Nucleic Acids Research, Vol. 20, No. 11 2853-2859

Identification of an enhancer involved in the melanoma-specific expression of the tumor antigen melanotransferringene

Nathalie Duchange, Alberto Ochoa, Gregory D.Plowman', Anne Roze, Mardjan Amdjadi andMario M.ZakinLaboratoire d'Expression des Genes Eucaryotes, Institut Pasteur, 28 rue du Docteur Roux, 75724Paris Cedex 15, France and 1oncogen, 3005 First Avenue, Seattle, WA 98121, USA

Received January 17, 1992; Revised and Accepted April 27, 1992

ABSTRACTMelanotransferrin (MTf) is a tumor associated antigenfound in abundance on the surface of melanoma cells.It is a transferrin-like protein found in low amount inmost adult tissues and whose gene is reminiscent ofhouse-keeping genes. With the goal of understandingthe regulatory mechanisms which might explain theenhancement of expression in tumor cells, we reporthere the characterization of a regulatory elementlocated 2 kbp upstream from the promoter and whosedeletion specifically impairs gene expression inmelanoma cells; we show that this element is part ofan enhancer composed of two modules which are eachthe target for the API transcription factor. The twomodules present a synergistic mode of action specificfor melanoma cells which requires both of the 130 bpaway AP1 sites. Furthermore, we show that theenhancer behaves differently according to the promotercontext.

INTRODUCTIONMelanotransferrin (MTf) was first described as p97, a tumorassociated antigen identified by the use of monoclonal antibodies(1,2,3). It is a cell-surface glycoprotein which is expressed athigh levels on most human melanomas while it is found in traceamounts on normal adult tissues (4,5,6). Nucleic aciddetermination of p97 cDNA revealed a high sequence homologyto transferrin and other members of this family giving rise tothe name melanotransferrin (7). Although the precise role ofMTfhas not been studied in detail, the demonstration that p97 is ableto bind iron (8) as well as the conservation of the amino acidsinvolved in the proposed iron pockets of transferrin and of thecysteines which define its secondary structure suggest that theprotein might be involved in iron metabolism (7,9).The human MTf gene has been mapped to chromosome 3 (10)

as those of transferrin and transferrin receptor. The gene spans26 kilobases and is composed of 16 exons. The 5' regulatoryregion presents the characteristics of house-keeping type genes(9) multiple start sites have been located between nucleotides-149 to -11 relative to the initiation AUG codon chosen as

EMBL accession no. X62668

position + 1; sequence inspection revealed a high G+C contentand the absence ofTATA and CAAT boxes. A minimal promoterwas defined from positions -204 to -1 which allows expressionof a reporter gene in different mammalian cell tested; thispromoter contains two potential binding sites for the transcriptionfactor SpI (11). Another feature of the MTf 5' region is thepresence of a 84 bp fragment repeated four times and presentupstream from the minimal promoter. The search for sequencesinvolved in the high expression of the gene in melanoma cellswas performed in different introns, in the 3' non coding regionand in up to 5 kbp of the 5' flanking region; this allowed to definea unique region located at -2 kbp whose deletion specificallylowers expression in melanoma cells (9).

In the present work, we show that this activator elementrepresents a module of an enhancer which works synergisticallyin melanoma cells with a second module. Each module is thetarget for API factors (12,13) which designate several proteinsincluding the fos and jun oncogene families (reviewed inreferencel4); mutation of each of the API sites affects thesynergism of the enhancer in melanoma cells suggesting that,although separated by 130 bp, the two API sites might cooperatein some way.

MATERIALS AND METHODSConstruction of expression vectorsThe pH5, pH6 and pH7 plasmids which contain respectively2158bp, 2026bp and 1969bp of 5' MTf sequences cloned in frontof the chloramphenicol acetyltransferase gene were constructedas described elsewhere (9).

Constructions with the MTf promoter are presented in Fig. 1and nucleotide positions refer to Fig. 3. The promoter constructpMTf was obtained by removal of the 5' MTf sequences locatedbetween the HindIII (-2171) and BssHII (-211) sites, afterdigestion ofpH6 with both enzymes, filling and ligation. All theother constructions (p56-MTf, p1 10-MTf and p166-MTf) wererealized by adding to the above ligation mixture the purified andblunt ended fragments of 56bp (HindJI-XmnI from pH6), 1 lObp(HindIII-BstXI from pH7) and 166bp (Hindlll-BstXI from pH6).In the p32wt-MTf and p32mut-MTf constructs, two syntheticoligonucleotides corresponding to positions -2025 to -1994

