Undergraduate Thesis

Name: Ian Martin

Programme: Genetics & Cell Biology GCB4

Student Number: 11532343

Supervisor: Dr. Brendan O’Connor

Combined Literature Survey & Final Year Research Project

Literature Survey

Simply Better Glycoproteins : A Bittersweet Relationship

Between Glycosylation and Recombinant Therapeutics

Final Year Research Project

Assessing the Sweet Tooth of Fungal Lectin AAL-2:

Characterizing AAL-2 binding with N-aceylglucosamine

Appendix A

DCU University’s Declaration on Plagiarism

Assignment Submission Form

This form must be filled in and completed by the student submitting an assignment.

Assignments submitted without the completed form will not be accepted.

Name:

Programme:

Module Code:

Assignment Title:

Submission Date:

I declare that this material, which I now submit for assessment, is entirely my own

work and has not been taken from the work of others, save and to the extent that such

work has been cited and acknowledged within the text of my work. I understand that

plagiarism, collusion, and copying are grave and serious offences in the university and

accept the penalties that would be imposed should I engage in plagiarism, collusion or

copying. I have read and understood the Assignment Regulations set out in the

module documentation. I have identified and included the source of all facts, ideas,

opinions, and viewpoints of others in the assignment references. Direct quotations

from books, journal articles, internet sources, module text, or any other source

whatsoever are acknowledged and the source cited are identified in the assignment

references. This assignment, or any part of it, has not been previously submitted by

me or any other person for assessment on this or any other course of study.

I have read and understood the referencing guidelines found at

http://www.library.dcu.ie/citing&refguide08.pdf and/or recommended in the

assignment guidelines.

Name: ________________________________ Date: _________________

Simply Better Glycoproteins

“A Bittersweet Relationship Between Glycosylation

and Recombinant Therapeutics”

Name: Ian Martin

Student Number: 11532343

Supervisor: Brendan O’ Connor

Programme: Genetics and Cell Biology (GCB4)

Abstract

Glycosylation is a ubiquitous post translational modification found in all domains of life

that involves the sequential addition of sugars to biomolecules. The attachment of specific

glycans to therapeutic glycoproteins imparts extensive functional information that extends

beyond the genome code and plays an important role in dictating a biologic’s pharmacological

efficiency, structure and immunogenicity. Several industrial cell lines are subject to a spectrum

of inventive glycoengineering strategies to produce high amounts of desired homogenous

therapeutic glycoproteins that are both fit for purpose and safe for patient consumption. This

review summarises the salient features of N- and O-linked protein glycosylation, details the

significance of glycosylation in relation protein therapeutics and explores glycoengineering

techniques used to obtain optimal biologics from mammalian, bacteria and plant cell lines.

Contents Introduction ............................................................................................................................................... 1

What Is Glycosylation? ............................................................................................................................ 1

N-Glycosylation ........................................................................................................................................ 2

O-linked Glycosylation ............................................................................................................................. 4

Glycoprotein heterogeneity ....................................................................................................................... 5

Properties of Therapeutic Glycoproteins .................................................................................................. 5

Controlling Glycosylation ......................................................................................................................... 7

Mammalian Cell Lines .............................................................................................................................. 9

Precision Genome Editing Strategies in CHO cells ................................................................................ 11

Bacteria Cell Lines .................................................................................................................................. 14

E.coli Vaccine Production ...................................................................................................................... 16

Plant Cell Lines ....................................................................................................................................... 18

Glycoengineering The First Plant FDA Approved Biologic .................................................................. 22

Future Perspectives ................................................................................................................................. 23

Conclusion .............................................................................................................................................. 24

References ............................................................................................................................................... 24

1

Introduction

Traditional small molecule drugs synthesised from reproducible chemical reactions are

steadily being replaced by large molecule recombinant proteins, known as biologics, which are

derived from genetically modified industrial cell lines(Walsh 2009; Walsh 2010; Lepenies &

Seeberger 2014). This molecular transition in therapeutic drug production has fuelled the

emergence of the biopharmaceutical industry over the last 30 years and today it is approximated

that there are over 4000 biotech companies worldwide (Walsh 2009; Walsh 2010). The

properties of a biologic are governed by several variables including post translational

modifications (PTM) and the biopharmaceutical industry are recognizing that 40% of

recombinant proteins are subject to glycosylation(Declerck 2012). Such a PTM can produce

thousands of variations of an approved recombinant drug which is a concern to drug authorities

because glycosylation has such an extensive impact on the biological and physical characteristics

of given recombinant therapeutic(Spiro 2002(Walsh 2010)). By characterising pivotal glycan

motifs that dictate pharmacological activity and harnessing industrial cell glycosylation in

controlled manner, glycoproteins can be optimised for efficiency and safe patient

consumption(Griebenow & Sola 2010). The purpose of this literature review is to examine the

prominent features of glycosylation as well as detailing the latest possible glycoengineering

strategies being pursued in regards mammalian and non-mammalian cells in order to produce

high quality drug products(Lepenies & Seeberger 2014).

What Is Glycosylation?

Glycosylation is a universal post-translational modification present in eukarya,

prokaryotes and archaea which facilitates the addition of oligosaccharides to lipids or proteins in

order to form glycoproteins and glycolipids respectively(Lowe & Marth 2003). A cell’s glycome

is the collective term given to all the free glycans that are transported into cells by integral

membrane transporters , sugars produced via de novo pathways and oligosaccharide bearing

biomolecules(Marth & Grewal 2008) . Different domains of life exhibit show glycomes and in

eukaryotic cells 10 monosaccharides predominant the composition of a given glycan

biomolecules. They are as follows; fucose (Fuc), galactose (Gal), glucose (Glc),

2

N‑acetylgalactosamine (GalNAc), N‑acetylglucosamine (GlcNAc), glucuronic acid (GlcA),

iduronic acid (IdoA), mannose (Man), sialic acid (SA) and xylose (Xyl)(Moremen et al. 2012).

Studies have indicated that most secreted molecules in cells are enzymatically modified

using the activated form of the above sugars as they travel through the Endo Reticulum (ER)

and Golgi Apparatus pathway (Freeze et al. 2009).It is suggested that there is nearly 700 proteins

work in symphony to orchestrate the production of an estimated 7,000 mammalian glycan

structures in the ER-Gogi pathway. (E.Taylor 2003)Glycosylation predominantly relies on

integral membrane known as glucosytransferases and glycosidases proteins within this system to

synthesise glycan structures onto biomolecules.

35 % of glycosylation enzymes found in eukarya cells are categorized as

glycosyltransferases which catalyse glycosidic alpha and beta bonds between activated

monosaccharides and add oligosaccharide chains to proteins directly. (Paulson et al. 2006;

Gloster 2014). Glycotranferases are specific for the monosaccharide donor substrates they act

upon and their anabolic action promotes the elongation of glycan motifs. Glycosidases on the

other hand cleave monosaccharides off oligosaccharides by disrupting glycosidic bonds within

an polysaccharide chain. The complimentary action of glycosyltransferases and glycosylsidases

carry out different types glycosylation which categorised by the identity of the atom contained

in the amino acid in which a carbohydrate chain is attached.(Ohtsubo & Marth 2006) For the

purposes of this review only N- and O-linked glycosylation will be examined as these are

predominant glycosylation products in a given cell.

N-Glycosylation

N-Linked Glycosylation is the most abundant form of glycosylation across all domains of

life as approximately 90-95 % of glycoproteins contain N-glycan structures. N-glycosylation

assembly is depicted in Figure 1 (Sneider,J n.d) and begins with the fabrication of a lipid

precursor known as lipid dolichol phosphate (Dol-P) made up of 14 monosaccharides (Costa et

al. 2014).This lipoglycan structure is constructed on the cytosolic side of the ER membrane with

GlcNac and Man residues before being translocated into the lumen of ER via a bilayer flippase

(Costa et al. 2014).Situated in the ER lumen four Man and three Glc residues are attached to the

lipoglycan completing the synthesis of the dolichol glycan precursor Glc3Man9GlcNAc2.

3

]he crucial step of N-glysoylation is the attachment of Glc3Man9GlcNAc2 to an

emerging protein being translated from a ribosome. This event is a co-translational and en bloc

transfer of the lipid-glycan is mediated by an oligosaccharyltransferase (OST) emedded in the

bilayer to an exposed Asn residue (Dell et al. 2010). Typically a predicted consequence Asn-X-

Thr/Ser motif sequence whereby X can be any amino acid except proline is used for N-

glycosylaion. (Spiro 2002). One should also acknowledge that proteins emerging from a

ribosome are not in a folded state thus facilitate access to an asn sites. Once a

Glc3Man9GlcNAc2 motif is attached a series of successive trimming steps ensue in the lumen of

the ER by glucosidases to yield Man8GlcNAc2. This is the core structure for any N-glycan

before diversification in the Golgi apparatus(Wang & Amin 2014).

Figure 1 N-glycan Construction.Lipid precursor is synthesised in the cytosol and

translocated into the ER via a flippase. An oligosaccharide transferase attaches the

precursor lipoglycan structure to an Asn residue of growing nascent protein

The Golgi Apparatus is composed of a series of cisternae stacks known as the cis,

medial and trans cisternae respectively. Vesicle transport allows secretory proteins to be shipped

from the ER to the Golgi complex and between these cisternse compartments. N-glycans are

initially transported to the cis cistarnae where 3 mannose residues are cleaved by mannosidase

before being transported to the medial Golgi. Within the medial-Golgi further mannose cleavage

ensues before GlcNac and fucose residues are attached. Processing of a glycoprotein is

completed in the Golgi when finally galactose residues and sialic are added. These reactions

allows variable amounts of GlcNAc, galactose, fucose, and sialic acid to be given glycoprotein in

4

variety of different linkage patterns before processed glycoproteins are transferred to many intra

and extracellular destinations (Freeze et al. 2014).

Ultimately, a N-Glycan with core Man3GlcNa2 can exhibit one of 3 types of sugar

structures as depicted in Figure 2 (Hossler 2009 ,pg 939, fig 01) (1) High mannose (5 -9

mannose residues linked to core Man3GlcNa2). (2) Complex (No mannose attached but Gal and

siaic acid residues are attached in branched structures). (3) Hybrid (High mannose content and

complex antenne which can be biantennary, triantennary and tetra-antennary)

O-linked Glycosylation

O-Glycosylation is the second most predominant form of glycosylation found in all

domains of life. It is characterised by the addition of oligosaccharides to serine and threonine

acceptor amino sites however unlike N-glycosylation does not harbour a specific amino acid

acceptor sequence(Ohtsubo & Marth 2006). Contrary also to N-glycans which decorate a given

protein at between 1 -10 sites, O-gylcans are more universally expressed along the polypeptide

backbone of glycoprotein(E.Taylor 2003). For example mucins and proteoglycans O-glycans

produce large sugar motifs that make up to 75% of the final mass of a given glycoprotein. The

Figure 2 N-Glycan and O glycan structures Structures (A) N-glycosylation can result in 3

possible structures: (1)High Mannose structure (2)Hybrid structure (3) Complex (B) O-

glycans cosist one of 8 core glycan structures.

5

exact mechanics of O-glycosylation are less characterised than that of N-glycosylation but it

widely accepted they principally take place in the Golgi complex. O-glycans exhibit simple sugar

motifs with one of 8 core structures depicted in figure 2.(Ohtsubo & Marth 2006; Hossler et al.

2009) While O- glycosylation produces a wide diversity of O-glycan structures, the purpose of

such modifications are not as well-known as N-glycosylation.For this reason the remainder of the

review will concentrate on primarily on N-glycosylation.

Glycoprotein heterogeneity

A given protein encoded from a single gene sequence can exist in several different

glycosylated states , known as a glycoforms, due to different sugar being attached to the same

protein.(Griebenow & Sola 2010). Unlike protein sequences which are derived from gene order,

glycan structures are indirectly coded from the genome because they are created from gene

encoded glycosytransferases and glycosidases. It should be emphasized each golgi cisternae

apparatus harbours different glycosylation enzymes that contend with other each other to modify

glycan motifs. (Lowe & Marth 2003) For example the competitive between glycosyltransferses

to act on glycan sugar substrate may be decided by monosaccharide availability in a cell.

Therefore if a particular sugar is more readily obtainable at a given time it will be added to a

glycan motif structure first. This is important because the product of each enzymatic reaction

provides the substrate for the next step thus the addition of one monosaccharide over another

may switch the faith of a glycan motif (Ohtsubo & Marth 2006). Variation in the activity of

glycosynthetic enzymes along other variables such as the speed in which glycosylation takes

place in the ER-Golgi pathway and remodelling of a glycoprotein when it is discharged from the

golgi apparatus result in glycan micro and macro heterogeneity being displayed on the surface of

a glycoprotein. (Ohtsubo & Marth 2006; Lowe & Marth 2003) This glycan deviation is best

exemplified by an IgG which can hold one of 32 unique oligosaccharides motifs on each of its

heavy chains. Due to the bisymmetrical nature of IgG therefore there are in total 500

glycoforms that could materialise due to variations in the glycosylation pathway (Uçaktürk 2012;

Jefferis 2009).

Properties of Therapeutic Glycoproteins

The above concept of glycosylation heterogeneity plays an instrumental role in dictating

the properties of proteins because glycan motifs convey supplementary information that

6

overrides DNA transcription, supersedes translation and ultimately dictates the properties of a

protein(Hossler et al. 2009a). As will be now discussed this is extremely relevant in regards

recombinant therapeutics because studies have shown that the presence and absence of sugar

contribute significantly the solubility, stability and half-life of a given biologic (Kamionka 2011;

Griebenow & Sola 2010)

Solubility

Solubility plays an instrumental role in attaining the desired therapeutic concentration of

a drug in systemic blood and hence promotes a correct pharmacological response in a patient.

One example whereby the solubility properties of a biologic is governed by glycosylation is

Fabrazyme which is a-galactosidase used to treat Fabrys disease.(Walsh 2009) Studies have

showed that if N-glycosylation does not occur at asn184 of its polypeptide chain unfavourable

aggregation and precipitation of the drug can transpire in vivo. It is suggested that N-

glycosylation increases solubility because hydrophilic sugar molecules such as sialic acid

shielding hydrophobic residues interacting with blood plasa. (Walsh 2009)

Stability

The systemic expression of proteases blood circulation can result in unwanted proteolytic

degradation of a given biologic and reduced bioavailability. It has been suggested that

glycosylation can mechanically disrupt protease catalysis by steric hindering or cleaving the

active site of a proteases. In addition the branching, length and overall charge of glycan

structures also repel proteolysis. (Golledge et al. 2007; Russell et al. 2009).

Half Life

It has been indicated that N- and O- glycan structures dramatically impact the circulatory

half-life of therapeutic glycoproteins. It is widely accepted that the presence of terminal sialic

acids is proportional to the lifespan of a glycoprotein in blood. Sialic residues are hypnotised to

shield galactose or mannose terminating glycoproteins by blocking asialoglycoprotein

receptor-mediated endocytosis in liver cells. (Hossler et al. 2009b)One recombinant protein

which expresses high sensitivity towards N-terminal sialylation is Erythropoietin (EPO). This

hormonal drug plays in an imperative role in the regulation of red blood cell homeostasis in

7

anaemic patients .Studies performed have shown that when human recombinant was injected

intravenously into rodents the half-life of the drug was between 5 to 6 hours while desialylated

EPO remained lasted under 2 minutes.(Hossler et al. 2009)

Immunogenicity

The capacity of a given compound to elicit an immune response is defined as its

immunogenicity. An unwanted immune reaction can be triggered by a glycoprotein because the

body’s immune system recognises a biologic as a non-self molecule. (van Beers & Bardor

2012)Over the last ten years several sugar epitopes have been identified to stimulate an

immunological response. For example 50 % of blood donors contain antibodies against β1,2-

xylose core-xylose, which is a characteristic of plant glycosylation. The potential stimulation of

the immune response because of the presence of these anti-β1,2-xylose core-xylose

immunoglobulins has pressed industry to regulate glycosylation pathways in cells.(van Beers &

Bardor 2012)

Controlling Glycosylation

As previously discussed above the unpredictability glycoform generation is a distinctive

hallmark of glycosylation. Drug authorities are becoming increasing concerned about variable

glycan composition because glycosylation can significantly affect the pharmacological

characteristics of a biologic(Jenkins et al. 2008). This capacity to modify proteins noticeably

means that control of glycosylation mechanism in industrial cell lines is of upmost priority in

relation to therapeutic protein manufactory (Walsh & Jefferis 2006) Drug authorities are exerting

mounting pressure of biotech companies to the regulate underlying glycosylation mechanisms,

characterise optimal glycoprofiles and enrich for such biologics in accordance with defined

acceptance limits stipulated by international drug protocols.(Hossler et al. 2009b). These limits

are set in place to ensure that drugs are fit purpose and not dangerous for patient consumption.

