hydrogen sulfide-induced chilling tolerance of cucumber and … 18 2016/cp030216 final proof.pdf ·...
TRANSCRIPT
REGULARARTICLE
Hydrogen Sulfide-induced Chilling Tolerance of Cucumber
and Involvement of Nitric Oxide
Guoxiu Wu, Bingbing Cai, Chaofan Zhou, Dandan Li, Huangai Bi, Xizhen Ai
State Key Laboratory of Crop Biology, Ministry of Agriculture Key Laboratory of Horticultural Crop Biology and
Germplasm Innovation, College of Horticulture Science and Engineering, Shandong Agricultural University, 61
Daizong St., Tai’an 271018, Shandong, People’s Republic of China
ABSTRACT Hydrogen sulfide (H2S) and nitric oxide (NO) are two signaling molecules that play important roles in various
physiological processes. However, the mechanisms and signal transduction pathways of H2S in plants and the
relationship between the H2S and NO pathways remain unclear. In this study, we assessed changes in endogenous
H2S and NO emission systems, membrane lipid peroxidation and antioxidant systems of cucumber seedlings
subjected to low temperature stress (5 ℃) that were pre-treated with 1.0 mM sodium hydrosulfide (NaHS), 0.15 mM
hypotaurine (HT), 0.1 mM sodium nitroprusside (SNP), 15 μM hemoglobin (Hb), 1 mM NaHS and 15 μM Hb, or
distilled water for 12 h. The results showed that chilling stress increased the activity and mRNA abundances of L/D-
cysteine desulfhydrase (CDes), which in turn induced the accumulation of endogenous H2S. In the same way, the
endogenous NO system was triggered by chilling stress. The chilling injury symptoms were significantly moderated
by 1.0 mM of the H2S donor NaHS and 0.1 mM of the NO donor SNP. On the contrary, treatment with HT or Hb,
the special scavengers of H2S and NO, respectively, prior to chilling stress aggravated these injury symptoms. NaHS
and SNP pre-treatments reduced the malondialdehyde (MDA) levels, hydrogen peroxide (H2O2) accumulation and
production rate of the superoxide anion (O2.-) caused by chilling stress, whereas the activities and mRNA abundances
of superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX) and glutathione reductase (GR) were
increased compared with the water-treated seedlings. Furthermore, NaHS and SNP led to greater accumulation of
ascorbic acid (AsA) and reduced glutathione (GSH)and lessened the decrease in the AsA/DHA and GSH/GSSG ratios
of stressed seedlings, thus resulting in the alleviation of oxidative damage. These results suggest that H2S could
alleviate chilling stress by enhancing the antioxidative system in cucumber seedlings, which might have a possible
interaction with NO signaling, because the addition of Hb reversed the positive effects.
Keywords: hydrogen sulfide, cucumber, nitric oxide, chilling stress, oxidative damage.
INTRODUCTION Cucumbers (Cucumis sativus L.) are sensitive to
chilling stress; however, they commonly encounter
chilling stress due to they are mainly cultivated
through the winter in solar greenhouses in the north
of China. Chilling stress causes many changes in the
biochemical and physiological processes and ROS-
homoeostasis of plants [1] and therefore may be a
major limitation to crop productivity.
Hydrogen sulfide (H2S), an endogenous
gasotransmitter that is involved in various
physiological processes in animals and plants. As
early as 1978, Wilson et al. [2] found that the leaves
of crops such as cucumber, corn, and soybean could
Journal of Plant Biology Research 2016 5(3) :58-69 eISSN:2233-0275
pISSN:2233-1980
http://www.inast.org/jpbr.html
*Corresponding author : College of Horticulture Science and
Engineering, Shandong Agricultural University, 61 Daizong St.,
Tai’an, Shandong 271018, PR China (E-mail: [email protected] ; Tel:
+86-5388246218).
J. Plant Bio. Res. 2016, 5(3): 58-69
59
release H2S in a light-dependent manner. However,
little was known about its physiological function in
higher plants for an extended period of time.
Because excessive H2S might cause an imbalance in
free radicals, which consequently influences plant
metabolism, previously studies focused on its
toxicology. In fact, in 1982, Hällgren et al. [3]
discovered that pine leaves responded to low SO2
stress by releasing H2S. This implied that H2S
exhibits specific physiological effects in vivo, but it
was previously considered that responses were as a
result of its toxic physiological features. Until
recently, H2S was explored as a gas signal molecule,
and its physiological effects have gradually
attracted people’s attention. It is now known that
H2S participates in the regulation of plant growth
and development as well as several physiological
metabolic processes. In addition, studies have
revealed that H2S, as a gasotransmitter, plays
essential roles in the resistance of abiotic stress,
including drought, salinity, low temperature, and
heavy metals [4, 5, 6, 7]. H2S can also improve
photosynthesis by enhancing the activity of Rubisco
and gene expression and by regulating the redox
modification of sulfhydryl compounds [8]. Thus,
recent studies have focused on the crosstalk
between H2S and other molecules involved in plant
growth and development, resulting in some notable
progress.
Nitric oxide (NO), an important plant endogenous
signaling molecule, also mediates complex
biological functions in plants. Previous studies have
shown the involvement of this molecule in almost
all biological processes in plants, including plant
maturation and senescence [9, 10], seed
germination or dormancy [11], as well as ABA-
mediated floral transition and stomatal movement
[12, 13]. Meanwhile, NO has been proved to be
capable of regulating numerous plant responses
toward a variety of biotic and abiotic stresses and to
alleviate certain consequences induced by oxidative
stresses [1].