.=) 1992 Oxford University Press

2854 Nucleic Acids Research, Vol. 20, No. 11

were introduced in the same way after annealing and kination;their sequences are as follows wt-32-mer (wild type) =5'-CAAGTTCACTGATGAGTCACAGCTGAATGACA-3';mut-32-mer (mutant) = 5'-CAAGTTCACTGCACGTTCACA-GCTGAATGACA-3'. Mutation of the TRE sites in the pt66MTfconstruct (pl66mutl-MTf and pl66mut2-MTf) were introducedby the polymerase chain reaction (PCR) by using the mut-32-meroligonucleotides for mutant 1, the oligonucleotides correspondingto the sequence from positions -1892 to -1862 (nucleotidereplacements are underlined) 5'-AGGAAGGACATCGATAT-CAAACAGATCCTG-3' for mutant 2 and two external primersa universal primer (USB 5'-CGCCAGGGTT'TCCCAGTCA-CGAC-3') and a primer corresponding to MTf sequences frompositions -1867 to -1853 followed by a BssHII site(5'-CTCGCGCGCAGATGACTGGCAGGA-3'). The mutatedfragments were obtained after digestion of the final PCR productwith Hindli and B3ssHII.The pSV2-CAT construct contains the promoter and the

enhancer of SV40 and the pUC-CAT2 contains only the earlypromoter (TATA and 21bp repeats) as described previously(15,16). Constructions with the SV40 promoter (pPK-CAT2,p32wt-CAT2, p32mut-CAT2, p56-CAT2, pI66-CAT2 andpantil66-CAT2) were made by ligation of the PK oligonucleotide5'-TGGTAGGACATCTGAGTCAGC-3' (17) and of the abovedescribed fragments into the unique SmaI site of pUC-CAT2.The different constructions and orientations were checked by

enzyme mapping and nucleotide sequencing.

Cell cultures, transfections and transient expression assaysHeLa and SK-MEL-28 melanoma cells (18) were grown inDulbecco's modified Eagle's medium (Boehringer Manheim)supplemented with 10% foetal calf serum (Biological Industries),2mM L-glutamine, 100 units/ml penicillin, and 100 i.g/mlstreptomycin. Cells were plated at a density of 0.5 x 106 cellsper 6 cm dish 24 h prior to transfection and refed 3 h before.Plasmid DNAs were prepared with the Qiagen plasmid Kit(Diagen, Dusseldorf). Cells were transfected with 1 pmole ofplasmid DNA introduced into the cells by the calcium phosphateprecipitation method (19). The precipitate was removed after a16 h incubation and replaced by fresh medium. Cells wereharvested 30 h after removal of the precipitate. Each transfectionexperiment was repeated a minimal of 3 times with at least twodifferent plasmid preparations. CAT activity was determined aspreviously described by Gorman et al. (16) with 5 itg or 100yg of protein extract for HeLa and SK-MEL-28 respectively andincubation times of 30 min for HeLa and 3 h for SK-MEL-28.The assays were quantified by liquid scintillation counting of thethin layer chromatography plates 14C spots.

DNAse I footprintingDNase I footprint experiments were performed with nuclearextracts prepared from HeLa or SK-MEL-28 cells and from ratliver as described by Galas and Schmitz (20) with somemodifications (21). The probes used in these experimentscorrespond to a 5' end-labelled fragment at the Tthl 11 site atposition -1886 and to a 3'end-labelled fragment at a BstE IIsite located at position -1822 in the pI66-MTf construct. In eachsample, 50 jg of crude nuclear extracts were added.

DNA-protein mobility shift assaysThe assays were performed according to Gardner and Revzin(22) with some modifications (23). Briefly, in a volume of 20

p1 were mixed 1 ng of 5' 32P-labelled double strandoligonucleotide (5000 cpm), 1.5 gg poly (dI-dC), 25 ng ofsonicated salmon sperm DNA, 30 ng of sonicated E. coli DNA,4 mM MgC12, 30 mM KCl, 0. 25 mM EDTA, 0.5; mM DTT,0.25 mM PMSF, 10 mM HEPES pH 7.9, 10% glycerol and6 ,g of HeLa, SK-MEL-28 or rat liver nuclear proteins. After15 min at 4°C, the mixtures were loaded onto a 6%polyacrylamide gel. For competition experiments, 200 ng ofunlabelled competitor oligonucleotides were added to the bindingreactions.

Methylation interference assaysThe probe used in methylation interference assays correspondsto the HindM-XmnI fragment ofpH6. The fragment was 5' endlabelled, and partially methylated (24). 60 isg of SK-MEL-28nuclear extracts were incubated with 20 ng of probe in thepresence of 20 jtg of poly (dI-dC) under the conditions describedfor the DNA-protein mobility assay. After incubation at 4°C for15 min, the incubation mixture was loaded onto a 6%polyacrylamide gel. Free and bound DNA were eluted from thegel, purified and treated with 1 M piperidine for 30 mn at 900C,lyophilized and electrophoresed on 20% acrylamide 8 M ureagels.

RESULTSDescription of the sequence required for melanoma-specificenhancement of expressionFig. 2 shows the results obtained in transient expressionexperiments performed in the melanoma cel line SK-MEL-28with constructs containing different parts of the MTf regulatoryregion (see Fig.1). The pH6 vector contains 2026bp of 5' flanking

_ _ p H~~~~~p6

pH7API

pl66-MTf

_t=inbm-pl66mutl-MTf

pl66mut2-MTf

AD--

__p32wt-.mgMp~ p32wt-MTf

_-~Az--e p32mut-MTf

_ _~~~~pMTf

Figure 1. Representation of the MTf expression vectors. The different positionsof the 56bp and I1lObp elements as regard to the MTf promoter are diagrammedby black and light rectangular boxes respectively. The API bing sites presentin the 56bp element (positions -2013 to -2007) and in te IlObp element(positions -1883 to -1877) are represented by white boxes unless dtey are mutatedin the constructs (for nucleotide sequence see Fig. 3B).