However ever since the first glycoprotein there has been ongoing debate regarding what

glycoforms comprise the identity, purity and potency of a drug product without revaluating a as a

new biopharmaceutical.(Schiestl et al. 2011) In a study published in Nature in 2011 Martin

Schiestl et el highlights the prevalence of glycoform variation in respect to 3 biologics Enbrel,

Aranesp and Rituxan when compared to their original approved glycoform. (Schiestl et al. 2011)

8

All three molecules exhibited subtle changes in their glycosylation status from 2007 to 2010

which were properly the resultant of alterations in bioprocessing. While the study acknowledges

that such implemented changes had to be proven they were beneficial in respective to their

pharmacological performance it comments that the control of constant glycoform during biologic

manufacturing is a considerable challenge due to variables introduced during the culturing and

the innate mechanics of glycosylation itself. (Schiestl et al. 2011) These are issues now being

circumvented by glycoengineering which is the controlled manipulation of a protein’s glycan

composition using in vitro and in vivo techniques.

Examples of glycongineering methods include modifying directly the amino acid content

of ta biologic such as introducing new N-glycosylation sites into its amino acid backbone. This

tactic is exemplified by Aranespap which is an EPO derivative Configured to contain 5 N-

glycosylation sites rather its wild type’s 3. It was shown that the addition of N-glycans in these

the new regions increased the half-life of the drug due to increased sialic acid conten(Zhong &

Wright 2013). As hinted at before altering culturing parameters can modify glycanprofiles and

one such glycoengineering strategy being used is the reduction the culturing temperatures to

yield homogenous glycoprofiles. The theory underpinning this culturing technique is that lower

temperatures promote cell survival and decrease glycosidases being emitted into culture from

cell apoptosis.(Hossler et al. 2009a).

A modern initiative to glycoengineering involves concentrating on the innate

glycosylation characteristics of the cell line it was generated from. Industrial cells lines display

unique glycosylation glycoprofiles as shown in Figure 3 (D.Ghaderi et al 2010,pg 149,fig 01)

because different cells lines do not use the same glycosylation pathway, contain the same

enzymes or harness the same monosaccharides. (Lowe & Marth 2003)For this reason there are a

spectrum of cells used in industry today ranging from mammalian to non-mammalian cells that

offer their own distinct advantages and disadvantages when producing recombinant

glycoproteins(Hossler et al. 2009a). Cell specific glycoengineering is transforming the

manufactory of these biologics because it regulates precisely the construction of glycoproteins.

The following section will examine mammalian, bacteria and plant cell lines and detail how

initiative glycoengineering techniques are revolutionising their use in biotechnology.

9

Figure 3 Glycoprofiles displayed in yeast, insect, animal and plants in comparison to Human

glycan structure.

Mammalian Cell Lines

Since the origin of animal derived recombinants up to 2011, 96 recombinant protein

therapeutics stemming from mammalian host cells have been approved by international drug

authorities and currently these cells generate 2 thirds of total biopharmaceutical revenues each

year (Lai et al. 2013). There are a variety of mammalian systems used in industry including

rodent cells lines Baby Hamster Kidney (BHK) cells and mouse myeloma (NS0) cells as well as

human cell lines such as Human Embryonic Kidney cells(HEK- 293)(Qiu et al. 2014; Hossler et

al. 2009a). For the purposes of this review hinase Hamster ovaries (CHO) cells will be the

mammalian culturing system of focus because they are most common cell host for commercial

bioprocessing. It is estimated that up to 70 % of current biologics are being produced using CHO

cells. These cells are useful for bioprocessing because of several reasons including low viral

transmission, tolerance to environmental factors (Temperature, pressure pH and oxygen) and

substantial yields of desired therapeutic proteins. (Butler & Spearman 2014; Durocher & Butler

2009; Lai et al. 2013) In addition CHO cells can adjust to growing in bioreactor suspension

cultures and in the presence of serum-free and chemically defined media to enhance

reproducibility between batches. From the perspective of this essay mammalian cell lines such as

CHO cells have the intrinsic ability to perform PTMs such as glycosylation in a manner which is

10

comparable to humans .However while the early events of glycosylation are conserved between

the two species evolutionary divergences have resulted immunogenic alpha-Gal and Neu5Gc

being added to the N-terminus during CHO glycosylation processes.

Alpha-Gal

The first dissimilarity between human and CHO glycosylation is that humans cannot cap

N-glycan structures with alpha-gal structures. Humans lost their ability to synthesise these motifs

structures 20 -30 million years ago and have developed antibody resistance during the same

period.(Xu et al. 2011) All humans have IgA, IgM, and IgG against alpha-Gal motifs and

collectively these antibodies account for 1% of all immunoglobulins in the bloodstream. It is still

unclear what exact levels of α-Gal is needed to stimulate anaphylaxis or immunogenic responses

in patients however the presence of high levels of anti-α-Gal antibodies suggests curtailing a-gal

exposure mitigates the risk of any potential reation (Bosques et al. 2010; Butler & Spearman

2014; Ghaderi et al. 2010).

It is well documented that the adverse effects associated with the anticancer drug Erbitux,

produced in myeloma cells, is attributed to the both the intravenous delivery method and the

presence of alpha Gal terminal moieties. Until recently it was believed that CHO cells lack the

machinery to synthesise such an immunogenic epitope and was a possible expression system

option to replace myeloma expression for Erbitux.(Ghaderi et al. 2010) However it has been

controversially reported that CHO cells contains the necessary N-acetyllactosaminide 3-α-

galactosyltransferase-1 which facilities the addition of a-gal to N-terminals of glycans(Bosques

et al. 2010). New Studies conducted on Abatacept produced in CHO cells now suggest low

occurrence of unwanted α-Gal epitopes in some of the glycoforms it generates.(Bosques et al.

2010).

Neu5Gc

Another difference between human and CHO cell glycosylation is that humans only

produce sialic acid N-acetylneuraminic acid (Neu5Ac ) and contrary to mammalian cell lines

including CHO cells human cannot synthesise N-acetylglycolneuraminic acid Neu5Gc .Recent

studies have shown that non-human Neu5Gc sialic acid is evident in various FDA approved

glycoprotein drugs(Ghaderi et al. 2010).Work by Ghaderi et al established that humans contain

11

variable levels anti-Neu5Gc antibodies and in some cases patients have shown to demonstrate

elevated levels of this immunglobulin in their blood serum which accounted for 0.1–0.2% of

circulating IgG. It is now suggested that injectable glycoproteins contaminated with Neu5Gc can

elicit the production of undesirable immune complexes that can trigger the complement system

and heighten the risk cancer and cardiovascular disease in patients(Ghaderi et al. 2012; van

Beers & Bardor 2012). To eradicate these undesirable immunogenic reactions several in vivo and

in vitro glycoengineering approaches have been employed including manipulation cell cultures

and anti-sense RNA strategies.

When CHO cells are grown in suspension medium they inherit extracellular Neu5G from

animal derived materials and metabolically incorporate them into their own glycan profile. By

growing CHO cells in medium that doesn’t contain Neu5G or supplementing human Neu5Ac in

order to compete with endogenous Neu5G the generation of glycoform containing Neu5Gc

residues can be eradicated (Ghaderi et al. 2012) .A more invasive in vivo approach was

employed by Stephane Chenu et al who used antisense RNA fragments designed from

homologous hamster and mice nucleotide sequences to inhibit the CMP-Neu5Ac hydroxylase.

(Chenu et al. 2003). Blocking of CMP-Neu5Ac hydroxylase translation and subsequent transfer

was achieved s by two mechanisms 1) steric hindrance of the ribosome binding and 2) removal

of antisense RNA-mRNA duplexes by Rnases. Overall this method achieved an 80% reduction

in the levels of Neu5Gc in the CHO-AsUH2 cell relative to the untreated parental cell. This

method produced a stable cell line that could passaged up to 30 times displaying low levels of

Neu5Gc content (Chenu et al. 2003).

Precision Genome Editing Strategies in CHO cells The arrival of new accurate gene manipulation technologies holds much promise in

yielding homogenous glycoforms that are produced via genetically tailored glycosylation

pathways in CHO cells. Techniques such as Zinc Finger Nucleases (ZFN), transcription

activator-like effector endonucleases and RNA-guided clustered regularly interspaced short

palindromic nuclease systems have already revolutionised a number of fields in biology and an

exemplary example of ZFN was used improve antibody-dependent cellular cytotoxicity in Cho

cell derived IgG. (Urnov et al. 2010; Steentoft et al. 2014; Durocher & Butler 2009).

12

Previously studies conducted by Clynes et al examined the effects of a range of

recombinant antibodies, including anti-cancer drugs trastuzumab and rituximab, in relation to

their modulation of immune effector cells(Shields et al. 2002).It was found that the Fc regions of

these biomolecules as shown in Figure 05 (Yamane-Ohnuki 2014,pg 232,fig 01) stimulated

enhanced ADCC activity if they interacted with Fcγ activation receptors on neutral killer cells.

While some Fc regions of other antibodies acted on inhibitory Fcγ receptors which exhibited

reduced ADCC action. (Shields et al. 2002)Follow up studies by Shields et al discovered the

absence of fucose residues attached at as297 in trastzumab dicated this reaction and facilitated a

43% increase of ADCC potency against breast cancer comprised cells in vitro. Similar

experiments using non fucosylated antibodies also demonstrated a high degree of potency

because of ADCC against viral diseases such as and including Ebola and respiratory syncytial

viruses which will discussed in detail later(Hiatt et al. 2014).

IgG is glycosylated at Asn297 of the heavy chain of the molecule is glycosylated tri-

mannosyl core structure,terminal galactose (Gal) ,bisect N-acetylglucosamine (GlcNAc) and a

fucose residue.. X. (Yamane-Ohnuki & Satoh 2014).Electron microscope examination of the

crystalized structure of non –fucoylated IgG revealed that increased binding and activation of

ADCC was attributed slight configuration changes in a small region of the IgG-Fc. It was

Figure 4 Deferential ADCC response displayed by Non fucosylated and fucosylated

anobodies.Non-fucosylated antibodies demonstrate an increased binding affinity for

FcγRIIIa compared to fucosylated IgGs. This enhanced binding in turn activates natural

killers cells and a heightened ADCC response.

13

revealed that high affinity of of non-fucosylated antibodies for FcγRIII is facilitated by

interactions between Asn-162 which is only exposed without fucose residues impeding it.

Ultimately the advantage of non-fucoyslated antibodies is that a therapeutic efficiency can

achieved at a lower dosage while maintaining cellular cytotoxicity against target cells.(Yamane-

Ohnuki & Satoh 2014) .FUT8 is a gene found CHO cells that is responsible for encoding α1,6-

fucosyltransferase which mediates fucose transfer to IgG molecule. Recently Malphettes, L. et al

used zinc finger nucleases to generate FUT8 deficient CHO cell lines and optimal non-

fucosylated antibodies.(Steentoft et al. 2014)

Figure 5 Zinc Finger nuclease editing of FUT8 exon (A) Molecular structure of Fut8

protein with highlighted cleavage motif to be target by ZFN treatment.(B)Nucleotide and

amino sequence to be targetdby ZFN.(C)Results of Surveyor nuclease activity shown

amplification of cleaved FUT8 locus.

Zinc finger nucleases are artificial synthetic endonucleases which permit efficient

genomic editing of DNA by introducing double strand breaks at specific sites.(Urnov et al.

2010). The knockout system used by Malphettes, L. et al entailed of 12 zinc finger proteins

adhering to the supercoiled state of DNA on both the template and non-template coding strands

of FUT8 as illustrated in figure 06 (Laetitia Malphettes et al 2010,pg 776 ,fig 01) .The Fokl

subunits as shown dimerze with each other to form a functional endonuclease and introduce

14

defined a double stranded break into the DNA sequence(Malphettes et al. 2010). PCR

amplification of the FUT8 in ZFN modified CHO compared to CHO showed that FUT8 had

been cleaved in 2.This indicates that a bialleic gene deletion of FUC8 event ensued because of

ambiguous non-homologous end joining repair. This gene removal specifically targeted the

removal 2 lysine amino acids that were deemed to be fundamental in the proper function of the

active site of fucosyltransferase (Malphettes et al. 2010).

Bacteria Cell Lines The capacity to carry out post-translational modifications is a defining characteristic that

differentiates eukaryotic and prokaryotic expression platforms in the biopharma industry.(Dell et

al. 2010; Jenkins et al. 2008) Until recently it was widely accepted that bacterial expression

systems were not capable of synthesising glycoproteins because they lacked the machinery to

carry out such a post translational modifcaton. However the substantial yields generated, low

running costs and simplicity of growing bacteria offers supreme benefits over any other existing

expression used in biopharming.(Berlec & Strukelj 2013; Chen 2012; Kamionka 2011) Recent

promising advances in glycoengineering have allowed certain strains of E.coli to be genetically

manipulated in a manner that facilities production of glycoproteins. (Ihssen et al. 2010; Garcia-

Quintanilla et al. 2014)

Glycoengineering E.coli

E.coli is perhaps the most investigated and thoroughly characterised bacterial

organism on this planet. Science’s detailed understanding of its physiology and protein

production makes it an ideal candidate to be exploited for expression of recombinant drugs. It is

simplest and cheapest expression system used in biopharming today and is regularly used for the

production of non-glycosylated proteins such as lispro produced by Eli Lilly(Wildt & Gerngross

2005; Chen 2012). While E.coli expression is inexpensive, well characterised and high yielding

there are number disadvantages to using such a system including deficient post-translational

modification capabilities such as glycosylation and limited capacity to perform adequate protein

folding. However in 2002 Wacker et al published a landmark paper that noted that N-linked

glycosylation present gam negative bacterium Campylobacter jejuni could be transferred to

E.coli.(Wacker et al. 2002)C. jejuni was the first bacterium to exhibit a N-glycosylation pathway

15

to be discovered in prokaryotes and bioinformatics has revealed that genes required for N-

glycosylation were existent among all C.jeuni species.(Tytgat & Lebeer 2014)

Figure 6 (A) 17 KB Gene Cluster composing of 13 genes required Pgl N-glycosylation (B)

Transformation of gene cluster encoding N-glycosylation into plasmid. (C) N-glycans

displayed on E.coli following N-glycosylation.

It has been shown that this system can modify more than 65 C.jejuni proteins. As shown

in figure 6 (Baker et al 2013,pg 314 Fig1) The system itself is a primate form N-glycosylation

and begins with a lipid linked heptasaccharide being assembled in the cytoplasm. GlaNac is

attached to phospholipid ,undeca prenyl phosphate (Und-P) using a oligotransferase protein

called WecA. This lipid-linked oligosaccharide lipoglycan is translocated to periplasm via a ATP

depedent flippase enzyme PgIK. Once situated in the periplasm PgIb ,aoligosaccharytransferase,

recognises the LLO and adds it to target protein Acra at consensus sequence asparagine

consensus Asp/Glu-X1 -Asn-X2 -Ser/Thr. (X1 and X2 signify any amino acid except

Proline)(Pandhal et al. 2012)

In 2002 Wacker et al successfully introduced this N-glycosylation system into by E.coli

by as depicted in figure 07 the ligating a17-kb pgl gene cluster containing all the necessary

glycosylation proteins needed into a pACYC plasmid and transforming the construct into the

target bacterium. Remarkably expression of the pathway decorated of simple N-glycans on lipid

16

bilayer of the bacterium(Baker et al. 2013). Since this accomplishment the system has been

utilised for production of recombinant vaccines.

E.coli Vaccine Production Conjugate vaccines consist of bacteria endotoxins chemically adhered to carrier proteins

and have been highly effective in eradicating viral infections such as Haemophilus influenza.

(Ihssen et al. 2010; Baker et al. 2013)The standard method for congregate vaccine manufactory

firstly involves cultivating large quantities of pathogenic bacteria producing O-antigens and

separately growing carrier proteins using another recombinant system as shown in Figure 07

(Ihssen et al 2010,pg 2 Fig 01),Subsequent purification of the lipopolysaccharide and carrier

proteins respectively is often difficult and significant losses of the therapeutic product occurs.In

addition due to the chemically imprecise nature of combining of lipopolysaccharide and carrier

often leads to unfavourable large heterogeneous congregates which exhibit decreased protection

against a given pathogen(Ihssen et al. 2010). This process is time consuming, and costly which

are the reasons why in vivo synthesis using E.coli harnessing glycosylation are being explored as

an alternate approach to produce congregate vaccines. The relaxed substrate specificity of PgIb

not only allows substrates found in Campylobacter jeunui to be added to carrier protein AcrA but

endotoxins found in pathogenic Gram-negative bacteria(Feldman et al. 2005).