Recently, it was reported that H2S can interact with
NO and can regulate various plant developmental
processes and stresses. For example, H2S might be
a novel downstream signal molecule in the NO-
induced heat tolerance response in maize [14]. H2S
donors reduced the accumulation of nitric oxide
(NO) induced by abscisic acid (ABA) treatment of
leaf tissues [15]. Shi et al. [16] speculated that NO-
activated H2S might be essential for cadmium stress
response in bermudagrass. However, the specific
response mechanisms of chilling tolerance are less
clear; knowledge of the potential molecular
mechanism and its signaling pathways remain
limited. In the present study, the interrelationships
between H2S and NO and their effect on the
antioxidant system under chilling stress were
investigated. We aimed to explore the molecular
mechanism of the positive effects of H2S and its
signaling pathways in the response of cucumber to
chilling stress.
MATERIALS & METHODS Plant material and growth conditions
Uniform cucumber seeds (‘Jinyou 35’, Tianjin,
China) were soaked in 1.0 mM sodium hydrosulfide
(NaHS), 0.15 mM hypotaurine (HT), 0.1 mM
sodium nitroprusside (SNP), 15 μM hemoglobin
(Hb), 1 mM NaHS and 15 μM Hb, or distilled water
for 12 h. Afterwards, the seeds were germinated on
moist filter paper in the dark at 28 °C for 24 h, and
then grown in a growth chamber with a photon flux
density (PFD) of 600 μmol m-2 s-1, a 26 °C /18 °C thermoperiod, 80% relative humidity (RH) and an
11-h photoperiod (control growth conditions).
When the first leaf was fully expanded, half of the
water-treated seedlings and all of the other
treatments were exposed to low temperatures (5 °C)
while the remaining half of the water-treated
seedlings were maintained under normal conditions
as the control. There were 3 replicates per treatment
and 20 seedlings per replicate. Young, fully
expanded leaves were sampled to analyze the H2S
and NO emission systems at 0 h, 3 h, 6 h, 9 h and 12
h after transferring from the control to the chilling
stressed condition, while the other physiological
indexes were measured at a 24-h time point.
Measurement of H2S emission
H2S emission was assayed as described by Sekiya et
al. [17] with minor modification. Leaves (0.1
grams) were ground into a fine powder in 0.9 ml
pre-chilled extraction medium (20 mM Tris–HCl
buffer, pH 8.0), and the resulting extract was
centrifuged for 15 min at 15,000×g at 4 °C. The
homogenate was mixed in a test tube containing 20
mM Tris–HCl buffer (pH 8.0), and the released H2S
was absorbed into a zinc acetate trap, i.e., a small
glass tube containing zinc acetate that was fixed to
the bottom of the test tube. After 30 min reaction at
37 °C, 100 μL of 30 mM FeCl3 dissolved in 1.2 M
HCl was added to the trap followed by the injection
J. Plant Bio. Res. 2016, 5(3): 58-69
60
of 100 μL 20 mM N,N-dimethyl-p-
phenylenediamine dihydrochloride dissolved in 7.2
M HCl. The amount of H2S in the zinc acetate trap
was determined colorimetrically at 667 nm after
incubation at 37 °C for 15 min.
Detection of L-/D-cysteine desulfhydrase activity
and relative mRNA expression
L-/D-cysteine desulfhydrase (CDes) activity was
estimated by determining the production rate of H2S
according to Riemenschneider et al. [18].
The relative mRNA expression of the CDes gene in
the cucumber seedlings was analyzed using real-
time quantitative RT-PCR using an AceQTM qPCR
SYBR Green Master Mix (Vazyme) according to
the manufacturer’s instructions. The cucumber β-
actin gene (GenBank accession No. DQ115883)
was used as a constitutively expressed internal
control. The primers were designed and synthesized
by BGI Sequencing (Beijing, China). The primers
used for the LCD, DCD and β-actin genes are as
follows:
LCD1: 5′-GGTTCGTCTGGCTGTGATTGATC -
3′
LCD2: 5′-
GGACCTCCTGGAATACAAGAAAGC -3′
DCD1: 5′-GTCCTGGGCCTCACACCTTAAT -3′
DCD2: 5′-CACGACAGTGATTGCTTTGGATGC
-3′
aF: 5′-CCACGAAACTACTTACAACTCCATC -
3′
aR: 5′-GGGCTGTGATTTCCTTGCTC -3′
Each real-time PCR reaction was performed in a
final volume of 25 µl in an iQ5 Multicolor real-time
PCR detection system (Bio-Rad, USA) using the
following program: initial denaturation at 95 °C for
5 min, followed by 40 cycles of 95°C for 10 s, 60°C
for 30 s, and 72 °C for 15 s. A melting curve analysis
was performed after every PCR reaction to confirm
the accuracy of each amplified product. The data
analysis was performed according to the
instructions provided by the manufacturer of the
quantitative real-time PCR instrument (iCycler iQ5,
Bio-Rad). The expression level for each sample was
calculated as 2-△△Ct, where Ct represents the cycle
number at which the fluorescence signal in each
reaction reaches the threshold. All of the samples
were analyzed three times.
