nM siRNA, 100uM chloroquineHA-PEI:siRNA 27:1

~40%

0

0.2

0.4

0.6

0.8

1

1.2

PLK

1/h

GA

PD

H

200nM siRNA, 100uM chloroquineHA-SP:siRNA 27:1

~38%**

52

different concentrations (50-300nM). Although, all the fatty acid modified HAs have

demonstrated cell uptake, most of them failed to down regulate the PLK1 gene

expression. The spermine derivatized HA demonstrated about 40% activity at 100, 200

and 300nM while the control siRNA/ HA-SP in the same study did not produce any

activity (Figure 12A). It’s interesting to note that the HA-SP demonstrated activity only

at the mass ratio of 54:1 (polymer: siRNA). It failed to demonstrate activity at a ratio of

27:1 or 9:1 (polymer: siRNA) or lower (Figure 12B). It’s worth noting that the zeta

potential of the 54:1 ratio complex was around +16.5mV whereas the other ones at ratios

of 27:1 or 9:1 was around +5-6 mV or close to neutral.

53

Figure 12: HA-SP/ PLK1 siRNA mediated PLK1 gene silencing in MDA MB 468 cells

Cells treated with PLK1 siRNA formulated HA -SP or CTL siRNA

Formulated HA-SP for 48 hours at mass ratios (1) 54:1 (A) or (2) 45:

or 27:1 or 9:1. (B) The PLK1 gene expression was measured

by qPCR. Data represented as a mean ± SD (n=3). * P = 0.01 compared

to PBS and CTL treatment groups

Since it’s believed that these complexes enter into the cells by receptor mediated

pathway, the resultant positive charge on the surface probably helps the complex to get

out of the endosome. In addition to HA-SP, the PEI modified HA also demonstrated

activity in the CD44 expressing MDA-MB 468 cells (Figure 13). Again at the ratio of

54:1, the complex demonstrated good activity with good dose response. This complex

0

0.2

0.4

0.6

0.8

1

1.2

PLK

1/h

GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2

PLK

1/h

GA

PD

H

HA-SP:siRNA 54:1

HA-SP:siRNA 45:1 or 27:1 or 9:1

* *

A.

B.

54

also failed to show activity at 27:1, 18:1 or 9:1 ratios. On contrary to HA-SP/ siRNA

complex, the HA-PEI became completely negative in charge after encapsulating the

siRNA, and despite of this, the complex showed good activity in cells suggests the

core/shell structure of the HA-PEI/siRNA complex with HA backbone exposed in the

shell and the PEI grafted chains complexed with siRNA molecules in the core.

55

Figure 13: HA-PEI/ PLK1 siRNA mediated PLK1 gene silencing in MDA MB 468 cells.

Cells treated with PLK1 siRNA formulated HA-PEI or CTL siRNA formulated HA-PEI

for 48hours at mass ratios (1) 54:1 or (2) 45:1 or 27:1 or 9:1. The PLK1 gene expression

was measured by qPCR. Data represented as a mean ± SD (n=3).*p= 0.01

and ** p =0.02 compared to PBS and CTL treatment groups

In the next step, the encapsulation of the chemotherapeutic drugs such as cisplatin

and doxorubicin in HA derivatives were tried. C4, C6, C8, C12, C18 and PEI modified

versions were used initially to encapsulate doxorubicin (Figure 14). Out of all these

derivatives tested, the C8 version gave the best encapsulation of doxorubicin and best

activity in cells.

0

0.2

0.4

0.6

0.8

1

1.2

1.4

PLK

1/h

GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2

1.4

PLK

1/h

GA

PD

H

HA-PEI:siRNA 54:1

HA-PEI:siRNA 45:1 or 27:1 or 9:1

***

56

Figure 14: Optimizing HA/doxorubicin particles

Doxorubicin was encapsulated in fatty acid chain modified HA particles and characterized (A)

and determined the IC50s in H69AR cells (C). The particles that have the similar IC50 as DOX

alone was further optimized for better size particles (B) and activity (D)

Based on the results obtained for doxorubicin, encapsulation of cisplatin was

initially tried in HA-C8 derivatives. Although the HA-C8 derivative encapsulated about

12% cisplatin and made reasonable size particles, the empty particles seemed to kill the

cells at higher concentration as good as the one with cisplatin (Figure 15). Encapsulated

cisplatin was quantitated with a calorimetric assay using O-phenyl diamine.

HA-C4 45/1 5 ~700-1000

HA-C6 45/1 5 ~600-900

HA-C8 45/1 5 ~700-900

HA-C18 45/1 5 ~1000

HA-CA 45/1 5 ~1000

mass polymer size

Ratio mg/ml nmHA-C8/ dox 45:1 5 ~600-800

90:1 5 ~350

450:1 5 ~300

900:1 5 ~300

4500:1 5 ~600

270:1 3 ~280

54:1 3 ~190

mass polymer size

ratio mg/ml nm

A B

C D

57

Figure 15: Encapsulation of cisplatin in HA-C8 particles

Cisplatin was encapsulated in C8 modified HA particles and

characterized(A).The viability of HA-C8 with and without cisplatin

was measured along with cisplatin alone (B).

HA-ODA on the other hand, killed the cells only when it contained cisplatin.

Along with this, the HA-ODA/PEG/cisplatin particles were also made and

determined the encapsulation efficiency. The cytotoxicity of the two particles (HA-

ODA/cisplatin and HA-ODA/PEG/cisplatin) were found to be slightly better than

the cytotoxicity of cisplatin alone in resistant A549 cells (Figure 16).

Encapsulation Size (nm) Charge (mV)

HA-C8 12% 250 -48.3

0

20

40

60

80

100

120

50 25 10 5

% v

iab

ility HA-C8/cis

HA-C8

cis

58

Figure 16: Encapsulation of cisplatin in HA-ODA particles

Cisplatin was encapsulated in ODA modified HA particles with and

without PEG and characterized (A). The viability of HA-ODA and

HA-ODA/PEG particles were measured with and without cisplatin

along with cisplatin alone as a control

2.4. Conclusions

A combinatorial library of lipid modified-HA derivatives were synthesized and

screened for self assembly and siRNA encapsulation. Different types of lipid chains were

used by varying the carbon chain lengths and nitrogen content of the polymer to generate

a series of novel derivatives that could reduce and/or shield the negative charge on the

anionic HA polymer, thus facilitating oligonucleotide complexation and encapsulation.

After extensive screening, the HA-PEI derivative was chosen for siRNA encapsulation

and used for further in vitro and in vivo evaluation. These HA-PEI particles encapsulated

0

0.2

0.4

0.6

0.8

1

1.2

100 50 25

% v

iab

ility

HA-ODA/cis

HA-ODA/PEG/cis

cisplatin

HA-ODA

HA-ODA/PEG

size % encapsulation

HA-ODA/cis 420nm ~14%

HA-ODA/PEG/cis 450nm ~15%

59

100% input siRNA and demonstrated good activity in cells that express saturating levels

of CD44 on their surface. Efficient cell uptake was nicely shown by encapsulating Cy3

labeled siRNA. By blocking the receptors artificially with excess of soluble HA, the cell

entry was blocked by ~85-90%, suggesting that the particles enter the cells by receptor

mediated pathway. These HA-PEI particles also demonstrated good gene silencing when

encapsulated PLK1 siRNA. It was also interesting to note that these particles seemed to

be active only when the polymer and siRNA were mixed at a particular ratio (54:1).

When the ratio is smaller than that they particles failed to show activity. However, the

same particles showed activity when the cells were pretreated with chloroquine, an

endosome disrupting agent, suggesting that those particles retain in the endosome without

being released. Also suggests that there was a minimum resultant positive charge should

be maintained to disrupt the endosomes.

In addition to siRNA encapsulation, these derivatives were also used for

chemotherapeutic drug delivery. Doxorubicin and cisplatin were encapsulated in different

derivatives to get maximum encapsulation efficiency. HA-C8/ doxorubicin particles not

only made reasonable size particles, but also demonstrated better cell killing in resistant

H69 (H69AR) cells compared to DOX alone. Cisplatin was also encapsulated in HA-C8

particles, but when tested these in resistant A549 cells at higher concentrations (as the

IC50 of cisplatin is much higher in these cells compared to the IC50 of DOX in H69AR

cells), these particles demonstrated toxicity even without cisplatin, may be because of the

higher loading of the lipid modified HA. However, cisplatin was not only successfully

encapsulated in HA-ODA derivatives but also showed no toxicity in cells as empty

particles at the similar higher doses.

60

Although these HA-ODA particles are not toxic as empty particles, they are cytotoxic

when they encapsulated cisplatin. These particles with and without PEG demonstrated

slightly better IC50 when compared to cisplatin alone.

61

CHAPTER 3

CHARECTERIZING SENSITIVE AND RESISTANT LUNG CANCER CELLS FOR

TARGETED DELIVERY

3.1. Introduction

The goal of this current study is to reverse the drug resistance in lung cancer by

down-regulating the resistance genes using siRNA followed by treating with

chemotherapeutic drug1. That requires a delivery system that delivers both siRNA and

chemotherapeutic drug together or separately. As previously pointed out, the delivery

seems to be a challenge, especially to soli tumors. To address this, in the current study, an

HA nanoparticle system was carefully designed in such a way that it could deliver siRNA

and different chemotherapeutic drugs efficiently. Since these HA seems to recognize the

CD44 receptors, our goal was first to identify cells with higher levels of CD44 receptors.

Since out ultimate goal is to reverse the resistance, the cells of choice should preferably

express higher levels of CD44 and certain level of resistance to either cispaltin or

doxorubicin or for both. To achieve this, a pair of drug sensitive/ resistant SCLC and a

pair of sensitive/resistant NSCLC cell lines were selected and screened for receptor levels

and extent of resistance.

3.2. Materials and Methods

3.2.1. Measuring CD44 levels in SCLC and NSCLC cells

A pair of NSCLC cells that are sensitive and resistant to cisplatin (A549/

A549DDP) and another SCLC pair of cells that are sensitive and resistant to doxorubicin

(H69/H69AR) were selected for this study. 1x10e6 cells were suspended in 100ul of

62

PBS in a tube and incubated with 100ul of 100:1 diluted CD44 specific antibody. After

1hr incubation, the cells were washed 3 times with PBS and analyzed on an automated

flow cytometer to measure the fluorescence intensity

3.2.2. Evaluate target knockdown using tool siRNA

All were cells were grown as previously described. 10,000 cells of each type were

plated per well. Following plating, PLK1 or SSB encapsulated HA-PEI particles were

made, diluted in serum free medium (100ul) and added to the cells in triplicates at 100 or

300nM siRNA concentrations. Following 48hr incubation, RNA was extracted from

cells and ran PCR using appropriate primers to determine the PLK1 and SSB knockdown.


As our goal was to reverse the resistance in both small cell lung cancer (SCLC)

and non-small cell lung cancer (NSCLC) cells, a pair of NSCLC cells that are sensitive

and resistant to cisplatin (A549/ A549DDP

) and another SCLC pair of cells that are

sensitive and resistant to doxorubicin (H69/H69AR) were selected. Cells were grown and

tested with CD44 specific antibodies to determine CD44 expression levels (Table 2).

Both A549 and its resistant cell line demonstrated saturated levels of CD44 expression.

H69AR cell line showed about 90% expression levels whereas its sensitive version

showed only 60% CD44 expression levels on the surface. This finding supports the

literature that the NSCLC cells express higher levels of CD44 compared to the SCLC

cells.

63

Table 2: CD44 receptor levels in SCLC and NSCLC cells

Cells were treated with CD44 antibody and quantitated the percent positive

cells by flow cytometry

In order to confirm if these CD44 levels correlate with the activity, cells were

treated with PLK1 encapsulated HA-PEI particles at 300 and 100nm concentrations and

looked at the target knockdown. Higher CD44 positive A549 and A549DDP

cells showed

good activity at 100 nM concentration. However, the activity was only 30% in H69AR

cells that express slightly lower levels of CD44. There was no activity observed in H69

cells (Figure 17) with the lowest levels of CD44 expression, suggest that there is good

correlation between the activity and the levels of CD44 in cell culture.

