1

2

A study on the interaction of Rab11 with tumour suppressor

gene(s) in epithelial morphogenesis of Drosophila melanogaster

Submitted by

S P Ratish Prashanth

B.Tech in Biotechnology

VIT University

Vellore

Under the supervision of

Prof. J. K. Roy

Cytogenetics Laboratory

Department of Zoology

Institute of Science

Banaras Hindu University

Varanasi

3

ACKNOWLEDGEMENT

I am thankful to The Indian Academy of Sciences for giving me this brilliant opportunity to work in

Cytogenetics Laboratory, Department Of Zoology, Banaras Hindu University, Varanasi.

I express my heartfelt thankfulness towards my guide Prof. J.K. Roy for accepting my fellowship and

guiding me throughout the term of my work.

I am deeply obliged to Mr. Nabarun Nandy and Mr. Rohit Kunar for their continuous support and

guidance throughout the course of fellowship and for successful completion of this project. I would like to

take this opportunity to thank them for their constant guidance, encouragement and patience. They were

always been positive source of inspiration for me to work towards betterment with perfection each day.

I would also like to extend my heartfelt gratitude to Ms.Gunjan Singh, Ms. Mukulika Ray, Mr. Anand

Prakash, Ms. Shainy Ojha, Mr. Animesh Banerjee, Mr. Sandeep Dubey, Mr. Rashmi Ranjan Sahu, Ms.

Surabhi Singh, Ms. Kavita Baghel, Mr. Deo Prakash Chaturvedi, Ms. Priyanka Kumari, Ms. Priyanka

Mathur, Ms. Madhumita Roy and Drs. Manish Singh and Yashwanth for their valuable suggestions and

support, sorting out my problems during the fellowship period.

I thank my fellow interns Sayantan Datta, Bhagyashri Soumya Nayak, Tulika for making this an

impressive episode for me.

I also extend my sincere thanks to the lab attendants Awdesh ji, Rajesh Ji, Guddu ji, Shyam ji and

Lawlesh ji for providing general bottles in right time and other resources whenever needed.

I would like thank my family members Appa, amma and my sister Ramya for motivating me and

supporting my idea and goals and my friends for their moral support and encouragement all the way

through the project.

Last but not the least Mr. Drosophila melanogaster which sacrifices his life at pretty early stage for my

work and made this project a success story.

S P Ratish Prashanth

4th Year B.Tech Biotechnolohy

VIT University, Vellore

4

Table of Contents

Content Page No.

A. Introduction 4-12

A.1. Roles of Rab11 5

A.2. Cell Polarity 5

A.3. Cell Migration 7

A.4. Tight Junction 9

A.5. Gap Junction 9

A.6. Role of pJNK 9

A.7. Role of FasIII 9

A.8. Role of Neurotactin 10

A.9. Life cycle of Drosophila melanogaster 10

B. Objective 12

C. Materials and Methods 13-21

D. Results and discussion 22-28

E. References 29-30

5

A. Introduction

Membrane trafficking is the process by which proteins and other macromolecules are distributed

throughout the cell, and released to or internalized from the extracellular space. Membrane-trafficking

uses membrane-bound vesicles as transport intermediaries.

Intracellular organelles are an essential feature of eukaryotic cells. Each organelle must maintain its

characteristic structure, biochemical composition, and functions, which defines the individual identity of

these organelles of the exocytic and endocytic pathways, which specifies the continuous flow of proteins

amongst them. The exocytotic pathway sorts newly synthesized proteins from the Endoplasmic

Reticulum, through the Golgi apparatus to their final destination at the plasma membrane, on the contrary,

the endocytic pathway is essential for the uptake of nutrients and the internalization of receptors. Newly

internalized material is transported to the early endosome, a tubulo-vesicular network localized to the cell

periphery. Proteins destined for recycling are sorted to Recycling Endosomes and then to the plasma

membrane, whereas proteins destined for degradation are transported to late endosomes(also called

prelysosomes or prevacuoles) and subsequently to the lysosome vacuole.

The mechanisms underlying membrane traffic can be divided into five essential steps: Vesicle

budding,Vesicle transport, Vesicle delivery, Vesicle tethering and fusion of the membrane with that of the

target compartment (Grosshans et.al, 2006). These vesicles are delivered to their target membrane, often

using molecular motors to transport vesicles along the cell’s microtubule or actin filament system.

Tethering then brings the vesicle and the target membrane into close proximity. The final step is the

fusion of those vesicles with the target membrane. As our discussion advances, we would find that Rab

GTPases have been implicated in the regulation of each of these steps of membrane traffic.

Rabs are a ubiquitously expressed family of small (20–29 kDa) monomeric Ras-like GTPases. Till date,

11 Rabs have been identified in yeast (including Sec4p and the Ypt proteins) and 60 in mammalian cells.

The much larger number of Rabs in mammalian cells reflects the higher in higher eukaryotes, as indicated

by the fact that several mammalian Rab proteins are expressed only in specific tissues and differentiated

cell types, where they participate in specialized transport pathways.

Rab GTPases function as molecular switches, cycling between GTP-bound and GDP-bound states. This

switch is controlled by guanine nucleotide exchange factors (GEFs), which trigger the binding of GTP,

and GTPase-activating proteins (GAPs), which accelerate hydrolysis of the bound GTP to GDP. Rabs

also undergo a membrane insertion and extraction cycle, which is partially coupled to the nucleotide

cycle. Membrane insertion requires the irreversible modification of two carboxyl-terminal cysteines with

isoprenyl lipid (geranylgeranyl) moieties. A protein called GDP dissociation inhibitor (GDI) binds to

prenylated Rabs in their GDP-bound form, masking their isoprenyl anchor and thereby maintaining the

Rab protein in the cytosol. Membrane attachment of Rab proteins therefore requires the function of a GDI

displacement factor (GDF). Once dissociated from GDI the Rabs are available for GEF-stimulated GTP

binding. The active, membrane-bound Rabs are then able to fulfill their various functions in membrane

traffic by binding to their specific effectors. After inactivation by their specific GAPs, the GDP-bound

Rabs can be extracted from the membrane by GDI and recycled back to the cytosol.