Detection of hydrogen peroxide, superoxide anion
and electrolyte leakage
The qualitative detection of hydrogen peroxide
(H2O2) was carried out using 3,3-diaminobenzidine
(DAB) (Beijing Solarbio Science﹠Technology Co.,
Ltd, China) as described by Thordal-Christensen et
al. [19] with minor modification. The leaves of the
seedlings subjected to the various treatments were
soaked in 1 mg·ml-1 DAB for 14 h under dark
conditions. After rinsing with distilled water, the
leaves were boiled in 90% (v/v) ethanol at 70℃ to
remove the pigments, and the H2O2 production was
visualized in the form of reddish-brown coloration.
The H2O2 content was estimated according to the
instructions of the specified in the H2O2 kit (Nanjing
Jiancheng Bioengineering Institute of China).
The qualitative detection of the superoxide anion
(O2·-) was performed using nitroblue tetrazolium
(NBT) (Beijing Biotopped Science﹠Technology
Co., Ltd, China) as described by Jabs et al. [20] with
minor modification. The leaves of the various
treatments seedlings were soaked in 0.5 mg· ml-1
NBT for 1 h under darkness. After rinsing with
distilled water, the leaves were boiled in 90% (v/v)
ethanol at 70℃ for 20 min, and then O2·- production
was visualized in the form of blue-purple
coloration. The O2·- production rate was measured
using the method presented by Wang et al. [21].
The electrolyte leakage (EL) was estimated as
described by Dong et al [22].
Nitric oxide content, nitrate reductase activity and
relative mRNA expression
The nitric oxide (NO) content was estimated
following the method specified in the NO kit
(Nanjing Jiancheng Bioengineering Institute of
China). Nitrate reductase (NR) activity was assayed
as described by Zhao et al. [23]. The relative mRNA
expression of the NR gene in the cucumber
seedlings was analyzed using the same method as
that used for the CDes gene. The primers used were:
NR1: 5′-CAAGAAAGAGCTGGCTATGG-3′;
NR2: 5′-CTACATGGGATGGCAAGAC T-3′.
Malonaldehyde content, antioxidant enzyme
activity and relative mRNA expression All samples were prepared for MDA and enzyme
analyses by homogenization of the fresh tissue in a
solution (4 ml·g-1 fresh weight) containing 50 mM
KH2PO4/K2HPO4 (pH 7.8), 1% PVP, 0.2 mM
EDTA and 1% Triton X-100, using a mortar and
pestle. After the homogenate was centrifuged at
12,000×g for 20 min at 4 °C, the supernatant was
used to determine the enzymatic activities [24]. All
of the spectrophotometric analyses were conducted
using a UV-visible spectrophotometer (UV-2450,
Shimadzu, Japan). The MDA content was measured
J. Plant Bio. Res. 2016, 5(3): 58-69
61
using the thiobarbituric acid (TBA) reaction as
described by Heath and Packer [25]. The SOD
activity was determined according to the method of
Beyer and Fridovich [26]. The POD activity was
assayed using the method of Omran [27]. The
ascorbate peroxidase (APX) activity was measured
by the method of Nakano and Asada [28] and
glutathione reductase (GR) activity by Foyer and
Halliwell [29].
The relative mRNA expression of the SOD, POD,
APX and GR genes in the cucumber seedlings was
analyzed using the same method as that used for the
CDes gene. The primers used are as follows:
SOD1: 5′-GGAAAGATGTGAAGGCTGTGG -3′
SOD2: 5′-GCACCATGTTGTTTTCCAGCAG -3′
POD1: 5′-GGTTTCTATGCCAAAAGCTGCCC-
3′
POD2: 5′-CAGCTTGGTTGTTTGAGGTGGAG-
3′
APX1: 5′-GTGCTACCCTGTTGTGAGTG -3′
APX2: 5′-AACAGCGATGTCAAGGCCAT -3′
GR1: 5′-TGATGAGGCTTTGAGTTTAGAGGAG
-3′
GR2: 5′-AACTTTGGCACCCATACCATTC -3′.
Detection of the GSH, GSSG, AsA and DHA
contents
The GSH and GSSG contents were measured
following the method specified in the glutathione
content kit (Nanjing Jiancheng Bioengineering
Institute of China). The AsA and DHA contents
were estimated using the method of Law et al. [30].
Statistical analysis
The data are presented as the mean ± the standard
deviation (SD) of three replicates. Analysis of
variance (ANOVA) was conducted using Microsoft
Excel software. Duncan’s multiple range test
(DMRT) was applied to analyze differences
between measured parameters.
RESULTS Chilling stress stimulated H2S emission
To explore the influence of chilling stress on the
H2S emission system, the H2S content, activities and
relative mRNA abundances of the H2S emission-
related enzymes L-cysteine desulfhydrase (LCD)
and D-cysteine desulfhydrase (DCD) were detected
in cucumber seedlings under chilling stress. It was
found that chilling stress induced H2S production,
and the activation was the most significant after 6 h
at 5 °C (Figure 1A). The LCD and DCD activities
(Figure 1B) and the relative mRNA abundance of
LCD (Figure 1C) were significantly increased
during the first 6 h of chilling stress, followed by a
decrease, while that of DCD reached a maximum
after 9 h at 5 °C (Figure 1D). These data indicated
that the H2S emission system was stimulated when
the cucumber seedlings were exposed to chilling
stress.
The response of NO to chilling stress in cucumber
seedlings Figure 2A revealed that chilling stress induced
greater NO production in the cucumber seedlings.