In 2010 Julian Ihssen et al designed vaccine glycogregates for Shigellosis, which is a

disease that kills up to 1 million people annually, using a reproducible large scale fed batch

system and in vivo E.coli N-glycosylation(Ihssen et al. 2010). Shigellosisis is attributed to 4 key

species of Shigella , S. dysenteriae, S. flexneri, S. boydii and S. sonnei, however this approach

produced congregate vaccines against specifically against S. dysenteriae because it demonstrates

a higher mortality rate than the other species. It was identified that rfp and rfb gene clusters

produce glycosyltransferases and polymerases needed for the production of undecaprenyl-

pyrophosphate-linked Shigella O1 polysaccharides and these were expressed on a pGVXN64

plasmid(Ihssen et al. 2010). Subsequent rounds of transfection using the pGVXN64 plasmid

along with plasmids harnessing PgI modification yield novel vacglycoproteins. Notable features

of the work include the use of alternate immunogenic carrier of P. aeruginosa exotoxoid A (EPA)

when expressed in the periplasm of the E.coli. Furthermore (Ihssen et al. 2010)

17

Fatima Garcia-Quintanilla el al employed the same in vivo synthesis technique of

congregate vaccine against Burkholderia pseudomallei, a Gram-negative saprophyte which is

responsible for melioidosi and considered a potential class B bioterrorism weapon if aerosolized.

It was stablished that two distinct O-polysaccharides governed the virulence of B. pseudomallei

and as depicted 15 gene cluster required for the biosynthesis of B. pseudomalle OPS II was

inserted into an E.coli harnessing N-glycosylation via plasmid transformation. (Garcia-

Quintanilla et al. 2014) One notable improvement employed by Fatima Garcia-Quintanilla was

the use of E.coli Waal- and WecA- mutant strain because it was hypnotised that these genes

reduce efficiency of protein glycosylation of OPS II. WecA adds on unwanted GlcNAc residues

not found in the case of OPS II while Waal ligase can disrupt OPS polysaccharide synthesis.

(Garcia-Quintanilla et al. 2014) Preliminary tests using mice test models injected with this novel

vaccine glycoprotein developed a long lasting IgG adaptive immune response when

compromised with B. pseudomallei when compared to controls.(Garcia-Quintanilla et al. 2014)

Figure 7 Comparison between in vitro method and in vivo biosynthesis of congregate

vaccines.

Optimisation of E.coli N-glycosylation

Most notably from a biopharmaceutical perspective N-glycans produced from bacteria

are differ in composition to any other eukaryotic glycan. This variance is attributed to a several

18

factors including the location assembly glycosylation pathway in the periplasm , the restricted

repertoire of glycosylation enzymes in the cytoplasm and the limited availability of

oligosaccharide residues contained in the bacterium (Baker et al. 2013). An additional important

to highlight note is timing of the PTM whereby E.coli glycosylates a given protein post

transitionally in its folded form which in turn reduces the addition of glycans to asn sites. Other

evident differences include an extended asn consensus sequence for n-glycosylation and absence

of a golgi apparatus in E.coli does not the replicate the extensive glycan remodeling

demonstrated in Eurkaryotic cells. The (Dell et al. 2010). While much progress has been

generating glycans in E.coli tthe sialylated terminal structures common to all human

glycanprofiles is ultimately the end goal(Baker et al. 2013). Strategies being currently examined

to enhance E.coli N-glycosylation include the use different E.coli operons to increase glycan

homogeneity and upregulatimg the expression some of the E.coli’s own e innate enzyme to

produce higher yields of glycosylated proteins.(Srichaisupakit et al. 2014; Pandhal et al. 2012)

However a more direct method being explored is the direct introduction of eukaryotic

glycosylation pathways into E.coli in an attempt to efficiently mimic complex extended human

glycan profiles. Valderrama-Rincon et al N-a successfully a engineered saccharomyces

cerevisiae gene cluster coding glycosylation proteinsALG13, ALG14, ALG1 and ALG2 into

E.coli strain. This was promising step for N-glycosylation because this gene cluster codes for a

range provided a platform for the first time precision directed synthesis of complex N-glycan

structures.(Dell et al. 2010; Valderrama-Rincon et al. 2012)

Plant Cell Lines

In recent times plant expression systems have become increasingly viable option to

synthesize recombinant antibodies because of their scalability, low-cost, high yields , lack of

human pathogen transmission and a capacity to produce complex N-glycans. While controlled

plant glycosylation is still its infancy because of issues relating protein heterogeneity, non –

human glycan epitopes and a lack of diverse glycofroms, breakthroughs in the last 10 years and

lately plant derived Ebola vaccines has propelled in planta glycoengineering to the forefront of

large molecule therapeutics(Strasser et al. 2014; Saint-Jore-Dupas et al. 2007).

Antibodies synthesised in plants display both exhibit high mannose and biantennary

complex type N-glycan structures as shown in Figure 08 (Veronique Gomord 2005,pg 560,fig

19

01). While the core precursor Man3GlcNAc2 is conserved between human and plants there are

extensive differences due to remodelling in the Golgi apparatus. (Saint-Jore-Dupas et al. 2007;

Baker et al. 2013)Typically mammalian systems modify core Man3GlcNAc2 with galactose and

terminal sialic acid residues while plants produce N-glycans with without b1,2-xylose and a1,3-

fucose residues . These structural differences between plants and animals form the basis of why

plant N-linked glycans are immunogenic to a range of lab mammals and elicit defined IgE

responses in humans when administered parentally (Giritch et al. 2006; Baker et al.

2013).Despite these pitfall humans are continuously exposed to plant glycoproteins in their diet

and oral administration poses perhaps an acceptable route for plant-made pharmaceuticals in the

future. (Gomord et al. 2005)To harness the full therapeutic potential of glycoproteins produced

from plants several different gene knock in and knock out avenues have been explored in order

to ultimately attain ‘humanized’ non-immunogenic N-glycan therapeutics.

Figure 8 Comparison between mammalian and plant N-glycan structures. Notably N-glycan

structures of mammals are capped with NeuAc and while plants exhibit B 1,3 Gal capping.In

addition plants contain B 1 2 Xyl residues which are absence from mammals.

Knock out Strategies

The most fast and flexible methods of in planta glycoengineering is the use of multiple

gene vectors to integrate cDNA into a given plant’s genome. This transfection process uses

recombinant plasmids carrying tailored genes that are injected into plants leaves and

incorporated into a plant’s genome via horizontal gene transfer instigated by typically

agrobacterium (Gleba et al. 2014). Normally the plant expression system used for such a

20

transfection process is Nicotiana benthamiana because of two reasons; (1) It is susceptible to a

wide variety of plant-pathogenic bacteria and viruses that can infiltrate its genome. (2) It displays

high regeneration efficiency and growth in greenhouses. (Strasser et al. 2008)

The use of a customised plasmid cDNA in conjunction with Nicotiana benthamiana is

best exemplified by one of the first in planta knock out strategies that pursued the removal

xylosyltransferases and core a1,3-fucosyltransferase from a given N-glycan. RNAi genes that

downregulated the expression of FucT and XylT were incorporated into pGA643 and

agrofiltrated into Nicotiana benthamiana. (Strasser et al. 2014) After a series of rounds selection

plants complex N-glycans made up of the GnGn oligosaccharide without the presence of

unwanted immunogenic N-glycan residues resulted. This success was a defining moment for

glycoengineering in plants for several reasons: (1) It was established that plants are able endure

extensive manipulation of their N-glycosylation pathway without disturbing adversely their

phenotype. (2) The efficient production of precursor GnGN oliggoshaccaride enabled further

glycan addition. (3) It permitted increased glycan homogeneity(Castilho et al. 2010). A subtle

variant of the above method is the use of viral vectors to insert glycan genes into the genome.

The advantages of such expression include the hijacking of innate host cell RNA mechanisms to

predominately amplify viral RNA over existing innate cell mRNA in order to generate high

qualities of recombinant protein in the process. As one writes this review the above viral

expression in conjunction with tobacco plants is being trailed for the production an Ebola

biologic known as Zmapp.

Glycoengineering Ebola

Ebola is ralovirus which poses serious detrimental health risk to humans and is

characterised by nose bleeding, nausea and vomiting. In the spring of 2014, a new strain ebola

emerged in the West Africa which has been reported to have claimed 7,000 people according the

World Health Organisation(Murin et al. 2014; WHO 2014). Currently there are several Ebola

drug products being assessed as possible treatment options including vaccines, small molecule

inhibitors, and siRNA-based drugs however studies have shown the passive injection of

antibodies due their long treatment offer the best cure for Ebola (Qiu et al. 2014).

21

Recently rodent models treated with 3 antibodies exhibited synergy between the

molecules and resulted in enhanced protection against Ebola. The key constituents of the most

effective antibody cocktails were isolated including MB-003 which is made up 3 antibodies to

form a novel composite antibody known as Zmapp. Interesting from the perspective of this essay

Gene Garrard Olinger explored if tobacco plants could be a cost saving, rapid and high yield

platform to manufacture MB-003.(Murin et al. 2014) The approach Gene el al utilised was a

transient viral expression system whereby two noncompeting vobacco mosaic virus and potato

viruses were systematically delivered into mature tobacco plants by Agrobacterium infiltration.

The use of two viruses was to ensure the heterooligomeric antibody structure of MB-003 was

efficiently expressed as previous work showed viral vectors containing both the large and small

chains of an antobody in the one plamid diminishes replication performance. The design of this

viral vector used a RNA interference system (RNAi) to down regulate α1,3 fucosyltransferase

and β1,2 xylosyltransferase(Olinger et al. 2012).

Interestingly when the therapeutic efficiency of plant derived MB-003 was compared to

its CHO produced counterpart, the plant derivative exhibited a greater potency because of

increased ADCC. This heightened level of ADCC activity was attributed to production non-

fucosylated plant antibodies and their increased affinity for neutral killer cell receptor

activation.(Olinger et al. 2012) However the most advantageous and important aspect of MB-003

is not directly the production of non-fucosylated antibodies but the efficiency it achieved this

task. While as previously discussed, glycoengineered knock out CHO cells could theoretically

generate non fucosylated antibodies these approaches thus far have only generated small yields

desired recombinant proteins(Yamane-Ohnuki & Satoh 2014). In contrast tobacco plant derived

cell antibodies exhibits elevated homogeneity within its produced glycoprofile and high yields at

the same time. Thus this expression reduces downstream processes, speeds up the production and

lowers the cost of the potential Zmapp drug. These are beneficial attributes given the speed in

which Ebola is aggressing in west Africa and the financial state of third world countries(Quick

2003)

Knock In Strategies

The first success to humanize plant glycosylation by introducing mammalian

glycosyltransferases was reported by Palacpac et al who produced b1,4-galactosylated glycans

22

in tobacco plants. This success only paved future to augment a plant’s repertoire of mammalian

enzymes further and allowed N-glycosyation siaylation to be performed.(Saint-Jore-Dupas et al.

2007) Sialylation was particularly arduous to glycoengineer into plants because of the absence

of several key requirements including : (1) An inability to biosynthesise sialic acid Neu5Ac (2)

No transmembrane receptor to import sialic acid into the Golgi apparatus (3) The absence of

sialictransferase to add a sialic acid to a protein. Thus the lack of prerequisites for siaylation

obligated the incorporation of 6 genes in a multigene vector to facilitate transfer of a mammalian

glycosylation pathway. When the experiment was analysed sialylation was reported in the

subsequent generated IgG glycoproteins(Castilho et al. 2010). Remarkably increased sialylation

of IgGs has is favourable for the production of potent autoimmune autoimmune drugs.Ultimately

the success of glycoengineering sialylation and galactosylases into plants has allowed the

production EPO in Nicotiana benthamiana.

Glycoengineering The First Plant FDA Approved Biologic A unique glycoprotein approach being incorporated into the production plant

pharmaceuticals is the use of C-terminal KDEL or HDEL retention s proteins signals in the

lumen of the ER to yield high non immunogenic mannose glycoproteins(Gomord et al. 2005). A

prime example of this method is the first FDA and EU approved plant biodrug Taliglucerase alfa

, which is a recombinant glucocerebrosidase used to treat Gaucher’s disease.(Shaaltiel et al.

2007) The role glucocerebrosidase is to catalyse the hydrolysis of glucosylceramide however an

deficiency of the enzyme leads to the build-up of the glycolipid and unwanted accumulation

foam cells. This collection of gaucher cells can cause anemia, bone irregularities and

cardiovascular problems however Taliglucerase alfa glucocerebrosidase can be used an enzyme

replacement therapy to eradicate such issues.

Recombinant glucocerebrosidase is made up of 497 amino acids and exhibits 5 N-glycosylation

sites that must be occupied with high Nmannose structures to promote maximum pharmaco

effects via activation macrophage internalization. Prior to Taliglucerase alfa approval in 2012

CHO cell derived recombinant glucocerebrosidase such as imiglucerase and velaglucerase were

used as Gaucher’s disease treatments. The manufactory of these CHO cell and human cell

derived glucocerebrosidase were costly and laborious as in vitro glycoengineering techniques

were required to deglycosylate sialic and galactose residues to expose preferable mannose

23

residues.(Zimran et al. 2014; Saint-Jore-Dupas et al. 2007) In contrast to carrot derived

glucocerebrosidase yielded high mannose n-glycans because HDE Lgene sequences were

incorporated into viral vectors and expressed signal motifs in the c-terminus of the

protein(Tekoah et al. 2013). This c terminal motif retards the transit of the glycoprotein through

the ER because it attaches to a HDEL receptor of retrograde vesicles. Notably in study

evaluating the glycoform profiles of Taliglucerase alfa, imiglucerase and velaglucerase, it was

shown by mass spectrometry that Taliglucerase alfa produced a 100% homogeneous glycan

profile of high mannose sugars and the other tested biologics demonstrated variable glycan

profiles a such as Velaglucerase alfa which showed that 50% of its produced glycoproteins were

inadequate as high mannose glycoproteins. (Zimran et al. 2014)

Future Perspectives While the review describes some of the seminal highlights achieved thus far for

glycobiology and recombinant therapeutics, many challenges still remain to be negotiated to

usher in a new era of optimised glycoprotein biologics The most formidable obstacle perhaps is

deciphering non-template driven glycan synthesis and enhancing complimentary in vitro

purification techniques(Walsh 2010; E.Taylor 2003). With the arrival of bioinformatics in the

last 20 years filling the information gap between glycan synthesis and gene expression has

become much more attainable. Inroads have already been made in cracking such a biological

enigma and recently statistical computer algorithms have been used to show what sites of

glycoproteins are favourable for glycosylation. In addition novel microarray technologies that

analyse the transcription levels of glycosidase and glycotransferases will also provide additional

information regarding glycan expression and regulation patterns. (Ohtsubo & Marth 2006)

Although the glycoengineering techniques discussed above increase the expression of

homogenous glycoproteins, the rate in which this is achieved is still relatively low. Therefore

glycoengineering will never total subside the need of downstream processing totally .Thus

advancing glycoproteins characterising technologies such mass spectrometry and enrichment

strategies such lectin affinity chromatography will only compliment glycoengineered cell

lines(Kaji et al. 2006).

24

Conclusion The advent of novel biologics coupled with the rapid expansion of the biopharmaceutical

industry marks a new era in modern medicine.(Press 2011) As shown therapeutic functionality of

recombinant therapeutics are dictated by PTMs such as glycosylation which decorates biologics

with a spectrum of heterogeneous N- and O-linked glycans as a result of the synchronized

activity displayed by 250 enzymes during the ER-Golgi pathway. In this light the regulation of

glycosylation is now essential in biopharmaceutical manufacturing and glycoengineering

industrial cell lines is quickly becoming widely used to produce recombinant pharmaceuticals

with optimised efficient and safe glycoprofiles.(Hossler et al. 2009) In conclusion controlled

glycosylation patterns within industrial expression systems and the subsequent attainment of an

optimal therapeutic glycoprotein’s sweet spot is the desired goal for any glycosylated

therapeutic. By utilizing some the approaches described above and answering some the questions

that lie ahead the generation of “Simply Better Glycoproteins” will save millions of lives in the

future(Lepenies & Seeberger 2014).

References

Baker, J.L., Çelik, E. & DeLisa, M.P., 2013. Expanding the glycoengineering toolbox:

the rise of bacterial N-linked protein glycosylation. Trends in biotechnology, 31(5),

pp.313–23.

Van Beers, M.M.C. & Bardor, M., 2012. Minimizing immunogenicity of

biopharmaceuticals by controlling critical quality attributes of proteins.

Biotechnology journal, 7(12), pp.1473–84.

Berlec, A. & Strukelj, B., 2013. Current state and recent advances in biopharmaceutical

production in Escherichia coli, yeasts and mammalian cells. Journal of industrial

microbiology & biotechnology, 40(3-4), pp.257–74.

Bosques, C.J. et al., 2010. Chinese hamster ovary cells can produce galactose-[alpha]-

1,3-galactose antigens on proteins. Nat Biotech, 28(11), pp.1153–1156.

Butler, M. & Spearman, M., 2014. The choice of mammalian cell host and possibilities

for glycosylation engineering. Current opinion in biotechnology, 30C, pp.107–112.

