identification and characterization of a rapd-pcr marker ... · used rapd-pcr to identify a dna...

Insect Molecular Biology (1996) 5(2), 81-91

In 1991 gypsy moths originating in Asia were dis-covered on ships attempting to enter ports in thePacific Northwest (Gibbons, 1992; Wood, 1994; Mudgeet al., 1994). The Asian gypsy moth differs from theNorth American population in having a larger range ofpreferred host trees, including economically-impor-tant conifers. In addition, the Asian strain may becapable of more rapid migration than the North Amer-ican strain, because the Asian females are capable offlight (Wallner et al., 1994), whereas North Americanfemales are flightless. For these reasons, the decisionhas been made to attempt to eradicate known Asianinfestations in the United States.

The native range of the gypsy moth extends acrossEurasia and North Africa. The highest levels of mor-phological and developmental variation have beendescribed in the far eastern regions of the range,especially Japan (Goldschmidt, 1940; Harrison et al.,1983), and it is possible that the species arose thereand spread westward. Similar patterns of variationhave been found j.Jsing isozyme (Harrison et al., 1983)and mitochondrial restriction site polymorphism (Bog-danowicz et al., 1993) analyses.

An extensive study by Goldschmidt (1940) showedthat some Asian/European crosses resulted in partialor full sex reversals, although Clarke & Ford (1980)were unable to reproduce these findings to the sameextent. A recent cytogenetic study has found evidenceof abnormal meiosis in testes of Asian/North Amer-ican F1 hybrid males (Krider & Shields, 1994). Never-theless, moths from far eastern Asia and Europe arefrequently capable of hybridization under laboratoryconditions (Keena, 1994a, b). When these hybrids areevaluated for such traits as diapause chill require-ments, larval colour, adult size, and female flightcapability, the hybrids are usually intermediatebetween the Asian and North American forms, or elsetend to more closely resemble the Asian parent.Because the characteristics of further generations ofAsian/North American hybrids outside of the labora-tory cannot be predicted, the presence of hybrids inNorth America is a cause for concern.

Identification and characterization of a RAPD-PCRmarker for distinguishing Asian and North Americangypsy moths

K. J. Garner and J. M. Siavicek

USDA Forest Service, Northeastern Forest ExperimentStation, Delaware, Ohio, USA

Abstract

The recent introduction of the Asian gypsy moth(Lymantria dispar L.) into North America has necessi-tated the development of genetic markers to distin-guish Asian moths from the established NorthAmerican population, which originated in Europe. Weused RAPD-PCR to identify a DNA length polymorph-ism that is diagnostic for the two moth strains. Thepolymorphism maps to an autosomal locus with codo-minant Mendelian inheritance. DNA sequence ana-lyses of the Asian and North American forms enableddevelopment of locus-specific primers so that thismarker, designated FS-1, will be useful for strainidentification under varying conditions in differentlaboratories.

Keywords: gypsy moth, Lymantria dispar, RAPD-PCR,sequence-characterized amplified region (SCAR).

Introduction

Gypsy moths originating in Europe were accidentallyreleased in Massachusetts in 1869 (Forbush &Fernald, 1896) and have spread throughout NewEngland. Adjacent areas of Canada have also beenaffected. The leading edge of the infestation is now inMaine, Michigan, Ohio, North Carolina, Virginia, andWest Virginia, and isolated outbreaks have beenfound in almost every state in continental USA (USDAForest Service, 1995). Although efforts are being madeto slow the spread of the infestation, and to reducedefoliation at outbreak sites, the North Americangypsy moth is considered to be too well established toeradicate.

Received 8 August 1995; accepted 9 October 1995. Correspondence: DrJames M. Siavicek, USDA Forest Service. Northeastern Forest ExperimentStation. 359 Main Road, Delaware, OH 43015, USA.

© 1996 Blackwell Science LId 81

82 K. J. Garner and J. M. Slavicek

Gypsy moth populations are monitored by trappingmale adults in pheromone-baited sticky traps. Mor-phological differences between Asian and NorthAmerican moths are slight and identification of Asianmoths can be difficult, especially if the specimen isdamaged. Asian and North American larvae possessdifferences in body coloration (Keena, 1994a, b) andcan be identified on the basis of head capsule colora-tion (Wallner et al., 1995). However, the larvae are notsubject to pheromone trapping at low population den-sities, as are the male adults. In order to identifytrapped male moths, DNA markers that can be usedon poorly-preserved samples or tissue fragmentshave been sought. Mitochondrial DNA markers for theAsian and North American strains are presently beingused to identify trapped moths (Bogdanowicz et al.,1993). However, because of the maternal inheritanceof mitochondrial DNA, these markers identify only thegenotype of the maternal parent in the case of a hybridmoth. Therefore additional markers representingnuclear DNA have been sought.

Because little genetic information is available forthe gypsy moth, we used random amplification ofpolymorphic DNA by the polymerase chain reaction(RAPD-PCR) to look for fixed DNA polymorphismsbetween the genomes of the two moth strains. RAPD-PCR is a technique that uses short oligonucleotideprimers and non-stringent reaction conditions toamplify multiple DNA fragments from a genomic DNAsample (Williams et al., 1991). The amplified DNAfragments are frequently polymorphic and can beused as markers for genetic mapping and as indica-tors for species, strains or populations of organismsunder circumstances where the markers are deter-mined to be heritable traits. RAPD-PCR markers havebeen used to distinguish strains of bacteria (Scieux etal., 1993), populations of nematodes (Folkertsma etal., 1994) and species and populations of insects(Edwards & Hoy, 1993; Gawel & Bartlett, 1993; Puterkaet al., 1993; Roehrdanz et al., 1993; Favia et al., 1994).RAPD-PCR has also been used to assess geneticvariability in German gypsy moths, although markersfor regional populations have not been defined(Graser et al., 1995).