In addition, the NR activity and mRNA abundance
were also enhanced by chilling stress in a time-
dependent manner (Figure 2B, C). These up-
regulated responses were remarkable after 9 h of
chilling stress. This result indicated that the NO
signal participated in the response of cucumber
seedlings to chilling stress.
H2S and NO alleviated chilling stress damage in
cucumber seedlings
To testify the effect of H2S and NO on chilling
tolerance in higher plants, we determined the H2O2
content, O2·- production rate and EL, at 5 °C for 24
h, using 1 mM NaHS as an exogenous H2S donor
and 0.15 mM HT as an H2S scavenger; and with 0.1
mM SNP as an exogenous NO donor and 15 µM Hb
as an NO scavenger. NaHS and SNP significantly
alleviated the injury symptoms caused by chilling
stress, to approximately natural levels (Figure 3A).
Furthermore, seedlings treated with NaHS or SNP
showed significantly lower H2O2 accumulation
(Figure 3B, D), O2·- production rate (Figure 3C, E)
and EL (Figure 3F) than the water-pretreated
seedlings; however, the HT- and Hb-pretreated
seedlings exhibited markedly higher levels of the
above parameters than the water-pretreated
seedlings.
The connection between H2S and NO signals in
cucumber seedlings under chilling stress
To reveal the relationship between H2S and the NO
signals in the cucumber seedlings response to
chilling stress, we determined the effects of NO
(SNP as an exogenous NO donor) and Hb (NO
scavenger) on H2S and L-/D-CD activity and
mRNA abundances. Simultaneously, the influences
of H2S (NaHS as an exogenous H2S donor) and HT
(H2S scavenger) on NO, NR activity and mRNA
expression were investigated. Fig. 4A showed that
the SNP improved the H2S production, while Hb
inhibited the H2S emission caused by chilling stress.
J. Plant Bio. Res. 2016, 5(3): 58-69
62
Figure 1. Response of the H2S-emission system to chilling stress in cucumber seedlings. A, H2S content in cucumber
seedlings under chilling stress for different treating time; B, LCD/DCD activities, the second leaf of cucumber
seedlings were sampled for the H2S concentration and LCD/DCD activities assay; C, D, mRNA abundances of LCD
and DCD, total RNA was separately isolated from the same tissues for the LCD/DCD activities determination, and
subjected to real-time PCR analysis. Seedlings were treated at 5 °C for 0h, 3h, 6h, 9h and 12 h. All values shown are
mean ± SD (n = 3).
The activity and mRNA abundance of CDes were
increased by SNP but decreased by Hb under
chilling stress (Figure 4B-E). Seedlings treated with
NaHS+Hb showed a significantly lower H2S
content and CDes activity and mRNA abundance
compared with the NaHS-treated seedlings. Higher
NO, NR activity and mRNA abundance derived
from chilling stress were significantly enhanced by
NaHS but decreased by HT (Figure 5A-C). These
results suggest that H2S and NO signals can
potentially crosstalk in the process of cucumber
response to chilling stress.
H2S and NO signaling alleviates the oxidative
damage from chilling stress
Both NaHS and SNP treatments showed lower
MDA content during chilling stress (Figure 6).
However, the MDA content was markedly
increased by HT and Hb. Seedlings treated with
NaHS +Hb showed a significantly higher MDA
content than the NaHS-treated seedlings, indicating
that Hb partly weakened the effect of NaHS in
MDA accumulation under chilling stress.
Seedlings subjected to chilling stress can activate
their antioxidant system to defend against oxidative
damage [31]. Therefore, we analyzed the
relationship between H2S and NO in regulating this
system. The SOD, POD, APX, and GR activities
were markedly elevated to prevent oxidative
damage under chilling stress (Figure 7A-D), and
their activities increased more significantly in
chilling-stressed seedlings with the addition of
NaHS and SNP. However, seedlings pretreated with
HT and Hb showed lower or similar POD, APX, and
GR activities compared with the water-treated
seedlings under chilling stress. NaHS +Hb-treated
seedlings displayed significantly lower SOD POD,
APX, and GR activities than the NaHS-treated
seedlings, indicating that Hb partly weakened the
positive effect of NaHS in protecting the membrane
against oxidative damage caused by chilling stress.
Real-time PCR showed that the mRNA expressions
of SOD, POD, APX and GR were increased by 26.1
%, 33.0, 33.9 % and 11.8 %, respectively, in the
chilling-stressed seedlings. They were up-regulated
J. Plant Bio. Res. 2016, 5(3): 58-69
63
Figure 2. Response of the NO and NR to chilling stress
in cucumber seedlings. The same tissues for H2S
emission system analysis were sampled for NO emission
system assay. A, NO content; B, NR activity; C, NR
mRNA abundance. Seedlings were treated at 5 °C for 0h,
3h, 6h, 9h and 12 h. All values shown are mean ± SD (n
= 3).
by NaHS or SNP (Figure 7E-H) but down-
regulated by HT, Hb and NaHS +Hb (P < 0.05)
under chilling stress.
The AsA content and AsA/DHA redox state
decreased significantly (P < 0.05) under chilling
stress but markedly elevated by NaHS and SNP
(Figure 8A, B). A noticeable decrease in the AsA
content and AsA/DHA were observed (P < 0.05) in
the HT and Hb treatments. No significant
differences were found in the GSH content between
the water pretreatment and the control, but GSH was
significantly increased by NaHS and SNP under
chilling stress (P < 0.05). When the seedlings were
pretreated with HT or Hb, the GSH contents
declined significantly (P < 0.05) (Figure 8C).