25

Castilho, A. et al., 2010. In planta protein sialylation through overexpression of the

respective mammalian pathway. The Journal of biological chemistry, 285(21),

pp.15923–30.

Chen, R., 2012. Bacterial expression systems for recombinant protein production: E. coli

and beyond. Biotechnology advances, 30(5), pp.1102–7.

Chenu, S. et al., 2003. Reduction of CMP-N-acetylneuraminic acid hydroxylase activity

in engineered Chinese hamster ovary cells using an antisense-RNA strategy.

Biochimica et Biophysica Acta (BBA) - General Subjects, 1622(2), pp.133–144.

Costa, A.R. et al., 2014. Glycosylation: impact, control and improvement during

therapeutic protein production. Critical reviews in biotechnology, 34(4), pp.281–99.

Declerck, P.J., 2012. Biologicals and biosimilars: a review of the science and its

implications. Generics and Biosimilars Initiative Journal, 1(1), pp.13–16.

Dell, A. et al., 2010. Similarities and differences in the glycosylation mechanisms in

prokaryotes and eukaryotes. International journal of microbiology, 2010, p.148178.

Durocher, Y. & Butler, M., 2009. Expression systems for therapeutic glycoprotein

production. Current opinion in biotechnology, 20(6), pp.700–7.

E.Taylor, M., 2003. Introduction to Glycobiolgy 2nd Edtion., Oxford University Press.

Feldman, M.F. et al., 2005. Engineering N-linked protein glycosylation with diverse O

antigen lipopolysaccharide structures in Escherichia coli. , 19.

Freeze, H.H. et al., 2014. Solving glycosylation disorders: fundamental approaches reveal

complicated pathways. American journal of human genetics, 94(2), pp.161–75.

Garcia-Quintanilla, F. et al., 2014. Production of a recombinant vaccine candidate against

Burkholderia pseudomallei exploiting the bacterial N-glycosylation machinery.

Frontiers in microbiology, 5(July), p.381.

Ghaderi, D. et al., 2010. Implications of the presence of N-glycolylneuraminic acid in

recombinant therapeutic glycoproteins. Nature biotechnology, 28(8), pp.863–7.

26

Ghaderi, D. et al., 2012. Production platforms for biotherapeutic glycoproteins.

Occurrence, impact, and challenges of non-human sialylation. Biotechnology and

Genetic Engineering Reviews, 28(1), pp.147–176.

Giritch, A. et al., 2006. Rapid high-yield expression of full-size IgG antibodies in plants

coinfected with noncompeting viral vectors. Proceedings of the National Academy of

Sciences of the United States of America, 103(40), pp.14701–6.

Gleba, Y.Y., Tusé, D. & Giritch, A., 2014. Plant Viral Vectors for Delivery by

Agrobacterium. , (August 2013), pp.155–192.

Gloster, T.M., 2014. Advances in understanding glycosyltransferases from a structural

perspective. Current opinion in structural biology, 28C, pp.131–141.

Golledge, J. et al., 2007. Bone marrow-derived cells and arterial disease. Journal of

vascular surgery, 46(3), pp.590–600.

Gomord, V. et al., 2005. Biopharmaceutical production in plants: problems, solutions and

opportunities. Trends in biotechnology, 23(11), pp.559–65.

Griebenow, K. & Sola, R.J., 2010. Glycosylation of Therapeutic Proteins An Effective

Strategy to Optimize Efficacy. , 24(1), pp.9–21.

Hiatt, A. et al., 2014. Glycan variants of a respiratory syncytial virus antibody with

enhanced effector function and in vivo efficacy. Proceedings of the National

Academy of Sciences of the United States of America, 111(16), pp.5992–7.

Hossler, P., Khattak, S.F. & Li, Z.J., 2009a. Optimal and consistent protein glycosylation

in mammalian cell culture. Glycobiology, 19(9), pp.936–49.

Hossler, P., Khattak, S.F. & Li, Z.J., 2009b. Optimal and consistent protein glycosylation

in mammalian cell culture. Glycobiology, 19(9), pp.936–49.

Ihssen, J. et al., 2010. Production of glycoprotein vaccines in Escherichia coli. Microbial

cell factories, 9, p.61

Jefferis, R., 2009. Glycosylation as a strategy to improve antibody-based therapeutics.

Nature reviews. Drug discovery, 8(3), pp.226–34.

27

Jenkins, N., Murphy, L. & Tyther, R., 2008. Post-translational modifications of

recombinant proteins: significance for biopharmaceuticals. Molecular biotechnology,

39(2), pp.113–8.

Kaji, H. et al., 2006. Mass spectrometric identification of N-linked glycopeptides using

lectin-mediated affinity capture and glycosylation site-specific stable isotope

tagging. Nature protocols, 1(6), pp.3019–27.

Kamionka, M., 2011. Engineering of Therapeutic Proteins Production in Escherichia coli.

Current Pharmaceutical Biotechnology, 12(2), pp.268–274.

Lai, T., Yang, Y. & Ng, S.K., 2013. Advances in Mammalian cell line development

technologies for recombinant protein production. Pharmaceuticals (Basel,

Switzerland), 6(5), pp.579–603.

Lepenies, B. & Seeberger, P.H., 2014. Simply better glycoproteins. Nat Biotech, 32(5),

pp.443–445. Available at: http://dx.doi.org/10.1038/nbt.2893.

Lowe, J.B. & Marth, J.D., 2003. A genetic approach to Mammalian glycan function.

Annual review of biochemistry, 72(1), pp.643–91.

Malphettes, L. et al., 2010. Highly efficient deletion of FUT8 in CHO cell lines using

zinc-finger nucleases yields cells that produce completely nonfucosylated antibodies.

Biotechnology and bioengineering, 106(5), pp.774–83.

Marth, J.D. & Grewal, P.K., 2008. Mammalian glycosylation in immunity. Nature

reviews. Immunology, 8(11), pp.874–87.

Moremen, K.W., Tiemeyer, M. & Nairn, A. V, 2012. Vertebrate protein glycosylation:

diversity, synthesis and function. Nature reviews. Molecular cell biology, 13(7),

pp.448–62.

Murin, C.D. et al., 2014. Structures of protective antibodies reveal sites of vulnerability

on Ebola virus. Proceedings of the National Academy of Sciences of the United

States of America.

Ohtsubo, K. & Marth, J.D., 2006. Glycosylation in cellular mechanisms of health and

disease. Cell, 126(5), pp.855–67.

28

Olinger, G.G. et al., 2012. Delayed treatment of Ebola virus infection with plant-derived

monoclonal antibodies provides protection in rhesus macaques. Proceedings of the

National Academy of Sciences of the United States of America, 109(44), pp.18030–5.

Pandhal, J. et al., 2012. Systematic metabolic engineering for improvement of

glycosylation efficiency in Escherichia coli. Biochemical and biophysical research

communications, 419(3), pp.472–6.

Paulson, J.C., Blixt, O. & Collins, B.E., 2006. Sweet spots in functional glycomics.

Nature chemical biology, 2(5), pp.238–48.

Qiu, X. et al., 2014. Reversion of advanced Ebola virus disease in nonhuman primates

with ZMapp. Nature, 514(7520), pp.47–53.

Quick, J.D., 2003. Ensuring access to essential medicines in the developing countries: A

framework for action[ast]. Clin Pharmacol Ther, 73(4), pp.279–283. Available at:

http://dx.doi.org/10.1016/S0009-9236(03)00002-X.

Russell, D., Oldham, N.J. & Davis, B.G., 2009. Site-selective chemical protein

glycosylation protects from autolysis and proteolytic degradation. Carbohydrate

research, 344(12), pp.1508–14.

Saint-Jore-Dupas, C., Faye, L. & Gomord, V., 2007. From planta to pharma with

glycosylation in the toolbox. Trends in biotechnology, 25(7), pp.317–23.

Schiestl, M. et al., 2011. Acceptable changes in quality attributes of glycosylated

biopharmaceuticals. Nat Biotech, 29(4), pp.310–312.

Shaaltiel, Y. et al., 2007. Production of glucocerebrosidase with terminal mannose

glycans for enzyme replacement therapy of Gaucher’s disease using a plant cell

system. Plant biotechnology journal, 5(5), pp.579–90.

Shields, R.L. et al., 2002. Lack of fucose on human IgG1 N-linked oligosaccharide

improves binding to human Fcgamma RIII and antibody-dependent cellular toxicity.

The Journal of biological chemistry, 277(30), pp.26733–40.

Spiro, R.G., 2002. Protein glycosylation: nature, distribution, enzymatic formation, and

disease implications of glycopeptide bonds. Glycobiology, 12(4), p.43R–56R.

29

Srichaisupakit, A., Ohashi, T. & Fujiyama, K., 2014. Identification of a protein

glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous

expression in Escherichia coli. Journal of bioscience and bioengineering, 118(3),

pp.256–62.

Steentoft, C. et al., 2014. Precision genome editing: a small revolution for glycobiology.

Glycobiology, 24(8), pp.663–80.

Strasser, R. et al., 2008. Generation of glyco-engineered Nicotiana benthamiana for the

production of monoclonal antibodies with a homogeneous human-like N-glycan

structure. Plant biotechnology journal, 6(4), pp.392–402.

Strasser, R., Altmann, F. & Steinkellner, H., 2014. Controlled glycosylation of plant-

produced recombinant proteins. Current opinion in biotechnology, 30C, pp.95–100.

Tekoah, Y. et al., 2013. Glycosylation and functionality of recombinant β-

glucocerebrosidase from various production systems. Bioscience reports, 33(5).

Tytgat, H.L.P. & Lebeer, S., 2014. The sweet tooth of bacteria: common themes in

bacterial glycoconjugates. Microbiology and molecular biology reviews : MMBR,

78(3), pp.372–417.

Uçaktürk, E., 2012. Analysis of glycoforms on the glycosylation site and the glycans in

monoclonal antibody biopharmaceuticals. Journal of separation science, 35(3),

pp.341–50.

Urnov, F.D. et al., 2010. Genome editing with engineered zinc finger nucleases. Nature

reviews. Genetics, 11(9), pp.636–46.

Valderrama-Rincon, J.D. et al., 2012. An engineered eukaryotic protein glycosylation

pathway in Escherichia coli. Nat Chem Biol, 8(5), pp.434–436. Available at:

http://dx.doi.org/10.1038/nchembio.921.

Wacker, M. et al., 2002. N-linked glycosylation in Campylobacter jejuni and its

functional transfer into E. coli. Science (New York, N.Y.), 298(5599), pp.1790–3.

Walsh, G., 2009. Post-Translational Modifications in the Context of Therapeutic

Proteins : An Introductory Overview,

30

Walsh, G., 2010. Post-translational modifications of protein biopharmaceuticals. Drug

discovery today, 15(17-18), pp.773–80.

Walsh, G. & Jefferis, R., 2006. Post-translational modifications in the context of

therapeutic proteins. Nature biotechnology, 24(10), pp.1241–52.

Wang, L.-X. & Amin, M.N., 2014. Chemical and chemoenzymatic synthesis of

glycoproteins for deciphering functions. Chemistry & biology, 21(1), pp.51–66.

WHO, 2014. EBOLA RESPONSE ROADMAP SITUATION REPORT, Available at:

http://www.who.int/csr/disease/ebola/situation-reports/en/.

Wildt, S. & Gerngross, T.U., 2005. The humanization of N-glycosylation pathways in

yeast. Nature reviews. Microbiology, 3(2), pp.119–28.

Xu, X. et al., 2011. The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell

line. Nature biotechnology, 29(8), pp.735–41.

Yamane-Ohnuki, N. & Satoh, M., 2014. Production of therapeutic antibodies with

controlled fucosylation. mAbs, 1(3), pp.230–236.

Zhong, X. & Wright, J.F., 2013. Biological Insights into Therapeutic Protein

Modifications throughout Trafficking and Their Biopharmaceutical Applications.

International journal of cell biology, 2013, p.273086.

Zimran, A. et al., 2014. Pivotal trial with plant cell – expressed recombinant

glucocerebrosidase , taliglucerase alfa , a novel enzyme replacement therapy for

Gaucher disease. , 118(22), pp.5767–5774.

Illustration References

Figure 1:Snider, J. (n.d.). N-glycan assembly and attachment. [image] Available at:

http://www.piercenet.com/method/protein-glycosylation [Accessed 12 Nov. 2014].

Figure 2:Hossler 2009 Optimal and consistent protein glycosylation in mammalian cell culture

Glycobiology Review

Figure 3:D.Ghaderi 2010 Production platforms for biotherapeutic glycoproteins. Occurrence,

impact, and challenges of non-human sialylation: Nature Biotechnology and Genetic

Engineering Reviews

31

Figure : Naoko Yamane-Ohnuki 2014. Production of therapeutic antibodies with controlled

fucosylation. Landes Bioscience Review

Figure 5 :Laetitia Malphettes et al 2010 Highly Efficient Deletion of FUT8 in CHO Cell Lines

Using Zinc-Finger Nucleases Yields Cells That Produce Completely Nonfucosylated

Antibodies. BioTechnology and Engineeering

Figure 6 :Jenny L. Baker1et al 2013 .Expanding the glycoengineering toolbox: the rise of

bacterial N-linked protein glycosylation Trends in Biotechnology.

Figure 7:Julian Ihssen et al 2010. Production of glycoprotein vaccines in Escherichia coli.

Microbial Cell Factories 2010

Figure 8;Veronique Gomord et al 2005.Biopharmaceutical production in plants: problems,

solutions and opportunities Trends in Biotechnology

Name: Ian Martin

Programme: GCB4

Student Number: 11532343

Supervisor: Dr.Brendan O’Connor

Final Year Research Project Title

“Assessing the Sweet Tooth of Fungal Lectin AAL-2:

Characterizing AAL-2 binding with N-acetyl-D-glucosamine”

Abstract

Glycosylation is widely considered the most biologically significant Post Translational

Modification (PTM) and involves the addition of oligosaccharide moieties to proteins.

Lectins are Carbohydrate Binding Proteins (CBP) that bind reversible to specific glycan

motifs and have become important components of glycoanalytic tools such as Enzyme-

Linked Lectin assays (ELLA). AAL-2 is a fungal lectin derived from the mushroom plant

Agrocybe Aegerita and has previously demonstrated high binding selectivity towards

terminal non-reducing N-acetyl-glucosamine (GlcNAc) residues. This lectin carbohydrate

interaction remained unspecified until BLAST analysis identified conserved sequence motifs

associated with GlcNAc residue binding between AAL-2 and another lectin Psathyrella

Velutina Lectin (PVL). In the present study AAL-2 was subjected to sited directed

mutagenesis in two sites to reduce binding efficiency and demonstrate that these are

implicated in GlcNAc binding. This research also presents a protocol to express AAL-2 using

E.coli strains KRX and JM109, purification strategy using IMAC chromatography and future

perspectives for GlcNAc and AAL-2 characterization.

Appendix A

DCU University’s Declaration on Plagiarism

Assignment Submission Form

This form must be filled in and completed by the student submitting an assignment.

Assignments submitted without the completed form will not be accepted.

Name:

Programme:

Module Code:

Assignment Title:

Submission Date:

I declare that this material, which I now submit for assessment, is entirely my own

work and has not been taken from the work of others, save and to the extent that such

work has been cited and acknowledged within the text of my work. I understand that

plagiarism, collusion, and copying are grave and serious offences in the university and

accept the penalties that would be imposed should I engage in plagiarism, collusion or

copying. I have read and understood the Assignment Regulations set out in the

module documentation. I have identified and included the source of all facts, ideas,

opinions, and viewpoints of others in the assignment references. Direct quotations

from books, journal articles, internet sources, module text, or any other source

whatsoever are acknowledged and the source cited are identified in the assignment

references. This assignment, or any part of it, has not been previously submitted by

me or any other person for assessment on this or any other course of study.

I have read and understood the referencing guidelines found at

http://www.library.dcu.ie/citing&refguide08.pdf and/or recommended in the

assignment guidelines.