Cell line Indication CD44 expression levels

H69 SCLC ~60%

H69AR SCLC ~90%

A549 NSCLC >99%

A549DDP NSCLC >99%

64

Figure 17: Target (PLK1 and SSB) knockdown in A549/A549DDP and H69/H69AR cells

Sensitive (A&C) and Resistant (B&D) cells were transfected with PLK1 or SSB

encapsulated HA-PEI or HA-PLL particles at 100 and 300nM concentrations. Cells

were harvested and RNA was extracted after 48hrs. qPCR was run to determine the

target knockdown.

3.4. Conclusions

Based on the data discussed above, it was clear that the HA particles get into the

cells that express saturating levels of CD44 and demonstrate activity. Although the

H69AR cells express reasonable levels of CD44 on the surface (by FACS analysis), the

activity was several fold lower than the activity in A549 pair suggests that there may be a

threshold level of CD44 levels necessary for those particles to enter efficiently. The H69

cells that express only 60% CD44 receptors failed to show activity at the conditions

0

0.2

0.4

0.6

0.8

1

1.2

PLK

1/h

GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2

PLK

1/h

GA

PD

H

~70%

~47%

HA-PEI HA-PLL

~50% ~50%

A. A549 B. A549DDP

0

0.2

0.4

0.6

0.8

1

1.2

1.4

PLK

1/h

GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2

1.4

PLK

1/h

GA

PD

H

C. H69 D. H69AR

~30%

65

tested again confirm the fact that, a minimum levels of the receptors should be present on

the surface of the cells to allow the particles to get in.

66

CHAPTER 4.

IDENTIFYING THE KEY RESISTANT GENES IN SCLC AND NSCLC CELLS

AND DESIGNING APPROPRIATE siRNAs TO TARGET THEM

4.1. Introduction

Resistance to anticancer drugs is observed frequently in SCLC and NSCLC

patients. Most of the patients with SCLC have an initial successful response to

chemotherapy, but the majority relapses and their tumors become largely refractory to

further treatment. Most NSCLC tumors inherent resistant and are generally not

responsive to initial chemotherapy. As discussed previously, multidrug resistance is

believed to arise from multiple mechanisms which may operate singly or in combination,

including decreased drug efflux or increased drug efflux by transporters, activation of

detoxifying systems, activation of DNA repair systems and evasion of apoptosis. Over

expression of the transmembrane transport protein P-gp or mrp-1 have been detected in

many MDR tumor cells. As pointed out earlier, the resistance generated by these

molecules is referred to as pump mediated resistance. One approach to obstruct this pump

mediated drug efflux is down regulation of P-gp or mdr-1 or mrp-1 expression.

Literature also suggests that in multidrug resistance cancer cells, the drug-induced

apoptosis pathway is blocked often times because of the change of related enzymes and

proteins. Apoptosis mediated or non pump mediated resistance can also be overcome by

down regulating the expression of anti-apoptotic molecules such as survivin and bcl-2.

The RNA interference approach is being used to down–regulate gene expression in cells

and in tumors. So, identifying the genes that are responsible for resistance is critical.

67

Once the appropriate genes are identified in the resistant cells, the siRNA sequences can

be designed accordingly using powerful in silico/computational methods. In order to rank

the potency of those sequences, they can be screened in cells. To increase the stability

and reduce the off target effects of those potent siRNAs, chemical modifications can be

introduced and re-tested in cells to confirm the activity before testing in mice.


4.2.1. Identifying resistant genes by RT-PCR

Total RNA was extracted using Qiagen kit as described. 1ug RNA was used to

synthesize cDNA by oligo-dT primer and reverse transcriptase (invitrogen). Quantitative

assessment of gene expression normalized to the b-actin housekeeping gene was

performed with Platinum Taq DNA polymerase (Invitrogen) and Sybr Green I

(Invitrogen) on an ABI Prism 7700 system (Applied Biosystems). PCR primers were

used to amplify the cDNA as follows: for MDR1, 5’ GGT GCT GGT TGC TTA CA 3’

and 5’ TGG CCA AAA TCA CAA GGG T 3’, for mrp-1, 5’ GGA CCT GGA CTT

CGT TCT CA 3’ and 5’CGT CCA GAC TTC TTC ATC CG 3’, for survivin, 5’ ATG

GGT GCC CCG ACG TT 3’ and 5’ TCA ATC CAT GGC AGC CAG 3’, for bcl2, 5’

GGA TTG TGG CCT TCT TTG AG 3’ and 5’ CCA AAC TGA GCA GAG TCT TC 3’,

for bactin, 5’ CCA GAG CAA GAG AGG CAT CC 3’ and 5’ GCT GGG GTG TTG

AAG GTC TC 3’. PCR conditions were 94°C, 3 min; 94°C, 1 min; 72°C, 1.5 min; 34

cycles. Analysis of the PCR products was done on 1.5% agarose gels.

68

4.2.2. Designing siRNA sequences

All 4 genes (mdr1, mrp1, survivin and bcl2) were selected for further analysis. As

this is the case, siRNAs were designed for all 4 genes. By running Dharmacon algorithm,

50 sequences were initially selected. These sequences were then further processed

through an intensive computational method to select 10 best sequences. Based on the GC

content and biopred scores, 4-5 best sequences were selected for further screen in cells.

4.2.3. Screening siRNAs in resistant cells to identify the potent sequence

Four to five sequences for each gene were transfected in resistant A549 cells

using lipofectamine at 0.01, 0.1, 1 and 10nM concentrations. After incubating the cells

with siRNA/ lipofectamine complex for 24hrs, RNA was extracted from cells and ran

PCR to determine the gene down regulation. Human GAPDH was used as the

endogeneous control for those experiments

4.2.4. Introducing chemical modifications to selected siRNA sequences

and identifying the most potent sequence

Based on the in vitro screening, the 2 best sequences were selected for all 4

genes. 2’OMe modification was then introduced to all those 8 sequences in the endo

light format. These modified siRNAs were then tested in cells along with the unmodified

versions using lipofectamine as described earlier to check the activity. The best

sequence was selected for further in vivo testing based on this in vitro screen.

69


As our goal is to identify the resistant genes that are over expressed in the

resistant cells, cells were grown and RNA was extracted from both sensitive and resistant

SCLC (H69/H69AR) and NSCLC (A549/A549DDP

) cells. Using the appropriate primers,

RT-PCR was run using the RNA extracted from cells. Based on the RT-PCR results,

pump and non pump resistance genes (mdr-1 or mrp-1 & survivin or bcl2) were identified

for combination studies (Figure 18).

Figure 18: Identifying resistant genes in cisplatin/ DOX resistant SCLC and NSCLC cells

RNA was extracted from both resistant and sensitive cells. With appropriate primers, the RT-

PCR was run to identify the expression of resistant genes.

Survivin is over-expressed in resistant cell lines (A549DDP

and H69AR) compared

to the counter sensitive cell lines (A549 and H69), whereas, the mrp-1 was expressed in

both resistant and sensitive cell lines (A549, A549DDP, H69, H69AR) almost at the same

levels. Although mrp1 gene is a member of the ATP-binding cascade transporter super

family and involved in the efflux of cytotoxic drugs (such as doxorubicin), it has been

demonstrated in some cases that the over expression of this confers resistance to

mdr-1 mrp-1 bcl-2 survivin VEGF

A549

A549 DDP

b-actin

mdr-1 mrp-1 bcl-2 survivin

H69Ar

mdr-1 mrp-1 bcl-2 survivin

b-actin

H69

b-actin

mdr-1 mrp-1 bcl-2 survivin VEGF

b-actin

70

chemotherapy induced apoptosis and it seems to be associated with the over expression

of anti-apoptotic genes and the down regulation of pro-apoptotic genes. Therefore the

mrp-1 was also selected for combination studies. Because the genes are over-expressed in

the resistant cells, it is hypothesized that by down regulating these gene expression levels,

one can enhance the sensitivity of the chemo drugs such as cisplatin (in case of A549DDP

)

and doxorubicin (in case of H69AR) and ultimately reverse the resistance. In addition to

survivin and mrp-1 genes, bcl-2 and mdr-1 genes were also identified from this

experiment. bcl2 was slightly over expressed in resistant A549 tumors but the overall

expression level was much lower than the survivin expression level. Just like the mrp-1,

bcl2 was expressed almost equally in both resistant and sensitive H69 cells. mdr-1 was

not expressed in sensitive cell lines, but slightly expressed in both the resistant cells.

Despite the differential expression levels, all 4 genes were selected in this study to carry

out combination experiments and to address both pump and non-pump mediated

resistance. Survivin and bcl-2 are well characterized anti-apoptotic molecules expressed

widely in majority of the cancers, and their over expression leads to uncontrolled cancer

cell growth and drug resistance. This non-pump mediated resistance is attributed

primarily to the mechanisms responsible for the activation of anti-apoptotic cellular

defense (mainly applicable for cisplatin mechanism). Pump resistance on the other hand,

is mainly caused by membrane efflux pumps that decrease the anti-cancer drug

concentration inside the cells. Since many widely spread human MDR cancers activate

both pump and non pump resistance in response to chemotherapy treatment with anti

cancer drugs, simultaneous suppression of both types cellular resistance may be required

to substantially enhance the efficacy of the treatment. In order to down-regulate these

71

genes, siRNA sequences were designed using the dharmacon algorithm followed by an in

silico computational filtering process (Table 3).

Table 3: siRNA selection process

50 sequences were selected for each target using the dharmacon algorithm.

These sequences were passed through rigorous computational filtration

process to pick the best 10. Based on the biopred score and GC content,

further selection was carried out to narrow down the number of sequences to

4-5. Based on the activity in appropriate cells, 2 best sequences were

selected for introducing modifications. The best modified one, used on the

in vitro activity, was selected for in vivo evaluation.

Up to 4-5 best siRNA sequences were selected (Table 4) from the in silico

analysis and tested in resistant A549 cells to determine the target knockdown.

50 siRNA sequences selected using

dharmacon algorithm

10 best sequences selected

Computational in silico methods

best ~4-5 sequences selected

Biopred score, GC content etc

2 best ones selected

One best sequence for in vivo testing

Introduction of modifications/in vitro analysis

In vitro analysis

72

Table 4: Selected (unmodified) siRNA sequences against 4 resistant genes

siRNA sequences were selected following an in silico computational filtration

process

siRNAs at 10, 1, 0.1 and 0.01nM concentrations were tested in this study using

lipofectamine transfection. 24h after the transfections, RNA was extracted from cells and

processed for qPCR (Figure 19).