During chilling stress, the GSH/GSSH ratio
decreased obviously, and this decrease was
weakened by NaHS and SNP. However, the effects
of NaHS and SNP were depressed by HT and Hb,
respectively (Figure 8D). In Figure 8, we observed
that seedlings treated with NaHS+Hb showed
significantly lower AsA and GSH contents as well
as AsA/DHA and GSH/GSSH ratios. This
demonstrated that Hb pretreatment obviously
weakened the positive effect of H2S on the
accumulation of antioxidants to some degree.
DISCUSSION In the present study, we noticed that chilling stress
caused seedling dehydration and ROS
accumulation. Meanwhile, both the endogenous
H2S emission system and NO signaling were
activated during this stress (Figure 1, 2). In addition,
exogenous NaHS and SNP, the well-known
respective H2S and NO donors in plants,
dramatically alleviated these negative effects
through the regulation of the antioxidant system,
while their scavengers HT and Hb aggravated the
negative impacts (Figure 3). The NaHS- and SNP-
driven alleviation of ROS accumulation by chilling
stress was significantly prevented when Hb was
added. Therefore, we speculate that endogenous NO
was involved in the responses induced by H2S under
chilling stress.
The activities of the H2S emission-related enzymes
LCD and DCD, as well as the LCD mRNA
expression, were significantly increased during the
first 6 h of chilling stress, followed by a decrease
(Figure 1B, C). Whereas, the gene expression of
DCD was increased from 0 h to 9 h under chilling
stress, subsequently decreased (Figure 1D). This
unsynchronized result may be due to differences in
the transcription regulation of the two genes. The
H2S production rate directly reflects the intensity of
enzymatic activity of H2S-generating proteins, and
it will take time for transcribed mRNA to be
translated into proteins following posttranslational
modification to ensure complete activity [31].
Previous studies confirmed that LCD and DCD are
the most important enzymes involved in the
respective decomposition of L-cysteine and D-
cysteine into H2S in plants [32, 33]. In the present
study, the H2S content in cucumber seedlings
followed the same trend as the activity and gene
expression of LCD and DCD (Figure 1), indicating
J. Plant Bio. Res. 2016, 5(3): 58-69
64
Figure 3. Effects of H2S and NO on H2O2 accumulation, O2
·- production rate and electrolyte leakage in cucumber
seedlings under chilling stress. A, Phenotype of seedling; B, D, H2O2 accumulation; C, E, O2·- production rate; F,
electrolyte leakage. Seeds were soaked with 1.0 mM NaHS (H2S donor), 0.15 mM HT (H2S scavenger), 0.1 mM SNP
(NO donor), 15 µM Hb (NO scavenger) or distilled water (control) respectively for 12 h. One-leaf seedlings were
exposed to 5 °C for 24 h. All values shown are mean ± SD (n = 3). a, b, c and d indicate that mean values are
significantly different among samples (P<0.05).
Figure 4. Effect of NO on H2S emission system in
cucumber seedlings under chilling stress. Seeds
were soaked with 0.1 mM SNP (NO donor), 15 µM
Hb (NO scavenger), 1 mM NaHS (H2S donor), 0.15
mM HT (H2S scavenger), 1 mM NaHS+15 µM Hb
or deionized water (control) for 12 h. One-leaf
seedlings were exposed to 5 °C for 24 h. A, H2S
content; B, C, LCD/DCD activities, the same
tissues were sampled for the H2S concentration and
LCD/DCD activities assay; D, E, mRNA
abundances of LCD and DCD, total RNA was
separately isolated from the same tissues for the
LCD/DCD activities determination, and subjected
to real-time PCR analysis. All values shown are
mean ± SD (n = 3). a, b, c, d, e and f indicate that
mean values are significantly different among
samples (P<0.05).
J. Plant Bio. Res. 2016, 5(3): 58-69
65
that these data are in agreement with previous
studies.
The chilling tolerance of cucumber seedlings
soaked in different concentrations of NaHS (0, 0.2,
0.4, 0.6, 0.8, 1.0, 1.2 mM) was improved in varied
degree, and pretreatment with 1.0 mM NaHS
revealed a significantly protective effect (data not
shown). Therefore, 1.0 mM NaHS wihich is within
the H2S physiological concentrations detected in
animals and plants [4, 34], was used as an
exogenous H2S donor. To exclude the effects of
other compounds derived from NaHS (Na+, HS-or
H+), 0.15 mM HT was used in this study. Based on
Figure 3, we found that HT did not exhibit an
inducible effect similar to that of NaHS. Therefore,
we suggest that H2S, rather than the other
compounds was responsible for the chilling
tolerance of the cucumber seedlings. It is
noteworthy that the H2S emission could be
enhanced by SNP but suppressed by Hb (Figure 4A)
during chilling stress. This may suggest that chilling
stress activates the H2S emission system in an NO-
dependent manner. Furthermore, H2S participated
in NO signaling by affecting the NO content and the
activity and gene expression of NR (Figure 5)
during the process. All of these results imply that
H2S and NO signaling have a potential connection
in the cucumber response to chilling stress.