6

A.1. Role of Rab11

Rab (Ras like G- protein initially indentified in Rat brain) Protein family has small monomeric GTPase

which regulates membrane trafficking. It is evolutionarily conserved, ubiquitously expressed subfamily of

Rab GTPase and has been implicated in the regulation of vesicular trafficking through the recycling of

cargo inside a cell. Rab family members have been found to be to aberrantly expressed in various cancer

tissues. Rabs perform variety of functions, viz., growth, protein trafficking and signaling pathways. Rab

11 is transported along microtubules to the cell periphery through association with recycling carriers, and

directly regulates vesicle exocytosis at the plasma membrane. Rab11 depletion inhibits tethering and

fusion of recycling carrier vesicles to the plasma membrane. Rabs can regulate virtually all the steps of

membrane traffic from the formation of the transport vesicle at the donor membrane to its fusion at the

target membrane. Some of the many regulatory functions performed by Rab include interacting with

diverse effector protein that select cargo, promoting vesicle movement and verifying the correct site of

fusion.

Rab Rab

Function

Direct

effector

Effector

function

Rab

specificity

Effector

partner

Partner

feature

Rab11 Recycling

through

perinuclear

recycling

endosomes.

Plasma

membrane –

membrane

traffic.

Rab11BP

Not clear

Rab11-GTP

mSec13

Coat

component

of COPII

Vesicles

Table.1: Rab11, their effectors and its functions

Different Rab effectors act during vesicle formation, movement, tethering and fusion, with each pathway

having its own unique set of effectors (Zerial and Heidi McBride,2001). In animal cels, many membrane

traffic pathways rely on microtubules and Rabs have been shown to interact with the microtubule-based

motors to regulate these pathways. Microtubules are generally organized with their minus ends at

microtubule organizing centres, such as the centrosome, and direct their plus ends into the cytoplasm and

towards the cell periphery. Rab proteins can regulate traffic in either direction by interacting with

members of the kinesin (plus-end directed motors) or dynein (minus-end directed motors) family. Dynein

is normally in a complex with dynactin that couples the motor to and stimulate vesicle motility along

microtubules.

A.2. Cell polarity

Cell polarity is one of the fundamental features of both eukaryotes and prokaryotes, and is defined as

asymmetric distribution of specific protein complexes, cellular organelle, and cell shape associated with

7

cellular identity and cell function and cell differentiation and many more biological functions such as cell

growth, cell migration and invasion (Henrique and Schweisguth, 2003). The establishment and

maintenance of epithelial cell polarity is also crucial for many cellular and developmental processes

including maintenance of epithelial integrity where cell adhesion molecules also play an important part

along with different polarity complexes (Johnson, 1999).

There major polarity complex are well characterized being associated with cell polarity, are as follows;

PAR complex- composed of PAR3, PAR6, atypical protein kinase C (aPKC, PKCζ and PKCι in

humans) and cell division control protein 42 (CDC42)- required for maintenance of apical-lateral

polarity (Henrique and Schweisguth, 2003).

Crumbs (CRB) complex- composed of transmembrane protein CRB, cytoplasmic protein PALS1 or

Stardust (std) in Drosophila and PALS1-associated tight junction protein (PATJ) or Discs-lost (dlt)

in Drosophila. It is required for apical polarity establishment (Li et al., 2015).

Scribble complex- comprises of scribble (SCRIB), lethal giant larvae homolog (LGL), discs large

homolog (DLG) proteins- required for maintenance of basolateral polarity (Liu et al., 2014).

Besides these, cell adhesion complexes consist of adherens junctional complexes and tight junctional

complexes, are also important for maintenance of cell polarity. Cadherin-catenin and nectin-afadin

complexes are two adherens junctional complexes present at the core of the adherens junction while the

tight junctional complexes composed of zonulaoccludens (ZO) subfamily, occludin, claudin and

junctional adhesion molecules (JAM) all of which are well characterized (Assemat et al., 2008).

Complex Components Functions

Cell polarity

complexes

PAR complex

Crumbs complexes

Scrib complex

PAR3, PAR6, aPKC

and CDC42

CRB, PALS1 and PATJ

Scrib LGL and DLG

Maintenance of apical

lateral polatrity

Establishment of the

apical plasma

membrane

Maintenance of

basolateral membrane

Cell adhesion

complexes

Adherens junctional

complexes

Tight junction complex

CAdherin, nectin-afadin

complexes

ZO family, occluding,

claudin and JAM

Adherens junction

Tight junction

Table.2: Cell polarity complexes and cell adhesion complexes [Adopted from Li et al., 2015].

Loss of cell polarity complexes and adhesion complexes lead to failure in maintenance of epithelial cell

polarity, inducing epithelial-to-mesenchymal transition (EMT), hyper-proliferation of cell and enhanced

cell invasive potential. Enhanced cell invasive potential is a characteristics of tumorous cells. So polarity

8

complexes are very important for tumor development as well as morphological and collective cell

migration found in normal developmental process (Henrique and Schweisguth, 2003).

A.3. Cell migration

Cell migration is a complex process shown by all cells or undifferentiated precursors of those cells during

specific time period of developmental stages. For majority of the cells including epithelial, neuronal and

stromal cells- migration phases are confined to morphogenesis and withdrawn with terminal

differentiation of the cells towards intact tissue. But in tumorous or neoplastic changes these cells are

reactivated and acquire migratory characteristics. But for certain other cell types such as leukocytes cells

move within body fluid or blood (Friedl and Katrina, 2009).

Cell migration can be broadly classified into two major types: single cell migration (amoeboid or

mesenchymal mode) and collective cell migration (migration of cohesive multicellular unit)

(Lauffenberger and Horwitz, 1996).

Single cell migration- It refers to the movement of one individual cell with two subtypes. In one case

blebbing occur in the cells but they do not adhere or pull on the surface, instead of this they uses

propulsive, pushing migration mode. In other case actin rich filopodia are generated at the Leading Edge

which then forms weak adhesive interaction with the substrate to move. In certain special cases of single

cell migration such as terminally matured non adhesive dendritic cells actin rich dendrites are produced

instead of blebs at the leading edge and these dendrites helps in entangling of substrate to the ECM of the

cells (Lauffenberger and Horwitz, 1996).

Collective cell migration- In collective cell migration more than two cells move together maintaining

their intracellular connections which requires complex changes in tissue dynamics, polarity and adhesion

complexes characteristically found in morphogenesis as well as during cancer development (Llina and

Friedl, 2009).

Mechanisms of cell-cell cohesion and polarity within collectively migrating cell groups

Similarly to non-migrating epithelia, collectively migrating cell groups are connected by cell-cell

junctions that mediate cell-cell cohesion, mechanical integrity, cell polarity and, probably, direct cell-cell

signalling. The types of cell-cell junctions utilized are those that are known to occur in epithelia and

endothelia; here they occur in the context of multicellular dynamics and tissue remodelling.