CAT

#%AVpl 10-MTf

#%AL,r, -- p56.-MTf_._

#%AV

API

Nucleic Acids Research, Vol. 20, No. 11 2855

sequences which correspond to sequences allowing maximalexpression of the CAT reporter gene (Fig. 2, lane 3); regionsupstream from the position -2026 have been shown to have noinfluence on expression in the different cell lines tested (9). Thelevel of expression driven by pH6 is comparable to that of thestrong and ubiquitously expressed pSV2CAT construct in whichCAT expression is under the control of SV40 regulatorysequences (lane 1); this shows the ability of the 5' MTf regionto drive a strong expression in melanoma cells. Comparatively,the minimal promoter defined as -204/-I (pMTf) is expressed10 times less (lane 2). Removal of 56bp of pH6 located betweenpositions -2026 and -1970 resulting in the pH7 construct leadsto a 5 fold drop of expression (lane 4); this difference in theexpression levels was not observed when transfections wereperformed in HeLa cells (result not shown); this showed that the56bp region constitutes a crucial regulatory element for expressionin melanoma cells.

A binding site for the transcription factor AP1 is present inthe activator regionSequence of the region surrounding the 56bp activator (positions-2026 to -1970) is presented in Fig. 3. In order to determinethe presence of melanoma specific DNA-protein interactions,

.~~~~V

footprint experiments were performed on a DNA fragmentspanning the activator region. Fig.4 shows the presence of 4regions protected by proteins present in SK-MEL-28 melanomanuclear extracts, two of them (regions II and IE) being locatedin the 56bp element (lanes 1 and 2). Region H spans a potentialTPA responsive element (TRE) 5'-TGAGTCA-3' followed bya core AP4 consensus sequence 5'-CAGCTG-3'. Protection overregion II is competed by the PK oligonucleotide (17) bearing aconsensus TRE (lanes 3 and 4).Protection II is also observed withHeLa nuclear extracts which are known to contain API (lanes5 and 6) and is competed by the PK oligonucleotide (lanes 7 and8). When a rat liver nuclear extract was used as a negative controlbecause of its low content in API (S. Cereghini, personalcommunication), the protection obtained over the TRE wasdifferent from the ones observed previously (lanes 9 and 10) andno competition occurred in the presence of the PK oligonucleotide(lanes 11 and 12). These results suggest that the DNA-proteininteraction at the TRE site in melanoma extracts is due to AP1factors and that it is the only protection detectable over region H.

Little differences could be observed in the protection patternsobtained with HeLa or SK-MEL-28 nuclear extracts and mainlyconsisted in the presence of strong DNase cleavage sites in HeLaextracts. Thus, it is difficult to correlate the melanoma specificityof the 56bp region with a particular protection.DNA-protein interactions were studied in more detail by gel

mobility shift assays. When the PK oligonucleotide was used asa probe, an identical retarded complex was observed with HeLaand SK-MEL-28 extracts and liver extracts did not lead to theappearance of a complex (data not shown). On the other hand,two double stranded oligonucleotides corresponding to sequencesaround the MTf TRE site were used in this assay a 32-mer

2 3 4

Figure 2. Location of the activator element in the 5' flanking region of the MTfgene. CAT activity directed by vectors 1 PSV2CAT, 2 pMTf, 3 pH6 and 4 pH7after transfections in SK-MEL-28 cells. See Materials and Methods and Fig. 1for constructions.

pil 6

A. p_5H-1

-2171

B. jfft -2020

pH6 pH7

r_ _

1 Obp

T B

- 1 990 pll7 -:19605 '-GCAAGTTCACT AGCTGAATGACACCCAAGAGATAAGGGAAGAACTTCATTGTGAAAGAGCCCAGCAAACCTCTTAGGTTA3 '-CGTTCAAGTGA TiTCACGCTTACTGTGGGTTCTCTATTCCCTTCTTGAAGTAACACTTTCTCGGGTCGTTTGGAGAATCCAAT

A,1It III rv

-1930 -1870

TGGTTGTTCTCACTCCCTATCAGCGTCACGTGGAGTTTTGCCAAAGGAAGGACITIL;T'CAAACAGATCCTGCCAGTCATCTGG- 3'ACCAACAAGAGTGAGGGATAGTCGCAGTGCACCTCAAAACGGTTTCCTTCCTGAT§AGTTTGTCTAGGACGGTCAGTAGACC - 5

Figure 3. Description of the upstream 5' MTf regulatory region. A- Graphicrepresentation of the 320bp corresponding to 13bp of vector sequence (-2171to -2158) (thick line) and 307bp of MTf regulatory sequences listed under (-2158to -1851). Arrows indicate the amount of 5' sequences contained in the pH5,pH6 and pH7 constructs. Numbers are calculated according to the +1 positioncorresponding to the MTfAUG codon. H HindIII, P PvuII, X: XmnI, T Tthl 11Iand B BstxI. B- Nucleotide sequence from positions -2026 to - 1851. Arrowsindicate the sequences contained in pH6 and pH7. The API binding sites areboxed.and the protections obtained in footprint experiments are delineate withbrackets over the corresponding DNA strand.