Name: ________________________________ Date: _________________

Abbreviations

BLAST Basic Local Alignment Search Tool

CBP Carbohydrate-binding protein

dH2O Distilled water

ELLA Enzyme Linked Lectin Assay

GFP Green Fluorescent protein

GSL-II Griffonia simplicifolia lectin-II

GlcNAc N-acetyl-glucosamine HRP Horse Radish Peroxidase

IPTG Isopropyl-β-D-thiogalactopyranoside

LB Luria Bertani Broth

MW Molecular weight

PAGE Poly-acrylamide gel electrophoresis

PCR Polymerase Chain Reaction

PVL Psathyrella Velutina Lectin PTM Post Translational Modification

SDS Sodium Dodecyl Sulphate

TEMED Tetramethylethylenediamine TB TB Terrific Broth

WGA WGA Wheat germ agglutinin

Contents

1. Introduction 1

1.1 Glycosylation 1

1.2 Lectins 1

1.3Glycoanalysis 1

1.4 O-GlyNAcylation 2

1.5 AAL-2 2

1.6 Experimental Hypothesis 3

1.7 Experimental Approach 4

1.8 Aims and Objectives 4

2.0 Methods and Materials 5

2.1 Bacterial Strains 5

2.2 Primers 5

2.3 Plasmid 6

2.4 Equipment 6

2.5 Reagents 7

2.6 Microbial Media 7

2.7 Buffers and Solutions 7

2.8 Enzyme Reactions 10

2.8.1 Polymerase Chain Reaction (PCR) 10

2.8.2 Restriction Digest 11

2.8.3 Ligation Reaction 11

2.9 Plasmid DNA Isolation Sigma GenElute Plasmid Miniprep Kit 11

3.0 Purification of DNA Mixture using GE Healthcare GFX Kit 12

3.1 Purification of DNA from agarose gels using GE Healthcare GFX Kit 12

3.2 Agarose Gels 12

3.3 Competent cells 13

3.4 Transformation of Competent cells. 13

3.5 Bacterial Stock Solutions and Culturing 14

3.6 Screening for Protein Expression 14

3.7 SDS-PAGE Analysis 14

3.8 Sample Preparation for SDS-PAGE 15

4.0 Protein Expression 15

4.1 Protein Purification 15

4.2 Stripping and Recharging the IMAC Resin 16

4.3 DNA Sequencing 16

5.0 Results & Discussion 16

5.1 Isolation of pQE-30 Plasmid 16

5.2 1st Round of Site Directed Mutagenesis 18

5.3 Plasmid Digestion and Ligation of PCR Products 19

5.4 Transformation with JM109 cells using RF method 20

5.5 Sequence Check of Transformants 21

5.6 Second Round Site Directed Mutagenesis 22

5.7 Plasmid Isolation from JM109 and KRX transformants 22

5.8 PCR Products of Site Directed Mutagensis 23

5.9 Digestion and Ligation of JM109 PCR Products 24

6.0 2nd

Round of Transformation 25

6.1 Sequence Verification using XX of mutated AAL-2 Protein 25

6.2 Protein Expression Check using 15 % SDS-PAGE Analysis 26

6.3 IMAC Chromatography 27

6.4 Troubleshooting IMAC Purification 27

6.5 Troubleshooting Transfromation with KRX and JM109 30

6.6 Protein Expression Check of KRX and JM109 new transformants 30

6.7 IMAC Purification of KRX Clone 31

7.0 Future Perspectives 32

8.0 Conclusion 33

9.0 Acknowledgements 33

9.0 References 34

10.0 Appendix 36

1

1. Introduction

1.1 Glycosylation

Glycosylation is a post translational modification (PTM) which involves the

addition of oligosaccharides to proteins to form glycoproteins .The heterogeneity of

glycoproteins is attributed to the non-template-driven process of glycosylation. The

unpredictable nature of the PTM produces a diverse range of complex glycans which

differ in variety of ways include monosaccharide sequence, chain length, anomery and

branching points.(Ohtsubo & Marth 2006) This abundant protein PTM facilitates a

number of biological functions that reach beyond the genome including efficient

folding, enhanced trafficking and increased stability of proteins. (Moremen et al. 2012)

1.2 Lectins

Lectins are classified as Carbohydrate Binding Proteins (CBP) that can

recognize particular glycans and bind to them in a reversible non-catalytic

manner(Varrot et al. 2013). They facilitate a range biological functions including bio

recognition and cell proliferation, cell communication and migration, activation of

immunological responses, cell death and interactions with a variety of pathogens

including prions, viruses and microorganisms.(Ambrosi et al. 2005; Thompson et al.

2011).

1.3Glycoanalysis

A growing number of lectins derived from plant, animals and bacteria are now

being incorporated into glycoanalytic tools because of their ability to distinguish

between different glycan molecules. Lectin microarrays are steadily becoming the

method of choice for glycomic based research and the most conventional glycoanalytic

device is known as an Enzyme-Linked Lectin Assay (ELLA)(Thompson et al. 2011).

The basic format of an ELLA as shown in (Figure 1) involves firstly the

immobilization glycoconjugates onto the surface of an ELISA plate, blocking of the

plate surface and then probing the glycan molecules with lectins. By using predefined

arrangements of glycans with characterized glycan binding specificities one can infer

glycosylation pattern of a given glycoprotein or glycoconjugate using lectins.

(Thompson et al. 2011).

2

Figure 1 Enzyme-Linked Lectin Assay (ELLA). Glycoproteins are immobilized onto

the wells of an ELISA plate. Surfaces of plates are blocked with a blocking agent. A

labelled or tagged Lectin is applied to ELLA. Binding is characterized using a labelled

or antibody against the labelled lectin or tag. The antibody used can be conjugated with

Horse Radish Peroxidase (HRP(Thompson et al. 2011)).

1.4 O-GlyNAcylation

Lectin microarrays are now being utilized as diagnostic tool for establishing the

glycosylation status of diseased cells. It has suggested that O-glynacylation is involved

in the pathogenesis of diabetes and neurology disorders including Alzheimer’s

disease(Ren et al. 2013). Until now the most extensively method for the detection of

O-GlyNAcylation was the use is N-acetyl- glucosamine (GlcNAc) specific commercial

lectins including wheat germ agglutinin (WGA) and lectin GSL-II (Griffonia

simplicifolia lectin-II). However the inadequate specificity and low affinity of these

CBPs toward O-GlcNAc has thus far delayed research on O-GlyNAcylation

diseases(Ren et al. 2013). In addition these plant derived lectins are subjected to costly

purification strategies which is not preferable.

1.5 AAL-2

Fungi derived lectins have become a major source of novel CBP with 82%

originating from mushrooms. These CBP are preferential for glycomic studies because

they have been showed to bind with high specificity to a human glycoconjugates such

as GlcNAc. The fungal lectin AAL-2 isolated from Agrocybe aegerita mushrooms has

exhibited a concentration-dependent binding and a precise specificity for non-reducing

terminal GlcNAc moieties(Jiang et al. 2012). AAL-2 is 1224 bp and has a molecular

3

weight of 43kDa.AAL-2 displays a greater affinity for GlcNac than both WGA and

GSL-II and its enhanced bio-recognition of GlcNAc has already been used in studies

concerning O-linked proteins.

1.6 Experimental Hypothesis

The advantage of having the ability express AAL-2 via a recombinant

expression system such as E.coli means it demonstrates minor batch to batch variations

when it is produced and it can subjected to mutagenesis strategies that can produce a

novel protein with enhanced bio recognition. While AAL-2 demonstrates a high

affinity towards GlcNac the exact mechanism whereby it interacts with this glycan

remains undefined. In order to elucidate this interaction an amino acid sequence-

homology BLAST search was performed and identified that Psathyrella velutina Lectin

(PVL) was 60% identical (Ren et al. 2013). As shown in the (Figure2a) PVL is a 401

amino acid lectin that exhibits a seven bladed b-propeller fold structure and has six

glycan binding pockets found sandwiched between 2 consecutive blades(Cioci et al.

2006). The amino acid sequences of each of the binding sites are highly conserved and

it is understood that 5 hydrogen bonds be facilitate glycan binding (see Figure 2b). By

analyzing sequence homology of PVL and AAL-2 it was hypnotized that certain amino

motifs identified in PVL also play an active role in GlcNac binding in AAL-2. By

characterizing these amino acids recombinant AAL-2may feature in diagnostic devices

for diseases associated with O-linked proteins.

A B

Figure 2 (a) Crystal structure of PVL indicating 6 binding sites for GlcNac.

(b)PVL hydrogen binding for sites 5-6 and 1-2.Note bulky tryptophan

molecule(Cioci et al. 2006)..

4

Figure 1 PVL amino acid sequence with 7 amino acids indicated in blue

implicated with glycan binding amino acids. The amino acids indicated in yellow are

associated with calcium binding(Cioci et al. 2006).

1.7 Experimental Approach

AAL-2 contains 5 suggested glycan binding sites as indicated in (Figure 2b). In order

to significantly alter lectin-glycan interactions the two binding sites with the most

homologous sequences with PVL were selected for alanine mapping which is a

common technique used to establish the influence of specific amino residues in relation

to a protein’s function. Alanine is utilized for amino acid knock out because of small

size, non-reactivity and ability to replicate the secondary structure of a protein. The

introduction of multiple alanines at both targeted glycan binding will in theory disrupt

the affinity of AAL-2 towards GlcNac it because replaces bulky amino acids such as

tryptophan illustrated in (Figure2b) .Removing a bulky amino will drastically alter the

binding pocket of AAL-2 and thus will stop binding with GlcNac. This reduced

binding can be characterized using an ELLA.

1.8 Aims and Objectives

Determine the binding specificity of AAL-2 for non-reducing terminal GlcNac

by site directed mutagenesis of sites associated with binding motifs as indicated

with BLAST analysis.

Develop an efficient E.coli expresser strain (JM109 and KRX) which produces

mutated AAL-2 at high levels.

Efficiently selectively purify mutated AAL-2 with the use of IMAC

chromatography.

Evaluate the binding effects of the mutated AAL-2 protein compared to wild

type AAl-2 with the use of ELLA characterization.

5

2.0 Methods and Materials

2.1 Bacterial Strains

Table 1 Information on Bacterial Strains Used

Type:

JM109

Genotype: e14–,(McrA–) recA1,

endA1, gyrA96, thi-1, hsdR17,

(rK–mK+), supE44, relA1, Δ(lac-

proAB),[F´ traD36 ,proAB

,lacIqZΔM15.

Comments: JM109 cells are

deficient endonuclease (endA),

which enhances quality of DNA

preps and lacks ecombination

(recA) lacking thus plasmid

stability.

Origin

Strategene

Type:

KRX

Genotype: [F´, traD36, ΔompP,

proA+B+, lacIq , Δ(lacZ)M15]

ΔompT, endA1, recA1, gyrA96

(Nalr ), thi-1, hsdR17 (rK –, mK

+), e14– (McrA–), relA1, supE44,

Δ(lac-proAB), Δ(rhaBAD)::T7

RNA polymerase

Comments: The ompT– and

ompP– mutations eliminate one

source of proteolysis of

overexpressed protein in E. coli.

Origin:

Promega

2.2 Primers

Site Directed Mutagenesis Primer Set 1:

Forward: 5’- GCGCTGACCACCAAACACGTTCGTCTGATCGC - 3’

Reverse: 5’- AGCAGCAGCGTTCTGAGCGAAGTTTTTAACAGCC- 3’

Site Directed Mutagenesis Primer Set 2:

Forward: 5’-GCTGCTGCTAAAATCGGTGACCACCCGCGTTTCGTTGC-3’

Reverse: 5’-AGCGTCAATGCAGAAGTTGTCGATAACAGATTTAGCCG-3’

6

2.3 Plasmid

Figure 04. Qiagen vector

pQE-30 plasmid generated

using Snapgene. Vector

contains AAl-2 sequence

under the control of T5

promoter and Lac

operator.Origin of replication

(Ori) ampicillin resistance

(AmpR) are also present.

Bam H1 and HindII restriction

sites also displayed. Primer

2.4 Equipment

Small Centrifuge Labnet spectrafuge

Large Centrifuge Sorvall RC 5B plus

Plasmid extraction kit Sigma GenElute plasmid miniprep kit.

Blue transilluminator Clare chemical research dark reader transilluminator

Cell disrupter Constant cell disruption systems

Incubator Sanyo orbital incubator

Spectrophotometer Shimadzu - UV Mni – 1240 UV-Vis spectrophotometer

Heating block Labnet accublock digital dry bath

Stirrer AGB 1000 hotplate and stirrer

Agarose Gel Rig BioRad Horizontal Gel apparatus

SDS-PAGE Rig ATTO vertical mini electrophoresis system

Power Pack Powerplex 3000

Gel purification kit GE Healthcare GFX PCR DNA and gel band purification kit

7

2.5 Reagents

All reagents used during experimentation were of ACS grade quality and originated

from Sigma-Aldrich unless stated otherwise. All microbial media prior to use was

autoclaved at 121oc for 60 minutes. Milli-Q system Academic supplied distilled water

(dH2O) for analysis in the lab.

2.6 Microbial Media

Table 2 Reagent table Luria Bertani Broth (LB)

Broth Type Composition Concentration

Luria Bertani Broth (LB)

Tryptone 10 g/L

NaCl 10 g/L

Yeast Extract 10 g/L

Comment: Using dropwise addition of NaOH pH was adjusted to pH 7.0 and dH20

was added to bring to volume. Solid agar plates were prepared by adding 15g/L of

agar before autoclaving.

Table 3 Reagent Table Terrific Broth (TB)

Broth Type Composition Concentration

Terrific Broth (TB)

Tryptone 12 g/L

Yeast Extract 24 g/L

Glycerol 4 mL/L

Comment: After sterilization dH20 was added to TB to bring solution to 900ml and

pH was adjusted to 7.4 using 100ml of phosphate buffer after adequate time for

cooling. All media manipulation was conducted in an aseptic environment

.

Ampicillin and IPTG

Ampicillin (Amp) and isopropyl β-D-1-thiogalactopyranoside (IPTG) were prepared at

100 mg/L concentration. Stocks were added to media after autoclaving in order to

attain 100μg/mL broth concentration.

2.7 Buffers and Solutions

8

Table 4 Reagent Table for 1M Potassium Phosphate Buffer

Buffer Type Composition Mass (g/l)

1M Potassium Phosphate Buffer KH2PO4

K2HPO4

23.1 g/L

125.4 g/L

Comment: Potassium Phosphate Buffer was brought to 1 L with dH2O and

autoclaved. pH needed to be adjusted to pH 7.4.

Table 5 Reagent Table for TB Buffer

Buffer Type Composition Concentration

TB Buffer

PIPES 10 mM

CaCl2 10 mM

KCl 250 mM

Comment: KOH and MnCl2 were used in conjunction with each other to adjust the

final pH 7.0. A sterile syringe with 0.22 μm filter membrane decontaminated

the solution. Stored at 4°C if needed at a later time.

Table 6 Reagent Table for TAE Buffer (50X)

Reagent Type Composition Volume

TAE Buffer (50X)

Tris 242 g/L

Glacial acetic acid 57.1 mL/L

EDTA 50 mM

Comment: 1X solution of TAE buffer was achieved by adding 20ml of 50X TAE

Buffer to 500ml dH2O. pH 8.0 was assumed for solution used.

Table 7 Reagent Table for TAE Buffer

Buffer Type Composition Volume

TAE Buffer (50X)

Tris 242 g/L

Glacial acetic acid 57.1 mL/L

EDTA 50 mM

Table 8 Reagent Table for Gel Loading Dye

Type Composition Concentration

Xylene Cyanol 0.25% (w/v)

9

Table 9 Reagent Table for SDS-PAGE Buffer (5X)

Type Composition Concentration

SDS-PAGE Buffer (5X) Tris-HCl 15 g/L

Glycine 72 g/L

SDS 5 g/L

: This was diluted toa 1X running buffer solution dH20. pH 8.3 assumed.

Table 10 Reagent Table for SDS-PAGE Sample Buffer (10X)

Type Composition Concentration

SDS-PAGE Sample Buffer (10X)

SDS 3.2 ml 10

2-Mercaptoethanol 0.8Ml

Tris-HCl 2.0ml 0.5M Stock

Bromophenol Blue (0.5 w/v)

dH2O 0.4ml

Table 11 Reagent Table for Coomassie blue stain solution

Type Composition Concentration

Coomassie blue stain solution

dH2O 50% (v/v)

Methanol 40% (v/v)

Acetic Acid 10% (v/v)

Coomassie blue 10% (v/v)

Table 12 Reagent Table for Coomassie blue stain solution

Type Composition Concentration

Coomassie blue stain solution

dH2O 50% (v/v)

Methanol 40% (v/v)

Acetic Acid 10% (v/v)

Table 13 Reagent Table for Coomassie Blue De-stain solution

Type Composition Concentration

Coomassie Blue De-stain solution dH2O 45% (v/v)

Methanol 45% (v/v)

Gel loading Dye Ficoll (Type 400) 15% (w/v)

10

Acetic Acid 10% (v/v)

Table 14 Reagent Table for Ethidium Bromide Solution

Type Composition Concentration

Ethidium Bromide Solution

dH2O 1 L

EB Stock 100 μL of 10mg/ml

solution

Table 15 Reagent Table for Lysis

Type Composition Concentration

Lysis Buffer NaH2PO4 50 mM

NaCl 0.5 M

Imidazole 20-250 mM

2.8 Enzyme Reactions

2.8.1 Polymerase Chain Reaction (PCR)

PCR reactions were executed in a Veriti 96 well Thermal Cycler (Applied

Biosciences).

Table 16

PCR reagent Volume (ul)

Template DNA 1μl

dNTP’s (10 μM) 1μL

Primers (10 μM) 1μL of each Primer Type

Buffer (5X) 10μL QF Phusion

dH2O 35 μL

Phusion DNA polymerase 1μL

DNA polymerase was added last immediately before PCR cycle initiation.