5’GCAAAGCACAUCCAAUAAAUU3’

5’UUUAUUGGAUGUGCUUUGCUU3’

5’GGGAGAACAGGGUACGAUAUU3’

5’UAUCGUACCCUGUUCUCCCUU3’

5’GGGAGAUAGUGAUGAAGUAUU3’

5’UACUUCAUCACUAUCUCCCUU3’

5’GGAAGUAGACUGAUAUUAAUU3’

5’UUAAUAUCAGUCUACUUCCUU3’

bcl-2 sequences mdr-1 sequences

Survivin sequences mrp-1 sequences

5’ GAGACAGAAUAGAGUGAUAUU3’

5’ UAUCACUCUAUUCUGUCUCUU3’

5’GGCGUAAGAUGAUGGAUUUUU3’

5’AAAUCCAUCAUCUUACGCCUU3’

5’CGGGCAGAAACAACUGAAAUU3’

5’UUUCAGUUGUUUCUGCCCGUU3’

5’CCUCUAAACUGGGAGAAUAUU3’

5’UAUUCUCCCAGUUUAGAGGUU3’

5’CCUCGACAUCUGUUAAUAAUU3’

5’UUAUUAACAGAUGUCGAGGUU3’

5’CCAGUGUUUCUUCUGCUUCUU3’

5’GAAGCAGAAGAAACACUGGUU3’

5’CCACGUACAUUAACAUGAUUU 3’

5’AUCAUGUUAAUGUACGUGGUU3 ’

5’CAAUGGGAUCAAAGUGCUAUU3’

5’UAGCACUUUGAUCCCAUUGUU 3’

5’GAGUGGAAUUCCGGAACUAUU3’

5’UAGUUCCGGAAUUCCACUCUU3’

5’AGGAAUUGGUUGUAUAGAAUU3’

5’UUCUAUACAACCAAUUCCUUU3’

5’CAGAAAGCUUAGUACCAAAUU3’

5’UUUGGUACUAAGCUUUCUGUU3’

5’GGAGGAUUAUGAAGCUAAAUU3’

5’UUUAGCUUCAUAAUCCUCCUU3’

5’CAGAGACUUCGUAAUUAAAUU3’

5’UUUAAUUACGAAGUCUCUGUU3’

5’CGAGUCACUGCCUAAUAAAUU3’

5’UUUAUUAGGCAGUGACUCGUU3’

73

Figure 19: BIRC5 (survivin) mRNA knockdown with survivin siRNAs in resistant A549 lung cells.

Six different unmodified sequences were screened at 4 different concentrations in A549DDP

cells

to rank the potency

Based on the activity, the two most potent sequences (#1 and #2) were selected for

further modifications. A 2’-OMe modification was introduced into these two sequences

and tested again in cells to confirm the activity (Figure 20).

0

0.2

0.4

0.6

0.8

1

1.2

BIR

C5

/hG

AP

DH

Sequence #1 #2 #3 #4 #5 #6

74

Figure 20: Survivin mRNA knockdown with unmodified vs modified survivin siRNAs in A549DDP

cells.

Cells were transfected with the 2 best unmodified survivin siRNAs along with the corresponding

modified versions at 10, 1 and 0.1nm concentrations. Target knockdown was determined 24hrs

after the transfections by qPCR (A). The sequences used are listed (B).

Since the sequence #2 did not lose any activity after introducing the modification,

it was selected for in vivo testing. The same procedure was followed for mrp-1, bcl-2 and

mdr-1 siRNA sequences as well. Out of the 4 mrp-1 siRNAs screened in cells, the best

0

0.2

0.4

0.6

0.8

1

1.2

BIR

C5

/hG

AP

DH

#1 #2

unmodified modified um m

A.

B.

Sequence #2 (modified) selected for in vivo

unmodified-S 5’GGCGUAAGAUGAUGGAUUUUU3’

AS 5’AAAUCCAUCAUCUUACGCCUU3’

modified- S 5’GGmCGmUAAGAmUGAmUGGAmUmUmUmUmU3’AS 5’AAAUCmCAUmCAUCUmUACGCCmUmU3’

Sequence #1

unmodified-S 5’ GAGACAGAAUAGAGUGAUAUU3’

AS 5’ UAUCACUCUAUUCUGUCUCUU3’

modified- S 5’GAGAmCAGAAmUAGAGmUGAmUAmUmU3’AS 5’mUAUmCACUCmUAUUCUGUCUCmUmU3’

75

one showed only 60% target knockdown even at 50 nm concentration (Figure 21). It

could because of the siRNA potency issues or may be the target issue.

Figure 21: mrp-1 mRNA knockdown with mrp-1 siRNAs in resistant A549 lung cells at 24hrs

Cells were transfected with 4 different sequences at 3 different concentrations (50, 10 and

1nM) in A549DDP

cells to rank the potency.

All 4 mdr-1 and bcl2 sequences screened (were found equally potent in cells.

(Figure 22). In order to avoid possible off target effects, the same 2’OMe modification

was introduced into the best 2 bcl2 sequences (#2 and #3). These modified sequences

were then tested in cells along with the unmodified sequences (Figure 23) to pick the

best possible sequence for in vivo testing. In this case, the activity was slightly lost when

the modification was introduced in both the sequences. However, to reduce or minimize

the off target/ immune stimulatory effects coming from an unmodified sequence, the best

modified sequence was selected for in vivo testing. (#2 m).

0

0.2

0.4

0.6

0.8

1

1.2m

rp-1

/hG

AP

DH

~60%

#1 #2 #3 #4

76

.

Figure 22: Screening mdr1 and bcl2 siRNAs in cells

mdr1 mRNA (A) and bcl2 mRNA knockdown (B) with mdr1 siRNAs

and bcl2 siRNAs (um) in resistant A549 lung cells at 24hrs. 4 different

sequences were screened at 3 different concentrations in A549DDP

cells

to rank the potency

0

0.2

0.4

0.6

0.8

1

1.2

md

r1/h

GA

PD

H

~92%

~72%

0

0.2

0.4

0.6

0.8

1

1.2

bcl

2/h

GA

PD

H

~90%

~65%

~90%

A.

B.

77

Figure 23: bcl2 mediated gene silencing with unmodified and modified bcl2 siRNAs in A549

DDP cells

Cells were transfected with the 2 best unmodified bcl2 siRNAs along with the

corresponding modified versions at 10, 1, 0.1 and 0.01nm concentrations. Target

knockdown was determined 24hrs after the transfections by qPCR.

4.4 Conclusions

Using PCR, the over expressed resistant genes were identified. Survivin was

clearly over expressed in both resistant cells compared to their counter sensitive cell

lines. bcl2 expression levels in A549DDP

were much lower compared to the survivin

levels, though it is higher compared to the levels detected in A549 cells. On the other

hand, the bcl2 was expressed almost at the same levels (and higher levels) in both H69

and H69AR pair. Little difference was seen between resistant and senstive cell lines.

bcl2-2

5’GGGAGAACAGGGUACGAUAUU3’

5’UAUCGUACCCUGUUCUCCCUU3’

bcl2-3

5’GGGAGAUAGUGAUGAAGUAUU3’

5’UACUUCAUCACUAUCUCCCUU3’

bcl2-2

5’rGrGrGrArGrArAmCrArGrGrGmUrAmCrGrAmUrAmUmU3’

5’mUArCrUrUmCArUmCArCmUArUrCrUrCrCrCrUrU3’

bcl2-3

5’rGrGrGrArGrAmUrArGmUrGrAmUrGrArArGmUrAmUmU3’

5’mUArCrUrUmCArUmCArCmUArUrCrUrCrCrCrUrU3’

unmodified modified

0

0.2

0.4

0.6

0.8

1

1.2

bcl

2/h

GA

PD

H

unmodified modified

#2 #3 #2 #3

78

mdr-1 expression was detected in both resistant cells, but at very lower levels. Although

mrp-1 expression levels are not obviously different in resistant cells compared to their

sensitive counter part, this was also choosen for further combination experiments along

with the other 3 genes. (survivin, bcl2, mdr-1 and mrp-1) to understand the pump and

non-pump mediated resistance mechanism.

79

CHAPTER 5.

COMBINATION STRATEGIES IN RESISTANT CELLS USING siRNA AND

CHEMO DRUG

5.1. Introduction

As discussed previously, the mechanisms of MDR is very complex and it is

usually the synergistic result of a combination of a few mechanisms. Over expression of

pump mediated genes or anti-apoptotic molecules are some of the examples discussed

earlier31,32

. Down regulating the genes that are over expressed and known to be

responsible for resistance in those cells using siRNAs is potentially a powerful way of

reversing the resistance1. Similar efforts have been tried successfully with siRNAs

targeted to bcl2, mdr-1 etc previously33

. After down regulating the over expressed gene,

one would hope that the resistance will be reversed and the tumors will become sensitive

to the anti cancer agents. However, these attempts have not demonstrated a high

efficiency in their anti cancer efforts in the past. It is possible that the inhibition of only

one contribution to cellular resistance may not be sufficient for overcoming all

mechanisms of cancer cell resistance to chemotherapy. Combination of more than one

mechanism or attacking more than one gene might be an effective strategy1. Screening

multiple combinations of gene targets together with drug would be one way to address

the problem. As timing also matters, the combination studies should be carried out

including all possible combinations at different time points to find the best possible

combination that could give the maximum synergy. This combination could be then used

in more tumor models.

80


5.2.1. Measuring cisplatin/ doxorubicin resistance in lung cancer cells

Before doing the combination studies, the cytotoxicity of cisplatin and

doxorubicin was measured in resistant and sensitive A549 (cisplatin) and resistant and

sensitive H69 cells (doxorubicin) to determine the IC50 of those two drugs. To measure

the cytotoxicity of doxorubicin, the H69/H69AR cells were incubated separately in 96

well microtiter plate with DOX concentrations ranging from 2 M to 0.001 nM for 5

days. Like wise, A549/A549DDP

cells were incubated with cisplatin at concentrations

ranging from 2m up to 10nM for 2 days. The cellular cytotoxicity was assessed using

MTS assay and calculated the percent viability.

5.2.2. siRNA+ chemotherapy combination

A range of concentrations below and above the IC50 concentration of cisplatin

determined from the previous cytotoxicity data were identified to be tested together with

the siRNAs in the first round of combination study. 3 sets of cells were plated and 2 of

the sets were transfected with survivin siRNA at dose that was chosen previously (~10

nM). 24 h after the transfection, cisplatin was added to one set of designated cells that

had siRNA, at its IC50 concentration and few other concentrations higher and below IC50.

In parallel, the third set of cells was incubated with cisplatin alone at the same doses. All

of those samples were kept at 37oC for 2 days after the cisplatin addition. In the same

study, siRNA and the drug were also simultaneously added to another set of cells and

incubated for 48 h as previously described. In the follow up study, the other siRNAs

(siRNAs for other targets such as bcl2, mdr1 and mrp1) were also included in the

81

combination evaluation. In these studies, based on the previous results, the cisplatin

concentration was kept at 100 M and the siRNA concentrations were kept 10 nM. As

described before, the siRNA treatment (single or multiple) was given first. When more

than one siRNA was added, the volume was adjusted in such a way that all was present at

10 nM concentration in 100 l volume. 24 hours after the incubation, the cisplatin was

added to the cells that contain siRNA and incubated for another 48hrs. The following

combinations have been tried in this experiment set up.

1. cisplatin alone

2. survivin alone

3. survivin+cisplatin

4. bcl2 alone

5. bcl2+cisplatin

6. survivin+bcl2

7. survivin+bcl2+cisplatin

8. mdr1 alone

9. mdr1+cisplatin

10. mrp1 alone

11. mrp1+cisplatin

12. Other possible combinations of 2 siRNAs or 3 siRNAs or 4 along with cisplatin


In order to determine how resistant these cells are against doxorubicin and

cisplatin, the cellular cytotoxicity assays were carried out. Cells were incubated with

82

different concentrations of doxorubicin and cisplatin and left for ~2-5 days. Cytotoxicity

was measured by MTS assay. As expected the A549DDP

cells showed resistance against

cisplatin compared to its sensitive A549 cells (IC50 is about 5-fold higher). However

these A549DDP

cells did not show any resistance against doxorubicin compared to the

A549 cells (similar IC50s). H69AR cells did show about 30-fold resistance against

doxorubicin compared to its sensitive H69 cells. Again these cells also failed to show

resistance against cisplatin (Figure 24).

Figure 24: IC50s of doxorubicin and cisplatin in sensitive/resistant lung cells

Cisplatin and doxorubicin were incubated with both sensitive and resistant cells at various

concentrations for 2-5 days. Cell viability was measured to determine the IC50s.