Figure 4. DNase footprint analysis of the activator region. The 285bp HindIII-Tthl 11I fragment (-1886 to -271) was 5' end-labelled at the TthlI 1I site (lowerstrand). A+G corresponds to the sequence ladder, F to free DNA, and M, H,L, to assays performed in presence of nuclear extracts prepared from SK-MEL-28,HeLa and rat liver respectively; in lanes 1-2, 5-6 and 9-10, the assays wereperformed in the absence of competitors whereas, in lanes 3-4, 7-8, and 11-12,a 200 fold excess of unlabelled PK oligonucleotide was added in the assays.Numbers alongside the autoradiograph indicate the positions as defined in Fig. 3.Brackets delineate the regions (I to IV) protected from DNase I digestion.

IM

i I

2856 Nucleic Acids Research, Vol. 20, No. 11

I'Atl;ric Mt ITI I.,

Irhc1 inll 'A' rtl ifCom.r tor V.'A M1 W m 11 M1 W rin A, -l

A-

p66.CAT2

p32mut-CAT2

p32wt-CAT2

pPK-CAT2

pUC-CAT2

3"% .".%I

0 10 20Relative CAT activity

B-

p6w-MTf

p32mut-MTf

p32wtrMTf

pMTf

Figure 5. Gel shift analysis and competition experinments with various nuclearextracts. The 5' end-labelled wt-32-mer and mut-32-mer were used in this assay.The upper brackets designate the nuclear extracts, M for SK-MEL-28, H forHeLa and L for rat liver. The intermediate arrows designate the probe w forwt-32-mer and m for mut-32-mer. The lower lane indicates the presence of thewt-32-mer (w) or mut-32-mer (m) competitors or the absence of compettor (-).

0 10 20Relative CAT activity

tt-

_

-, c' F

I:i.

Ftgure 6. Methylation interference pattern of the binding of SK-MEL-28 nuclearproteins on the MTf activator region. A- Preparative gel shift assay of the 5'labelled Hindl-XmnI fragment ofpH6 incubated with SK-MEL-28 nuclear extractwith (+) or without (-) the PK oligonucleotide competitor. B- Methylation

pattern. F free DNA. C DNA from the DNA-protein complex. Positions of theguanine residues where methylation interferes with binding are indicated by arrowsand by asterisks in the API sequence region.

corresponding to the wild-type sequence (wt-32-mer) and a

32-mer containing a 5 bp substitution in the TRE site(mut-32-mer) with an intact AP4 binding site (see Materials andMethods). The choice of the replacements was made accordingto the description of the nucleotides essential for API binding(25). When the wt-32-mer was submitted to gel shift exrin,only one broad retarded band was observed with SK-MEL-28or HeLa extracts; the complex was competed by the unlabelledwt-32-mer but not by the mut-32-mer (Fig. 5). Moreover, themutation completely abolished the appearance of the specificcomplex supporting once more the fact that the DNA-proteininteraction over the TRE in melanoma extracts is due to APIand that no AP4 binding is detected in the region.

Ftgure 7. Activity of the 56bp fragment on the MTf and SV40 promoters.Transient CAT expression in SK-MEL-28 and HeLa tansfected cells with theSV40 constuct (A) or MTf construct (B). Results are expressed as the relativeactivity of that of the vectors corresponding to the promoters alone pUC-CAT2and pMTf.

Finally, methylation interference experinents were performedto establish the essential contacts in this region. Surprisingly,when a preparative gel retardation assay was performed with the56bp activator fragment, a unique retarded band was observed(Fig. 6A), whereas two protected regions were previouslydetected in footprint experiments. This band dis rd whenthe PK oligonucleotide was used as a comeior suggesting the

presence of only one protein-DNA interaction in the wholeregion. The contact points were identified on the lower strandand correspond to those described for API proteins (Fig. 6B).Thus, all the in vitro data point out that API is the maintranscription factor interacting with the 56bp region.

The 56bp fragment is able to activate an heterologouspromoter In a non melanoma-specific manner

When the 56bp fragment is cloned in front ofthe SV40 promoter(p56-CAT2), it is able to enhance strongly- its expression 15 foldin SK-MEL-28 and 30 fold in HeLa (Fig. 7A). These data suggestthat the activity of the 56bp fragment is neithr restricted to itsown promoter nor to melanoma cells.

In both cell lines, the activity of the 56bp fnragmet on the SV40promoter expression is quite stronger than that of a single TREsite (pPK-CAT2) suggesting that interactio"mught occur in the

region other than those revealed in vitro. However, a differentbehaviour is observed between the two cell ies for the capacityto act through the PK TRE site factors present in HeLa cellsactivate 5 fold the SV40 promoter through th,PK oligonucleotidewhile this activity is absent in SK-MEL-22 extracts suggestingthat the API factors present in the two cell lines might bedifferent.