1. Adherens junctions

Adhesive cell-cell coupling in all known forms of collective cell migration is mediated by Adherens-

junction proteins, including Cadherins and transmembrane proteins of the immunoglobulin superfamily.

During branching morphogenesis in the mammary gland, luminal epithelial cells within elongating ducts

elongate collectively while retaining E-cadherin along cell-cell interfaces (Ewald et al., 2008). In

carcinoma cells, loss of expression of E-cadherin, together with upregulation of N-cadherin and neural

9

cell adhesion molecules, results in the onset of collective migration in which cell-cell junctions are

retained; this process is often referred to as incomplete epithelial-mesenchymal transition (Lee et al.,

2006; Lehembre et al., 2008). Immunoglobulin family members, including activated leukocyte cell

adhesion molecule (ALCAM, also known as CD166) and L1 cell adhesion molecule (L1CAM), mediate

homophilic cell-cell interactions in cell-cell junctions and are upregulated in cohesively invading

melanoma (van Kempen et al., 2000) and colorectal carcinomas (Gavert et al., 2008; Weichert et al.,

2004). However, their role in collective cell dynamics still needs to be elucidated.

2. Desmosomes

Desmosomal proteins are markers of epithelial differentiation, and loss of their expression results in the

epithelial-mesenchymal transition during morphogenesis and cancer progression (Lee et al.,

2006;Chidgey and Dawson, 2007). During epidermal regeneration, migrating keratinocyte sheets retain

desmosomal cell-cell junctions while closing a wound (Shaw and Martin, 2009). In addition, there is

substantial evidence that membrane-localized desmosomal proteins are expressed during collective

migration in advanced epithelial cancer (Christiansen and Rajasekaran, 2006). Expression of

desmocollins 1 and 3, which are members of the desmosomal cadherin family, increases in invasion

regions of colorectal adenocarcinomas, as detected by immunohistochemistry (Khan et al., 2006), and this

is indicative of collective invasion. Squamous cell carcinomas of the skin retain functional desmosomes at

cell-cell junctions, which does not seem to prevent aggressive tumour behaviour or risk of metastasis

(Kurzen et al., 2003).

3. Cadherin

Cadherins or calcium dependent adhesion molecules are cell surface glycoproteins involved in Ca2+

-

dependent cell–cell hemophilic adhesion. They are required for both cell-cell adhesion as well as cell-

ECM adhesion. It is a large group of protein family classified into classical cadherins (subdivided into

type I and type II), protocadherins, and atypical cadherins (Fat, Dachsous, and Flamingo) on the basis of

number of calcium binding EC repeats. Characteristic EC repeats of the extracelluar domains of cadherin

regulate homophilic and heterophilic interactions during adhesion. Cadherin interacts with a variety of

molecules which modifiesCcadherin expression and adhesion activity by local regulation of the actin

cytoskeleton and diverse signaling pathways. Such diverse functioning of Cadherins is also facilitated by

their interactions with a wide range of cytoplasmic proteins, including cytoskeletal regulators, protein

kinases and phosphatases, and transcriptional cofactors (Halbleib and Nelson, 2006).

4. Integrins

Integrins are heterodimeric cell-surface receptors that are typically involved in cell-matrix interactions.

The function of integrins in cell-cell interactions is poorly understood, but recent data suggest that

integrins are also involved in formation of cell-cell contacts in collective cell migration. α5β1 integrin

interacts with fibronectin along interfaces between ovarian carcinoma cells (Casey et al., 2001) or

fibroblasts (Salmenpera et al., 2008), and blocking of β1-integrin function through the use of a function-

10

perturbing antibody in migrating multicellular melanoma clusters leads to loss of cell-cell cohesion

followed by cell detachment and the transition to amoeboid single-cell migration (Hegerfeldt et al., 2002).

A.4. Tight junctions

Tight junctions and tight-junction-related proteins (including claudins 1 and 4, occludin and zona

occludens 1; ZO-1) are present in many invasion zones of squamous cell carcinomas (Langbein et al.,

2003) as well as in melanomas in vitro, as detected by histopathological sections. ZO-1 colocalizes with

N-cadherin in homophilic junctions between melanoma cells and in heterophilic junctions between

melanoma cells and fibroblasts (Smalley et al., 2005), suggesting that expression of junction proteins

favours invasiveness of melanomas. Besides its function as a cell-adhesion molecule, the tight-junction

protein junctional adhesion molecule C (JAM-C) can lead to activation of β1 and β3 integrins and

promote collective migration of epithelial cancer cells across a 2D surface (Mandicourt et al., 2007).

A.5. Gap junctions

Gap junctions are present at cell-cell junctions in all epithelia and in most other cells, and mediate direct

intercellular metabolic coupling and signalling across the plasma membranes of neighbouring cells. In

many cancer cells, including melanoma and lung squamous cell carcinomas, the homotypic gap junctions

between cancer cells themselves and the heterotypic gap junctions between cancer cells and dermal

fibroblasts are mediated by connexins CX26 and CX43, respectively (Ito et al., 2006). Heterotypic gap-

junction formation depends additionally on cadherin-mediated cell-cell adhesion (Hsu et al., 2000), but

the role of connexins in supporting collective migration is unclear.

A.6. Role of pJNK

JNK promotes cell survival and proliferation on one hand and cell death on the other. For example,

Purkinje cells are refractory to the proautophagy JNK1 signaling pathway identified in nonneuronal cells.

The ability of JNK1 to suppress the expression of antiapoptotic genes, while JNK2 negatively regulates

the activity of genes related to tumor suppression and the induction of cell differentiation, apoptosis, or

cell growth, may reflect the distinct function of JNK isoforms in the skin. The unexpected contribution of

JNK in both tumor promotion and inhibition may reflect our little understanding of the role of JNK in the

tumor microenvironment. This idea rests on evidence that, in addition to controlling cell-autonomous

functions, JNK can drive the expression of cytokines that can act in a paracrine manner to sustain the

proliferation of cancer cells.

A.7. Role of FAS

The cell adhesion molecule Fasciclin III (FAS3) mediates synaptic target recognition through homophilic

interaction. FAS3 is expressed by the RP3 motoneuron and its target muscles during synaptic target

recognition. Fas3 is expressed during neurogenesis in a small subset of neural cells, and possibly also in

11

glial cells. Interestingly, the molecule is not present throughout the axon of single neurons, but only on

specific portions within the commissural fascicles (Patel, 1987).