Since the delivery of siRNA using the HA-PEI nanoparticles to H69AR cells

seemed to be very poor, all the combination studies were done in A549DDP

cells. In

addition, cisplatin is among the most effective agents in the treatment of lung cancer in

patients and the development of resistance to this drug is the main reason that results in

chemotherapy failure in the clinic. The concept is to determine if the combination of any

cisplatin resistance in A549/ A549DDP (IC50s) doxorubicin resistance in H69/H69AR (IC50s)

83

of the resistant gene down regulation enhance the sensitivity of the cells to cisplatin

treatment. Based on the previous knockdown results, survivin siRNA sequence that gave

>80% silencing was selected for initial combination studies. Few different concentrations

below and above the IC50 concentration of cisplatin determined from the previous

cytotoxicity data were identified to be tested together with the siRNAs in the first round

of combination study. The results of this study indicated that the combination of survivin

down regulation and cisplatin treatment was found to be more effective when compared

with cisplatin alone treatment (Figure 25). This suggests that the down regulation of one

of the resistant gene may enhance the sensitivity of the cells to cisplatin. In addition to

survivin siRNAs, bcl2, mdr-1 and mrp-1 siRNAs were also then included in the follow

up combination studies with cisplatin to identify the best combination that gives the

highest killing. For these experiments, bcl2 siRNA sequence that gave ~90% KD, mrp1

siRNA that gave the maximum knockdown had been tried as described in the material

and methods with and without cisplatin. The combination of survivin and/ bcl2 with

cisplatin demonstrated combination/synergistic effect but not the mrp-1 and mdr1

siRNAs (Figure 26 and 27). As these mdr1 and mrp1 are known to mediate pump

mediated resistance, it makes sense that they are not contributing to the anti apoptotic

pathway regulation. Down regulation of anti apoptotic genes showed much clearer

involvement in the resistance by enhancing the killing effect when compared to the

cisplatin killing alone. Down regulation of both survivin and bcl2 together showed

slightly better killing effect compared to the single agent combinations suggesting a

possible reversal of resistance with the given combinations.

84

Figure 25: Effect of survivin siRNA combined with cisplatin on cell viability

A549DDP

cells were treated with survivin siRNA for 24hrs followed by the

addition of cisplatin (A) along with the co-treatment of siRNA and cisplatin (B).

48hrs after the cisplatin treatment, viability of the cells were measured by MTS assay.

20

30

40

50

60

70

80

90

100

110

120

%vi

abili

ty

cisplatin 100uM 50uM 10uM 1uM

~50%

~25%

20

30

40

50

60

70

80

90

100

110

120

%vi

abili

ty

~57%%

~34%

cisplatin 100uM 50uM 10uM 1uM

A.

B.

85

Figure 26: Combination effect of survivin, bcl2, mdr1 and mrp1 siRNAs with cisplatin on cell viability.

A549DDP

cells were treated with siRNA for 24 hours followed by the addition of cisplatin

for 48hrs after the cisplatin treatment, and viability of the cells were measured by MTS

assay.

10

20

30

40

50

60

70

80

90

100

110

% v

iab

ility

45%

~72% ~72%

~80%

non-pump resistant genes pump resistant genes

Cisplatin effect

86

Figure 27: Effect of different combinations of siRNAs with cisplatin on cell viability

A549DDP

cells were treated with various possible combinations of siRNA or

24 hours followed by the addition of cisplatin for 48hrs after the cisplatin treatment,

viability of the cells were measured by MTS assay. (s: survivin)

0

20

40

60

80

100

120

% v

iab

ility

0

20

40

60

80

100

120

% v

iab

ility

87

5.4. Conclusions

The results clearly suggest that the combination of siRNAa targeted to genes that

are involved in the non pump mediated resistance showed synergistic effect with cisplatin

treatment. In other words, the down regulation of those genes clearly enhanced the

sensitivity of those resistant cells to cisplatin treatment, ended up resulting higher level

killing compared to the killing observed with cisplatin treatment alone. Based on these

results, the combination of survivin/cisplatin, bcl2/cisplatin and survivin+bcl2/cisplatin

combinations were selected for in vivo efficacy studies.

88

CHAPTER 6.

EVALUATING DELIVERY IN VIVO IN TUMOR-BEARING MICE

6.1 Introduction

Since our interest was to reverse the drug resistance in lung tumors, the siRNA

delivery efficiency to lung tumors were primarily evaluated. Subcutaneous tumor

xenografts are the most commonly used tumor models in the pre-clinical settings. These

are human tumors and therefore they would grow only in immune deficient mice, an

animal model with no humoral immune system. Delivery efficiency to many different

human tumors can be determined by screening in these xenograft models. Also, these

tumors mimic the heterogeneity and complexity of the actual human tumors. However, in

addition to these primary xenograft models, it will also be useful to look at other types of

relevant tumor models such as metastatic tumor models. As most of the patients with

cancer succumb to metastasis and in majority of cases, these are the tumors being treated

in the clinic, it is important to evaluate these tumor models as well in the pre clinical

settings. Primary tumors are generally surgically removed at the time of treatment. Apart

from these two types of models, understanding the delivery to syngeneic mouse models is

also important, as these tumors are developed in normal mice with fully developed

immune system to mimic what is present in human patients. As noted, these different

tumor types provide different benefit, so collective information from the models will be

more predictive of clinical outcome.

89


6.2.1. Establishing subcutaneous, metastatic and syngeneic tumor models

Human non-small lung cancer cell lines A549 and small cell lung cancer cell line

H69 were obtained from ATCC. The corresponding resistant cell lines (A549DDP and

H69AR) were obtained from MGH and ATCC respectively. In addition to the lung lines,

other cell lines such as B16F10, Hep3B, MDA-MB 468 were also obtained from ATCC.

Cells were grown in RPMI medium supplemented with 10% FBS.

Tumor models were developed in nude mice. 5-6week old nude mice were

injected subcutaneously with tumor cells A549 (5x106 cells in matrigel), A549

DDP (1x10

7

cells), H69 (1 x 106 cells + matrigel), H69AR (1 x 10

6 cells + matrigel), Hep3B (7 x 10

6

cells+matrigel), MDA-MB-468 (5 x 106 cells + matrigel) and B16F10 (1 x 10

5 cells)

under the right shoulder. Tumor sizes were measured at least once or twice a week to

monitor the tumor growth.

In addition, the B16F10 cells were intravenously injected (5x105 cells/mouse) into

nude mice to generate an experimental metastatic lung or syngeneic model with the idea

of checking out the delivery and activity when the tumors are located on lungs as

metastatic lesions. Since these cells do not express luciferase, several mice were opened

up on day 7 and 10 to make sure that they developed tumors in the lung. All the mice did

have tumors developed in lung. In a similar trend, the A549-luc cells (5e5) were also

injected iv to generate lung metastatic tumors.

90

6.2.2. Evaluating target knockdown in tumor types with varied levels of CD44

and vascularity using tool siRNA

When the A549 subcutaneous tumors were approximately ~150-200 mm3 in size,

the animals were randomized into groups such that each group had similar tumor size.

These groups of mice with A549 tumors then received either PLK1 or SSB formulated

HA-PEI/siRNA, HA-PEI/HA-PEG/siRNA or HA-PEI/HA-PEG/HA-SH/siRNA at 0.5

mg/kg dose level every day for 3 consecutive days. 24hrs after the last dose, the tumors

were collected, RNA was extracted and PCR was run to determine the PLK1 or SSB

knockdown. Likewise, similar doses were tried in other tumor models as well

(A549DDP, H69, H69AR, B16F10 (sc and met), Hep3B, MDA-MB231 and A549 met

model) as described.


The first study results indicated that the HA-PEI/HA-PEG/siRNA complex

delivered the siRNA more efficiently and showed the highest knockdown (55%)

compared to the other groups (Figure 28).

91

Figure 28: In vivo activity of HA particles

Size and charge characterization of different combinations of HA modified

functional blocks and their activity (A) in A549 tumors following 3, i.v

doses of 0.5mg/kg

Although these tumor cells express >99% CD44 receptors on the surface, they

seemed to be very solid and only moderately vascularized. Based on these results, the

HA-PEI/HA-PEG/siRNA formulation was selected for further testing in other tumor

models. Similarly, the mice with A549DDP

, H69 and H69Ar tumors were given the same

doses and mRNA knockdown was examined 24hrs after the last dose. There was

0

0.2

0.4

0.6

0.8

1

1.2

SSB

/hG

AP

DH

~55%

~40% ~40%

#1 #2 #3

A549 tumors

HA-PEI/siRNA

#1

HA-PEI/

HA-PEG/siRNA

#2

HA-PEI/

HA-PEG/HA-SH/siRNA

#3

Size 50nm (0.2) 85nm (0.2) 90nm (0.4)

Charge -6.5mV -5.5mV -8.5mV

A.

B.

92

marginal activity in A549DDP

tumors (Figure 29). However, no activity was seen in the

other two SCLC tumors at the doses given (Figure 29).

A.

0

0.2

0.4

0.6

0.8

1

1.2

PBS HA-PEI/PEG/SSB HA-PEI/PEG/PLK1

SSB

/hG

AP

DH

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2


PLK

1/h

GA

PD

H

SSB KD PLK1 KD

~55%

~30%

0

0.2

0.4

0.6

0.8

1

1.2


PLK

1/

PP

1A

~15%

~20%

SSB KD PLK1 KD

A549

A549DDP

93

B.

Figure 29:PLK1/SSB siRNA mediated target knockdown in resistant sensitive lung tumors

Resistant and sensitive tumor bearing mice A549/A549DDP

(A) and H68/H69AR tumors (B)

were injected with PLK1 or SSB siRNA encapsulated HA-PEI/HA-PEG particles at 0.5mg/kg

for 3 days. 24 hrs after the last injection, tumors were harvested and RNA was extracted. qPCR

was run to determine the target KD.

Given that the CD44 levels were not that high in H69/H69AR pair compared to

A549 pair, it is not very surprising to see this outcome. However, as the doses used in

these studies were also at the very lower edge, it is possible that minimal siRNA was

delivered. To address this issue, further steps are being taken to improve the loading of

siRNA in those formulations either by making the particles at higher ratios or by

concentrating the existing formulations by 5-10 fold using TFF or other filtration

0

0.2

0.4

0.6

0.8

1

1.2


PLK

1/h

GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/hG

AP

DH

SSB KD PLK1 KD

0

0.2

0.4

0.6

0.8

1

1.2


PLK

1/h

GA

PD

H

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/hG

AP

DH

SSB KD PLK1 KD

H69AR

H69

94

methods without disrupting the particles. In addition to testing in these lung tumors,

these particles were also tested in other tumor types either expresses CD44 receptors at

higher or lower levels with varied levels of vascularity, just to understand the correlation

between activity, CD44 expression levels and vascularity. B16F10, a murine melanoma

type tumor that expresses high levels of CD44 receptors were implanted (1x105

cells/mouse) subcutaneously into nude mice. These tumors were treated the same way as

described before. Reasonable activity (~40%) was seen in these tumors confirms the role

of CD44 levels (Figure 30). It is worth noting that these tumors seem to be highly

vascularized. Mice with B16F10 metastatic lesions in lung were then randomized into

groups and treated with either PLK1 or SSB formulated HA nanoparticles. After 3 doses,

the tumors were checked for SSB target knockdown as this siRNA is a mouse cross

reactive one. The study results suggested that there was no activity in these tumors

(Figure 30).

95

Figure 30: Target knockdown in B16F10 metastatic and subcutaneous lung tumors

B16F10 cells were subcutaneously implanted to get sc tumors. These cells were also

injected iv to generate experimental metastatic lung tumors. Mice with tumors were

injected with SSB/PLK1 encapsulated HA particles at 0.5mg/kg for 3 days. 24hrs after the

last dose, tumors collected and KD was measured.

In a similar trend to B16F10 tumors, the metastatic A549-luc lung lesions were

also developed by iv injecting the cells. As this cell line express luciferase, the mice were

imaged to monitor the tumor growth. Both sc and metastatic tumor were treated with

PLK1 or SSB encapsulated HA-PEI/PEG particles at the same doses (3 doses of 0.5

mg/kg each). Target knockdown was ~55% in sc tumors whereas the metastatic lesions in

lung showed only 25% target knockdown (Figure 31).