* 8K-EL-28

30

i

Q H.iA* SK-MEL-28

30

-*W.- -... 4m ,W. .4.w.:

Nucleic Acids Research, Vol. 20, No. 11 2857

A M

G 1 2 3 4 5 6 7 F

921 f-

3 ~~~~1;3 HeLa- * SK-MEL-28

0 10 20 30 40Relative CAT activity

2

r2

r2E3 HeLa*2* SK-MEL-28

0 10 20 30 40Relative CAT activity

Figure 8. Activity of the enhancer element. Transient CAT expression in SK-MEL-28 and HeLa transfected cells with the 166bp element cloned in front ofthe MTf promoter (A) or SV40 promoter (B). Results are expressed as the relativeactivity of that of the pMTf and pUC-CAT2 vectors respectively.

V

-1872

Figure 9. DNase I footprint on the 1 10bp module and competition experiments.A 307 bp probe 3' end-labelled at a BstE II site located 40bp away from the3' end of the enhancer was incubated in presence of SK-MEL-28 (M). A+Gcorresponds to the sequence ladder and F to free DNA. The assays were performedin absence (-) or in presence of a 200 fold molar excess of unlabelled doublestranded oligonucleotides; lane I wild-type API oligonucleotide from region II

(wt-32-mer), lane 2 mutant API oligonucleotide from region II (mut-32-mer),lane 3 wild-type API oligonucleotide from region V (5'-AGGAAGGACTTA-GTCATCAAACAGATCCTG-3'), lane 4 mutant API oligonucleotide from regionV (5'-AGGAAGGACATCGATATCAAACAGATCCTG-3'), lane 5 wild-typeCTF/NF1 oligonucleotide corresponding to positions -1996 to -1885 of regionV (5'-CAGCGTCACGTGGAGTTTTGCCAAAGGA-3'), lane 6 mutatedCTF/NF1 corresponding to positions -1996 to -1885 of region V (5'-CAGCGT-CACGCATCG1TITAAATAAGGA-3'), lane 7 CTF/NF1 oligonucleoteide fromthe Tf gene (5'-GACGACCCGCCAGTGGAAGGAGTCAGCACAG-3') Oneprotected region is visible (indicated with brackets) whose positions correspondto those described in Fig.3.

The activity of the 56bp fragment in the p56-CAT2 vector isalso stronger than that of the wt-32-mer in p32wt-CAT2;nevertheless, the activity present in the 32bp sub-fragment of theMTf activator can be attributed to interactions at the TRE siteas mutation of this site in the construct p32-mut-CAT2 reducesthe level of expression to that of the promoter alone.These results show that the situation is more complicated that

what could have been expected from the in vitro data pointingtoward a single DNA-protein interaction at the TRE site.

The 56bp activator is not sufficient to explain the melanoma-specific enhancement of expressionSimilar constructions were made with the MTf promoter (seeFig. 1) and analyzed in transient expression experiments in HeLaand SK-MEL-28 cells (Fig. 7B). Surprisingly, the 56bp fragmentwas found to have a very weak effect on its own promoter (about2 fold). The presence of the sequences corresponding to the 56bp,wt-32-mer or mut-32-mer led to comparable low levels of MTfpromoter activation and no specificity could be observed as regardto the cell line tested. From these results, we concluded that the56bp element is necessary but not sufficient to activate the MTfpromoter and that the potential activity present in the fragmentis exploited differently by the two promoters. The activityresulting from interactions at the TRE site might explain in partthe difference indeed, mutation of the TRE site has no influencein the context of the MTf promoter while it abolishes most ofthe SV40 promoter activation.

A llObp fragment adjacent to the activator is necessary forfull induction in melanoma cellsThese results prompted us to search for other regulatorysequences which might restore full induction in SK-MEL-28 cells.

As sequences upstream from those present in the pH6 plasmidwere previously shown to have no influence on gene expression(9), a 166bp fragment containing the 56bp plus lObp adjacentin 3' was cloned in front of both the MTf (see Fig. 1) and SV40promoters. Fig. 8 shows the results obtained in transientexpression experiments; the 166bp fragment cloned in front ofthe MTf promoter exhibits as much if not higher activity thanthe whole 5' sequences present in pH6 (Fig. 8A). Unexpectedly,this fragment also leads to a strong activation after transfectionsin HeLa cells suggesting that the newly defined region mightconstitute an enhancer element which is not melanoma-specific.The 166bp fragment is able to activate the heterologous SV40

promoter independently of its orientation, thus behaving like aclassical enhancer (Fig. 8B). However, this region has lessactivity on the SV40 expression than the 56bp alone (see Fig.7A)and the levels of activation vary depending on the orientation;this result could be explained by different efficiencies in thecooperation between the promoter and enhancer elements asregard to the spacing in the different constructs. Moreover, itis interesting to note that the activity of the 56bp activator seemsto be potentiated specifically in melanoma cells by the presenceof the lObp fragment indeed, the construct pantil66-CAT2 ismore active in SK-MEL-28 than in HeLa (Fig.8B) whereasp56-CAT2 is less active in SK-MEL-28 than in HeLa (seeFig7A).