After germ-band extention, Fas3 is expressed transiently on segmentally repeated patches of

neuroepithelial cells, and on specific, more mature neuronal lineages. FAS3 is also found on segmentally

repeated stripes of cells at the anterior margin of the segmental grooves. It is also expressed on patches

of epithelial cells near the stomodeal and proctodeal invaginations, on visceral but not somatic mesoderm,

and on the luminal surface of the salivary gland epithelium. By the end of germ band retraction Fas3 is

expressed in repeated stripes across all body segments (Patel, 1987). Fas3 is expressed by the growth

cones of several specific motoneurons, and is expressed as well on their peripheral muscle targets during

embryogenesis at the period when the first neuromuscular contacts are made (Halpern, 1991).

A.8. Role of Neurotactin (Nt)

Neurotactin (Nrt), a Drosophila transmembrane glycoprotein which is expressed in neuronal and

epithelial tissues during embryonic and larval stages, exhibits heterophilic adhesive properties. The

extracellular domain is composed of a catalytically inactive cholinesterase-like domain. A three-

dimensional model deduced from the crystal structure of Torpedo acetylcholinesterase has been

constructed for Nrt and suggests that its extracellular domain is composed of two sub-domains organized

around a gorge: an N-terminal region, whose three-dimensional structure is almost identical to that of

Torpedo Acetylcholinesterase, and a less conserved C-terminal region. By using truncated Nrt molecules

and a homotypic cell aggregation assay which involves a soluble ligand activity, it has been possible to

show that the adhesive function is localized in the N-terminal region of the extracellular domain

comprised between His347 and His482. The C-terminal region of the protein can be removed without

impairing Nrt adhesive properties, suggesting that the two subdomains are structurally independent.

A.9. Life cycle of Drosophila melanogaster:

Fig.1: Diagrammatic representation of life cycle of Drosophila melanogaster

12

Diagrammatic representation of life cycle of Drosophila melanogaster

Duration

(hours)

Days Developmental stages at 25o C

0 0 Fertilization and fusion of the pronuclei.

24 1 Hatching of 1st instar larva.

48 2 First moulting and emerge of 2nd

instar larva.

72 3 Second moulting and emerge of 3rd

instar larva.

120 5 Pupartum formation white whitepuparium.

122 6 Darkening of puparium.

124 7 Prepupalmoult.

132 8 Pupation and eversion of imaginal discs.

216-240 9-10 Emergence of the fly from the pupa.

Table 3:Life cycle of D. melanogaster

Embryonic stages of development in Drosophila melanogaster

Fig.2: Stage12, 13, 15 and 16 of Drosophila melanogaster embry

13

Table.3: Embryonic developmental stages.

B. Objective:

The membrane organizing capacity of Rab11, and also lgl, which is a potential Tumour Suppressor as

well as a polarity determining gene, whether or not synergise in epithelial morphogenesis of developing

embryos becomes a valid point of query. Here using the differentiating epithelium of Drosophila

embryos, we wish to find the following:

a) Do tumour suppressor mutants show defects in epitheliogenesis of developing embryos?

b) If yes, is there a difference in the spatio, temporal localization of Rab11 and downstream cell signaling

components in the mutants as compared to wild type?

c) Are these differences also associated with changes in the distribution of cell adhesion complexes and

titers of Rab11effectors which is evidently observed in tumour suppressor mutants?

14

C. Materials and methods

1. Fly Stocks

The fly stocks used during the period of analysis are:

Oregon R+ strain: This line was used as the wild type stock.

Lgl4/CyO Act 5C GFP: This is the line where homozygous individuals have extended larval life and are

pupal lethal. This line is balanced with CyO Act 5C GFP and the emerging adults have curly wings with

red eyes and express GFP ubiquitously.

2. Fly culture conditions

All Drosophila stocks were developed in milk bottles and plastic vials on standard medium containing

agar, maize powder, sugar and yeast at 22±1°C. Synchronized embryos were collected by starving the

flies for 1 hour and then allowed to lay eggs for 1 hours in egg laying chambers on Petri plates having

agar and sugar medium with yeast, but these eggs will non-synchronized hence they are discarded. In the

same setup they are allowed to lay egg for one more hour almost 90% of the embryos will be

synchronized. Now depending on the stages required for further analysis they are collected, i.e.; if we

want 9 hrs synchronized embryos then embryos are collected 9 hrs after the egg laying process has been

set.

3. Drosophila food:

The food is made by mixing following components:

Components Amount

Agar-agar 7g

Dried yeast 18g

Maize powder 51g

Brown sugar 45g

Nepagin (Methyl-phydroxy benzoate) 3g

Propionic acid 3ml

After adding all the components in definite proportion in a container make upto 1000ml by distiller water

and boil until all the components dissolve well. Then it was cooled to 65°C-70°C and finally poured into

the bottles.

15

4. Agar plates for egg laying and collection of synchronized embryos:

For collecting synchronized embryos, mandatory for time kinetic analysis, the flies were starved for 1 hrs

and were allowed to lay egg in egg chamber on petri plates for a period of 1 hours. All the embryos

hatched in this period are discarded and from then onwards, the embryos that hatched within a period of

one hour, were collected and screened for homozygosity of tumorous, which is balanced with GFP (in my

case balanced with cyo Act 5C GFP), and transferred in the tubes.

Components Amount

Distilled water 180ml

Sugar 7.5g

Agar 2.5g

Propionic acid 0.5ml

At first all the components except propionic acid were added and boiled until they get dissolved

completely and become partially transparent. Then the solutions were cooled to 60°C and then 0.5ml

propionic acid is added and finally poured to plates and allowed to solidify.

5. Synchronized larvae collection:

For collecting synchronized larvae, the flies were starved for 2 hours and were allowed to lay egg in egg

chamber on petri plates for a period of 24 hours. All the larvae that hatched at 24th hour were discarded

and from then onwards, the larvae that hatched within a period of one hour, were collected and transferred

to food plates.

6. Reagents

A. Composition of 10X PBS (500ml)

Component Amount

NaCl 40.0g

KCl 1.0g

Na2HPO4 7.2g

KH2PO4 1.2g

All the components were dissolved in 400ml distiller water and then pH of the solution was adjusted to

7.4 by using dilute HCl/NaOH pellet. Finally the volume of the solution is made up to 500ml by adding

distilled water.