0

0.2

0.4

0.6

0.8

1

1.2


mSS

B/m

-bac

tin ~40%

0

0.2

0.4

0.6

0.8

1

1.2

PBS HA-PEI/PLK1 HA-PEI/SSB

mSS

B/m

b-a

ctin

heavy tumor burden

sc tumors

Lung mets

96

Figure 31: Target knockdown in metastatic and sc A549 tumors

A549 cells were subcutaneously implanted to get sc tumors. These cells were also injected

intravenously to generate experimental metastatic lung tumors. Mice with tumors were

injected with SSB/ PLK1 encapsulated HA particles at 0.5mg/kg for 3 days. 24hrs after

the last dose, tumors collected and knockdown was measured.

One explanation would be that these metastatic tumors that form in lung, may not

have the same structure and micro-environment compared to the ones that are located at

the subcutaneous space. Previous studies have also identified distinct molecular

differences between primary tumors and metastatic tumors based on meta- analysis and

profiling experiments.

Another tumor type was also included in the study to understand the correlation

between the CD44 levels, vascularity and activity. Hep3B, a highly vascularized human

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/hG

AP

DH

~25%

sc tumors

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/GA

PD

H

~55%

Lung mets

Tumors in lung

97

hepatic tumor type, does not express or very minimally express CD44 receptors (~4%).

Delivery and activity in these tumors were checked to see if these particles without the

help of the receptors still get delivered to the cells and show activity. When these tumors

were treated with the similar doses of HA/siRNA particles, the activity was very minimal

(~15%), but not completely negative, suggesting that both factors play a role in tumor

uptake and activity (Figure 32). MDA-MB468 tumors were another type that expresses

higher levels of CD44 (>99%) with very minimal or no vascularity. Activity in these

tumors was only 15% at the doses used, again indicates that the CD44 levels only are not

enough for the delivery in the tumors, and other factors such as vascularity also plays a

role. The ideal tumors obviously would be one with higher levels of CD44 and higher

levels of vascularity to attract the HA based particles.

98

Figure 32: Correlating target knockdown with vascularity of the tumors

Target knockdown in tumors with different levels of CD44 expression and vascularity

6.4. Conclusions

Although there was a linear correlation observed with CD44 expression levels and

activity in cells, it was not exactly translated in solid tumors. Tumors that express very

high levels of CD44 showed reasonable activity only when they were vascularized to

some extent. Tumors with higher CD44 expression levels with extremely lower

vascularity showed only very marginal activity. Similarly, highly vascularized tumors

with very low levels of CD44 expression also showed marginal activity. These data

together suggest that the solid tumors need both the receptors and vascularity to some

level to let the HA particles to get in and show activity.

0

0.2

0.4

0.6

0.8

1

1.2


mSS

B/m

-bac

tin

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/GA

PD

H

~40%

~15%

0

0.2

0.4

0.6

0.8

1

1.2


SSB

/GA

PD

H

~55%

A549 (>99% CD44 , moderate vascularity ) B16F10 (65% CD44, highly vascularized)

Hep3B (~4% CD44, very vascularized) MDA-MB468 (>99% CD44, very poor vascularity)

~15%

0

0.2

0.4

0.6

0.8

1

1.2

1.4

PBS HA-PEI/PEG/PLK1 HA-PEI/PEG/SSB

PLK

1/G

AP

DH

~15%

99

CHAPTER 7.

QUANTITATING CISPLATIN AND siRNA DISTRIBUTION IN TISSUES

7.1. Introduction

To reverse the drug resistance in lung cancer, a combination strategy is used in

this study. Combination treatment of siRNAs that down regulate the anti-apoptotic genes

and anti cancer drug such as cisplatin together demonstrated synergistic effect in cells

and in tumors. In addition to looking at the efficacy and target knockdown, it is also

worth looking at the distribution of the different components of the delivery system such

the nanoparticle, siRNA and cisplatin in different tissues to correlate the accumulation

with the activity. To address this, different methods have been used. Nanoparticles were

monitored by encapsulating a near IR dye and injecting into mice and monitoring the

fluorescence signal at different time points. siRNA in different tissues was quantitated

using a PCR method. Like wise, the cisplatin content was quantitated in tissues by ICP-

MS method.


7.2.1. Nanoparticle distribution using ICG

In order to understand the biodistribution of those particles, indocyanine green

(ICG), an amphiphilic carbocyanine dye that strongly absorbs and fluoresces in the near-

infrared region of light was encapsulated in these HA particles in place of siRNA34

. The

HA-PEI/ ICG complexes were prepared by mixing 10 l of 0.5 mg/ml ICG with 90ul 3

mg/ml HA-PEI solution. After vortexing for few min, the complex was kept at RT for 15-

100

20 minutes. The solution was then dialyzed against PBS O/N. In order to determine the

encapsulated ICG content in the particles, a standard curve was run with the dye alone at

different concentrations. The absorbance was measured at 780 nm to determine the ICG

content in the particles. These were then injected into mice bearing A549, A549DDP

, H69

and H69AR tumors. Tumor bearing mice were prepared by injecting 5-10 million cells

into the subcutaneous dorsa of nude mice. Once the tumors reached a reasonable size

(~200mm3), the prepared particles were intravenously injected into mice bearing

different tumor. Mice were imaged at 10 minutes, 4 hours, 10 hours, and 24 hours after

the injection to monitor the distribution of the particles using Xenogen (EX: 785nm &

Em: 820nm). Along with these, the ICG alone in PBS (at the encapsulated concentration)

was also injected into mice carrying A549 tumors to compare the distribution of dye

itself.

7.2.2 Cisplatin distribution

Cisplatin-encapsulated hyaluronic acid-conjugated diaminooctane (HA-ODA) and

HA-ODA/hyaluronic acid-conjugated PEG (HA-PEG) nanoparticles were intravenously

injected in mice bearing cisplatin resistant A549 tumors at 1 mg/kg dose. Cisplatin

solution was also injected in its conventional form at the same dose along with the

nanoparticles to get a comparative tissue distribution. After 6 and 24 hours following a

single intravenous dose, blood and tissues were collected for Pt analysis. Tumors were

grown and when they reached the size of ~100-150mm3, they were randomized into 4

groups (n=3 /group) for the study. Blood samples were collected in heparinized tubes and

centrifuged to get the plasma. Tissue samples such as liver, spleen, lung, kidney, heart,

101

brain and tumor were harvested at 6 hours and 24 hours. Pt analysis will be done by the

University of North Carolina Chapel Hill group by the ICP-MS method.

7.2.3 siRNA distribution

Survivin silencing siRNA encapsulated HA-PEI/HA-PEG particles were injected

in mice bearing A549DDP tumors at 0.5 mg/kg for 3 days. After 1 hour, 6 hours, and 24

hours following the last injection, blood samples and several tissues (liver, spleen, lung,

heart, kidney and tumors) were collected. The tissues were then homogenized to make

tissue lysates. Tissue lysates were diluted 1:1000 to make a dilute sample. Using the

appropriate reverse primers, antiprimer and the tissue lysate, the annealing step was run

initially followed by RT-PCR. The reverse primer, forward primer and an antiprimer

sequences are listed below.

Reverse: GGAAGCCGACAAGGCGTAA

Forward: /56-FAM/ACTCCCTCCCTCGATTT AAATCCATCATCT

Antiprimer: AAATCGAGGGAGGGAG/3BHQ_1/

The amplified siRNAs were detected and quantitated by running a standard curve using lysate

from untreated mouse tissue and spiked with known siRNA concentrations.

102

7.3 Results and Discussion

In the ICG biodistribution study, a strong signal was observed throughout the

whole body of mice in all 4 types of tumors at 10 minutes. As these particles (with ICG)

were injected intravenously, they were expected to be in the circulation at very early time

points. At 4 hours, majority of the signal was detected in the liver and spleen area of all

the mice (Figure 33).

Figure 33: Biodistribution of ICG/HA-PEI/PEG in A549/ A549DDP

tumor bearing mice

Mice bearing A549 andA549DDP tumors were injected with HA-PEI/PEG/ICG and imaged

them at different time points.

A549DDP

A549 tumor

10min 4hrs 10hrs

A549

A549DDP tumor10min 4hrs 10hrs

103

In addition, a signal was also detected in A549 tumors. None of the other tumors

had any signal at this time point. At 10 hours, the signal in A549 tumors was still

persisted. However, the overall, signal intensity was decreased in the liver area for all the

mice, may be due to the shorter half life of the ICG drug when it is released in the

circulation or in tissues. Interestingly, there was signal detected in A549DDP

tumors at 10

hours. No signal was detected in H69 or H69AR tumors at any time points tested (Figure

34).

Figure 34: Biodistribution of ICG/HA-PEI/PEG in H69/H69AR tumor bearing mice

Mice bearing H69 and H69ARtumors were injected with HA-PEI/PEG/ICG and imaged

them at different time points.

Again the overall signal intensity further decreased in the body at 10hrs for

all the mice. At 24 hours, the entire signal was completely disappeared in all those

H69AR

H69

No signal in tumor

No signal in tumor

10min 4hrs 10hrs

10min 4hrs 10hrs

104

mice (data not shown). When ICG was injected alone (without any nanoparticles),

the intensity of the signal was slightly lower than the signal that was observed in

mice that received NP/ICG at 10 min time-point (Figure 35), but much lower at 4

(only detected in liver not in tumors).

Figure 35: Biodistribution of ICG in A549 tumor bearing mice

ICG alone was injected in mice bearing A549 tumors and monitored the imaging

At 10 hours, the majority of the signal in the liver was gone, suggesting and

confirming the literature data that this ICG drug alone has a very short half life when it is

exposed in the circulation or in tissues.

In the siRNA distribution study, the siRNA was quantitated in each tissue and

calculated the % input dose based on the starting siRNA loading. Liver showed about

20% of the input dose at 1 hour and 6 hours (Figure 36). It was slightly reduced at 24

hours (~15%). The same pattern was detected in spleen as well (~20%).

10min 4hrs 10hrstumor

105

Figure 36: Tissue distribution of siRNA in A549DDP

tumor bearing mice

Mice were injected three times with HA-PEI/PEG/survivin at 0.5mg/kg and collected

the tissues 1, 6 and 24 hours after the last dose. PCR method was utilized to quantitate the siRNA

in tissue samples

The larger signal in liver and spleen supported the observation from ICG study.

Apart from these two organs, siRNA was also detected nicely in tumor lysates but at a

lower level compared to liver and spleen though still at a higher level than the levels

found in the other organs. Also, it was interesting to note that the levels in tumor at 1 and

6 hours is about 0.5%, but the levels were increased to ~1% at 24hrs the same trend of

higher accumulation at later time point that was observed in the ICG study. Levels found

in lung and heart are very low (0.2-0.5%), but were in the detectable range. The levels

detected in plasma was even lower than that (~0,05%), suggesting that either the siRNA

is not that stable in plasma for more than an hour or they reach the organs very fast.

There was no signal detected in the lysates of kidney

Time after 3rd dose

% i

np

ut

do

se

1h

6h

24

h

1h

6h

24

h

1h

6h

24

h

1h

6h

24

h

1h

6h

24

h

1h

6h

24

h

1h

6h

24

h

0.0

0.5

1.0

1.5

10

20

30

40

tumor

spleen

liver

lung

heart

Plasma

Kidney

tumor

spleen

liver

lung

heartblood

0.01-0.005% kidney (<< detection level)

106

7.4. Conclusions.

The distribution study with ICG clearly demonstrated that the nanoparticles

accumulated in tumors that express saturating levels of CD44. However there was no

signal detected in tumors that express less than saturating levels of CD44 suggesting that

a certain level of CD44 expression should be necessary for the particles to get through the

receptors. siRNA distribution study suggests that the siRNA from the nanoparticles was

delivered to different organs with higher levels reaching in liver and spleen. It is very

encouraging to observe detectable levels of siRNA in tumors and it is also interesting that

the levels in tumors increased with time. The same trend was also noticed with higher

ICG signal at later point in A549DDP

tumors. Together this suggests that the particles may

distribute to the tumor slowly and deliver the drug or get to the tumor immediately and

release the drug slowly.