PCR Programme utilised for all Site Directed Mutagenesis reactions.

Stage 1.0 -Denaturation Step: 95°C for 10 minutes

Stage 2.1 - Denaturation Step: 95°C for 30 seconds

Stage 2.2 - Annealing for 30 seconds. (Temperatures used 55, 60, 65, 70°C)

Stage 2.3 - Extension at 72°C for 3 minutes.

11

Stage 3.0 - Extension at 72°C for 10 min

Stage 4.0 - Samples refrigerated at 4°C

NOTE : Stage 2.1 , 2.2 and 2.3 were repeated for 30 cycles in total

2.8.2 Restriction Digest

Table 17 Restriction Digest Quantities

Digestion Reagent Volume μL

Buffer (10X) 5 μL

Purified Plasmid 30 μL

Enzyme (DpnI) 1.5 μL

dH2O 13.5 μL

Reactions were incubated at 37°C for 2 hours. Before the digested DNA could be used

additional applications purification was carried out as detailed below with a GE

Healthcare GFX Kit.

2.8.3 Ligation Reaction

Table 18 Ligation Reaction Quantities

Ligation Reagent Volume (μL)

Purified plasmid 40 μL

Buffer (10X) 5 μL

T4 Ligase 2 μL

dH2O 3 μL

Ligation reactions were incubated at ambient room temperature for 3 hours or

overnight at 4oC. The ligated plasmid can then be introduced into competent cells.

2.9 Plasmid DNA Isolation Sigma GenElute Plasmid Miniprep Kit

1.5ml of overnight bacterial culture was centrifuged at 13,000 rpm for 2 minutes to

form a cell pellet. The supernatant was pipetted off and pellet was suspended in 200ul

of chilled suspension solution containing RNase A. Lysis solution was added to

Eppendorf tube, inverted allowed to rest at room temperature for approximately 5

minutes. 350 μL of Neutralisation solution was supplemented to the tube and mixed by

inversion in order remove cell debris, lipids, proteins and chromosomal

DNA.Neutralization mixture was allowed to settle for 10 minutes. Precipitate was

12

gathered by centrifugation at 13,000 rpm for 5 minutes. During this period a spin

column was prepared by adding 500 μL of column preparation solution to spin column

surface. The spin column was then centrifuged at 13,000 rpm for 1 minute. The

supernatant was then added to the conditioned spin column and centrifuged at 13,000

rpm in order to bind the plasmid DNA. The flow through was removed 750 μL of

wash solution was added to spin column. The column was centrifuged at 13,000 rpm

for 30 sec to remove remaining contaminants. The flow through was thrown away and

the matrix was dried further by centrifuging at 13,000rpm for 2 minutes. Spin column

was added to Eppendorf tube and centrifuged at 13,000 rpm elute plasmid DNA.

3.0 Purification of DNA Mixture using GE Healthcare GFX Kit

Purification of DNA from PCR mixtures involved adding 500 μL of capture buffer

type 3 to 100 μL of a PCR mixture. The solution should turn a pale yellow. The sample

was added to a spin column and centrifuged at 13,000 rpm for 30 seconds before flow

through was removed .40ul of elution buffer was added to the middle of the spin

column matrix and allowed to rest at room temperature for 2 minutes. The column was

then centrifuged at 13,000 rpm for 30 seconds to allow elution of the DNA

3.1 Purification of DNA from agarose gels using GE Healthcare GFX

Kit

Under blue light DNA bands were purified from the agarose using a scapal.DNA bands

were cut out and 500ul of capture buffer type was added to the sample and vortex in

Eppendorf tube. The tube was incubated at 60°C for 15- 20 minutes until the agarose

was dissolved. The tube was inverted every 3 minutes to progress the dissolving

process.Purification was then in the same manner of DNA mixture purification

3.2 Agarose Gels

DNA samples were examined using electrophoresis through in a BioRad Horizontal

Gel apparatus. Agarose was added to TAE buffer to make 0.7% w/v concentration.

Agarose solutions were stored at 60°C to avert unwanted solidification. When needed

the heated agarose was poured into a BioRad horizontal gel apparatus and allowed set

with a plastic comb inserted in order to form wells. The gel was allowed to air dry for

20 minutes before being placed in the fridge at -40C for 5 minutes. The comb was

13

removed and 1.0 μL of gel loading dye was mixed with 4 μL of sample to help the

sample settle in the well and to give indication of migration distance during

electrophoresis.1X TAE buffer was used as the running buffer. A 1kb ladder was used

to identity DNA fragments. The gels were run for 25 minutes at 120 volts and

subsequently stained carefully with ethidium bromide staining solution for 15 minutes.

The gels were then visualized using a UV transilluminator. SYBR gels were prepared

by combining 3 μL of SYBR Safe stain with 30 mL of 0.7% agarose before being

added to a BioRad horizontal gel apparatus.(Larragy 2011) SYBR gel was visualized

under blue light.

3.3 Competent cells

5ml of LB broth containing ampicillin was inoculated with 1 colony of JM109 E.coli

from a plate stock and cultured overnight at 37oC. A 1L flask with 200ml of LB was

inoculated with 2ml of the LB overnight culture and incubated at 37oc shaking at 180-

220rpm. When OD 600 reached approximately 0.5 the flask was chilled on ice in the

cold room. The overnight culture was placed into a sterile centrifuge tube .The cells

were centrifuged at 3000 rpm at 5 minutes. The supernatant was removed and cells

were gradually suspended in 60ml of cold RP1 buffer. The suspension was allowed to

rest on ice for 90minutes .The cells were subjected to centrifugation at 3000 rpm for 5

minutes. The supernatant was removed and the cells were placed in 8ml of RP2 buffer.

Aliquots of 400ml of JM109 competent cells were flashed frozen using a metal steel

block and stored in 1.5ml microfuge tubes at -80oc.(Larragy 2011)

3.4 Transformation of Competent cells.

Aliquots of containing competent cells and plasmid DNA were allowed thaw

completely on ice. 5ul of plasmid DNA and 200ul of competent cells were softly

mixed in an Eppendorf tube. The tube was placed on ice for 30 minutes to allow the

plasmid and the cells to bind together. Cells were heat-shocked at 42°C for 30 seconds

and placed back on ice for 2 minutes.800ul of LB broth was supplemented to the cells

and they were incubated in a water bath for an hour at 37°.A neat suspension if cells

was prepared by adding 200ul onto a LB ampicillin plate and was incubated overnight.

The leftover 800ul was subjected to centrifugation at 5,000 rpm for 1 minute. 600ul of

the supernatant was removed and the remainder of the solution was used or suspension

14

of the pellet. This remainder was added to the ampicillin plate and incubated at 37oc

3.5 Bacterial Stock Solutions and Culturing

Both JM109 and KRX were stored as glycerol stock solutions. These stocks were

stored at -800c and made from 1 ml LB cultures with 50% glycerol. Ampicillin

was also added to maintain of E.coli of interest. Overnight E. col cultures were

prepared by inoculating a single colony from LB agar pate or a loopful glycerol

stock with 5ml of media culture(TB or LB).2ml of this overnight was then

subsequently used to inoculate 200 mL of broth which was shaken at 37°C for 2-

4 hours.

3.6 Screening for Protein Expression

Transformants were streaked in order to isolate a single transformant on individual LB

ampicillin plates. These colonies were inoculated in separate 8ml of TB, ampicillin and

IPTG (50 μg/mL) cultures. Expression cultures were grown overnight at 370C. After

overnight incubation the cultures were allowed to cool to arrest growth. The samples

were analyzed by spectrometer at OD600 to calculate the volume needed for harvested.

Samples were normalized using the equation:

The volume obtained using the equation is subjected to centrifugation at 13,300 rpm

for 1 min and pellet is combined with 50 μL of 1X SDS-PAGE sample buffer. The

samples are evaluated using 15% SDS-PAGE gel.

3.7 SDS-PAGE Analysis

Table 19 Regents for SDS-PAGE

Reagents 15% resolving gel 4% stacking gel

30% Acrylamide (mL) 3.75 0.325

dH2O (mL) 1.75875 1.54

1.5M Tris-HCl pH 8.8 (mL) 1.875 -

0.5M Tris-HCl pH 6.8 (mL) - 0.625

10% APS (μL) 37.5 12.5

10% SDS (μL) 75 25

Temed (μL) 3.5 2.5

15

.

Preparation of 15% resolving and 4% stacking polyacrylamide are detailed as per table

19.Gels were casted in an ATTO vertical mini electrophoresis system and TEMED was

always added last to initiate the setting process. After the addition of TEMED to the

resolving gel it was immediately covered with IMS. A comb was placed into the top of

the gel to form loading well .If the gels were not used straight away, they were placed

in the fridge at 4°C wrapped in soaked tissue.

3.8 Sample Preparation for SDS-PAGE

18 μL of protein sample and 2 μL of 10X gel loading dye was combined in a

microfuge tube and heated for 5 minutes at 100°C. 5 μL of this mixture was then

injected into a well. A broad range protein marker was used 2-212kDa in order to

gauge protein size. Prior to loading the samples gels were pre-run for 30 minutes at a

constant voltage of 30 mA. When gels were electrophoresed the constant fluctuated

between 30-70 mA and lasted as long as 90-120 minutes. When run was completed

gels were cleaned with dH20 and stained with Comassie blue overnight. The following

day gels were treated with Comassie destain solution to visualize protein bands.

4.0 Protein Expression

The highest expresser clone identified during screening was grown in 200ml TB

ampicillin culture. The culture was grown at 370C until it reached OD600 of 0.4-0.6

.When OD reached this range IPTG 100ug/ml was added and the culture was

transferred to a 30°C incubator for 16 hours. The culture was subjected to

centrifugation at 5,000 rpm for 10 min at 4°C using sterile centrifuge bottles.

Supernatant was disposed of and obtained pellet was suspended in in 100 mL of lysis

buffer (20 mM imidazole) with 0.01% anti-foam. Cell lysis was performed using a cell

disruptor, Constant Systems Ltd., at 15kPSi twice. The cell lysate was collected in high

speed centrifuge tubes and spun at 13,000 rpm for 40 min at 4°C. The resulting late is

filtered using Whitman filter into a sterile duran.

4.1 Protein Purification

Immobilized Metal Affinity Chromatography (IMAC) was used to purify recombinant

16

AAL-2 with terminal (His) 6 tag. Table 20 shows the steps needed for a standard

elution Column used was BioRad Proafinity Column with a Column volume (CV) of

20ml.

Table 20 IMAC Purification Washes

Step Added Fraction Collected

Rinse 10 CV dH2O -

Equilibrate 10 CV LB (20 mM) -

Lysate Filtered Lysate Unbound Lysate

Wash 10 CV LB (20 mM) 20 mM wash

10 CV LB (50 mM) 50mM wash

10 CV LB (80 mM) 80 mM wash

Elution 5 CV LB (250 mM) 10 x 1 mL

Rinse 10 CV dH2O -

Storage In 20% IMS -

4.2 Stripping and Recharging the IMAC Resin

IMAC resin was stripped and recharged after purification. The column was initially

washed with 20 ml of dH2O followed by 20ml of 20% IMS. Metals were removed by

washing with 20ml of 100 mM EDTA.The resin was then washed with 10 CV of

dH2O and recharged with ½ a CV of 100 mM NiSO4. The column was again washed

with 10 CV of dH2O and stored in 20% ethanol.

4.3 DNA Sequencing

Possible Mutants are screened using agarose gel electrophoresis and a potential mutant

is then identified using DNA sequencing. The sent plasmid sent for sequencing is

purified and eluted into dH20. The obtained plasmid is then delivered to Eurofins

MWG Operon .Sequences for both forward and reverse reads are retrieved by logging

into Eurofins website(Larragy 2011).

5.0 Results & Discussion

5.1 Isolation of pQE-30 Plasmid

Plasmid isolation was carried out as detailed using a Sigma GenElute Plasmid

Miniprep Kit and gel electrophoresis confirmed the presence of a pQE-30 isolated

plasmid. (Figure5a) illustrates a 0.7% agarose gel stained with ethidium bromide

showing a band in lane 6. As can be seen that smearing was observed all lanes loaded

17

with DNA including PQE30 plasmid AAL-2 in lane 6. While a DNA band did appear

in lane 6 it was difficult to establish its molecular weight due to unfavorable resolution

of the ladders in lanes 1 and 5. The banding at the bottom of the gel was the result of

short fragments of DNA. One reason the gel showed inconclusive results was that the

agarose used was expired and the gel therefore did not polymerize correctly. As shown

in (Figure4b) SYBR staining and new fresh agarose were used for enhanced

visualization of gel analysis. As shown in (Figure5b) a faint band of approximately

4Kb materialized in lane 7 which confirmed the presence of the pQE-30. The faint

suggests that a low amount of DNA plasmid was extracted from the JM109 E.coli.

Figure 5 Plasmid Isolation Agarose Gel Analysis (a) 0.7 % agarose gel stained with

ethidium bromide containing isolated plasmid pin lane 6.(B)0.7% agarose Gel stained

with SYBR containing DNA prep in lane 7. Faint band is observed in lane 7

corresponding to molecular weight of plasmid DNA. Molecular Ladder used Thermo

Scientific Gene Ruler 1Kb Plus DNA Ladder.

One should note there were several problems associated with imaging and preparation

of agarose gels throughout analysis. Agarose gels were fragile and would often

disintegrate when manipulated during the process. Often fragmentation of the gel

occurred where the electrophoresis comb was inserted. Amendments introduced to

rectify this included a longer period to allow the gel to set after agarose pouring, a 5

minute freezing step in -4o fridge and reduction in comb size to ensure gel was

structurally intact.

18

5.2 1st Round of Site Directed Mutagenesis

Figure 06 Agarose gels with PCR Products (a) 0.7% agarose stained with ethidium

bromide loaded with site directed mutagenesis PCR products in lanes (6-9) .Molecular

Ladders loaded in lanes 1 and 5. (b) 0.7 % agarose SYBR stained gel with site directed

mutagenesis PCR products in lanes 2-5. Molecular ladder loaded in lanes 1 and 6.

Molecular Ladder used for both gels Thermo Scientific Gene Ruler 1Kb Plus DNA

Ladder.

Site directed mutagenesis was the method used to alter the binding pockets of each

motif indicated in (Figure 18) of the appendix. The first round of mutagenesis used

mutagenic primers indicated in Methods and Materials 2.2 and intended to introduce

mutations N51A, N53A W54A. By amplifying the whole plasmid these desired

mutations could be integrated into the newly synthesized pQE-30 plasmid and

subsequently checked by gel electrophoresis to establish if the PCR reaction had

worked. In addition one could also establish which annealing temperature was optimal

for the production of the mutated plasmid.

(Figure 6a) displays a 0.7 % agarose gel stained with ethidium bromide loaded with

PCR products in lanes 6-9 .One can see that 4 PCR products were obtained for all

temperatures and it is evident from the intensity of the bands that annealing

temperatures 600c and 65

0c produced the greatest amount of PCR product. While PCR

products were attained one could not infer if the PCR was the correct molecular weight

due to the wavy appearance of the gel and resolution of the molecular ladder.

Possibilities for these unwanted characteristics include forceful removal of the gel

19

comb prior gel electrophoresis and incorrect positioning of the gel in electrophoresis

rig.

In order to validate the result categorically a SYPR gel was loaded with samples and

the results are shown in (Figure 6b). As depicted 4 of the 4 PCR products ran

effectively on the gel and their banding correlated with molecular weight of the

mutated plasmid 4.6kba. In order to obtain the maximum amount of mutated PCR

product the 60oC and 70

0C products were combined. Smearing observed in lanes

loaded may have be the result loading too much PCR product. Banding at the bottom

of gel indicate primer dimer formation.

5.3 Plasmid Digestion and Ligation of PCR Products

Before transformation could commence the original template pQE-30 plasmid had to

be removed from the PCR products in order to prevent a non-mutated plasmid being

transformed into a competent JM109 cell. This was achieved by subjecting the PCR

products to a DpnI restriction digestion. Dpn1 cuts at recognition sites GATC of

template plasmid only because adenosine residues of template plasmid are methylated.

The first digestion was unsuccessful as shown in (Figure 7a) as the gel was severely

warped. This distorted shape was caused by not allowing the gel set adequately. The

second attempt to examine the Digestion products as shown in (Figure 7b) was

ineffective as the loaded samples got caught in the loading well. One cause for this

result is protein contamination which limits mobility of the DNA through the agarose.

(Figure 7c) shows the digestion had worked properly as two thick bands of plasmid

DNA were obtained in lanes 3 and 5 corresponding to the molecular weight of the

plasmid. The residual smearing at the bottom of the gel is most likely caused lingering

cleaved DNA fragments.