B. 4% PFA (Paraformaldehyde)

0.4g of PFA was added to 10ml of 1X PBS and incubated at 60°C until it dissolves completely.

16

C. Triton X-100

D. 1% PBST

In 10ml of 1X PBS 100µl of Triton X-100 added and allowed to dissolve completely at room

temperature.

E. 0.1% PBST

In 10ml of 1%PBST 90ml of of distiller water is added and vortexed well for proper mixing.

F. Blocking solutions

0.1% Triton X, 0.1% BSA, 1%FCS, 0.1% De-oxycholic acid, 0.02% thiomersal and final volume made

by 1X PBS.

G. Antibodies

(i) Primary antibodies

(1) Anti Neurotactin: Raised in mouse against Drosophila neurotactin and marks the neuroepithelial

cells on their membranes. It is conspicuously seen in the membrane of the cells of CNS and PNS. The

working concentration is 1:50.

(2) Anti Fasciclin III: Raised in mouse against Drosophila fasciclin protein and is a tight junction

marker. It localizes exclusively on the membranes of the ectodermal epithelial cells. The working dilution

is 1:2, and it is stored at -20°C.

(3) Anti pJNK (c-Jun N-Terminal Kinase): Detects phosphorylated JNK or Basket, which is the activated

form of the same. It is raised in rabbit against Drosophila pJNK. The working dilution is 1:100 and it

shows a punctate cytoplasmic distribution in wild type conditions.

(ii) Secondary antibodies

AF488 conjugated goat anti-mouse IgG: This antibody recognizes primary antibody raised in mouse

and the dilution factor is 1:200.

AF488 conjugated goat anti-rabbit IgG: This antibody recognizes primary antibodies raised in rabbit

and the working dilution factor is 1:200

17

H. DAPI (4,6 diamidino-2 phenylindoledihydrochloide, Sigma, USA)

It is a fluorescent stain used to stain the DNA of both live and fixed cells. It is used to localize nucleus

during immunostaining. Working dilution of DAPI is 1µg/ml. It has absorbance maxima at 350nm and

emission maxima at 470nm.

I. DABCO (Sigma, USA)

DABCO or 1,4-diazobicyclo-(2,2,2)-octane was used as a mounting medium during immunostaining. It is

an anti fade agent prepared by dissolving 2.5% DABCO in 70% glycerol.

J. Gradient methanol

For 90% methanol 10µl of absolute methanol is mixed with 90µl of distilled water and similarly 70%,

50%, 30% and 10% methanol is prepared. It is used to rehydrate embryos, so that all the proteins which

got deactivated during mounting gets activated.

K. Homogenizers

It is used to homogenize embryos and larvae for RNA isolation. They are kept in absolute methanol at

room temperature for 45-60 minutes and the mouth of the beaker is covered with aluminum foil as

methanol is highly volatile substance. It’s done because all enzymes get deactivated including RNases,

which hinders the process of RNA isolation by degrading them.

7. Cuticle Preparation

Flies were put into egg-laying cages sealed with with agar plates and incubated at 25°C in the dark.

Collection plates were changed when 50–100 eggs have been laid. For wild-type or viable larvae,

embryos were allowed to age for 24h at 25°C. Larvae were recovered before they hatch because crawling

larvae will have yeast in the digestive track and this can spoil the preparations. For preparations of larvae

carrying a lethal genetic combination, collect the unhatched embryos from a 24–36h old plateThe

unhatched embryos were removed from the periphery of the plate using a fine paint brush which has been

cut to create stiffer bristles. The embryos were placed in a small tube and washed thoroughly with

distilled water to remove yeast paste. Embryos were dechorionated s in a bleaching solution, Sodium

Hypochlorite for 3-5min. The embryos were washed well with 0.1% PBST containing triton-X and then

washed with distilled water. The embryos were fixed in a solution containing n-heptane and PFA in the

ratio 1:1 and kept on a shaker for 20-25min.

The solution was now removed and n-heptane and absolute methanol were added in equal amount and

pipetted vigorously to de-vitellizee the embryos, remove the non-devitellized embryos and empty vitelline

18

membrane float at the interface of the two liquids. The supernatant was removed and absolute methanol

was added and at this stage embryos could be stored for an infinite period.

The methanol was removed and fixative i.e. glycerol and acetic acid in the ratio 1:4 and incubate at room

temperature for 15-20 min. 25 µl Hoyer's mountant was placed at the center of a microscope slide. a small

number of cuticles were transferred from the basket into the mountant using the stiffbristled paint brush.

A 22mm square no. 1 coverslip was placed over the drop of Hoyer's and allowed to completely settle.

Capillary action will draw the mountant to the edge of the coverslip. The minimum amount of Hoyer's

should be used so that none is squeezed out at the edges.

The slide was transferred to a 60oC oven and a 10 g weight was gently placed in the center of the

coverslip. Incubate at 60°C for 1-2 days at 60°C. The additional weight produces flatter preps but should

not be added too soon in order to avoid popping the cuticles.

The cuticles were viewed under dark field to see the overall cuticle pattern and to observe gross changes

(e.g. missing segments). Phase contrast microscopy can be used to observe subtle details (e.g. ventral pits,

Keilin's sense organs).

8. Immunostaining:

Overnight egg laying of the desired fly stocks were set on standard agar plates. Eggs were collected after

12-15h of egg laying. These egges (with developing embryos inside), were washed, dechorionated via

bleaching using sodium hypochlorite, fixed in 4% PFA and n-heptane and then devitellised using n-

heptane and methanol. The dechorionated and de-vitellised eggs were fixed in methanol and then

rehydrated in gradient methanol (90%, 70%, 50% and 30%), followed by successive washes in 1X PBS

for 10 min thrice. Embryos were then blocked with blocking solution followed by overnight primary

antibody treatment. Next day three consecutive washings were appended to the tissues for 5 min each

time with 0.1% PBST. The tissues were blocked for 2h and then treated with secondary antibody for 2h or

overnight. The tissues were washed with 0.1% PBST thrice, counter stained with DAPI, again washed

and finally mounted in DABCO. Mounted tissues were examined at 40X magnification under the

confocal microscope and images were analyzed by LSM image browser.

9. Treatment of plastic wares

10 Liter of 0.1% SDS solution was prepared. All the plastic wares like tip boxes, measuring cylinders, etc

were dipper in the solution and kept overnight. Next day all the plastic wares were washed with tap water

and again dipper in 0.1% SDS solution in a bucket and kept under running tap water overnight. The

following day the plastic wares were rinsed with distiller water and kept in a oven to dry, at last they are

autoclaved at 15lb/sq. inch for 1h.