A second AP1 binding site is present in the llObp moduleA search for other DNA-protein interactions was performed inthe newly defined portion of the enhancer. An extended region(region V) was found to be protected by proteins present in SK-MEL-28 nuclear extracts as shown in Fig.9. The comparison

A-

pH7

pH6

p1 66-MTf

pMTf

B-

panti1 66-CAT'

p1 66-CAT

pUC-CAT

. ,I

% % % % I

777-777,17,,,q

2858 Nucleic Acids Research, Vol. 20, No. 11

p166mut2-MTf

pl 66mut1-MTf

p166-MTf

pl 1 -MTf

pMTl

% %

I-~ ~ - 20 ESK--40

3 HeLa* SK-MEL-28

0 II0 A 30 40Relative CAT activly

Figure 10. Role of API in the enhancer. Transient CAT expression in SK-MEL-28and HeLa transfected cells. Results are expressed as the relative activity of thatof the pMTf vector.

with the protection pattern obtained with HeLa nuclear extractsdid not allowed to characterize a melanoma-specific protetion(result not shown). Region V exhibits a consensus CTF/NF1 site5'-TGGAN6GCCA-3' centered at position -1900 followed bya potential TRE site 5'-TTAGTCA-3'. Competition experimentswere performed with oligonucleotides corresponding to the wild-type or mutated API sites of region II and V. Positions -1872to - 1888 spanning the TRE site of region V are no more

protected when the oligonucleotides bearing an intact API siteare used as competitors (lanes 1 and 3) whereas the mutated onesdo not alter the protection (lanes 2 and 4); this result shows thatthe TRE site of region V is able to bind the same factors thanregionI, that is API factors. On the other side, competition were

performed with oligonucleotides bearing CTF/NF1 sites; a wild-type oligonucleotide corresponding to positions -1916 to -1885of region V was able to compete the left portion of the protectionwithout affecting the pattern over the TRE site (lane 5);introduction of mutations in both half-sites of the CTF/NF1sequence abolishes the competitive ability (ane 6). Surprisingly,an oligonucleotide bearing a CTF/NF1 binding site correspondingto the CR region of the Tf gene (21) was not able to abolish the

binding over the CTF/NF1 site of region V (lane 7). This resultsuggests that the MTf site binds a melanoma CTF/NF1 putativefactor with more affinity than the Tf site; another possibility isthat factors other than CTF/NFl might be able to bind tosequences in region V with their binding requiring one or bothCTF/NF1 half-sites.

Impication of AP1 in a melanom-specific synergism betweentwo elements of the enhancerIn order to determine where the melanoma specific activity liesand to estimate the role of the two API sites, other constuctionswere tested in transfection experiments. The I l0bp fragment was

cloned in front of the MTf promoter and mutations of each TREsite were introduced separately in the pI66-MTf construct as

pl66mutl-MTf and pl66mut2-MTf (see Fig. 1). The differencein expression observed between the pH6 and pH7 constructs inSK-MEL-28 versus HeLa cells could be explained by the resultsobtained with the p1 IOMTf construct the llObp fragment hasno activity in SK-MEL-28 and activates 5 fold the MTfpromoter

in HeLa (Fig. 10). Consequently, this result suggests that boththe 56bp and the 1 lObp elements are required to drive a stron,gexpression in melanoma cells where they work in synergy.

Mutation of each of the TRE sites have different effects; mutationof the TRE present in the 56bp module reduces 5 times the

enhancer activity in SK-MEL-28 cells and 2 times in HeLa. Thisresult is consistent with the fact that the 56bp element is not crucialfor expression in HeLa where it only leads to slight activationwhich might be higher when the enhancer is brought close tothe promoter. Mutation of the TRE present in the 10bp modulehas a drastic effect in both cell lines suggeting that this site isrequired for the activity of the 110bp module in HeLa and forthe synergism between the two modules in melanoma cells.

DISCUSSIONIn this report, we investigate the characteristics of an activatorelement specifically required for MTf gene expression inmelanoma cells. Our data indicate that the interaction of APIfactors with two TRE sites plays a crucial role in the melanomadependent gene activation resulting from a strong cooperationbetween two adjacent regulatory elements of an enhancer.

First, we analyzed the DNA-protein interactions occurringwithin the melanoma-specific activator region previouslydescribed as a 56bp region located 2 kbp upsteam from the MTfpromoter (9) (Fig. 2 and Fig. 3). This led to the identificationof one main interaction due to API factors over a TRE site(Fig. 4). A second weak interaction was detected in the activatorregion by footprint experiments but gel retardation assays withthe whole region revealed the presence of a unique mtarded band(Fig. 5); however, there is a possibility that several proteins,including API, are present in the retarded complex and that theabsence of API (when competed) destabilizesthe whole complex.The comparison of melanoma and HeLa extrc did not allowedthe identification of a melanoma-specific intetion, but it cannotbe ruled out that the protections observed over fthe TRE site withthe different extracts could be due to distinct AP aors. Indeed,API is formed by the two families of leucine zipper proteins Junand Fos, each being composed of several members which areable to bind as Jun homodimers or as Jun-Fos heIterdImers. Thisgives rise to a large number of combinations differing in theirregulatory activities and in their response to sfimuli such as tumorpromoters, growth factors and oncogene products. Still, at thelevel of binding to DNA, it is difficult if not impossible todifferentiate between the various combinations (reviewed inreferences 14 and 26).We next addressed the question whether or not the 56bp region