20

Figure7 (a) 0.7% Agarose ethidium bromide stained gel loaded with digested

DNA Lanes 5 & 6: DNA digest. (b)Failed 0.7 % SYBR agarose with digested DNA

samples retained in loading wells 6 and 6. (c) Successful 0.7 % SYBR agarose with

digested plasmid DNA in lanes 3 and 5. Molecular ladder used Thermo Scientific Gene

Ruler 1Kb Plus DNA Ladder.

Digested PCR was purified from TAE agarose gel using a GE Healthcare purification

kit as detailed in the protocol. After obtaining purified DNA ligation of linearized PCR

products was initiated by T4 ligase in order to promote self ligation. This ligation step

was used to promote DNA uptake during transformation.

5.4 Transformation with JM109 cells using RF method

The purpose of the transformation was to introduce one’s mutated pQE-30 plasmid

into a competent cell in order to replicate and store plasmid indefinitely. Competent

JM109 E.coli cells were cultured in 5ml LB with 100ug/ml ampicillin overnight before

upscaling to a 200ml LB. The JM109 LB was allowed to grow for approximately 90

minutes until its 0D600 was determined to be 485nm. This indicated that the cells had

reached mid exponential phase and were ready for resuspension using RFP buffer.

Transformation was carried out using a heat shock method with prepared competent

JM109 using RF method. Selection of the JM109 transformants involved streaking

transformed cells onto LB amp+ agar plates. Only JM109 E.coli with the pQE-30 of

interest would grow due to the presence of amp gene located in the vector shown in

(Figure 4). As shown in figure transformants colonies were obtained on both neat and

21

concentrated plates streaked with JM109. No colonies materialised on the control plate

which indicated no contamination was present. All transformants displayed similar

morphology as they were circular, smooth, off white and shiny in appearance. Single

transformants were picked off from the neat and concentrated plates and streaked onto

new LB amp + plates to create a bank of single colony transformants.

As shown in (Figure8c) the streaking technique used was not efficient in

isolating singular colonies as an incorrect streak technique was applied. In addition the

plates had grown new colonies that differed in morphology compared to the original

transformants obtained. As shown the contaminants were identifiable due to their

larger circular morphology. New plates were streaked as shown desired single colonies

were obtained for further experimentation.

Figure 8 LB amp+ agar plates with JM109 transformed colonies. (a) Control plate

containing no transformants (b) Concentrated JM109 transformant LB agar plate

whereby 9 transformants were exhibited. (C) Streak plate of one of the JM109

transformants. Single colonies were obtained despite unfavourable streaking technique.

Transformation was also carried successfully with previously generated KRX

competent cells as well. The success of transformation was not as effective as JM109

competent cells as only 2 transformants materialised. Competent cells ability to obtain

plasmid DNA reduces overtime. Transformation was performed KRX as a backup if

the new the JM109 competent cells were not successful.

5.5 Sequence Check of Transformants

22

In order to validate if site directed mutagenesis had integrated the correct mutations

into the predicted binding pocket of AAL-2 and transformants contained pQE-30 a

sequence check was required. Only the reverse read of the DNA product was obtained

and it was converted into its reverse complement using the reverse complement tool

available from (http://www.bioinformatics.org/sms/rev_comp.html). This reversed

sequence was then converted from its nucleotide sequence to amino acid sequence

using the ExPasy translate tool (http://web.expasy.org/translate/). Figure 19 of the

appendix shows that BLAST analysis of the mutated plasmid confirming the presence

of AAL-2 in the transformant. As can be seen the sequences were 100% identical

however this result did not verify if the mutation had been introduced successfully into

the recombinant AAL-2 as the reverse read stopped 45 amino acids upstream from the

wanted mutation site. Given time constraints and cost it was decided to continue

despite no confirmation of the desired mutation.

5.6 Second Round Site Directed Mutagenesis

The aim of the second of round of mutagenesis was to introduce silent mutation at

another site implicated GlcNac binding as shown Figure 18 of the appendix. The

following mutations G221A G222A W223A would be introduced into the second

glycan binding site.

5.7 Plasmid Isolation from JM109 and KRX transformants

Plasmid isolation was performed as before using a Sigma GenElute Plasmid Miniprep

Kit and (Figure 9) shows the CYBR gel confirming the presence of isolated pQE-30

plasmid. Two types of competent cells were used for this experiment freshly produced

JM109 competent cells in lane 2 and older KRX competent cells in lane 5. As

indicated by the band intensity more plasmid DNA was extracted in the newer JM109

competent cells. Interestingly along with the low amount of DNA extracted from KRX

a faint band in lane 7 can be seen higher up the gel in lane. The positioning band is

unusually as it is higher than would be inspected for circular DNA. Two possibilities

for this outcome is that the plasmid DNA got caught in the gel loading channel and did

not resolve correctly as a result. The second more unlikely possibility is that same

plasmid was contaminated with chromosomal DNA which explains it high molecular

weight.

23

Figure 09 0.7 % agarose SYBR stained gel

showing isolated plasmid from JM109 and

KRX E.coli strains. DNA preparations of

JM109 (Lane 2) and KRX plasmid (Lane3).

Band displayed in lane 2 is 1.4kb which

corresponds to pQE30 plasmid size. .Molecular

ladder used New England BioLabs N3232S

DNA Ladder 1 kb.

5.8 PCR Products of Site Directed Mutagensis

The purpose of the PCR gel illustrated in (Figure 10) was to determine what

annealing temperatures produced the optimal amount of product for further DNA

manipulation. Only PCR reactions derived from fresh competent JM109 DNA were

successfully as PCR products were seen in 3 of the 4 loaded this sample while no PCR

products were seen in the older KRX cells. This compliments the previous isolation gel

above as it was seen that low quality plasmid template DNA was extracted from the

older competent cells. This lower quantity of DNA thus facilitated an unsuccessful

PCR reaction. As shown in figure 10 temperatures 550C

and 70

oC demonstrated the

best bands and were combined to ensure an adequate mutated plasmid could be

retrieved. As shown smearing was apparent in lanes 2-5 were PCR product was

obtained and this could be attributed to a number of factors.1) The gel was not

prepared properly and therefore solidified unevenly. 2) Wells were overloaded with

PCR product. 3) The DNA was contaminated with proteins. 4) DNA was degraded by

nuclease activity.

24

Figure 10 0.7 % TAE agarose gel stained SYBR displaying PCR products

obtained during second round of site directed mutagensis. Lanes 2-5 were loaded

with PCR products from JM109 template plasmid . Lanes 7-10 show PCR products

from KRX derived plasmid DNA. As shown annealing temparatures 550C and 70

0C

created the most PCR product.Molecular ladder used New England BioLabs N3232S

DNA Ladder 1 kb.

5.9 Digestion and Ligation of JM109 PCR Products

Digestion was peformed with Dpn1 to remove nonmethylated DNA template. The

result of the restriction is shown in (Figure 11) and as shown two distinct bands of

AAL-2 plasmid materialised at 4.6Kb mark on the gel. The smearing apparent in both

lanes loaded with sample is indicative that DNA was degraded during the incubation

time of the digestion. Another possiblity for the smearing is that the restriction enyzme

used became bound to the template DNA it was cuting and didn’t allow the DNA

fragments to resolve adequently on the gel. Digested Dna was excised from the gel ,

purfied and subjected to ligation reaction as detailed above to promote transformataion

efficency.

Figure 11 0.7 % TAE agarose gel stained with

SYBR displaying digested PCR products PCR

products loaded lanes in 3 and 5. DNA Bands

relating to th molecular weight of pQE-30 plasmid

materialise in both lanes loaded with 20 ul of

digested sample. Smearing apparent in both lanes

loaded. Molecular ladder used New England

BioLabs N3232S DNA Ladder 1 kb.

25

6.0 2nd

Round of Transformation

The first attempt at transforming competent JM109 with mutated plasmid was

unsucessful. This can be inferred as no colonies were found on any of the agar amp+

plates treated with JM109 cells . This outcome was likely attributed to experiemental

error as competent cells were allowed to thaw on ice for an excessively long period.

This prolonged thawing may have caused the cells to undergo lysis. Another possiblity

which caused this unfavourable result may have caused by ineffective ligation. The

ligation was allowed to proceed for 3 days during which some the plasmid may have

become linearised. Linearised DNA does not transform as efficently as circular

plasmid. A second attempt at transformation was performed adheing to protocol more

stringently and applying a concentrated cell samples to LB amp + plates. These

obtained transformants were streaked onto additional plates to establish e.coli bank to

work from,

6.1 Sequence Verification using XX of mutated AAL-2 Protein

Figure 12. Amino acid sequence of mutated AAL-2. As indicated by the red arrow

in the diagram 3 alanines were introduced as a result of the first round of mutagensis.

As shown by the blue arrow 3 alanines were created as result second round of

mutatgenesis.

In order to validate if the transformation had incoporated the correct mutated pQE-30

plasmid the next step invloved sequence verification. Both Transformanants were

seperately cultured overnight in 5ml LB and their respective plasmids were isolated

using Sigma GenElute plasmid miniprep kit. The isolated plasmids were purfied using

a GE Healthcare GFX PCR DNA purification kit before being sent for sequencing.

Full sequence retrival was gathered for plamsid and it was established that intended

point mutations had been successful integrated during both rounds of mutagensis. As

26

shown Figure 12 new NAAL and DAAA sequences had been established in the

plasmid.

6.2 Protein Expression Check using 15 % SDS-PAGE Analysis

The purpsose of the evalauting the expresson levels of each of the transformants by

SDS-Page gel electrophoresis was to establish which clone produced the maximum

amount of AAL-2 protein. 2 transformatants were used inoculate inoculate two

separate overnigh 5 mL TB ampicillin and IPTG (50 μg/mL) cultures.When the

overnight cultures were evaulated the following day no growth had occurred in any

cultures. This result was attributed to experimental error during the inoculation

procedure whereby the loop used was not allowed to cool efficently when obtaining

bacteria from stocks.The second possibly for no growth was that the TB used

supplemented with too high a concentration of amplicin thus killing the transformant

ecoli in the process. The second attempt to produce overnights was sucessful and OD

values were obtained for both transfomant cultures as shown in Table 21 of the

Appendix. These OD figures were substitued into the equation 1 to determine the

amount of cell culture to be loaded onto subsequent 15% SDS-PAGE gels.

Figure 13. 15 % SDS Agarose Protein

Expression gel showing the expression of

two transformants. Protein samples loaded

in lanes 13 and 13. Ladder used was New

England Biolab Unstained Protein Marker,

Broad Range (2-212 kDa) AAL-2 reference

sample loaded in lane 11.

The 15 % SDS agarose gel shown in figure 10 was inconclusive in determining which

of the 2 transformant loading in lanes 12 and 13 expressed the most AAL-2. While the

two JM109 samples loaded produced a mileau of proteins as indicated by the multiple

blue bands observed because the reference AAL-2 protein loaded in lane 9 did not

maternalise and the 25 Kb molecular weight ladder did not migrate properly one could

not ascertain if AAL-2 had been produced. The absence of the AAL-2 reference band

27

in lane 11 could have been attributed too low amount of protein being loaded intially

onto the gel. The improper ladder patterning may have been attributed contaminatation

of of the running buffer. Due to time restrictions transformant 2 was picked as the

clone to continue experimental analysis.

6.3 IMAC Chromatography

After selecting a JM109 expressor the aim of using IMAC chromatography during this

stage of the analysis was to selectively purify AAL-2 by allowing its engineered His-

tag to complex with a Biorad Proaffinity Column . JM109 transformant 2 was upscaled

from an 5 ml to 200ml TB culture before being induced with 100 ug/ml IPTG at an OD

600 value of 0.500. (Figure 12) shows the 15% SDS-PAGE gel of IMAC purfied lysate

and indicates that no protein was selectively fractionated in any of the collected

250mM fractions. This can be deduced as no bands corresponding to AAL-2 were

present in any of elutions. In additon no reference AAL-2 protein maternalised on the

SDS-PAGE gel. A Red Run Expeon Protein ladder was used and it migrated

unfavourable down the gel.

Figure 12 15 % SDS Gel

containing IMAC purified AAL-

2 products. 14ul of purified

IMAC product was loaded in lanes

2 – 10. Ladder used was a

RunBlue Expeodeon prestained

7.6Kda - 195Kda Ladder.

6.4 Troubleshooting IMAC Purification

In order to establish if any proteins, including AAL-2, were produced by

JM109 transformant selected during the upscaling process a 15% SDS-PAGE gel

loaded with JM109 filtered lysate was analyzed. As can be seen in Figure 13 multiple

bands materialized in lane 9 indicating overall JM109 protein expression was efficient

28

however it difficult to establish if the AAL-2 was expressed adequately due to other

proteins masking it. This is a noteworthy observation because it suggests that the

JM109 clone selected perhaps was not an optimal expresser of AAL-2. If a JM109

clone selected had been an efficient expresser of AAL-2 it would have displayed an

intense 42Kda band which would not have been masked by other contaminant proteins

As a result of the previous 15% SDS-Page gel it was decided reevaluate the 250mM

collections along with the unbound and elution washes to conclusively ascertain were

AAL-2 had been fractionated during the purification process.

Figure 13 15% SDS-Page Gel

evaluating the filter Lysate of

JM109 clone. Lane 5 loaded with

AAL-2 reference sample. Lane 9

contains filtered lysate sample.

Lane 2 contains a RunBlue

Expeodeon prestained 7.6Kda -

195Kda Ladder.

Figure 14 15% SDS Page

Comassie Blue stained gel

containing filtrate unbound and

wash steps. Unbound (Lane 13),

imidazole washes steps (Lanes1, 2

and 14) and elution fractions

(Lanes 2-11). Ladder used was a

RunBlue Expeodeon prestained

7.6Kda - 195Kda Ladder.

Figure 14 displays the second

troubleshooting 15 % SDS-PAGE gel produced with all fractions loaded in lanes (2-

11), excluding lane 10. No AAL-2 was detected in any of 250mM washes as inferred

by the absence of band of 42Kda. Lane 13 containing unbound wash shows the

collection of proteins that did not complex with the nickel column. There is a low

intensity band corresponding to 42Kda present in unbound wash suggests the JM109

29

clone is producing AAL-2 however it is not interacting with column efficiently.

Possibilities which may have contributed to include

1. Proteolytic cleavage of the histag during fermentation or purification.

2. The target protein could be found in inclusion bodies which didn’t permit

complexation with IMAC column.

3. Air bubbles within the column impeded gravity flow of the fractions and

washes limited the contact of the proteins with column.

4. The proteins were folded state which did not allow the AAL-2 to interact with

the column.

As shown in gel on the 20mM elution was the only step which showed any indication

of the presence of protein. This was as expected as the purpose of imidazole wash

gradient wash was to elute any unwanted histine rich contaminating proteins from the

IMAC column. Overall the low intensity of bands found in wash and elution steps

suggest low protein expression was demonstrated by the JM109 clone. The cause for

the absence of protein could be attributed to transformant chosen not being an efficent

expressor of protein. In hindsight more colonies should been selected after

transformation process to increase the chances of obtaining a robust expressor of AAL-

2.

Another cause for the above 15% SDS gel could be attributed to applying an incorrect

temperature during 16 hour incubation period. The temperature used was 22o

c which

was not conducive in maximasing protein output. The protocol stipulates that a 30oC

incubation should have been performed as this maintains the bacteria in healthy

phsyiological whereby protein production is optimised while at the same time the

culture does not overgrow.

While the gel was electrophoresed it was observed the 30 amps being subjected gel

steadily increased. This surge in amps levels may have contributed to the

instatisfactory resolution of this molecular ladder in this gel and previous gels.

30

6.5 Troubleshooting Transfromation with KRX and JM109

In attempt to improve the likelihood of attaining AAL-2 for purification both KRX and

JM109 were transformed again in order to obtain an efficient expresser of AAL-2.

Plasmid isolation was carried out as detailed using a Sigma GenElute Plasmid

Miniprep Kit and a low amount of plasmid DNA was obtained. As a result 20ul of

plasmid DNA was used in the transformation reaction instead of 5ul as stipulated in the

protocol to enhance the chances of effective transformation. Transformation was

successfully carried in both competent KRX and JM109 strains as 3 colonies for KRX

and 5 colonies for JM109 were selected on amp positive agar plates.

6.6 Protein Expression Check of KRX and JM109 new transformants

Figure 15 15% SDS gel showing expression levels of new transforannts lanes.

JM109 (Lanes1-5), KRX transformants (Lanes 6-8) and old JM109 transformants

(Lanes 9-10). From the SDS gel KRX transformant in lane 6 was identified as the most

efficient expresser of AAL-2 as it produced the most intense band corresponding to the

MW of AAL-2. RunBlue Expeodeon prestained 7.6Kda - 195Kda Ladder loaded in

lane 5 and 12.