We tested 222 decanucleotide primers in search ofdiagnostic markers for Asian and North Americangypsy moths. In general, the two strains are similarwhen analysed using this method; however, one DNAlength polymorphism has been found that distin-guishes the two strains with a high degree of accu-racy. We cloned and sequenced the amplifieddiagnostic DNA regions in both Asian and North Amer-ican moths and developed locus-specific primers thatsuccessfully amplify this region in crude DNA extracts

of moth tissue. Markers of this type have beenreferred to as 'sequence-characterized ampl ifiedregions' or SCARs (Paran & Michelmore, 1993). Thismarker should be useful in the identification oftrapped adult insect specimens as well as other lifestages including eggs.

Results

Screening of RAPO PCR primers

Decanucleotide primers were initially tested on asmall set of gypsy moth DNA samples in order to findprimers that amplified markers specific for one or theother population. In general it appears that the twopopulations are not well differentiated genetically,because most primers amplify bands common to bothpopulations.

Twenty primers were selected for a band-sharinganalysis of fifteen Asian and nine North Americanmoths. A sample result is shown in Fig. 1. A total of322 RAPD bands were scored, including all but veryweak ones. Of these, twenty-four were present in allindividuals, 168 were present in one or more indivi-duals of both strains, and 128 were found in some butnot all individuals of one strain. Only two fragmentswere seen in all individuals of one (North American)but not the other strain within this primer set. Pairwisedistances between individuals were calculated bydividing the number of differing bands by the totalnumber of bands scored. The average pairwise dis-tance within the Asian population is 0.26; the averagedistance between Asian and North American moths is0.27; and the average distance within the North Amer-ican population is 0.16.

Of 222 RAPD-PCR primers tested, seventeen (7.7%)initially appeared to amplify Asian or North Americandiagnostic fragments. However, ten failed to be strain-specific when larger numbers of samples were tested(data not shown). Seven of the remaining markerfragments were cloned and sequenced and locus-specific primers were selected. However, four ofthese primer sets failed to amplify the expected band,and two amplified the same band in both Asian andNorth American samples (data not shown).

One primer, OPD-02, consistently amplified anapproximately 700 basepair fragment in Asian mothsand an approximately 590 basepair fragment in NorthAmerican moths (Fig. 2A). This primer also amplifiedother fragments; however, these were not diagnosticfor either strain.

Characterization of the diagnostic fragments amplified byprimer OPO-02

In order to develop locus-specific primers, the Asian

© 1996 Blackwell Science Ltd, Insect Molecular Biology 5: 81-91

KB M 13.0-

2 3 4 567 8 9 1011121314

A RAPD·PCRmarker for Asian and North American gypsy moths 83

M 2 3 4 5 6 7 8 M 9 10 11 12 13 14 15 16 M 17 18 19 20 21 22 23 24 M

1.7·

KB

1.1-

0.5-

0.3-

Figure 1. Example of RAPD-PCR band analysis, RAPD-PCR products generated from Asian and North American gypsy moth DNA using primer UBC 108,Lanes 1-15, Asian moths from eastern Russia, Lanes 16-24, North American moths from NJ (16 and 17), PA (18), MA (19 and 20), WV (21), OH (22), and MI (23 and24), Lanes labelled 'M' contain a molecular weight marker (lambda phage DNA digested with Ps~),

1.0-

~N

2.0-1.6-

A·0.5-

A

KB M 13.0-

2 3 4 5 6 7 8 9 10 11 12 1314

2.0-1.6-

Figure 2. Detection of gypsy moth strain-specificmarkers using primer OPD-02, (A) RAPD-PCRproducts generated from Asian and North Americangypsy moth DNA using primer OPD-02, Lanes 1-5,Asian moth DNA; lanes 6-12, North American mothDNA; lanes 13 and 14, DNA-minus controls; lane M,molecular weight marker (1 kb ladder, Gibco BRL),Asian and North American marker bands areindicated by arrows, (B) Hybridization of clonedOPD-02700 DNA to a Southern blot of the gel shown in(A), ASian and North American marker bands areindicated by arrows,

1.0-

0.5-••••• #~

_.-. __ •••• iSI# ~NA.

•

B


.:::.:U3;:::3:...- ~>~U2~9~ >


A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

A696-01A696-78A696-97N591-06N591-78N591-97

U22 > 90GGACCCMCC CGTCTGATCA GTATGGTATA GCGGATGGTG GGTGTCGTTA AGGACGTTTA AMTGTATAT MCATCMTG TCAGAGAMG..................... c. ...................... c. A •• A •••.•••••••••••••••••••••••••••.••••••••••••••••••••••••••••••••••••• G ••••••••••••••••••• A ••••••••••••••••• C ---------- ----------. . . . . . . . .. .G. . . . . . .. .A........ . C ---------- ----------••••••••••••••••••••••••••••••• G ••••••••••••••••••• A ••••••••••••••••• C ---------- ----------

180AAAACTCMC ATAMGTATG CCMCTCGTC TGACCAGCTT GATATAGTAG GTCMTTGCT ACCCCATTAT GGMGGAGGT TCMGGGCAG•••••••••••••••••••••••••••••••• G •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••...•••.••••.•••••••••..••• A ••••••..•...••.•••••••••••.••.•••••••••••••.•••••••••••••••••---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -----A .---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -----A .---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -----A .

270CACTGAGACA GAGATTGMC TGTGATCATG MTTATCAGG ATCAGATGM TCTMMCM ATACCTMCC MAMTTGGA ATAMCTMT

T •..•••.••T •••.••.••T .••.••.••

.... c. ....