19

10. Treatment of microfuge tubes, tips and PCR tubes

0.1% DEPC water was prepared in a glass beaker and all glasses and plastic wares were dipped in the

solution, the beaker was covered with aluminium foil and kept overnight. Following day the DEPC was

vaporized from the water by boiling. The beaker was kept in the oven for drying and the content were

then autoclaved at 15lb/sq. inch for 2h.

11. Isolation of RNA from the embryos

Embryos were homogenized inn 400µl TRIzol (Sigma Adirich, USA) and the volume was made upto

100µl with TRIzol. The samples were left at room temperature for 10-12min, for the nucleoproteins to get

dissociated, following that 200µl of chloroform is added and sample was vigorously shaken and kept at

room temperature for 10-15min. The samples were then centrifuged at 12,000 rpm for 15min at 4°C. 200-

400µl of upper aqueous phase is collected in a fresh centrifuge tubes and 500µl of isopropanol is added

and gently mixed by inverting the tubes and the samples are kept undisturbed at room temperature for 20

min. Subsequently the samples were centrifuges at 12,000 rpm for 15 min at 4°C for the RNA o pellet

down. The pellets were washed with 70% ethanol and centrifuges at 12,000 rpm for 5 min at 4°C. Finally

the pellets were allowed to dry and later DEPC treated 12µl MQ water is added. 1µl of dissolved RNA is

used to run the gel and verify validates the process.

12. DNase treatment to remove DNA contamination

Samples were treated with DNaseI to remove DNA contamination and kept at 37°C water bath for 2-4h,

later 2µl EDTA is added and heat shock is given leading to achievement of pure RNA, which can be

stored for infinite period of time at -70°C.

4. Reverse transcription- Polymerase chain reaction (RT-PCR)

Preparation of cDNA by reverse transcription

To the 11.5µl sample of RNA, 1µl of random hexamer is added followed by incubating at 65°C for 5 min.

Then it was immediately chilled in ice. A master mix of 4µl 5X reverse transcription buffer, 1µl of

Reverse Transcription enzyme, 0.5µl of ribolock RNase inhibitor and 2µl dNTP(2mM) were aprepared

and added the sample in the ice. The reaction was carried out in ABI Thermo cycler.

Cycling conditions

25°C 10’

42°C 60’

60°C 10’

10°C ∞

20

Monitoring efficiency of DNase treatment and Quantification of cDNA

Efficiency of the DNase treatment of the RNA sample and quantification of the cDNA prepared from it

by reverse transcription can both be achieved by selectively checking the expression of a housekeeping

gene. For this purpose, primers for the gene, G3PDH (glycerol-3- phosphate dehydrogenase)were used

and and a polymerase chain reaction was set for all cDNA samples. The presence of contaminating DNA

can be detected by running the product of the PCR on aa agarose gel, and at the same time, the cDNA can

be normalized by using Adobe photoshop 7.0 histogram feature measuring the band intensities and

thereby calculating the equal amount of DNA to be used for each PCR reaction.

The reaction mixture (25µl volume per reaction) was prepared as follow:

DEPC MQ water 16.8µl

10mM dNTPs 4.0 µl

10X buffer 2.5 µl

Taq polymerase 0.1 µl

Forward primer (25pmol/ µl) 0.4 µl

Reverse primer (25pmol/ µl) 0.4 µl

cDNA 1.0 µl

Total 25.0 µl

Cycling Condition

Primers used to check the RNA levels are: Dpp, Puckered and G3PDH

Appropriate primers, spanning the exon-inton-exon territory common to all transcripts of the gene, were

designed with the help of Primer 3 plus software and Primer blast software (offer by NCBI website). All

the primers were checked in the FlyBase with the BLAST software offered there. Primers which give a

single hit after running on UCSC are taken for further studies.

Initial denaturation 94°C 3’

Cyclic denturation 94°C 30”

Primer annealing 60°C 30”

Extension 72°C 45”

Final Extension 72°C 7’

Storage 4°C ∞

X 30 Cycles

21

Details of the Primers used

Gene Primer Sequence Annealing

temperature

Amplicon

Size (for

cDNA)

Dpp

Dpp_RT_F

Dpp_RT_R

GCTACCAGGTGCTTGTCTACG

GTCTTGGTGTCCAACAGCAG

60°C

85bp

Puc Puc_F TACAAGTCGCTCTCCCTGCT

GGGTGCTTAATCCCACAGAA

60°C 196bp

G3PDH

G3PDH_F

G3PDH_R

CCACTGCCGAGGAGGTCAACTA

GCTCAGGGTGATTGCGTATGCA

60°C

144bp

Table.4: Primer details

Polymerase Chain Reaction

Firstly, the appropriate annealing temperature for each primer pair was standardized. The annealing

temperature at which reactions were performed was 60°C.

The reaction mixture was prepared as follows:

Autoclaved MQ water According to normalization

10mM dNTPs 4.0 µl

10X buffer 2.5 µl

Taq polymerase 0.1 µl

Forward primer (25pmol/ µl) 0.4 µl

Reverse primer (25pmol/ µl) 0.4 µl

cDNA According to normalization

Total 25.0 µl

22

The following program was run on the thermo cycler

The products were resolved on 2% agarose gel and their sizes were verified by running a 50bp ladder.

Gel Documentation

All the images were captured with the help GeneSnap Gel Documentation System and the images were

analyzed and assembled using Adobe Photoshop 7.0

Initial denaturation 94°C 3’

Cyclic denturation 94°C 30”

Primer annealing 60°C 30”

Extension 72°C 45”

Final Extension 72°C 7’

Storage 4°C ∞

X 30 Cycles

23

D. Results and discussion:

The following approaches were adopted for the analysis of the roles of tumour suppressor genes in

embryonic development:

a. Cuticle preparations of developing embryos:

This technique is a classical and a robust technique which facilitates the analysis of epithelial

morphogenesis in Drosophila. The cuticle secreted is an identical replica of the epidermal tissue of the

organism, which is formed after a series of developmental and differentiation events.

b. Immunostaining and immunofluorescence :

A technique in which the spatio-temporal organization of proteins within the cells of a tissue can be

monitored using fluorescence or confocal microscopic technique. In this technique we use fluorescence

labelled antibodies to detect the protein concerned to analyze its spatio-temporal localization within a cell,

which could also justify its functional relevance.

c. Semi-Quantitative RT-PCR:

This technique is used for the quantitative analysis of gene expression at the transcriptional level. Here

the net titer of RNA transcribed from any locus can be measured indirectly by at first synthesizing cDNA

from the spliced mRNA via RT (Reverse Transcription), and then amplifying the desired cDNA using

exon specific primers of the gene under study via PCR. The amplicon amount may be quantitated by the

measurement of its corresponding band intensity when observed over a trans-illuminator or else it can

also be spectrophotometrically determined. The measurements obtained directly yield an idea about the

initial rate of transcription of the gene under consideration. However, equalizing the initial amount of

cDNA used for the amplification of the same gene in different experimental and control samples, is a

mandatory step in the above procedure, a process often referred as “Normalization”.