Each of the transformants were streaked onto separate LB agar plates before being

grown overnight at 37oc in 8ml TB. 5 transformants of new JM109, 3 transformants

from KRX and the two previously transformed JM109 strains were tested for protein

expression. The OD600 values are shown in Appendix table 23 and the samples were

normalised (Appendix Table 24) prior to loading onto SDS. The SDS-gel was

31

optimised by using making fresh preparations of 10% APS and TRIS buffers. In

addition 140 volts were applied to the gel. This reduced voltage meant the gel ran

considerably slowly and took 3 hours for the run to be completed. These changes gave

fruitful results and as shown in Figure 16 KRX clone in lane 6 displayed the greatest

levels of AAL-2 expression as indicated by in band at 42kb molecular marker.

However due to experimental error no IPTG was added to TB prior to protein

expression check therefore the production exhibited may not have been representative

of which clone was the best expresser. Instead results obtained shows which clone has

exhibits leakiest T5 promoter and highest basal expression of AAL-2. Another reason

that KRX may have produced more AAL-2 is that it could displays reduced Condon

bias.

The experiment was rerun with the addition of IPTG using 3 clones that displayed high

levels basal AAL-2 expression however the subsequent 15 % SDS gel analysis, not

shown, produced a gel which was inclusive due to unfavourable protein migration. Due

to time constraints the KRX clone which showed high expression of AAL-2 despite not

being induced by IPTG was selected for upscale culturing and IMAC purification.

6.7 IMAC Purification of KRX Clone

The 15% SDS gel shown in Figure 16 performed after IMAC purification of

KRX shows no bands corresponding to AAL-2 in any of the 250 Mm eluted fractions.

Overall the gel did not perform efficiently as shown by the poor resolution of the

molecular ladder loaded in land 6.Visualisation of bands was difficult and the only

bands that did materialise were faint high molecular weight proteins bands found in the

filtrate and unbound loaded lanes of 1 and 2. This SDS gel performance mimicked the

gel failure obtained during previous protein expression checks of KRX and JM109

transformants. A possible source of error was that the pH gradient between the

stacking and resolving gels was not maintained due to incorrect TRIS buffer

preparation. Another error that could have caused this result was that the OD600 of

KRX was 0.389 when induced with IPTG which is not optimal and therefore did not

express sufficient amounts of the protein of interest. Due to time limitations IMAC

purification was not repeated and no AAL-2 protein collected for further ELLA

characterisation.

32

Figure 16 Failed 15% SDS-PAGE gel contain KRX derived IMAC purified

protein samples. Filtered lysate (Lane 2) unbound fraction (Lane 3), Imidazole

Washes 20-80 Mm (Lanes 4-6) and eluted fraction Lanes (8-13). MW is in (Lane 7)

Ladder used was a RunBlue Expeodeon prestained 7.6Kda - 195Kda Ladder.

7.0 Future Perspectives

The first recommendation one could explore is the use of precast SDS-PAGE gels to

firmly confirm that the lack of AAL-2 production was attributed to the identification of

a poor AAL-2 expresser rather than gel failure(Schagger 2006). Other techniques that

could identify AAL-2 more proficiently include using SDS-PAGE in conjunction with

silver staining and western blotting analysis. Silver staining is a more sensitive staining

while Anti-HisTag antibodies could be used to recognize AAL-2 from a protein lysate

for western blot analysis.(Mahmood & Yang 2012). One could use a gene reporter

such as Green Fluorescent Protein (GFP) to track the location of AAL-2 during a

purification process. The pQE-30 vector harbouring AAL-2 could be reengineered to

have AAL-2 expression under the control of a T7 promoter Bacteriophage. Both

JM109 and KRX contain T7 RNA polymerase in their respective genotypes and this

could enhance protein production of AAL-2. Additionally same E.coli strain which

Jang et al used as also processes a T7 promoter. The use of multiple chromatography

steps such as ion exchange and affinity chromatography prior to IMAC

chromatography could fractionate the protein lysate further and yield purer AAL-

2(Anon 2006; Durham 2005). The final avenue

33

8.0 Conclusion

In this study one successfully introduced two mutations by site directed

mutagenesis into two hypnotised carbohydrate binding sites of AAL-2 for GlcNac. It

was envisioned that alanine mapping would reduce the binding of AAL-2 to GlcNac

thus proving that that specific amino acids are implicated in the interaction between

AAL-2 and N-GlcNac residues. While one did effectively identify clones with

sufficient levels of basal AAL-2 expression, the identification of clone with adequate

IPTG protein expression were not attained. This failure to obtain an expresser of AAL-

2 coupled with issues with SDS gel analysis did not facilitate IMAC chromatography

purification. Ultimately no protein could be fractionated and therefore characterisation

using ELLA analysis of the binding of mutated AAL-2 with GlcNac was not

performed. In conclusion this project has identified several issues with AAL-2 protein

expression and purification, solved problems associated DNA visualisation using

agarose gel electrophoresis and has provided some suggests which can enhance the

experimental process. Ultimately the outcome of this project can be deemed

bittersweet while the evaluation of AAL-2 binding with GlcNac was achieved overall

this FYP has been personally awarding experience and was provides a solid foundation

for the characterisation AAL-2 in the future.

9.0 Acknowledgements

I would like to sincerely thank my supervisor Dr. Brendan O’Connor for all his

help, support and patience throughout my final year project. I would also like to thank

PhDs students John Cawley and Donal Monaghan for their daily guidance in the lab

and showing me that maintaining a positive attitude in a research environment is a

valuable skill.

34

9.0 References

Ambrosi, M., Cameron, N.R. & Davis, B.G., 2005. Lectins: tools for the molecular

understanding of the glycocode. Organic & biomolecular chemistry, 3(9),

pp.1593–608. Available at: http://www.ncbi.nlm.nih.gov/pubmed/15858635.

Anon, 2006. Gel-filtration chromatography. Nat Meth, 3(5), pp.411–412. Available at:

http://dx.doi.org/10.1038/nmeth0506-411.

Cioci, G. et al., 2006. Beta-propeller crystal structure of Psathyrella velutina lectin: an

integrin-like fungal protein interacting with monosaccharides and calcium.

Journal of molecular biology, 357(5), pp.1575–91. Available at:

http://www.ncbi.nlm.nih.gov/pubmed/16497330 [Accessed April 23, 2015].

Durham, D., 2005. Isolation by Ion-Exchange Methods. In S. Sarker, Z. Latif, & A.

Gray, eds. Natural Products Isolation SE - 6. Methods in Biotechnology.

Humana Press, pp. 159–183. Available at: http://dx.doi.org/10.1385/1-59259-955-

9:159.

Jiang, S. et al., 2012. A novel lectin from Agrocybe aegerita shows high binding

selectivity for terminal N-acetylglucosamine. The Biochemical journal, 443(2),

pp.369–78. Available at:

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3316157&tool=pmce

ntrez&rendertype=abstract [Accessed April 20, 2015].

Larragy, R., 2011. The cloning, expression and characterisation of bacterial chitin-

binding proteins from Pseudomonas aeruginosa, Serratia marcescens,

Photorhabdus luminescens and Photorhabdus asymbiotica. DCU.

Mahmood, T. & Yang, P.-C., 2012. Western Blot: Technique, Theory, and Trouble

Shooting. North American Journal of Medical Sciences, 4(9), pp.429–434.

Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3456489/.

Moremen, K.W., Tiemeyer, M. & Nairn, A. V, 2012. Vertebrate protein glycosylation:

diversity, synthesis and function. Nature reviews. Molecular cell biology, 13(7),

pp.448–62. Available at:

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3934011&tool=pmce

ntrez&rendertype=abstract [Accessed July 11, 2014].

Ohtsubo, K. & Marth, J.D., 2006. Glycosylation in cellular mechanisms of health and

disease. Cell, 126(5), pp.855–67. Available at:

http://www.ncbi.nlm.nih.gov/pubmed/16959566 [Accessed July 10, 2014].

Ren, X. et al., 2013. Crystallization and preliminary crystallographic studies of AAL-2,

a novel lectin from Agrocybe aegerita that binds nonreducing terminal N-

acetylglucosamine. Acta crystallographica. Section F, Structural biology and

35

crystallization communications, 69(Pt 6), pp.650–2. Available at:

http://www.ncbi.nlm.nih.gov/pubmed/23722844 [Accessed April 23, 2015].

Schagger, H., 2006. Tricine-SDS-PAGE. Nat. Protocols, 1(1), pp.16–22. Available at:

http://dx.doi.org/10.1038/nprot.2006.4.

Thompson, R. et al., 2011. Optimization of the enzyme-linked lectin assay for

enhanced glycoprotein and glycoconjugate analysis. Analytical biochemistry,

413(2), pp.114–22. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21320462

[Accessed April 23, 2015].

Varrot, A., Basheer, S.M. & Imberty, A., 2013. Fungal lectins: structure, function and

potential applications. Current opinion in structural biology, 23(5), pp.678–85.

Available at: http://www.ncbi.nlm.nih.gov/pubmed/23920351 [Accessed April 20,

2015].

36

10.0 Appendix

(Figure 17)

Selected Features of Quiagen pqE30

ATG - Protein Translation Start Site

CAT CAC CAT CAC CAT CAC - His BamH1Tag Methionine

GGA TCC - BamH1 Restriction Site

TAA- Methionine Stop Condon

AAG CTT – HindIII Restriction Site

GCT GGT GGT - Mutation Site One

GGT GGT TGG – Mutation Site Two

AAL-2 IN PLASMID PQE30

CTC GAG AAA TCA TAA AAA ATT TAT TTG CTT TGT GAG CGG ATA ACA ATT

ATA ATA GAT TCA ATT GTG AGC GGA TAA CAA TTT CAC ACA GAA TTC ATT

AAA GAG GAG AAA TTA ACT ATG AGA GGA TCG CAT CAC CAT CAC CAT CAC

GGA TCC ATG ACC TCT AAC GTT ATC ACC CAG GAC CTG CCG ATC CCG GTT GCT TCT CGT GGT TTC GCT GAC ATC GTT GGT TTC GGT CTG GAC GGT GTT

GTT ATC GGT CGT AAC GCT GTT AAC CTG CAG CCG TTC CTG GCT GTT AAA

AAC TTC GCT CAG AAC GCT GGT GGT TGG CTG ACC ACC AAA CAC GTT CGT

CTG ATC GCT GAC ACC ACC GGT ACC GGT AAA GGT GAC ATC GTT GGT TTC

GGT AAC GCT GGT GTT TAC GTT TCT GTT AAC AAC GGT AAA AAC ACC TTC

GCT GAC CCG CCG AAA ATG GTT ATC GCT AAC TTC GGT TAC GAC GCT GGT

GGT TGG CGT GTT GAA AAA CAC CTG CGT TAC CTG GCT GAC ATC CGT AAA

ATC GGT CGT GCT GAC ATC ATC GGT TTC GGT GAA AAA GGT GTT CTG GTT

TCT CGT AAC AAC GGT GGT CTG AAC TTC GGT CCG GCT ACC CTG GTT CTG

AAA GAC TTC GGT TAC GAC GCT GGT GGT TGG CGT CTG GAC CGT CAC CTG

CGT TTC CTG GCT GAC GTT ACC GGT AAC GGT CAC CTG GAC ATC GTT GGT

TTC GGT GAC AAA CAC GTT TTC ATC TCT CGT AAC AAC GGT GAC GGT ACC

TTC GCT CCG GCT AAA TCT GTT ATC GAC AAC TTC TGC ATC GAC GCT GGT

GGT TGG AAA ATC GGT GAC CAC CCG CGT TTC GTT GCT GAC CTG ACC GGT

GAC GGT ACC GCT GAC ATC ATC GGT TGC GGT AAA GCT GGT TGC TGG GTT

GCT CTG AAC AAC GGT GGT GGT GTT TTC GGT CAG GTT AAA CTG GTT ATC

AAC GAC TTC GGT ACC GAC AAA GGT TGG CAG GCT GCT AAA CAC CCG CGT

TTC ATC GCT GAC CTG ACC GGT AAC GGT CGT GGT GAC GTT GTT GGT TTC

GGT AAC GCT GGT GTT TAC GTT GCT CTG AAC AAC GGT GAC GGT ACC TTC

CAG TCT GCT AAA CTG GTT CTG AAA GAC TTC GGT GTT CAG CAG GGT TGG

ACC GTT TCT AAA CAC CGT CGT TTC GTT GTT GAC CTG ACC GGT GAC GGT

TGC GCT GAC ATC ATC GGT TTC GGT GAA AAA GAA ACC CTG GTT TCT TAC

AAC GAC GGT AAA GGT AAC TTC GGT CCG GTT AAA GCT CTG ACC AAC GAC

TTC TCT TTC TCT GGT GGT AAA TGG GCT CCG GAA ACC ACC GTT TGC TGG

ATG GCT AAC CTG GAC TCT TCT CGT CAC TAA AAG CTT AAT TAG CTG AGC

TTG GAC TCC TGT TGA TAG ATC CAG TAA TGA CCT CAG AAC TCC ATC TGG

ATT TGT TCA GAA CGC TCG GTT GCC GCC GGG CGT TTT TTA TTG GTG AGA

ATC CAA GCT AGC TTG GCG AGA TTT TCA GGA GCT AAG GAA GCT AAA ATG

GAG AAA AAA ATC ACT GGA TAT ACC ACC GTT GAT ATA TCC CAA TGG CAT

CGT AAA GAA CAT TTT GAG GCA TTT CAG TCA GTT GCT CAA TGT ACC TAT

37

AAC CAG ACC GTT CAG CTG GAT ATT ACG GCC TTT TTA AAG ACC GTA AAG

AAA AAT AAG CAC AAG TTT TAT CCG GCC TT

Figure 18 Blast sequence alignment of amino acid sequence of AAL-2 and PVL.

As indicated the sequences are 60 % identical. The boxed regions indicate the N-

GlcNac binding motifs of the proteins. The Red boxes are the sites that were targeted

for site directed mutagenesis First Red box mutation Site1.Second red box mutation

site 2

Figure 19 Blast alignment of pQE-30 translated reverse read and AAL-2. This

alignment confirmed the presence of PQE30 in a JM109 transformant. No mutation

indicated as sequence read of AAL-2 stopped 45 amino acids from mutation site.

Calculations for Protein Expression analysis Table 21 Sample Preparation for Transformants JM109 and KRX

Clone OD (600nm) D.Factor (1:5) Sample (ul) dH20

JM109 0.548 2.74 76 4

KRX 0.521 2.605 80 0

38

Table 22 Calculations Normalization of Loaded JM109 and KRX

Table 23 Sample Preparation for Troubleshoot JM109 and KRX Transformants

Clone Type OD (660nm) D. Factor (1:5) Sample (ul) dH20 (ul)

JM109 0.602 3.01 70 10

JM109 0.538 2.69 78 2

JM109 0.524 2.62 80 0

JM109 0.566 2.83 74 6

KRX 1 0.655 3.275 64 16

KRX 2 0.544 2.72 77 3

JM109 0.7 3.5 60 20

JM109 0.65 3.25 64 16

KRX 3 0.621 3.105 67 13

Table 24 Normalization of Loaded Troubleshoot JM109 and KRX samples

Table 25 Sample Preparation for induced JM109 and KRX Troubleshoot Transformants

Transformant OD Value Dilution Factor (1:5) Sample Volume (ul) dH20 (ul)

JM109 3 0.501 2.505 84 21

JM109 4 0.405 2.025 104 1

KRX 6 0.399 1.995 105 0

Table 26Normalisation JM109 and KRX Troubleshoot IPTG induced samples

Sample Normalization Calculations

Steps KRX 6 JM109 Trans 4

Dilution Factor (0.399) X 5 =1.995 (0.501 X 5 =2.50

Formula (0.7/2.0) X 300 (0.7 /2.50) X 300

Sample (ul) 105 ul 104 ul

Water (ul) 105 ul - 105 ul = 0 ul 105 -104 = 1 ul

Total Volume (ul) 105 ul + 0 ul = 105 ul 104 ul + 1ul = 105 ul

Clone JM109 Tranformant 3 JM109 Tranformant 2

Dilution Factor (0.524) X 5 = 2.62 (0.538) X 5 =2.69

Formula (0.7/2.62) X 300 (0.7 /2.69) X 300

Sample ul 80.15ul Sample Loaded 78.06 Sample Loaded

Water ul 80.15 -80.15 = 0 ul 80.15- 78.06 = 2.08 ul

Total Volume ul 80.15ul + 0 ul = 80.15ul 78.06 + 2.08 ul = 80.15ul

Clone JM109 Tranformant 3 JM109 Tranformant 2

Dilution Factor (0.524) X 5 = 2.62 (0.538) X 5 =2.69

Formula (0.7/2.62) X 300 (0.7 /2.69) X 300

Sample ul 80.15ul Sample Loaded 78.06 Sample Loaded

Water ul 80.15 -80.15 = 0 ul 80.15- 78.06 = 2.08 ul

Total Volume ul 80.15ul + 0 ul = 80.15ul 78.06 + 2.08 ul = 80.15ul