"'------'" L325 360

TTTACGGTM TTTTMGGCT MTMTCATA ATTCATMGC AMTTATTCC ACMCATCTA ATCATCMCC MCCGCCTCA MCMCAGM••.. T ••.•••••.••••••••...••••••••..••.•..••••.••••.•••.........•••..•••.•• A ...••..•.•••.•••.•• T ••••••••••••• T ••••••••••••••••.••.•••.••.....••..•••••.••..••••••••••.•••••••••••••••.••• T ..•...•••.•••.•.•••••.••••••••.••••.••••••.••••.••.•..•...•.•.•.••.•.•••.•....•..•••.•.•• T ..•..••.•••.•.•.••.••••••••••••••.••.••..•..•.•.••.••.•.•.•.•••..••...•••..••.•.••••.•••• T •••••••••••••.••••.•••••••••••.••.••.•••••••••••••.•......•••.•.•••..••••..••••.•••••

< G~ ~CAMTGAGCA ACACGTCGAT GTCCTCTCCG GMTGACMT GATTATTGTA ACAGCCTCAT AMCCGGCAT TATTGTGAGC GCACTGTATT••••. A •••...•••••••••••••••••.•••••.•••••••••••••••••••••..•...•••••...•.•.•••..••••••••••••..• A .•..•..•••.....•••••.••.•••••••••••.•••••.••••••••••••..••••.••••••••••••••••.••.•••••••• A •••••••••••••••••••••••••••••••••••••••• c. .. G •••••••••••••••••••••••••••••••••••••••••••. A •.•••.•...••••.•••••••••••....•••••.••••••••.•.....•••••....••••.••••...••..•••••..•••••• A •.•••••...•••••.....•..•.••••..•..•..•.........•..••••••...••••..•••..••••..•..••.••

540TATACGCCAT AGCMTTATC GGTCGTMCT GCCGCATCGA TCTTCGTCGA TMTTGCCTT GTGAMCATG AGTTATTGTT CCATCTGMC

•• T ...•••.

•••. A ••••••••• A ••••.•••. A •••••

630TMTTAGTGT ATGTTATTAG GTTMGGGTG ACATTTTGM GTTATACTAC TTCTGACACT TTAGGGMM MCATCATCG GGCCGACCAC•••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• G ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• G ••••••••••••••••••••••••.••..•...•...•••.•.•••••..•••..••••..•..•..•..•.....•••••••.••••. G ••••••••••••.••••.••••.•••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• G ••••••••••••••••••••••••.•••••.••.•••.•••••••••..••••..............•.•..•••...••••••••.•• G •••••••••••.•••••••••••

696TGMGACMG TTACTCTGCA CCGATGGTCG GCTCMCGAT GMGGCGACG TGTCACGGTT GGGTCC

591© 1996 Blackwell Science Ltd. Insect Molecular Biology 5: 81-91

Selection of locus-specific diagnostic primers

Longer primers (17-20 bases) were selected fromDNA sequence flanking the insertion/deletion regionin areas with few or no polymorphic bases betweenthe Asian and North American sequences. Theseprimers were used to analyse gypsy moth DNAsamples of known geographic origin. As expected,with primers U22 and L346 a fragment 345 basepairsin length is amplified in Asian moths and one 240basepairs in length is amplified in North Americanmoths (Fig. 4). In hybrids, both the Asian and NorthAmerican forms are seen, as well as an additional,more slowly-migrating band which is a heteroduplexformed during the annealing stage of the amplificationprocess. This heteroduplex band was formed in theabsence of Taq DNA polymerase by mixing pureAsian and North American amplified DNA and subject-ing the mixture to a PCR amplification cycle (data notshown).

Additional weak bands are sometimes seen whenusing the locus-specific primers (Fig. 4, lanes 2, 3 and4). In these lanes a fragment is seen that is similar insize to the North American fragment, which might leadto misidentification of these Asian samples ashybrids. However, in these lanes the lack of theheteroduplex band indicates that the samples are nottrue hybrids. Comparison of amplified products fromDNA samples being tested with those from knownstandard DNAs usually allows an accurate identifica-tion of specimens.

A RAPD-PCR marker for Asian and North American gypsy moths 85

KB M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Figure 4. Amplification products obtained usinglocus-specific primers U22 and L346. Lanes 1--£,Asian moths; lanes 7-10, hybrids; lanes 11-16, NorthAmerican moths. Lane M, 1 kb ladder. Asian andNorth American marker bands are indicated byarrows.

and North American fragments were cloned andsequenced. To confirm the identity of the clones,plasmid insert DNA from clones of both fragments wasradioactively labelled and hybridized separately to ablot of RAPD PCR-amplified DNA. Both clones hybri-dized to both the 700 and 590 basepair regions of theblot, indicating shared sequences between the twofragments (Fig. 2B). Sequences of both fragmentswere each determined from three individuals (Fig. 3).The actual sizes of the Asian and North Americanfragments are 696 and 591 basepairs respectively,and they have been designated OPD-02696and OPD-02591.respectively. Sequence comparisons of the frag-ments show that the sequences are nearly identical(99%) except that the Asian fragment has a 105 base-pair region that is missing in the North Americanfragment. There are also five nucleotide positions(homologous site numbers 32, 70, 176, 181 and 535)showing fixed differences between Asian and NorthAmerican strains. It is not known whether the 105basepair region was inserted in the Asian or deletedfrom the North American allele. It does not displayflanking repeats that might be associated with a trans-posable element. Neither the Asian nor the NorthAmerican fragment sequence contains any long openreading frames. Searches of the GenBank databaseswith the DNA sequences and with translations of theshort open reading frames have not yielded significantmatches.

•

Figure 3. Alignment of Asian and North American marker band sequences. A696-01 is from a far-east Russian moth; N591-Qe is from a New Jersey Standard StrainNorth American moth; A696-78 and N591-78 are from a North American moth from Ashtabula Co., Ohio; and A696-97 and N591-97 are from a Russian/MA hybridmoth. Matches with A696-01 are indicated by dots, deletions are indicated by hyphens. Locations of locus-specific primer sequences are indicated by arrows.



With some samples, differing results are seen withthe locus-specific primers and OPD-02. These differ-ences are probably caused by nucleotide polymorph-isms at the primer binding sites. The primers U22 andL346 were actually the third set designed. The firstprimers, U33 and L325, were designed based on thefirst two sequences determined, A696-01 and N591-06.In one hybrid individual these locus-specific primersfailed to amplify an Asian fragment even though onewas seen when the same DNA was amplified usingOPD-02. The OPD-02696fragment from this individual(A696-97) was cloned and sequenced and thesequence was compared with the original OPD-02696sequence. A T-A substitution at site number 49 wasseen at the U33 primer binding site (see Fig. 3,sequence A696-97). Initially, a second nucleotidechange was seen at the L325 primer binding site, butupon sequence analysis of additional clones, thatmutation proved to be a Taq polymerase error. Asecond locus-specific primer set, U29 and L374, wasselected based on this additional sequence informa-tion, but these primers failed to amplify the expectedbands. A third set, U22 and L346, was selected andthis set seems to amplify most variants, althoughmore testing is needed. The diagnostic fragmentsamplified by both RAPD-PCR primer OPD-02 and bythe specific primers have been designated as the FS-1marker.