It is generally considered that ROS are largely
induced as toxic molecules that result in oxidative
damage to nucleic acids, proteins, lipids and
carbohydrate molecules when plants are subjected
to chilling stress. Lipid peroxidation and an increase
in the MDA content can also occur [22]. In this
paper, chilling stress induced the burst of H2O2, O2·-
(Figure 3D, E) and MDA (Figure 6) and caused
ROS-associated damage in the cucumber seedlings.
By contrast, NaHS alleviated the ROS burst and
ROS-triggered cell injury. To avoid this injury,
plants usually activate the antioxidant system,
including enzymatic antioxidant enzymes (SOD,
POD, APX, GR, etc.) and non-enzymatic
antioxidant molecules (AsA, GSH, etc.) to remove
generated ROS. As the first line of defense against
ROS, SOD converts the O2·- into H2O2, and H2O2 is
Figure 5. Effect of H2S on NO emission system in
cucumber under chilling stress. The same tissues for H2S
emission system analysis were sampled for NO emission
system assay. Seeds were soaked with 1.0 mM NaHS
(H2S donor), 0.15 mM HT (H2S scavenger), 0.1 mM
SNP (NO donor), 15 µM Hb (NO scavenger) or
deionized water (control) for 12 h. One-leaf seedlings
were exposed to 5 °C for 24 h. A, NO content; B, NR
activity; C, NR mRNA abundance. All values shown are
mean ± SD (n = 3). a, b, c, d, e and f indicate that mean
values are significantly different among samples
(P<0.05).
Figure 6. Effect of NaHS and SNP on MDA content in
cucumber seedlings under chilling stress. Seeds were
soaked with 1.0 mM NaHS (H2S donor), 0.1 mM HT
(H2S scavenger), 0.1 mM SNP (NO donor), 15 µM Hb
(NO scavenger), 1.0 mM NaHS+15 µM Hb or
deionized water (control) for 12 h. One-leaf seedlings
were exposed to 5 °C for 24 h. All values shown are
mean ± SD (n = 3). a, b, c, d, e and f indicate that mean
values are significantly different among samples
(P<0.05).
J. Plant Bio. Res. 2016, 5(3): 58-69
66
Figure 7. Effects of NaHS and SNP on activities and mRNA expression of antioxidant enzymes in cucumber seedlings
under chilling stress. Seeds were soaked with 1.0 mM NaHS (H2S donor), 0.1 mM HT (H2S scavenger), 0.1 mM SNP
(NO donor), 15 µM Hb (NO scavenger), 1.0 mM NaHS+15 µM Hb or deionized water (control) for 12 h. One-leaf
seedlings were exposed to 5 °C for 24 h. A-D, SOD, POD, APX and GR activity, the second leaf of cucumber seedlings
were sampled for the activities assay. E-H, mRNA expression of SOD, POD, APX and GR, total RNA was separately
isolated from the same tissues for the activities determination, and subjected to real-time PCR analysis. All values
shown are mean ± SD (n = 3). a, b, c, d, e and f indicate that mean values are significantly different among samples
(P<0.05).
J. Plant Bio. Res. 2016, 5(3): 58-69
67
Figure 8. Effects of NaHS and SNP on the contents of AsA and GSH, and the ratio of AsA/DHA and GSH/GSSH in
cucumber seedlings under chilling stress. Seeds were soaked with 1.0 mM NaHS (H2S donor), 0.1 mM HT (H2S
scavenger), 0.1 mM SNP (NO donor), 15 µM Hb (NO scavenger), 1.0 mM NaHS+15 µM Hb or deionized water
(control) for 12 h. One-leaf seedlings were exposed to 5 °C for 24 h. A, C, the contents of AsA and GSH; B, D, the
ratio of AsA/DHA and GSH/GSSH. All values shown are mean ± SD (n = 3). a, b, c, d, e and f indicate that mean
values are significantly different among samples (P<0.05).
then reduced to water by POD, CAT, APX, etc.,
thus preventing further injury to the cell membrane
[35]. GR is responsible for modulating the
glutathione redox state by converting GSSG into
GSH, and GSH is the major non-enzymatic
antioxidant that contributes to plant antioxidant
defense and chilling stress response [22]. From the
results, we found that the activities and mRNA
expressions of SOD, POD, APX, and GR in
cucumber seedlings during chilling exposure were
significantly increased by NaHS and SNP (Figure
7). This provides evidence that higher activities of
antioxidant enzymes is one of the important
mechanisms of resistance to chilling stress induced
by H2S and NO in cucumber seedlings.
AsA and GSH are the key metabolites of the AsA-
GSH cycle [36] and are generally considered to be
one of the main ROS detoxification systems in
plants [37]. Under chilling stress, the AsA content
decreased, while GSH showed no significant
alteration (Figure 8A, C). We thus inferred that AsA
contributed earlier than GSH to the defense against
oxidative damage. The AsA and GSH scavenged
ROS in a way that they were oxidized into DHA and
GSSG, respectively. Consequently, the AsA/DHA
and GSH/GSSG ratios decreased obviously during
chilling stress (Figure 8B, D). NaHS and SNP led to
increase in AsA and GSH and decrease in the
AsA/DHA and GSH/GSSG ratios in the stressed
seedlings. Therefore, we speculate that H2S and NO
might activate the AsA-GSH pathway and regulate
the plant antioxidative defense system.