Here, larval tissue samples obtained from different time points of development have been used for the

quantification of the expression levels of some developmentally active genes in order to detect changes in

them during the course of tumorigenesis.

The rearrangement of cell junctional complexes is a critical step for cancers in order to spread and

disseminate. This process is also known as epithelial to mesenchymal transition. A loss or gain of these

junctional complexes results into the spatio-temporal re-shuffling of the downstream signaling complexes

which may ultimately result in cell death. Here we wish to probe deep into spatio-temporal dynamics of

the tight junction proteins along with activated JNK (c Jun –N- terminal Kinase) under different

backgrounds of tumor suppressor mutations in developing embryonic epidermis. Using embryonic

epidermis as a model for studying effects of tumor suppressor mutations seems to be appropriate, as they

show features of an epithelium like cell proliferation, metastasis, contact inhibition etc.

Here we observed the localization of activated JNK and an epithelial tight junction marker FasIII under

wild type and mutant conditions. We observed that these molecules perfectly co-localize which otherwise

under tumorigenic background s show an aberrant distribution.

24

Fig.3: Confocal sections of wild type embryos showing the distribution of pJNK (green) and FasIII

(Red).Panels (A-D) represent the distributions of pJNK and fasIII in the lateral epidermis of the Wild type

embryos. Note that there exists a perfect overlap of their expression in these cells. E-H represent

magnified view of the same.

Since lgl and Scribble mutants are basically associated with carcinomas of epithelial tissues hence we

were interested to observe the defects in the pJNK localization pattern with FasIII which is a marker of

epithelial tight junctions.

Fig.4: Confocal sections of stage 13 embryos showing the spatio-temporal localization of pJNK and

FasIII in lgl4

homozygotes. (A-D) show the irregularities and the disruptions brought about in the pJNK

and FasIII expression patterns in the lateral epidermis. (E-H) magnified image of the same.

25

Fig.5: Confocal sections of stage 13 embryos showing the spatio-temporal localization of pJNK and

FasIII in scribM101968

homozygotes. (A-D) show the irregularities and the disruptions brought about in the

pJNK and FasIII expression patterns in the lateral epidermis. (E-H) magnified image of the same.

Although the above explains that pJNK localization depend upon the integrity of the tight junctions, yet in

the above the neuro epithelium goes un-noticed. Therefore to ensure whether the above is also true for the

neuro-ectoderm and brain related tumor suppressors, we observed another neuro=epithelailtight junction

marker i.e. Neurotactin which was co-stained with pJNK. The general profile of both the molecules is as

follows:

26

Fig.6: Confocal sections showing the gradual parts of the PNS and the CNS as stained with Neurotactin

(Red). Note the co-localization of pJNK with neurotaction in all the tissues. Sections are as follows: (A-

D) Tracheal and lateral neurons. (E-H) Dorsal nerve plexi and ganglion. (I-L) Dorsal nerve net and (M-P)

the ventral nerve chord and the brain lobe.

27

Fig.7: Confocal sections of the Ventral Nerve Chord showing neuro-epithelial cells in Wild Type (A-D)

and Brat homozygous loss of function mutants (E-H). The expression of pJNK is much more regular in

the Wild type neuro-epithelium is much more regular as compared to the Brat LOF mutants. The

expression of Neurotactin also goes down in these cells as compared to the wild type. This could be a

probable cause of the death observed in the Brat14/Brat14 homozygous mutants.

Fig.8: Cuticles preparations of 22-24 hours developed embryos of lgl4/lgl

4 (Right) and of wild type,

Oregon R+

(Left) showing distinct characteristics features and morphogenetic defects in the lgl4/lgl4

28

Fig.9: Transcript level of different genes at different hours in 3rd

instar larvae of ActinGal4>>lglRNAi

and Scrib/Scrib.

A semi quantitative RT PCR was performed for the above depicted genes in order to find out a putative

pathway which could be a possible target of Rab11 and Dlg upregulation in lgl and scribble mediated

tumour background.

Glyceraldehyde-3-Phosphate dehydrogenase (G3PDH) transcript level was used as an internal control

to normalize the quantity of cDNA to be loaded for each gene sample.

Expression analyses of different gene samples of the genotype Actin-Gal4>>lglRNAi, Scrib/Scrib with

type third instar larvae as internal control, was done at the following time points: 192h, 264h, 288h, 312h,

120h spiracle everted third instar larvae were used as a positive control.

Expression analysis of cell signaling components like puckered (a downstream target of pJNK) and TGFβ

(Dpp), which play a critical role in tumour progression and metastasis seem to be upreglated under the

different genetic background differentially. Dpp was found to be uniformly upregulated in both the

tumourogenic background whereas on the other hand Puckered, a negative regulator of pJNK was found

to be elevated in the lglRNAi background, which could on one hand prevent JNK mediated Apoptosis and

promote MET in the metastatic cells.

Discussion:

Epithelial integrity plays a key role in the tumour progression as well as in the development. It depends

on the cell-cell interaction and cell signaling potential, in this tight junction and pJNK play a crucial role.

They show uniform display in ectodermal epithelium and neuroepithelium via co-localizatio with

activated JNK.

29

Such kind of uniform distribution is deficient in tumour background during the developmental stages such

as in Brat14

, scribble and lgl4

homozygous. This conclusion is confirmed using tight junction markers of

ectoderm (FasIII) and neuro-epithelium (Neurotactin,Nt).

Activated pJNK localization depends on the integrity of the tight junction complexes, which is absent in

the tumourous background. Results seen are tumor suppressor mutation shows coincidence in Rab11 loss

of function mutatnt. This could play crucial role integrity of pJNK with the epithelial markers.