Assessment of the accuracy of the FS-1 marker on samplesof known origins

Table 1 shows the results of amplification of 370 mothsamples with OPD-02 or the specific primer sets U22and L346, or U33 and L325. To date these primershave been used to analyse 116 Asian moth DNAsamples, of which 114 have the Asian form of themarker (98%) and two have both forms. The twoindividuals that show the hybrid pattern are fromcentral Russia (Bellyk, in Krasnoyarsk Territory) andthe moths in this region may have an increasedoccurrence of the so-called North American form dueto a natural east/west cline in allele frequencies.When only samples originating in far eastern Asia arecounted, 100% type correctly as Asians. 154 NorthAmerican samples were analysed, with 148 having theNorth American form (96%) and six typing as hybrids.100 F1 hybrid moths were analysed. Of these, ninety-two type as hybrids (92%), four type as Asians andfour type as North Americans. The four hybrid indivi-duals that type as North Americans have an Asianparent from central rather than far eastern Russia.Based on samples of far eastern Asian parentage, theFS-1 marker has an accuracy rate of 96% for detectinghybrids.

Table 1. Results of analyses of gypsy moth samples from known loca-tions with FS-1 marker. Samples were analysed with RAPD primer OPD-02 or specific primers U33 and L325, or U22 and L346. Sample origins(numbers tested): CH, China: Beijing (4), Hubei, (5) Liaoning (5) andShandong (5). JA, Japan: Hokkaido (9), Kashiwada (2), Kukisaki (1),Namiki (2) and Sakuragaoka (1). RB, Bellyk, Central Russia. RM, Miner-alni, far-eastern Russia. Ship, ships intercepted on route from far-easternRussia. North American samples are indicated by state of origin exceptthat NJ refers to the New Jersey Standard Strain, a laboratory strain.Hybrid descriptions list the maternal strain first.

Asianform

NorthAmerican

formHybrid

(both forms)

AsianCHJARBRMShip

Total

19157

4528

114

2

2

HybridNJ x JAJA x NJMA x RMRM x MARB x RMNC xRMRM x NC

Total

31

12111054

2723

92 4

4

4

North AmericanCTMAMINCNJSSOHPAWV

Total

4

1030162513171225

148

1

6

Efficacy of markers used on DNA from samples at variousdevelopmental stages

The RAPD primer OPD-02 and the locus-specificprimers amplify the expected DNA bands from DNAprepared from adults, pupae, larvae and diapause-stage eggs. The diapause-stage eggs contain well-developed embryos. The samples described in Table1 included 59 eggs, 102 larvae, nine pupae, and theremainder were adults (132 males and 68 females).We have seen no indication that the FS-1 primersamplify sequences that are specific to the stage ofdevelopment.

Inheritance of markers

Parental, F1, F2 and backcross moth DNA sampleswere tested to investigate the mode of inheritance of


three North American types. Similarly, the results ofamplification of DNA from two backcross familieswere close to the expected ratios of 1:1 for the hybrid:-Asian or North American parental type. The first set,offspring of an F, hybrid crossed with a North Amer-ican moth, had nine hybrid and ten North Americantypes, and the second set, from an F, hybrid crossedwith an Asian moth had nine hybrids and eleven Asiantypes. The results indicate that the marker exists as asingle-copy autosomal locus with co-dominant Men-delian inheritance.


Table 2. Results of F2 and backcross gypsy moth samples ana lysed withFS-l. A. Asian form; H, both Asian and North American form; N, NorthAmerican form. Hybrid descriptions list the maternal type first.

Expected Observed

Parental strainsRussian (R) SA SANorth Carolina (NC) 5N 5N

F, hybridsNC by Russian (NCR) 5H 5HRussian by NC (RNC) 5H 5H

F2 hybridsRNC x RNC 5 A, 10 H, 5 N 4 A, 9 H, 7 NNCR x NCR 5 A, 10 H, 5 N 4 A, 13 H, 3 N

Backcross hybridsNCR x NC 9.5 N, 9.5 H 9 N, 10 HRNC x R 10 A, 10 H 11 A,9H

the Asian and North American markers. The resultsare shown in Table 2. All F, hybrids typed correctly,having both the Asian and North American fragments.The results with two sets of F2 hybrids were also veryclose to the expected ratios of 1:2:1 for Asians, hybridsand North Americans, respectively. One set had fourAsian, nine hybrid and seven North American typesand the other had four Asian, thirteen hybrids and

KB 234 KB 1 234

12 -

1.6-

12 -

1.6-

0.4-

A• 0.4-

BFigure 5. Genomic Southern blots of gypsy moth DNA probed with OPD-2-generated marker DNA fragments. (a) and (B), identical blots probed withOPD-02a96and OPD-0259, respectively. Lanes 1 and 2 contain Asian mothDNA and lanes 3 and 4 contain North American moth DNA digested withEcoRl.


Characterization of locus copy number by genomicSouthern blotting

The OPD-02696 Asian fragment and the OPD-0259,

North American fragments were both radioactivelylabelled and hybridized to blotted genomic gypsymoth DNA digested with EcoRI. The results are shownin Fig. 5. Both probes hybridize as smears, indicating

Sau3al188 269 208

sites i, ' ,

Asian dZ'NorthAmerican

A KB 2 3 4 5 6

"13.5- •••

:}I ••

6.6 - -~4.6 - •••2.3- -1.2 -

B 0.94-_ -Figure 6. (A) Diagram of the location of the OPD-02a96269 base pair Sau3alsubfragment within the Asian and North American marker fragmentsequences. Sizes of the larger Sau3al fragments are indicated above the line .The 208 basepair fragment ends at the EcoRI site in the cloning vector. Thelocation of the insertion/deletion region differentiating the Asian and NorthAmerican alleles is indicated below the line. (B). A genomic Southern blot ofNorth American gypsy moth DNA probed with the 269 basepair Sau3alsubfragment of OPD-02a96' Lane 1, Acel; lane 2, Aval; lane 3, 8glll; lane 4;Clal; lane 5, Hind II I; and lane 6, Ndel. Sizes of hybridizing bands areindicated.


that the fragments contain repetitive DNA sequences.In addition, the repetitive sequence or sequences arenot limited to the 105 basepair region found in theAsian but not the North American fragment.