It was clear that the beneficial effects of NaHS on the
activities and mRNA expression of the antioxidant
enzymes as well as the AsA and GSH contents could
be partly weakened by Hb. This suggested that H2S
up-regulated the antioxidant systems in an NO-
dependent or independent manner. A model based on
the results in this experiment was proposed to
elucidate the signaling pathways of H2S and NO in the
cucumber response to chilling stress. Chilling stress
stimulated H2S and NO signal, and H2S interacting
with NO signal participated in physiological processes
to defend against chilling stress.
CONCLUSION
It is clearly shown that H2S induced chilling
tolerance in cucumber seedlings, as shown by the
decrease in stress-induced electrolyte leakage, the
decreased contents of H2O2 and MDA and the
production rate of O2·-, which occurred partially due
to the induction of antioxidant metabolism.
Interestingly, all of these events interacted with NO,
J. Plant Bio. Res. 2016, 5(3): 58-69
68
therefore, suggested that NO involved in H2S
induced chilling tolerance of cucumber seedlings.
ACKNOWLEDGENT This work was supported by the National Science
Fundation of China (contract no. 31572170) and the
Natural Science Foundation of Shandong Province
(contract no. ZR2015CM005).
REFERENCES
[1] Siddiqui. M.H., Al-Whaibi. M.H and Basalah. M.O.
2011. Role of nitric oxide in tolerance of plants to
abiotic stress. Protoplasma. 248: 447-455.
[2] Wilson. L.G., Bressan. R.A and Filner. P. 1978.
Light-dependent emission of hydrogen sulfide from
plants. Plant Physiology. 61: 184-189.
[3] Hällgren. J.E and Fredriksson. S.A. 1982. Emission
of hydrogen sulfide from sulfur dioxide-fumigated
pine trees. Plant Physiology. 70: 456-459.
[4] Jin. Z.P., Shen. J.J., Qiao. Z.J., Yang. G.D., Wang. R
and Pei. Y.X. 2011. Hydrogen sulfide improves
drought resistance in Arabidopsis thaliana.
Biochemical and Biophysical Research
Communications. 414: 481-486.
[5] Wang. Y.Q., Li. L., Cui. W.T., Xu. S., Shen. W.B and
Wang. R. 2012. Hydrogen sulfide enhances alfalfa
(Medicago sativa) tolerance against salinity during
seed germination by nitric oxide pathway. Plant Soil.
351: 107-119.
[6] Luo. Z.S., Li. D.D., Du. R.X and Mou. W.S. 2015.
Hydrogen sulfide alleviates chilling injury of banana
fruit by enhanced antioxidant system and proline
content. Scientia Horticulturae. 183: 144-151.
[7] Zhang. L.P., Pei. Y.X., Wang. H.J., Jin. Z.P., Liu.
Z.Q., Qiao. Z.J., Fang. H.H and Zhang. Y.J. 2015.
Hydrogen Sulfide alleviates cadmium-induced cell
death through restraining ROS accumulation in roots
of Brassica rapa L. ssp. pekinensis. Oxidative
Medicine and Cellular Longevity. 2015: 1-11.
[8] Chen. J., Wu. F.H., Wang. W.H., Zheng. C.J., Lin.
G.H., Dong. X.J., He. J.X., Pei. Z.M and Zheng. H.L.
2011. Hydrogen sulphide enhances photosynthesis
through promoting chloroplast biogenesis,
photosynthetic enzyme expression, and thiol redox
modification in Spinacia oleracea seedlings. Journal
of Experimental Botany. 62: 4481-4493.
[9] Guo. F.Q and Crawford. N.M. 2005. Arabidopsis
nitric oxide synthase1 is targeted to mitochondria and
protects against oxidative damage and dark-induced
senescence. Plant Cell. 17: 3436-3450.
[10] Mishina. T.E., Lamb. C and Zeier. J. 2007.
Expression of a nitric oxide degrading enzyme
induces a senescence programme in Arabidopsis.
Plant, Cell and Environment. 30: 39-52.
[11] Bethke. P.C., Libourel, I.G and Jones R.L. 2006.
Nitric oxide reduces seed dormancy in Arabidopsis.
J. Exp. Bot. 57: 517-526.
[12] He. Y.K., Tang. R.H., Hao. Y., Stevens. R.D., Cook.
C.W., Ahn. S.M., Jing. L.F., Yang. Z.G., Chen. L.E.,
Guo. F.Q., Fiorani. F., Jackson. R.B., Crawford. N.M
and Pei. Z.M. 2004. Nitric oxide represses the
Arabidopsis floral transition. Science. 305: 1968-
1971.
[13] Neill. S.J., Desikan. R., Clarke. A and Hancock. J.T.
2002. Nitric oxide is a novel component of abscisic
acid signaling in stomatal guard cells. Plant Physiol.
128: 13-16.
[14] Li. Z.G., Yang. S.Z., Long. W.B., Yang. G.X and
Shen. Z.Z. 2013. Hydrogen sulfide may be a novel
downstream signal molecule in nitric oxide-induced
heat tolerance of maize (Zea mays L.) seedlings.
Plant Cell Environ. 36: 1564-1572.
[15] Lisjak. M., Srivastava. N., Teklic. T., Civale. L.,
Lewandowski. K., Wilson. I., Wood. M.E.,
Whiteman. M and Hancock. J.T. 2010. A novel
hydrogen sulfide donor causes stomatal opening and
reduces nitric oxide accumulation. Plant Physiology
and Biochemistry. 48: 931-935.