was sufficient to confer a melanoma-specific enhancement ofexpression. The SV40 minimal promoter was strongly activatedby the presence of this element while, unexetedly, the MTfpromoter was not; moreover, a similar behaviour was observedin the two cell lines SK-MEL-28 and HeLa (Fig. 7). Thus,isolated fron its context, the 56bp element is not sufficient toconfer a melanoma-specific activation and is not able to activateits own promoter although it contains a t civationactivity. The results obtained after transfectis of couctionswithin the SV40 promoter led to several otherconc lsis First,the activity of the 56 bp region is strongerthn dtat of MTfTREsub-region and dtan that of an unrelated TRE site and this activityis even stronger in SK-MEL-28 than in HeLa cells; dtis suggeststhat other interactions in the 56bp activator might be importantand different in the two cell lines and/or that the spacng of theTRE site according to the promoter is crcial. Second, factorspresent in HeLa cells were able to activate dte SV40 promoterthrough a single consensus TRE site while this was not the casein SK-MEL-28; this result could be explained by the presenceof different amounts or activities of API factors in the two cell

J

Nucleic Acids Research, Vol. 20, No. 11 2859

lines. For example, it has been shown that JunB is not able toactivate expression through a single TRE while c-Jun is (27).

Mutation of the MTf TRE sequence showed that theinteractions occurring at this site are essential to explain the strongactivation of the SV40 minimal promoter (Fig. 7A). As aconsequence, the fact that the MTf promoter is not activated bythe 56bp element suggests that the API-TRE interactions areineffective in this context (Fig. 7B). A likely explanation couldbe that different protein-protein interactions are involved. As bothpromoters contain SpI binding sites, the difference might resideat the coactivator level as was recently proposed (28,29).

Full activation of the MTf promoter in melanoma cells wasrestored by the addition of a 1 lObp fragment 3' adjacent to theactivator in the original sequence of the gene (Fig. 8A). However,this addition also led to a strong activation in HeLa cellssuggesting that activity was gained back but not specificity. Thewhole region was able to activate the SV40 promoter in bothorientations showing its ability to function as an enhancer(Fig. 8B). The 1 lObp element was also found to be the targetfor API through a second TRE site located in an extendedprotected region also containing a CTF/NF1 consensus sequence(Fig. 9). However, it was not possible to certify the binding ofCTF/NF1 to the region which reveals the presence of othersequences close to the consensus for the PEA3 and CREB factors(30) which might be other candidates for binding in this vicinity.

In a last set of experiments, we were able to show thatspecificity in melanoma cells relied upon a strong synergismexisting between the 56bp and 1 lObp modules of the enhancerwhich are inactive when separated (Fig. 10). The synergism isdrastically affected by mutation of each TRE site althoughmutation of the TRE site present in the 1 lObp module has a moresevere effect. This suggests that each TRE site plays a differentrole in the enhancer which might result from their environmentand interactions with factors binding to surrounding sequences.Thus, although we cannot exclude at the time that other factorsmight be involved in the synergism, it seems that API factorsplay a key role in this mechanism. The mechanism by whichthe synergism is exerted is not known at the time; we were notable to detect a cooperativity in binding between the two TREsites as mutation of each site separately did not affect the bindingover the other site in footprint experiments (result not shown).In Hela cells, the synergism was not observed, at least at thesame level as in SK-MEL-28, and the l1lObp module alone isresponsible for most of the enhancer activity in this cell line.Mutation of the 56bp TRE has only a slight effect while mutationof the 1 lObp TRE completely abolishes the enhancer activity.

Cooperation of API factors on tandem sites or with othertranscription factors have been well documented (31,32,33,34)as well as synergism between transcription factors in close orremote positions (reviewed in reference 35). However, enhancersof house-keeping type genes are not so well characterized asregard to their existence and function. Here we report evidencefor the existence of an enhancer for the melanotransferrin house-keeping gene which might be involved in the deregulation of thisgene in cancer cells. This enhancer is composed of two moduleseach containing a binding site for API and both sites are involvedin a strong synergistic activity of the enhancer in melanoma cells.More experiments are necessary to characterize other factorswhich might interact with APl in melanoma cells and to establishthe exact contribution of the enhancer element in the mechanismsleading to the high number of MTf molecules at the surface ofthese cells.

ACKNOWLEDGEMENTSWe are grateful to G.N.Cohen for his support during this workand for critical reading of the manuscript, to S.I.Hirai for kindlyproviding the PK oligonucleotide, to M.C.Py for expert technicalassistance, and to E.Croullebois for help in the preparation ofthis manuscript. This work was supported by the Centre Nationalde la Recherche Scientifique (Unitede Recherche Associee 1129)and by the Ligue Nationale contre le Cancer.