8ecause the inheritance of the markers in F2 andbackcross hybrids suggests that the marker regionbeing amplified is a single-copy locus, three Sau3AIsubfragments of the 696 basepair Asian fragmentwere also used to probe genomic blots to attempt tofind a single-copy portion (Fig. 6A). Hybridization withthe 188 and 208 basepai r fragments generated smears(data not shown), but a 269 basepair region in thecentre of the 696 basepair fragment hybridizes primar-ily as a single band when used to probe genomic DNAdigested with six different restriction enzymes (Fig.68). This indicates that although the full-length OPD-02696 fragment contains repetitive DNA regions, asingle-copy region also exists. The location and extentof the repetitive sequences within the marker regionhave not been characterized. However, the RAPD-PCR and locus-specific primers may be binding insingle-copy regions flanking the polymorphic portion(i.e. the 105 basepair insertion or deletion) of themarker.

Discussion

We developed a nuclear DNA marker, FS-1, that canbe used to differentiate the Asian and North Americanstrains of the gypsy moth. The marker exhibits anaccuracy rate of 96% when tested on known NorthAmerican moths and 100% when tested on mothsoriginating in far eastern Asia. In addition, the markerwill identify Asian/North American hybrid moths. Thismarker will be useful for identifying specimens inregions where recent introductions of Asian mothsare suspected and for monitoring these regions fol-lowing eradication efforts.

It is not known how many European moth indivi-duals were released in Massachusetts in 1869, but itwas probably a relatively small number. The band-sharing analysis indicates that the North Americanindividuals are more genetically homogeneous (0.16intra-strain distance) than the Asian population.Homogeneity within the North American populationhas also been seen using isozyme and mtDNA RFLPanalyses (Harrison et al., 1983). Approximately asmuch variation exists within the Asian population(0.26% distance) as is seen between the Asians andNorth Americans (0.27% distance). Overall, however,the two strains are genetically very similar, contribut-ing to the paucity of observed useful RAPD-PCRmarkers.

The FS-1 marker locus has been characterized toconfirm that it is a chromosomal and not a mitochon-drial marker. The inheritance pattern is that of anautosomal codominant single copy locus. Althoughthe entire OPD-02696fragment contains a highly repeti-tive sequence or sequences, a 269 basepair subfrag-ment hybridizes to a single band on a genomic blot,indicating that the polymorphic portion of the fragmentmay be linked to single copy sequences that bind thePCR primers. If the primers were amplifying dispersedrepetitive sequences, and if the repeat units weresegregating randomly, the F2 and backcross hybridswould have a higher proportion of individuals typingas hybrids. It would also be unexpected that an inser-tion/deletion polymorphism could become completelyfixed in most or all copies of a repetitive sequence inonly one of two closely-related moth strains. In anycase, the F2 and backcross inheritance patterns indi-cate that the Asian and North American FS-1 markerforms each segregate as single units.

A disadvantage of RAPD-PCR is that slight changesin reaction conditions can lead to inconsistent results.Results using RAPD primers frequently differ betweenlaboratories. In order to minimize variations due totechnical artefacts of RAPD-PCR, we sequenced thediagnostic RAPD fragments and developed locus-spe-cific primers. These primers amplified the expectedbands in most individuals. In a few cases a hybridpattern was detected with one primer set but notanother. These cases were probably due to nucleotidepolymorphisms at the primer binding site. Null resultswere rarely if ever seen in 'pure' North American orfar east Asian samples, but non-detectable poly-morphisms in these individuals would have beenmasked by the presence of a detectable allele. Analy-sis of more hybrid individuals should allow the selec-tion of primers or mixtures of primers that will detectthe majority of sequence variants.

The problem of identification of Asian introductionsinto North America has been complicated by thearrival of moths with Asian characteristics (femaleflight) on ships from Europe. This occurred in 1993 inSunny Point, North Carolina (South, 1994; North Car-olina Department of Agriculture, 1994), and also atmilitary shipping ports in Washington in 1993 and 1994(Wood, 1994). It is believed that Asian moths havebeen introduced into some regions in Europe in recentyears (Graser et al., 1995) providing another route intoNorth America. The FS-1 marker has been used to testDNA from moths collected at several European loca-tions, including some where female flight has beenobserved and others where the moths appear to be ofthe European type. At all sites a mix of ASian, NorthAmerican and hybrid marker forms are seen, with

•


Preparation of gypsy moth DNA

The DNA from larvae or adult gypsy moths was preparedusing a modification of the method of Ish-Horowicz et al.(1979). Tissue was homogenized using glass homogenizers ina grind buffer consisting of 10 mM Tris-CI pH 7.5, 60 mM NaCI,and 10 mM EDTA. An equal volume of post-grind buffer (200mM Tris-CI pH 9.0, 30 mM EDTA and 2% sodium dodecylsulfate) was added to the homogenate. Proteinase K wasadded to a final concentration of 200 /1g/ml and the solutionwas incubated for 4-16 h at 50°C. After the Proteinase Ktreatment, sodium acetate (pH 4.8) was added to a finalconcentration of 0.3 M. The solution was extracted with anequal volume of buffered phenol, then with an equal volume ofchloroformlisoamyl alcohol (24/1). Two volumes of ethanolwere added to precipitate the DNA. After at least 2 h at -20°Cthe DNA was pelleted by centrifugation at 8000 g for 30 min.

The DNA was resuspended in 200 /11water and treated with200 /1g/ml RNAse A for 2 h at 37°C in the presence of 50 mMTris-CI pH 8.0 and 10 mM MgCI2. The DNA was then extractedwith phenol and chloroform and precipitated with ethanol inthe presence of 0.3 M sodium acetate. The DNA was resus-pended in 200/11water.