The main goal of this dissertation project is to develop and evaluate a novel

approach to overcome the multidrug resistance in lung cancer cells/ tumors using a

combination therapeutic strategy that involves silencing multidrug resistance genes and

augmenting the efficacy of a chemotherapeutic agent. Currently, one of the most

challenging aspects of lung cancer therapy is the rapid acquisition of multidrug resistant

(MDR) phenotype. MDR develops due to multiple factors that include poor systemic

drug delivery efficiency, inefficient drug residence at the tumor site, poor intracellular

availability and micro environmental selection pressures that allow certain cells to

survive despite aggressive chemotherapy. Although, the RNA interference therapy has

emerged as a powerful strategy to down-regulate key genes, the intracellular delivery of

siRNA to specific tumor site is still a major challenge that needs to be overcome before

107

this experimental technique can be routinely used as a clinically-viable therapeutic

strategy for lung cancer patients. To address this need, in the current study, a self-

assembled hyaluronic acid nanoparticle system is designed with different functional

blocks that are expected to circulate longer and specifically reaches the tumor cell by

receptor mediated endocytosis via its receptors that are over expressed in the tumor cell

surface. With efficient delivery of siRNA directed against MDR genes using the HA

based nanoparticle system described, the reversal of drug resistance and enhancement of

sensitivity to chemotherapeutic drugs was achieved. Anti-MDR strategies may thus show

the highest clinical efficacy when administered in combination with conventional

chemotherapeutic regimens.

108

CHAPTER 8.

EVALUATION OF COMBINATION EFFICACY IN RESISTANT TUMORS

8.1. Introduction

As discussed previously, lung cancer is one of the leading causes of cancer death in the

USA. Owing to the size and distribution of those tumors, surgery is not very effective for

this disease. Chemotherapy and or radiation are the standard of care for both NSCLC and

SCLC patients. Cisplatin is one of the most effective chemotherapy drug and it is being

used as first line therapy for lung cancer at the current settings35

. However, the majority

of the chemotherapy treatment fails in the clinic because of the development of cancer

cell resistance during treatment9. To address this issue, chemotherapy drugs are

administered at higher doses, which, as expected resulted in adverse effects. One

alternative and more effective approach would be to identify the resistance related genes

that are over expressed in those cells and down regulate them with the hope of reversing

the resistance. As describe in the previous chapter, suppression of pump mediated genes

such as mdr1 and mrp-1 did not show any synergistic effect with cisplatin treatment in

cisplatin resistant A549 cells. However, there was a combination effect observed when

cisplatin treatment was combined with suppression of survivin and bcl2 gene expression.

To translate this finding in tumors, the resistant tumors have been grown and tested with

combination of gene down regulation together with cisplatin treatment and monitored the

tumor growth inhibition.

109


8.2.1. Target knockdown with therapeutic siRNAs

A549DDP

tumor model was developed as described previously. Tumor bearing mice were

treated with survivin siRNA or CTL siRNA encapsulated HA nanoparticles at 0.5mg/kg

for 3 days. Tumors were harvested 24, 72 and 120hrs after the third dose. RNA was

extracted from the tumors to analyse the mRNA KD. In another study, the above tested

unmodified survivin siRNA sequence was injected into tumor bearing mice along with a

modified sequence. Knockdown was monitored 72 and 12hrs after the third dose. In a

different study, 2 bcl2 (um) and 2 bcl2 (m) siRNA encapsulated HA particles were tested

in the same tumor model to pick the best possible sequence for the combination efficacy

study.

8.2.2. Cisplatin efficacy in A549 resistant tumors

In order to run the efficacy study, the cisplatin was first encapsulated in HA

nanoparticles. To find the best HA derivative that can encapsulate and release cisplatin

effectively, multiple HA derivatives (HA-C8, HA-C12, HA-C18, HA-ODA) have been

tried. The HA-ODA derivative seemed to make reasonably good size particles with good

cell killing ability. 10mg/ml of HA-ODA solution was made in water. Likewise, 10mg/ml

cisplatin solution was also made in DMSO. 90ul of the HA-ODA and 10ul of cisplatin

were mixed well to form HA-ODA/cisplatin particles. Along with this, HA-ODA

solution was mixed with equal volume of HA-PEG (at 10mg/ml) and then with cisplatin

solution in the following volume ratio (0.9:0.9:2). The HA-ODA/PEG/cisplatin complex

110

was kept at RT for 15-20min for the particles to stabilize. Four groups of mice (n=5)

with A549DDP

tumors received doses of either cisplatin or HA-ODA/cis or HA-

ODA/PEG/cisplatin at doses of 1mg/kg. (twice a week). Tumor volumes were measured

using the following formula to monitor the tumor growth inhibition: Tumor volume = (

length x width/ width)/2. The growth inhibitory effect was estimated using the treated/

control ratio (T/C).

8.2.3. Pilot efficacy with survivin knockdown and cisplatin treatment

In order to determine if the combination of survivin down regulation and cisplatin leads

to a significantly better killing compared the either treatment, a small pilot study was run.

Five groups of mice (n=5) with A549DDP

tumors received doses of PBS or cisplatin or

HA-PEI/PEG/survivin or HA-PEI/PEG/survivin+cisplatin at the doses described below

(Table 5). Tumor volumes were monitored during the study period at least twice a week.

111

Table 5: Experimental study design for a pilot efficacy study

Study plan used for the pilot efficacy study that was run using survivin knockdown

and cisplatin treatment (A). The doses were given in the synchronized form as

described (B)

8.2.4. Combination efficacy with 2 siRNAs and cisplatin

Based on the previous efficacy study, the dosing regimen was changed to accommodate

improvement in efficacy as described here. 10 groups of mice (n=5) with A549DDP

tumors received doses of different agents (Table 6). In this study, both survivin and bcl2

siRNAs were used as single agent with and without cisplatin and also used together to

down regulate both genes at once with and without cisplatin. Tumor size measurements

were taken throughout the whole study. Body weights were also monitored during the

study period.

Groups Treatment Mice Dose Duration

1 PBS 5 -

2 HA-PEI/PEG/survivin 5 0.5mg/kg, IV QDx3~3 weeks

3 HA-ODA/cisplatin 5 1mg/kg, IV~3 weeks

4 HA-PEI/PEG/survivin+ HA-ODA/cisplatin 5 0.5mg/kg, IV QDx3 + 1mg/kg, IV~3 weeks

A.

B.

HA-cisplatin

(1mg/kg)

d1 d2 d3 d4 d5 d6 d7 d8 d9 d10 d11 d12 d13 d14

HA-siRNA (0.5mg/kg)

112

A

B.

Table 6: Combination efficacy study design

Study plan used for the complete efficacy study with survivin and bcl2 siRNAs

and cisplatin (A).The dose regimens were slightly changed from the previous pilot

study to improve the outcome (B)


In the first target knockdown study, the unmodified survivin siRNA sequence gave only

15% target knockdown in tumors 24hrs after the last injection. However, the activity was

Groups Treatment Mice Dose Duration

1 PBS 5 - ~2 weeks

2 HA/CTL siRNA 5 0.5mg/kg IV, QDx3~2 weeks

3 HA/CTL siRNA+HA/Cisplatin 5 0.5mg/kg IV, QDx3~2 weeks

4 HA/Cisplatin 5 1mg/kg IV~2 weeks

5 HA/survivin 5 0.5mg/kg IV, QDx3~2 weeks

6 HA/bcl2 5 0.5mg/kg IV, QDx3~2 weeks

7 HA/survivin+ HA/bcl2 5 0.5mg/kg IV, QDx3~2 weeks

8 HA/survivin+ HA/Cisplatin 5 0.5mg/kg IV, QDx3 , 1mg/kg IV~2 weeks

9 HA/bcl2+HA/ Cisplatin 5 0.5mg/kg IV, QDx3 , 1mg/kg IV~2 weeks

10 HA/survivin+ HA/bcl2+ HA/Cisplatin 5 0.5mg/kg IV, QDx3 , 1mg/kg IV~2 weeks

HA/cisplatin

(1mg/kg)

d1 d2 d3 d4 d5 d6 d7 d8 d9 d10 d11 d12 d13 d14

HA/siRNA (0.5mg/kg)

113

increased to ~40% at 72hrs and this activity was still maintained at 120hrs. The CTL

sequence in the same study did not show any target knockdown (Figure 37).

Figure 37: Survivin knockdown in A549DDP

tumors at different time points

Tumor bearing mice were injected with survivin siRNA encapsulated

HA-PEI/HA-PEGparticles at 0.5mg/kg for 3 days. 24, 72 and 120hrs after the

last injection, tumors were harvested and RNA was extracted. qPCR was run to

determine the target KD.

One of the best modified sequences selected from the in vitro screening was tested in the

same tumor model in the second study to compare the activity with the unmodified

sequence. 2’ OMe modifications were introduced into couple of siRNA sequences with

the aim of increasing stability and reducing off target effects by maintaining the same

potency. One of the modified sequences did not seem to loose any activity when re-tested

in cells. This sequence was then tested in tumors along with the unmodified sequence that

was previously tested in tumors to compare the activity. The activity of unmodified

sequence was ~40% at 72 and 120hrs after the last injection just like the previous study

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

1.1

1.2

BIR

C5

/PP

1A

~15%

~40%

24h 72h 120h

~40%

114

(Figure 38). Whereas, the activity of the modified sequence was only about 25-35% at

the doses tested, suggesting that there may be a slight loss of potency when the

modification was introduced.

Figure 38: Survivin knockdown with unmodified and modified siRNA sequences

Tumor bearing mice were injected with survivin (um-6) siRNA and

survivin (m-2) encapsulated HA-PEI/HA-PEG particles at 0.5mg/kg for 3

days. 72 and 120hrs after the last injection, tumors were harvested and RNA

was extracted. qPCR was run to determine the target KD.

It is also possible that there was some immune stimulatory effect demonstrated by

the unmodified sequence although the RNA bases present in that sequence do not suggest

that. In the bcl2 screening study, the best 2 bcl2 sequences found in the in vitro study were

tested along with the corresponding modified versions (with standard 2’ OMe

modifications) in the same resistant A549 tumors. The unmodified sequences (#2 and 3)

gave about 55% and 40% target knockdown respectively at 72hr time point. The modified

versions however, gave only 20-30% activity at the same time point (Figure 39). Based

0

0.2

0.4

0.6

0.8

1

1.2

BIR

C5

/PP

1A

unmodified modified

72h 120h 72h 120h

~40-45%

~25-30%

115

on the above in vivo studies, the survivin #3 (m) and bcl2 #2 (m) sequences were selected

for the combination efficacy study to minimize any off target effects.

Figure 39: Screening bcl2 siRNA sequences in tumors

2 unmodified and modified bcl2 sequences were formulated in HA-PEI/PEG

particles and injected into tumor bearing mice at 3x0.5mg/kg. Target

knockdown was determined 72hrs after the last dose.