REFERENCES1. Brown, J. P., Wright, P. W., Hart, C. E., Woodbury, R. G., Hellstrom,

K. E. and Hellstrom, I. (1980) J. Biol. Chem. 255, 4980-4983.2. Dippold, W. G., Lloyd, K. O., Li, L. T., Ikeda, H., Oettgen, H. F. and

Old, L. J. (1980) Proc. Natl. Acad. Sci. USA 77, 6114-6118.3. Woodbury, R. G., Brown, J. P., Yeh, M-Y., Hellstrom, I. and Hellstrom,

K. E. (1980) Proc. Natl. Acad. Sci. USA 77, 2183-2187.4. Brown, J. P., Nishiyama, K., Hellstrom, I. and Hellstrom, K. E. (1981a)

J. Immunol. 127, 539-546.5. Brown, J. P., Woodbury, R. G., Hart, C. E., Hellstrom, I. and Hellstrom,

K. E. (1981b) Proc. Natl. Acad. Sci. USA 78, 539-543.6. Garrigues, H. J., Tilgen, W., Hellstrom, I., Franke, W. and Hellstrom,

K. E. (1982) Int. J. Cancer 29, 511-515.7. Rose, T. M., Plowman, G. D., Teplow, D. B., Dreyer, W. J., Hellstrom,

K. E. and Brown, J. P. (1986) Proc. Natl. Acad. Sci. USA 83, 1261-1265.8. Brown, J. P., Hewick, R. M., Hellstrom, I., Hellstrom, K. E., Doolittle,

R. F. and Dreyer, W. J. (1982) Nature (London) 296, 171-173.9. Plowman, G. D. (1986) Ph. D. thesis. University of Washington. Seattle.10. Plowman, G. D., Brown, J. P., Enns, C. A., Schroder, J., Nikinmaa, B.,

Sussman, H. H., Hellstrom, K. E. and Hellstrom, I. (1983) Nature (London)303, 70-71.

11. Dynan, W. S. and Tjian. R. (1983) Cell 35, 79-87.12. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf,

H. J., Jonat, C., Herrllich, P. and Karin, M. (1987) Cell 49, 729-739.13. Lee, W., Mitchell, P. and Tjian, R. (1987) Cell 49, 741-752.14. Curran, T. and Franza, B. R. (1988) Cell 55, 395-397.15. De Simone, V., Ciliberto, E., Hardon, G., Paonessa, G., Palla, F., Lundberg,

L. and Cortese, R. (1987) EMBO J. 6, 2759-2766.16. Gorman, C. M., Moffat, L. F. and Howard, B. H. (1982) Mol. Cell. Biol.

2, 1044-1051.17. Piette, J., Hirai, S. I. and Yaniv, M. (1988) Proc. Natl. Acad. Sci. USA

85, 3401-3405.18. Carey, T. E., Takahashi, T., Resnick, L. A., Oettgen, H. F. and Old, L.

J. (1976) Proc. Natl. Acad. Sci. USA 73, 3278-3282.19. Graham, F. L. and Van der Eb, A. J. (1973) Virology 52, 456-467.20. Galas, D. J. and Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170.21. Brunel, F., Ochoa, A., Schaeffer, E., Boissier, F., Guillou, Y., Cereghini,

S., Cohen, G. N. and Zakin, M. M. (1988) J. Biol. Chem.263,10180-10185.

22. Gardner, N. M. and Revzin, A. (1981) Nucleic Acids Res. 9,3047-3060.23. Ochoa, A., Brunel, F., Mendelzon, D., Cohen, G. N. and Zakin, M. M.

(1989) Nucleic Acids Res. 17,119-133.24. Maxam, A. M. and Gilbert, W. (1980) Meth. Enzymol. 65,499-560.25. Risse, G., Jooss, K., Neuberg, M., Bruller, H-J. and Muller, R. (1989)

EMBO J. 8,825-3832.26. Vogt, P. K. and Bos, T. J. (1990) Ad. Canc. Res. 55,1-35.27. Chiu, R., Angel, P. and Karin, M. (1989) Cell 59,979-986.28. Lin, Y. S., Carey, M., Ptashne, M. and Green, M. R. (1990) Nature (London)

345,359-361.29. Pugh, S. F. and Tjian, R. (1990) Cell 61,1187-1197.30. Faisst,S. and Meyer, S. (1992) Nucleic Acids Res. 20,3-26.31. Chong, T., Chan, W-K. and Bernard, H-U. (1990) Nucleic Acids Res.

18,465-470.32. Diamond, M. I., Miner, J. N., Yoshinaga, S. K. and Yamamoto, K. R.

(1990) Science 249,1266-1272.33. Ney, P. A., Sorrentino, B. P., McDonagh, K. T. and Nienhuis, A. W. (1990)

Genes Dev. 4,993-1006.34. Okuda, A., Imagawa, M., Sakai, M. and Muramatsu, M. (1990) EMBO

J. 9,1131-1135.35. Herbomel, P. (1990) 7he New Biologist 2,1063 -1070.