The DNA prepared from larvae often required further pur-ification for consistent amplification. The DNA solution waspurified using an Elutip-D column following the manufacturer'sinstructions.

Crude preparation of DNA from eggs was done by crushingthe egg with a disposable pipettor tip and incubating for 4 h at56°C in 100/11of a buffer containing 10 mM Tris-CI pH 8.0,0.1 %NP40, and 50 /1g/ml proteinase K. Following incubation thelysate was incubated at 80°C for 10 min to inactivate theproteinase K. A 1:10 or 1:100 dilution of the lysate was oftennecessary to reduce the concentration of inhibitory sub-stances. DNA from small fragments punched out of wings witha capillary pipette were also prepared in the same way.


proportions of each varying between sites (data notshown). The original European population may havecontained both forms of the marker, but it will be verydifficult to test this as it is almost impossible toconfirm the existence of a pure European populationnow.

The occurrence of the so-called Asian form in NorthAmerica may be a consequence of its presence in theoriginal European moths released in Massachusettsin 1869. Alternatively, other undetected Asian or Eur-opean introductions may have occurred since then.One population with a higher than usual occurrence ofthe FS-1 Asian form is in Ashtabula County, Ohio,approximately 20 miles from Lake Erie. In addition,analysis of mitochondrial markers has found elevatedfrequency of Asian types in Ashtabula Co., Ohio, aswell as in Cleveland and Toledo, Ohio and Detroit,Michigan (Prasher & Mastro, 1995). Overseas ship-ping on the Great Lakes may have carried Asian orEuropean gypsy moths into this and other areas.

The accuracy rate for the marker in correctly identi-fying Asian samples is 100% for samples originatingin far-eastern Russia (106 individuals), but moths withthe North American form occur with greater frequencyin central Russia (two of nine tested). Individuals frommore areas need to be tested, but the FS-1 markermay be most useful in identifying Asian moths origi-nating in far Eastern ports of Russia, Japan, andChina.

The lack of clear genetic differentiation betweenAsian and North American gypsy moths combinedwith the variability within the Asian population willprobably make it very difficult to find any singlegenetiC marker that gives 100% accurate results.However, the FS-1 marker, in combination with themitochondrial and other nuclear markers of similaraccuracy, should allow statistically valid identificationof suspect moth specimens.

Experimental procedures

DNA samplesAsian gypsy moth samples used in screening decanucleotideprimers were collected in China (Beijing, Hubei, Liaoning andShandong), Japan (Hokkaido, Kashiwada, Kukisaki, Namikiand Sakuragaoka), Russia (Mineralni, in Primor'ye Territory,and Bellyk, in Krasnoyarsk Territory) or were reared from eggmasses collected from ships originating in Vladivostok,Russia. North American moths were collected from Massa-chusetts (Norfolk County), Michigan (Manistee, Newaygo,Oceana and Ottawa Counties), North Carolina (Currituck andDare Counties), Ohio (Ashtabula County), Pennsylvania(Forbes State Forest) and West Virginia (Cooper's Rock StateForest). Hybrids were generated at the USDA Forest ServiceQuarantine Laboratory, Ansonia, Connecticut, from indivi-duals of known geographic origin.

© 1996 Blackwell Science Ltd, Insect Molecular 8iology5: 81-91

RAPD-PCR methodsRAPD-PCR amplifications were performed under two slightlydifferent sets of conditions at two different laboratories.Operon 20-primer sets OPA, OPB, OPC and OPD were used atDelaware, Ohio in 25/11reactions containing 10 ng DNA, 50 mMKCI, 10 mM Tris-CI (pH 9.0 at 25°C), 0.1% Triton X-100, 2.0 mMMgCI2, 0.2 mM each dNTP, 0.2 /1Mprimer and 0.625 units TaqDNA polymerase (Boehringer Mannheim or Perkin Elmer).Reactions were topped with a drop of mineral oil. Thesamples were incubated in 0.5 ml tubes in a Perkin Elmerthermal cycler for 2 min at 94°C (initial denaturation step) andthen for forty-five cycles consisting of 94°C for 1 min, 36°C for 1min, and 72°C for 2 min.

142 decanucleotide primers were screened at the SouthernInstitute of Forest Genetics, USDA Forest Service, Gulfport,Mississippi. The primers used were University of BritishColumbia numbers 102, 103, 108, 111, 114, 116, 119, 122, 123,129,132, 133, 135, 146, 153, 155, 159, 167-169, 171, 181, 184,186, 190, 193, 195, 198, 200, 202, 203, 209, 210, 213, 219, 222,225, 242, 248, 254, 256, 258, 264, 266-271, 285, 288, 295-297,299-301,308,315-320,322,324,327,330,333,336,337,348,352, 357, 360, 362, 367, 370, 375, 376, 381, 389, 396, 399, 402,403, 423, 424, 427, 429, 452, 460, 471, 479, 483, 485, 493, 499,504-507, 509, 510, 517, 519, 530-533, 536, 550, 551, 554, 561,562, 564, 566, 570, 578-580, 582, 586, 587, 589, 590, 599, 600,

•


614,618,624,625,631,633,638,645,654,660,679,686 and 695.The reactions were performed in 96-well microtitre plates on aMJR thermal cycler. The 16/11reactions contained 10 mM Tris-CI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% gelatin, 0.2 mMeach dNTP, 3.125 ng DNA, 0.3125 /1M primer, and 1 unitBoehringer Mannheim Taq DNA polymerase. The sampleswere incubated at 95°C for 5 sand 1:55 min at 92°C (initialdenaturation steps) and then for forty-four cycles consisting of95°C for 5 s, 92°C for 55 s, 35°C for 1 min, and 72°C for 2 min.Following these cycles the samples were incubated at 72°C for7 min and then held at 4°C.

Reaction results were analysed by electrophoresis in 1.2%agarose gels using Tris-borate EDTA buffer followed by ethi-dium bromide staining of the DNA.