To determine the optimum cisplatin doses that are needed for the efficacy study, a

pilot cisplatin efficacy study was run. Cisplatin was encapsulated in HA-ODA derivative

with and without HA-PEG component. The encapsulation efficiency was found to be

very similar in both cases. To check the activity of those two systems, mice bearing

A549DDP

tumors were grown and sorted out to accommodate 4 groups with 5 mice in

each group. Mice were injected twice with either PBS, cisplatin alone, HA-ODA/cisplatin

and HA-ODA/HA-PEG/cisplatin particles at 1mg/kg dose. Mice treated with either

cisplatin or HA-ODA/cisplatin or HA-ODA/PEG/cisplatin showed tumor growth

inhibition compared to the PBS treated group (T/C of 40-50%). Out of these 3, the HA-

0

0.2

0.4

0.6

0.8

1

1.2

bcl

2/P

P1

A

unmodified unmodified modified modified

#2 #3 #2 #3

~30%

~55%

116

ODA/cisplatin tend to be slightly better than the other two in the efficacy curve, Given

this, the HA-ODA/cisplatin was selected for the combination study (Figure 40).

Figure 40:Effect of cisplatin and cisplatin encapsulated HA particles on the growth of resistant A549 tumors Tumor bearing mice were injected twice with cisplatin or HA-ODA/cisplatin

or HA-ODA/PEG/cisplatin at 1mg/kg and monitored the tumor growth.

Next, a pilot efficacy study was run combining the survivin siRNA treatment and

cisplatin treatment. Based on the results from knockdown and cisplatin efficacy studies,

the doses and dose regimen were chosen. Mice bearing A549DDP

tumors were treated

with either PBS, cisplatin, HA-PEI/PEG/ survivin or combination of HA-

PEI/PEG/survivin + cisplatin. As the activity of 3 consecutive siRNA doses retains for 5

days, the cisplatin treatment was given 72hrs after the third siRNA dose to get the activity

of both treatment. The second round of siRNA treatments started 5 days after the last

siRNA dose. There was tumor growth inhibition observed for survivin (~23%) and

cisplatin (~46%). But the combination group showed significantly better growth

inhibition (~65%) compared to PBS or either of the single agent treatment on day17

Days post implantation

Tum

or v

olum

e (mm3)

12 14 16 18 20 22 24 26 280

200

400

600

800

1000

1200

1400

1600

1800PBS

cisplatin

HA-ODA/cisplatin

HA-ODA/PEG/cisplatin1mg/kg

~35-40%

117

(Figure 41). The corresponding T/C values were 0.77, 0.54 and 0.35 suggesting that

there was combination or synergistic effect to some extent with the combination

treatment. It suggests that the cell death induction by an anti cancer drug in combination

with the suppression of nonpump resistance is required for effective killing of drug

resistant cancer cells.

Figure 41:Combination efficacy with survivin siRNA and cisplatin after first round of treatment A549

DDP tumor bearing mice were grouped and injected with

either siRNA alone at 3x0.5mg/kg or with cisplatin at 1mg/kg or with both siRNA

and cisplatin over a period of 6 days as listed and monitored the tumor growth.

However, the rate of tumor growth inhibition was slightly reduced after the second round

of treatment. After 2 rounds of treatment, the growth inhibition was only 25% (T/C of

0.75) for survivin, 40% (T/C 0.6) for cisplatin and 54% (T/C 0.46) for combination

treatment (Figure 42). This may be due to the development of further resistance for


Tumor

Volu

me (

mm3)

6 8 10 12 14 16 18 20

0

200

400

600

800

1000

PBS

HA-ODA/cisplatin

HA-PEI/PEG/survivin

HA-PEI/PEG/survivin+HA-ODA/cisplatin

HA-PEI/PEG

survivin

0.5mg/kg

HA-ODA/cisplatin

1mg/kg

23%

46%

65%

118

treatments or doses were not high enough to kill all the cells. Based on the results, further

modifications were incorporated in the study plan for the next efficacy study.

Figure 42: Combination efficacy following 2 rounds of survivin siRNA and cisplatin treatment. The second set of treatment started 2 days after the cisplatin treatment.

In the next efficacy study, as described in the material and methods, 2 siRNAs (survivin

and bcl2) were used in the study in combination with cisplatin. In this study, in addition

to 2 therapeutic siRNAs, a control siRNA was also used in the presence and absence of

cisplatin treatment to eliminate any non specific activity. After 2 rounds of treatment, (3

siRNA doses and one cisplatin), the groups that had combination treatment

(survivin+cisplatin, bcl2+cisplatin or survivin+bcl2+cisplatin) showed significantly better

tumor growth inhibition compared to PBS or CTL group and the groups that had single

agent treatment (survivin, bcl2, survivin+bcl2 or cisplatin) with growth inhibition of 62%

(T/C of (0.38) for survivin+bcl2+cisplatin group, 58% (T/C of 0.42) for bcl2+cisplatin


Tumor

Volu

me (

mm3)

6 8 10 12 14 16 18 20 22 24 26 28

0

300

600

900

1200

1500

1800

2100

2400 PBS

HA-ODA/cisplatin

HA-PEI/PEG/survivin

HA-PEI/PEG/survivin+HA-ODA/cisplatin

25%

40%

54%

surviviin

3x0.5mg/kg

cisplatin

1mg/kg

119

group and 52% (T/C 0.48) for survivin+cisplatin group. Knocking down both survivin

and bcl2 together with cisplatin treatment, although did not show significant difference in

efficacy compared to one siRNA+cispaltin (survivin+cisplatin or bcl2+cisplatin) groups,

the combination did show much greater significant difference from its control groups.

(survivin+bcl2+cisplatin vs survivin+bcl2; p=0.02, survivin+cisplatin vs survivin p=0.07

or bcl2+cisplatin vs bcl2; p=0.03 or cisplatin vs survivin+cis; p=0.07, cisplatin vs

bcl2+cisplatin; p= 0.05, cisplatin vs survivin+bcl2+cisplatin; p=0.01 or PBS vs

survivin+cisplatin; p=0.01, PBS vs bcl2+cisplatin; p=0.002, PBS vs

survivin+bcl2+cisplatin; p=0.0001 (Figure 43). There was a slight added benefit of

having both siRNAs together with cisplatin over either of the siRNA+ cisplatin treatment

in this study (62% growth inhibition vs 58 or 52% growth inhibition) supporting the

pattern that was found in in vitro study results (80% killing vs ~72% killing).

The growth inhibition for mice that had cisplatin treatment was only 31% (T/C of

0.69) and it was 29% (T/C of 0.71) for mice that had CTL siRNA+cisplatin treatment.

The siRNA treatment groups such as survivin alone, bcl2 alone and survivin+bcl2 groups

had 31, 31 and 30% growth inhibition (T/C values of 0.69, 0.69 and and 0.70

respectively). The control group with no cisplatin had almost no difference from PBS

treated group (Figure 43 and 44). This suggests that the combination of survivin or bcl2

or survivin+bcl2 down regulation and cisplatin treatment together demonstrated

combination or synergistic effect. Again, the combination of anti cancer drug with

suppression of non-pump resistance seems required for effective killing of MDR cells.

Alternatively, one could also say that by down regulating the over expressed resistant

gene or genes, the resistance to cisplatin was lifted to some extent. More exploration

120

should be carried out to identify any other genes that also contribute to the resistance, the

right dosing and timings to improve the synergistic effect.

Figure 43: Combination efficacy of 2 siRNAs and cisplatin in resistant A549 tumor

Mice bearing resistant tumors were treated with survivin and bcl2 siRNAs and cisplatin

using the dosing regimen described and monitored the tumor growth.


Tum

or v

olum

e (mm3)

6 8 10 12 14 16 18 20 22 240

200

400

600

800

1000

1200

1400

1600

PBS

HA/CTL

HA/CTL+HA/cisplatin

HA/cisplatin

HA/survivin

HA/bcl2

HA/survivin+HA/bcl2

HA/survivin+HA/cisplatin

HA/bcl2+HA/cisplatin

HA/survivin+HA/bcl2+HA/cisplatin

siRNA

0.5mg/kg

cisplatin

1mg/kg

121

Figure 44: Elaboration of the efficacy curves in parts

The following groups were separated from the efficacy curves and plotted. Mice that had bcl2

siRNA treatment or cisplatin vs mice that had bcl2 siRNA+cisplatin (A), mice that had cisplatin

treatment or survivin siRNA alone vs mice that had survivin siRNA+cisplatin treatment (B) and

mice that had cisplatin treatment or bcl2+survivin treatment vs mice that had survivin +bcl2

siRNA+cisplatin treatment (C). (PBS vs CTL+cisplatin; p<0.05, PBS vs cisplatin; p<0.05, PBS

vs survivin+cisplatin; p<0.01, PBS vs bcl2+cisplatin; p<0.01, PBS vs survivin+bcl2+cisplatin;

p<0.001, cisplatin vs survivin+cisplatin; p=0.07, cisplatin vs bcl2+cisplatin; p=0.05, cisplatin vs

survivin+bcl2+cisplatin; p=0.01, survivin vs survivin+cisplatin; p=0.07, bcl2 vs bcl2+cisplatin;

p=0.03, survivin+bcl2 vs survivin+bcl2+cisplatin; p=0.02 by t-test.


Tum

or v

olum

e (mm3)

6 8 10 12 14 16 18 20 22 240

200

400

600

800

1000

1200

1400

1600

PBS

HA/cisplatin

HA/survivin+HA/

bcl2+HA/cisplatin

HA/survivin+HA/bcl2


Tum

or v

olum

e (mm3)

6 8 10 12 14 16 18 20 22 240

200

400

600

800

1000

1200

1400

1600

PBS

HA/cisplatin


HA/survivin


Tum

or v

olum

e (mm3)

6 8 10 12 14 16 18 20 22 240

200

400

600

800

1000

1200

1400

1600

PBS

HA/cisplatin


HA/bcl2

~30%

~62%

~31%

~52%

~31%

~58%

bcl2 vs bc2+cisplatin

survivin vs. survivin+cisplatin

A.

B.

C.

122

8.4. Conclusions

After screening siRNA sequences for survivin and bcl2 in tumors, the best one of each

was selected for the combination study. Cisplatin efficacy study was run to pick the

optimum dose that could be used in the combination efficacy study. Combining siRNA

(either survivin or bcl2) and cisplatin treatments clearly gave a significantly improved

activity compared to single agent treatment. Also, when both siRNAs are used in

combination with cisplatin, the growth inhibition was the highest compared to single

siRNA +cisplatin treatment.

123

CHAPTER 9

EVALUATION OF SAFETY PROFILE OF SINGLE AND COMBINATION

THERAPY

9.1. Introduction

In addition to evaluating delivery and efficacy, it is also important to monitor the safety

and tolerability of the particles that are being used to deliver both siRNA and cisplatin in

the efficacy studies. To examine the safety/toxicity, the parameters such as change in

body weight, plasma levels of the liver enzymes (ALT and AST), and LDH were

measured and compared between the treatment groups. Both ALT and AST are

aminotransferases. AST is found in a variety of tissues including liver, heart, kidney and

brain. It is released into the serum when any of these tissues is damaged. It is therefore

not a highly specific indicator of liver injury. Whereas the ALT is exclusively found in

liver and it is released as a result of liver injury. Thus, it serves as a fairly specific

indicator of liver status. To further characterize the efficacy and safety of this therapy, the

histopathology of liver and spleen can also carried out and compared between the

treatment groups.


9.2.1. Body weight changes

In addition to the treatment groups (n=5) in the efficacy study, 3 additional mice with

tumors were kept in each group to monitor the toxicity/ safety measurements. These were

given the same treatment as the mice in the efficacy study groups. Mice were weighed the

124

day the treatments were started and every day for 5 days to cover all the doses given at

the first round. Body weights were taken continuously throughout the whole study period.

9.2.1. Measuring liver enzyme levels

To measure the liver enzyme levels, the blood was collected, 48hrs after the first round of

treatment (3 doses of HA/siRNA and one dose of cisplatin) from all 10 groups

(n=3/group). Also, at the end of the efficacy study, a terminal bleed was done to collect

blood from all 10groups (n=5) to look at the liver enzyme levels (both ALT and AST)

and LDH levels after 2 rounds of treatment using the manufacturer’s instructions.