[16] Shi. H.T., Ye. T.T and Chan. Z.L. 2013. Exogenous
application of hydrogen sulfide donor sodium
hydrosulfide enhanced multiple abiotic stress
tolerance in bermudagrass (Cynodon dactylon (L).
Pers.). Plant Physiology and Biochemistry. 71: 226-
234.
[17] Sekiya. J., Schmid. A., Wilson. L.G and Filner. P.
1982. Emission of hydrogen sulfide by leaf tissue in
response to L-cysteine. Plant Physiology. 70: 430-
436.
[18] Riemenschneider. A., Nikiforova. V., Hoefgen. R.,
de Kok. L.J and Papenbrock. J. 2005. Impact of
elevated H2S on metabolite levels, activity of
enzymes and expression of genes involved in
cysteine metabolism. Plant Physiology and
Biochemistry. 43: 473-483.
[19] Thordal-Christensen. H., Zhang. Z.G, Wei. Y.D and
Collinge. D.B. 1997. Subcellular localization of H2O2
in plants. H2O2 accumulation in papillae and
hypersensitive response during the barley-powdery
mildew interaction. Plant J. 11: 1187-1194.
[20] Jabs. T., Dietrich. R.A and Dangl. J.L. 1996.
Initiation of runaway cell death in an Arabidopsis
mutant by extracellular superoxide. Science. 27:
1853-1856.
[21] Wang. A.G and Luo G.H. 1990. Quantitative
relation between the reaction of hydroxylamine and
superoxide anion radicals in plants. Plant physiology
communications. 6: 55-57.
[22] Dong. X.B., Bi. H.G., Wu. G.X and Ai. X.Z. 2013.
Drought-induced chilling tolerance in cucumber
involves membrane stabilisation improved by
J. Plant Bio. Res. 2016, 5(3): 58-69
69
antioxidant system. International Journal of Plant
Production. 7: 67-80.
[23] Zhao. S.J., Shi. G.A and Dong. X.C. 2002.
Techniques of plant physiological experiment. Press
of Agricultural science and technology in China. 42-
44.
[24] Cho. U.H and Park. J.O. 2000. Mercury-induced
oxidative stress in tomato seedlings. Plant Science.
156: 1-9.
[25] Heath. R.L and Packer. L. 1968. Photoperoxidation
in isolated chloroplasts I. Kinetic and stoichiometry
of fatty acid peroxidation. Archives of Biochemistry
and Biophysics. 125: 189-198.
[26] Beyer. WF.Jr and Fridovich. I. 1987. Assaying for
superoxide dismutase activity: some large
consequences of minor changes in conditions.
Analytical Biochemistry. 161: 559-566.
[27] Omran. R.G. 1980. Peroxide levels and the activities
of catalase, peroxidase, and indoleacetic acid oxidase
during and after chilling cucumber seedlings. Plant
Physiol. 65: 407-408.
[28] Nakano. Y and Asada. K. 1987. Purification of
ascorbate peroxidase in spinach chloroplasts; its
inactivation in ascorbate-depleted medium and
reactivation by monodehydroas- corbate radical. Plant
Cell Physiol. 28: 131-140.
[29] Foyer. C.H and Halliwell. B. 1976. The presence of
glutathione and glutathione reductase in chloroplasts:
a proposed role in ascorbic acid metabolism. Planta.
133: 21-25.
[30] Law. MY., Charles. SA and Halliwell. B. 1983.
Glutathione and ascorbic acid in spinach (Spinacia
oleracea) chloroplasts. The effect of hydrogen
peroxide and of paraquat. Biochemical Journal. 210:
899-903.
[31] Fang. H.H., Jing. T., Liu. Z.Q., Zhang. L.P., Jin. Z.P
and Pei. Y.X. 2014. Hydrogen sulfide interacts with
calcium signaling to enhance the chromium tolerance
in Setaria italic. Cell Calcium. 56: 472-481.
[32] Harrington. H.M and Smith. I.K. 1980. Cysteine
metabolism in cultured tobacco cells. Plant
Physiology. 65: 151-155.
[33] Nagasawa. T., Ishii. T., Kumagai. H and Yamada.
H. 1985. D-cysteine desulfhydrase of escherichia coli.
purification and characterization. International
Orthopaedics. 153: 1-7.
[34] Shen. J.J., Xing. T.J., Yuan. H.H., Liu. Z.Q., Jin.
Z.P., Zhang. L.P and Pei. Y.X. 2013. Hydrogen
sulfide improves drought tolerance in Arabidopsis
thaliana by microRNA expressions. PLOS ONE. 8:
1-8.
[35] Kornyeyev. D., Logan. B.A., Payton. P., Allen. R.D
and Holaday. A.S. 2001. Enhanced photochemical
light utilization and decreased chilling-induced
photoinhibition of photosystem II in cotton
overexpressing genes encoding chloroplast -targeted
antioxidant enzymes. Physiologia Plantarum. 113:
323-331.
[36] Noctor. G and Foyer. C.H. 1998. Ascorbate and
glutathione: keeping active oxygen under control.
Annual Review of Plant Biology. 49: 249-279.
[37] Xu. S., Li. J.L., Zhang. X.Q., Wei. H and Cui. L.J.
2006. Effects of heat acclimation pretreatment on
changes of membrane lipid peroxidation, antioxidant
metabolites, and ultrastructure of chloroplasts in two
cool-season turfgrass species under heat stress.
Environmental and Experimental Botany. 56: 274-
285.