Screening of RAPD PCR primers

Initially eighty Operon decanucleotide primers (sets OPA toOPD) were used to amplify three to five DNA samples fromeach geographic location. 142 University of British Columbiaprimers were used to test fifteen Asian and nine North Amer-ican samples. In many cases the results obtained in Gulfport,Mississippi, could not be reproduced in the Delaware, Ohiolaboratory, although attempts were made to match the reac-tion components exactly. When reproducibility was good, anyprimer which appeared to amplify a diagnostic fragment wastested on increasing numbers of moths until up to fifty indivi-duals of each strain had been analysed. The sequence ofprimer OPD-02 is 5' GGACCCAACC 3'.

Band-sharing analysisTwenty primers (University of British Columbia primers 108,111,114,116,119,122,123,129,132,133,153,155,159,167,168, 169, 171, 181, 186 and 190) were selected for a band-sharing analysis of fifteen Asian and nine North Americanmoth individuals. The fifteen Asian moths were from eggmasses collected on ships originating in Russia found enter-ing ports in the Pacific Northwest. The North American mothsincluded two from Massachusetts, two from Michigan, onefrom Ohio, two from the New Jersey Standard LaboratoryStrain, one from Pennsylvania, and one from West Virginia.

322 strong and moderate bands were scored and the resultsanalysed using the 'distance matrix' function of PAUP 3.1.1(Swofford, 1993). This function performs pairwise calculationsof the number of shared bands divided by the total number ofbands. Pairwise distance values were averaged withinAsians, between Asians and North Americans, and withinNorth Americans.

Characterization of the diagnostic fragments amplified byprimer OPD02Amplified DNA from a representative gel was blotted ontoDuralon hybridization membrane according to the manufac-turer's instructions. The Asian (OPD-027oo) and North Ameri-can (OPD-02590) diagnostic fragments were gel-purified fromlow-melting-point agarose and cloned using the TA cloning kit(Invitrogen). Multiple fragments differing slightly in size werecloned, so gel-purified plasmid insert DNA was radioactivelylabelled using the Gibco BRL Nick Translation System andhybridized to the RAPD PCR gel blot to identify the correctclones. Once the correct clones were identified, double-

stranded plasmid DNA was sequenced using the Sequenase(United States Biochemical Co.) sequencing kit.

Genomic blot

20/1g of genomic DNA were digested with restriction enzymesand run on 0.8% agarose gels. To ensure that the digestionwas complete, a 20% portion of the restriction enzyme reac-tion mix was removed to a separate tube and 1 /1g of lambdaphage DNA was added. The lambda DNA was allowed todigest under the same conditions as the remainder of thegenomic DNA. The lambda reaction was checked on a sepa-rate gel for completeness of digestion before the remainder ofthe genomic DNA was used for blotting. After electrophoresisthe gel was blotted onto Duralon hybridization membranefollowing the manufacturer's directions.

The OPD-02696 and OPD-02591 fragments and the OPD-02696

Sau3a1188 and 208 basepair subfragments were radioactivelylabelled using the Gibco BRL Nick Translation System. The269 basepair Sau3AI subfragment labelled poorly using the kitso instead it was self-ligated and then labelled using specificprimer L346 and random primer labelling conditions. The 50/11labelling reaction contained 50 mM Tris-CI pH 6.8, 5 mM MgCI2,10 mM betamercaptoethanol, 150 /1g/ml primer D2L346, 0.2 mMeach dATP, dGTP, and dTTP, 50 /1Ci 32p dCTP, and 12 unitsKlenow fragment of E. coli DNA polymerase I. The DNA andprimer were annealed by heating to 90°C for 2 min and coolingto 20°C over 20 min. The remaining reagents were added andthe reaction was incubated at 3TC for 1 h. UnincorporateddNTPs were removed using a Sephadex G-50 spun column.

Selection of locus-specific diagnostic primers

Seventeen to twenty base locus-specific primer pairs wereselected in non-polymorphic regions of the diagnostic frag-ments, based on comparison of the Asian and North Americansequences. The OLIGO Primer Analysis software package(National Biosciences, Inc.) was used to analyse the selectedprimer sequences for possible internal secondary structure orprimer-primer interactions.

DNA amplification using locus-specific primers

The locus-specific pri mer sequences are as follows: U22:TATGGTATAGSGGATGGTGG 3', L346: 5' ATTTGTTCTGTT-GTTTGRGG 3', U29: 5' TAGSGGATGGTGGGTGTCGT 3', L374:5' TTCCGGAGAGGACATCGACG 3', U33: 5' GGATGG-TGGGTGTCGTT 3', L325: 5' GGTTGGTTGATGATTAGATG 3'.Amplifications were performed in 25 /11reactions containing 10ng DNA, 50 mM KCI, 10 mM Tris-CI (pH 9.0 at 25°C), 0.1% TritonX-100, 1.5 mM MgCI2, 0.2 mM each dNTP, 0.2 /1Mprimer and 0.3units Taq DNA polymerase. Reactions were most successfulwhen hot start PCR was used. In this case the lower reactionmix consisted of primers, dNTPs and water, while the upperreaction mix included the 10 x buffer, DNA, and Taq polymer-ase. The samples were incubated in a thermal cycler for 2 minat 94°C (initial denaturation step) and then for 45 cyclesconsisting of 94°C for 1 min, 49°C for 1 min, and 72°C for 1 min.

Reaction results were analysed by electrophoresis in 2%agarose gels using Tris-borate EDTA buffer followed by ethi-dium bromide staining of the DNA.

© 1996 Blackwell Science Ltd, Insect Molecular BiologyS: 81-91

Keena, M.A. (1994a) Genetics and biology of Asian gypsy moth andits hybrids. US Department of Agriculture Interagency GypsyMoth Research Forum, General Technical Report NE-188, p. 32.

Keena, M.A. (1994b) Identification of Gypsy Moth Larval ColorForms. US Department of Agriculture Forest Service LeafletNElNA-INF-123-94.

Krider, H.M. and Shields, K.S. (1994) Developmental genetics ofLymantria dispar. US Dept of Agriculture Interagency GypsyMoth Research Forum, General Technical Report NE-188, pp.33-34.