Effect of JNK and Dpp pathways is confirmed by RT-PCR which shows that Expression cell signaling

components like puckered (a downstream target of pJNK) and TGFβ (Dpp), which play a critical role in

tumour progression and metastasis seem to be upreglated under the different genetic background

differentially.

E. References

1. Albert B, Johnson A, Lewis J, Raff M, Roberts K, Walter P (2002) Molecular biology of cells, 4th Edition

(Garland Science).

2. Aridor M and Traub L M (2002) Cargo selection in vesicular transport: the making and breaking a coat.

Traffick 3, 537-436.

3. Role of Rab GTPases in Membrane Traffic and Cell Physiology, ALEX H. HUTAGALUNG AND

PETER J. NOVICK, Department of Cellular and Molecular Medicine, University of California, San

Diego, La Jolla, California.

4. Ali B, Seabra M. Targeting of Rab GTPases to cellular membranes. Biochem Soc Trans 33: 652–656,

2005.

5. Bonifacino J S and Glick B S (2004) The mechanism of vesicle budding and fusion. Cell 116, 153-166.

6. Zerial, M. and McBride, H. (2001) Rab proteins as membrane organizers. Nat. Rev. Mol. Cell Biol. 2,

107–117

7. Stenmark, H. and Olkkonen, V.M. (2001) The Rab GTPase family. Genome Biol. 2, REVIEWS3007

8. Mammoto, A., Ohtsuka, T., Hotta, I., Sasaki, T. and Takai, Y. (1999) Rab11BP/Rabphilin-11, a

downstream target of rab11 small G protein implicated in vesicle recycling. J. Biol. Chem. 274, 25517–

25524

9. Wallace, D.M., Lindsay, A.J., Hendrick, A.G. and McCaffrey, M.W. (2002) The novel Rab11-

FIP/Rip/RCP family of proteins displays extensive homo- and hetero-interacting abilities. Biochem.

Biophys. Res. Commun.292, 909–915

10. Zerial M, and McBride H (2001) Rab proteins as membrane organizers. Nature review of Mol Cell Biol 2,

107-117.

11. Bianka L. Grosshans, Darinel Ortiz, and Peter Novick, Department of Cell Biology, Yale University

School of Medicine, New Haven, CT 06520, Edited by William T. Wickner, Dartmouth Medical School,

Hanover, NH, and approved June 21, 2006, Rabs and their effectors: Achieving specificity in membrane

traffic (received for review February 27, 2006)

12. Geli, M. I. & Riezman, H. (1998) J. Cell Sci. 111, 1031–1037.

13. Assemat E, Bazellieres E, Pocachard E P, Bivic A L and Harroche D M (2008) Polarity complex

proteins. Biochim Biophys Acta 1778, 614-630.

30

14. Chiba H, Osanai M, Murata M, Kojima T and Sawada N (2008) Transmembrane proteins of tight

junction. Biochim Biophys Acta 1778, 588-600. Davis R J (2000) Signal transduction by the JNK group of

MAP kinases. Cell 103, 239-252.

15. Du D, Xu F, Yu L, Zhang C, Lu X, Yuan H, Huang Q, Zhang F, Bao H, Jia L, Wu X, Zhu X, Zhang X

and Chen Z (2010) The tight junction protein, occludin, regulates the directional migration of epithelial

Cells. Devel Cell 18, 52-63.

16. Ebnet K, Aurrund-Lions A, Kuhn A, Kiefer F, Butz S, Zender K, Meyer zuBrickwedde M K, Suzuki A,

Imhof B A, Vestweber D (2003) The junctional adhesion molecule (JAM) family members JAM-2 and

JAM-3 associate with the cell polarity protein PAR-3: a possible role for JAMs in endothelial cell

polarity, J Cell Sci 116, 3879–3891.

17. Ebnet K, Suzuki A, Horikoshi Y, Hirose T, Meyer ZuBrickwedde M K, Ohno S, Vestweber D (2001) The

cell polarity protein ASIP/PAR-3 directly associates with junctional adhesion molecule (JAM), Eur J Mol

Biol 20, 3738–3748.

18. Friedl P and Gilmour D (2009) Collective cell migration in morphogenesis, regeneration and cancer. Nat

Rev Cell and Mol Biol 10, 445-457.

19. Friedl P and Katrina W (2009) Plasticity of cell migration: a multiscale tuning model. J Cell Biol 188,

11-19.

20. Furuse M and Tsukitas (2006) Claudins in occluding junctions of humans and flies, Trends Cell Biol 16,

181–188.

21. Furuse M, Itoh M, Hirase T, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S (1994) Direct association of

occludin with ZO-1 and its possible involvement in the localization of occludin at tight junctions, J Cell

Biol 127, 1617–1626.

22. Halbleib J M and Nelson W J (2006) Cadherins in development: cell adhesion, sorting, and tissue

morphogenesis. Genes Dev 20, 3199-3214.

23. Harden N, Ricos M, Yee K, Sanny J, Langmann C, Yu H, Chia W, Lim L (2002) Drac1 and Crumbs

participate in amnioserosa morphogenesis during dorsal closure in Drosophila. J Cell Sci 115, 2119–

2129.

24. Henrique D and Schweisguth F (2003) Cell polarity: the ups and downs of the Par6/aPKC complex. Curr

Opin Genet Dev 13, 341-350.

25. Inoue H, Ha V L, Prekeris R and Randazzo P A (2008) ArfGTPase-activating protein ASAP1 interacts

with Rab11 effector FIP3 and regulates pericentrosomal localization of transferrin receptor-positive

recycling endosome. Mol Biol Cell 19, 4224-4237.

26. Junutula R J, Schonteich R, Wilson G M, Peden A A, Scheller R H and Prekeris R Molecular

characterization of Rab11 interactions with members of the family of Rab11-interacting proteins. J Biol

Chem 279, 33430-33437.

27. Khalil A A and Friedl P (2010) Determinants of leader cells in collective cell migration. Integrative Biol

2, 568-574.

28. Lee J M, Dedhar S, Kalluri R and Thompson E W (2006) The epithelial-mesenchymal transition: new

insights in signaling development, and disease. J Cell Biol 172, 973-981.

29. Liu J, Li J, Ren U and Liu P (2014) DLG5 in cell polarity maintenance cancer development. Int J Biol Sci

10. 543-549.

30. Llina O and Friedl P (2009) Mechanisms of collective cell migration at a glance. J Cell Sci 122, 3203-

3208.