9.2.3. Tissue histopathology

Liver and spleen samples were also collected for histo pathological analysis from mice at

early time point (n=3) and at the end of the study (n=5). Serum samples and tissue

samples were sent out to Tufts university for anlaysis.


During this study period, to monitor the toxicity of those formulations, the body weights

of the mice that were in the study were measured. Following giving 2 rounds of

treatments, there was no obvious weight loss seen in any of the groups (Figure 45)

suggesting that the formulations/ particles that were used for treatment are reasonably

safe. Mice tolerated the single as well as the combination treatment quite nicely.

In addition, there was no elevation in liver enzyme levels observed during the

study period. AST and ALT levels were at the background levels (as same as the levels

125

noted for PBS treated and untreated mice) on day14 , 48hrs after the first round of

siRNA/cisplatin treatment. Similar results were also found at the end of the study point as

well (day21). LDH levels were also at the background levels at both time points.

Figure 45: Monitoring body weight change

Percentage weight change in mice that had single or combination treatment during the study

period.

9.4. Conclusion

No body weight change or liver enzyme level elevation observed in any of the treatment group

during the study period suggests that these treatments those were given by either single agent or

in combination were well tolerated by the mice with resistant tumors.


Perc

enta

ge w

eigh

t ch

ange

8 10 12 14 16 18 20 22

-20

-15

-10

-5

0

5

10

15

20PBS

HA/CTL

HA/CTL+HA/cisplatin

HA/cisplatin

HA/survivin

HA/bcl2

HA/survivin+ HA/bcl2



HA/survivin+HA/bcl2+HA/cisplatin

126

CONCLUDING REMARKS

Currently, one of the most challenging aspects of lung cancer therapy is the rapid

acquisition of multidrug resistant (MDR) phenotype. MDR develops due to multiple

factors that include poor systemic drug delivery efficiency, inefficient drug residence at

the tumor site, poor intracellular availability and micro environmental selection pressures

that allow certain cells to survive despite aggressive chemotherapy. Although, the RNA

interference therapy has emerged as a powerful strategy to down-regulate key genes, the

intracellular delivery of siRNA to specific tumor site is still a major challenge that needs

to be overcome before this experimental technique can be routinely used as a clinically-

viable therapeutic strategy for lung cancer patients. In the current study, a hyaluronic acid

nanoparticle system was designed in which, different fatty acid chains and polyamine

groups were drafted to the HA backbone to obtain a novel family of biodegradable and

self assembling particles that efficiently encapsulate siRNA and chemotherapy drugs.

These self assembled particles demonstrated very specific targeted delivery to cells that

express high levels of CD44 but not to cells that do not or minimally express CD44

receptors. The cell entry was blocked by 85-90% by pre-blocking the receptors with

excess of soluble HA, confims the receptor mediated cell entry. However this linear

correlation between CD44 expression levels and activity observed in cells was not exactly

translated in solid tumors. It was noted that only the solid tumors with both the receptors

and vascularity showed reasonably good delivery and corresponding activity, not the

tumors that had only CD44 receptors but minimum vascularity or vise versa. Since the

ultimate goal of this current study was to reverse the drug resistance present in the cells,

the MDR related genes were first identified in resistant lung cancer cells. Potent and stable

127

siRNA sequences to target those genes were then identified by multiple steps. Efficient

delivery of those siRNAs directed against MDR genes using these HA based nanoparticle

system described, resulted specific target knockdown in tumors. Combining this target

knockdown with cisplatin treatment, resulted in a significantly better therapeutic efficacy

compared to either of the single agent treatment suggesting that there is synergistic effect

observed when the combination of siRNA down-regulation and cisplatin treatment was

carried out. Anti-MDR strategies may thus show the highest clinical efficacy when

administered in combination with conventional chemotherapeutic regimens.

128

REFERENCES

1. Saad M, Garbuzenko OB, Minko T 2008. Co-delivery of siRNA and an anticancer drug

for treatment of multidrug-resistant cancer. Nanomedicine (Lond) 3(6):761-776.

2. Pai SI, Lin YY, Macaes B, Meneshian A, Hung CF, Wu TC 2006. Prospects of RNA

interference therapy for cancer. Gene Ther 13(6):464-477.

3. Fridman E, Skarda J, Pinthus JH, Ramon J, Mor Y 2008. Expression of multidrug

resistance-related protein (MRP-1), lung resistance-related protein (LRP) and

topoisomerase-II (TOPO-II) in Wilms' tumor: immunohistochemical study using TMA

methodology. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 152(1):47-51.

4. Gottesman MM, Fojo T, Bates SE 2002. Multidrug resistance in cancer: role of ATP-

dependent transporters. Nat Rev Cancer 2(1):48-58.

5. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz

EU, Duncan AM, Deeley RG 1992. Overexpression of a transporter gene in a multidrug-

resistant human lung cancer cell line. Science 258(5088):1650-1654.

6. Ozben T 2006. Mechanisms and strategies to overcome multiple drug resistance in

cancer. FEBS Lett 580(12):2903-2909.

7. Takara K, Sakaeda T, Okumura K 2006. An update on overcoming MDR1-mediated

multidrug resistance in cancer chemotherapy. Curr Pharm Des 12(3):273-286.

8. Kanintronkul Y, Worayuthakarn R, Thasana N, Winayanuwattikun P, Pattanapanyasat K,

Surarit R, Ruchirawat S, Svasti J Overcoming multidrug resistance in human lung cancer

with novel benzo[a]quinolizin-4-ones. Anticancer Res 31(3):921-927.

9. Shen J, Liu J, Long Y, Miao Y, Su M, Zhang Q, Han H, Hao X 2009. Knockdown of

survivin expression by siRNAs enhances chemosensitivity of prostate cancer cells and

attenuates its tumorigenicity. Acta Biochim Biophys Sin (Shanghai) 41(3):223-230.

10. Ocker M, Neureiter D, Lueders M, Zopf S, Ganslmayer M, Hahn EG, Herold C,

Schuppan D 2005. Variants of bcl-2 specific siRNA for silencing antiapoptotic bcl-2 in

pancreatic cancer. Gut 54(9):1298-1308.

11. Lei XY, Zhong M, Feng LF, Zhu BY, Tang SS, Liao DF 2007. siRNA-mediated Bcl-2

and Bcl-xl gene silencing sensitizes human hepatoblastoma cells to chemotherapeutic

drugs. Clin Exp Pharmacol Physiol 34(5-6):450-456.

12. Huang Z, Lei X, Zhong M, Zhu B, Tang S, Liao D 2007. Bcl-2 small interfering RNA

sensitizes cisplatin-resistant human lung adenocarcinoma A549/DDP cell to cisplatin and

diallyl disulfide. Acta Biochim Biophys Sin (Shanghai) 39(11):835-843.

13. Trabulo S, Cardoso AM, Santos-Ferreira T, Cardoso AL, Simoes S, Pedroso de Lima MC

Survivin silencing as a promising strategy to enhance the sensitivity of cancer cells to

chemotherapeutic agents. Mol Pharm 8(4):1120-1131.

14. Kim DH, Rossi JJ 2007. Strategies for silencing human disease using RNA interference.

Nat Rev Genet 8(3):173-184.

15. Gartel AL, Kandel ES 2006. RNA interference in cancer. Biomol Eng 23(1):17-34.

16. Abdelrahim M, Safe S, Baker C, Abudayyeh A 2006. RNAi and cancer: Implications and

applications. J RNAi Gene Silencing 2(1):136-145.

17. Oh YK, Park TG 2009. siRNA delivery systems for cancer treatment. Adv Drug Deliv

Rev 61(10):850-862.

129

18. Dong X, Mumper RJ Nanomedicinal strategies to treat multidrug-resistant tumors:

current progress. Nanomedicine (Lond) 5(4):597-615.

19. Liang XJ, Chen C, Zhao Y, Wang PC Circumventing tumor resistance to chemotherapy

by nanotechnology. Methods Mol Biol 596:467-488.

20. Oh KT, Baik HJ, Lee AH, Oh YT, Youn YS, Lee ES 2009. The reversal of drug-

resistance in tumors using a drug-carrying nanoparticular system. Int J Mol Sci

10(9):3776-3792.

21. Chidambaram M, Manavalan R, Kathiresan K Nanotherapeutics to overcome

conventional cancer chemotherapy limitations. J Pharm Pharm Sci 14(1):67-77.

22. Ossipov DA Nanostructured hyaluronic acid-based materials for active delivery to

cancer. Expert Opin Drug Deliv 7(6):681-703.

23. Choi KY, Chung H, Min KH, Yoon HY, Kim K, Park JH, Kwon IC, Jeong SY Self-

assembled hyaluronic acid nanoparticles for active tumor targeting. Biomaterials

31(1):106-114.

24. Yadav AK, Mishra P, Agrawal GP 2008. An insight on hyaluronic acid in drug targeting

and drug delivery. J Drug Target 16(2):91-107.

25. Mironov V, Kasyanov V, Zheng Shu X, Eisenberg C, Eisenberg L, Gonda S, Trusk T,

Markwald RR, Prestwich GD 2005. Fabrication of tubular tissue constructs by centrifugal

casting of cells suspended in an in situ crosslinkable hyaluronan-gelatin hydrogel.

Biomaterials 26(36):7628-7635.

26. Choi KY, Min KH, Yoon HY, Kim K, Park JH, Kwon IC, Choi K, Jeong SY PEGylation

of hyaluronic acid nanoparticles improves tumor targetability in vivo. Biomaterials

32(7):1880-1889.

27. Lee H, Mok H, Lee S, Oh YK, Park TG 2007. Target-specific intracellular delivery of

siRNA using degradable hyaluronic acid nanogels. J Control Release 119(2):245-252.

28. Pichler A, Zelcer N, Prior JL, Kuil AJ, Piwnica-Worms D 2005. In vivo RNA

interference-mediated ablation of MDR1 P-glycoprotein. Clin Cancer Res 11(12):4487-

4494.

29. Yague E, Higgins CF, Raguz S 2004. Complete reversal of multidrug resistance by stable

expression of small interfering RNAs targeting MDR1. Gene Ther 11(14):1170-1174.

30. Murphy EA, Waring AJ, Murphy JC, Willson RC, Longmuir KJ 2001. Development of

an effective gene delivery system: a study of complexes composed of a peptide-based

amphiphilic DNA compaction agent and phospholipid. Nucleic Acids Res 29(17):3694-

3704.

31. Pakunlu RI, Wang Y, Tsao W, Pozharov V, Cook TJ, Minko T 2004. Enhancement of the

efficacy of chemotherapy for lung cancer by simultaneous suppression of multidrug

resistance and antiapoptotic cellular defense: novel multicomponent delivery system.

Cancer Res 64(17):6214-6224.

32. Pakunlu RI, Cook TJ, Minko T 2003. Simultaneous modulation of multidrug resistance

and antiapoptotic cellular defense by MDR1 and BCL-2 targeted antisense

oligonucleotides enhances the anticancer efficacy of doxorubicin. Pharm Res 20(3):351-

359.

33. Minko T, Dharap SS, Fabbricatore AT 2003. Enhancing the efficacy of chemotherapeutic

drugs by the suppression of antiapoptotic cellular defense. Cancer Detect Prev

27(3):193-202.

130

34. Sandanaraj BS, Gremlich HU, Kneuer R, Dawson J, Wacha S Fluorescent nanoprobes as

a biomarker for increased vascular permeability: implications in diagnosis and treatment

of cancer and inflammation. Bioconjug Chem 21(1):93-101.

35. Dhar S, Kolishetti N, Lippard SJ, Farokhzad OC Targeted delivery of a cisplatin prodrug

for safer and more effective prostate cancer therapy in vivo. Proc Natl Acad Sci U S A

108(5):1850-1855.

hyaluronic acid based self-assembled multifunctional …... · 2019-02-13 · amit singh, srinivas...

Documents