Mudge, A.D., Hilburn, D.J. and Johnson, K.J.R. (1994) Gypsy mothdetection and eradication programs in Oregon. Proceedings ofthe 1994Annual Gypsy Moth Review, pp. 319-324.

North Carolina Department of Agriculture (1994) North Carolinagypsy moth program: 1994 overview. Proceedings of the 1994Annual Gypsy Moth Review, pp. 305--315.

Paran, I. and Michelmore R.w., (1993) Development of reliablePCR-based markers linked to downy mildew resistance inlettuce. Theor Appl Genet 85: 985-993.

Prasher, D. and Mastro, V. (1995) Genotype analysis of 1994 portspecimens. Proceedings of the 1994 Annual Gypsy MothReview (Hilburn, D.J., Johnson, K.J.R. and Mudge, A.D., eds).pp.61--63.

Puterka, G.J., Black, W.C., IV, Steiner, W.M. and Burton, R.L. (1993)Genetic variation and phylogenetic relationships among world-wide collections of the Russian wheat aphid, Diuraphis noxia(Mordvilko), inferred from allozyme and RAPD-PCR markers.Heredity70: 604--618.

Roehrdanz, R.L., Reed, D.K. and Burton, R.L. (1993) Use of poly-merase chain reaction and arbitrary primers to distinguishlaboratory-raised colonies of parasitic hymenoptera. BioiControl3: 199-206.

Scieux, C., Grimont, F., Regnault, B., Bianchi, A., Kowalski, S. andGrimont, PAD. (1993) Molecular typing of Chlamydia tracho-matis by random amplification of polymorphic DNA. ResMicrobio/144: 395-404.

South, M.D. (1994) North Carolina update. Gypsy Moth News 34: 12.Swofford, D.L. (1993) PAUP: Phylogenetic Analysis Using Parsi-

mony, Version 3.1.1. Illinois Natural History Survey, Universityof Illinois, Champaign.

US Department of Agriculture, Forest Service (1995) Gypsy MothManagement in the United States: a Cooperative Approach.Draft Environmental Impact Statement, pp. 1--6.

Wallner, W.E., Grinberg, P.S. and Keena, M.A. (1994) Female flight:evaluation of Asian gypsy moth and its hybrids. 1994 US Depart-ment of Agriculture Interagency Gypsy Moth Research Forum,General Technical Report NE-188, p. 89.

Wallner, W.E., Grinberg, P.S. and Walton, G.S. (1995) Differentiationbetween gypsy moth (Lepidoptera: Lymantriidae) populationsby spectral color discrimination of head capsules. EnvironEntomo/23: 659-664.

Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. andTingey, S.V. (1991) DNA polymorph isms amplified by arbitraryprimers are useful as genetic markers. Nucleic Acids Res 18:6531--6535.

Wood, J. (1994) Washington State Department of Agriculture, PlantServices Division. 1994 gypsy moth program summary report.Proceedings of the 1994 Annual Gypsy Moth Review, pp. 334--342.


GenBank accession numbers

The sequences reported here have the GenBank accessionnumbers LDFS1A01U37125, LDFS1A78U-37126, LDFS1A97U37127, LDFS1 N06U37128, LDFS1 N-78U37129 andLDFS 1N97U37130.

Acknowledgements

We thank Melody Keena for Asian, European andNorth American specimens and for generation ofhybrids and backcross samples. We also thank BonitaBaldwin, Alan Baumgard, Hermann Bogenschutz, LeeHumble, Vic Mastro, Mary Smallsreed and RegisYoung for additional samples. We are very grateful toWarren Nance for screening large numbers of RAPD-peR primers.

References

Bogdanowicz, S.M., Wallner, W.E., Bell, J., O'Dell, T.M. and Harri-son, R.G. (1993) Asian gypsy moths (Lepidoptera: Lymantriidae)in North America: evidence from molecular data. Ann EntomolSoc Am86: 710-715.

Clarke, C. and Ford, E.B. (1980) Intersexuality in Lymantria dispar(L.): a reassessment. Proc R Soc Lond B 206: 381-394.

Edwards, O.R. and Hoy, M.A. (1993) Polymorphism in two para-sitoids detected using random amplified polymorphic DNApolymerase chain reaction. Bioi Control 3: 243-257.

Favia, G., Dimopolous, G. and Louis, C. (1994) Analysis of theAnopheles gambiae genome using RAPD markers. InsectMolec Bioi 3: 149-157.

Folkertsma, R.T., Rouppe van der Voort, N.A.M., van Gent-Pelzer,M.P.E., de Groot, K.E., (Reineke) van den Bos, W.J., Schots, A.,Bakker, J. and Gommers, F.J. (1994) Inter- and intraspecificvariation between populations of Globodera rostochiensis andG. pal/ida revealed by random amplified polymorphic DNA.Genetics 84: 807-s11.

Forbush, E.H. and Fernald, C.H. (1896) The Gypsy Moth. Boston,Wright and Potter Printing Co., State Printers.

Gawel, N.J. and Bartlett, A.C. (1993) Characterization of differencesbetween whiteflies using RAPD-PCR. Insect Molec Bioi 2: 33-38.

Gibbons, A. (1992) Asian gypsy moth jumps ship to United States.Science 255: 526.

Goldschmidt, R. (1940) The Material Basis of Evolution. YaleUniversity Press, New Haven.

Graser, V.E., Wulf, A. and Burgermeister, W. (1995) Intraspecificvariation of gypsy moth (Lymantria dispai) revealed by RAPD-PCR. Nachrichtenbl Deut Pflanzenschutzd47: 25-27.

Harrison, R.G., Wintermeyer, S.F. and O'Dell, T.M. (1983) Patternsof genetic variation within and among gypsy moths, Lymantriadispar (Lepidoptera: Lymantriidae), populations. Ann EntomolSoc Am 76: 652--656.

Ish-Horowicz, D., Pinchin, S.M., Schedl, P., Artavanis-Tsakoncis, S.and Mirault, M. (1979) Genetic and molecular analysis of the87A7 and 87C1 heat-inducible loci of Drosophila melanogaster.Ce1l18: 1351-1358.


identification and characterization of a rapd-pcr marker ... · used rapd-pcr to identify a dna...

Documents