BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS 231, 254–256 (1997)ARTICLE NO. RC976084

Identification of Cytochrome P450 2E1 in Rat Brain

Min Yoo,*,1 Hye-Myung Ryu,* Song-Woo Shin,* Chul-Ho Yun,† Soon-Chul Lee,‡Young-Mi Ji,§ and Kwan-Hee You§,1

*Department of Biology, Keimyung University, Taegu, 704-701 Korea; †Department of Biochemistry,Pai-Chai University, Taejon, 302-735 Korea; ‡Department of Pharmacy and §Department of Biology,Chungnam National University, Taejon, 305-764, Korea

Received December 2, 1996

MATERIALS AND METHODSWe have isolated cDNA fragments that were origi-

nated from P450 2E1 in rat brain by PCR analysis. Materials. Adult rat brain cDNA libraries were from Clontechand Stratagene. Oligonucleotides were synthesized and purified atTheir size matched up to what we expected based onKorea Biotech, Inc. (Taejon, Korea). Rat liver P450 2E1 cDNA probethe reported sequence of rat liver P450 2E1 mRNA.was a BglII-PstI fragment that corresponds to the sequence codingInternal structure of the longest first-round PCR prod-for amino acids 26-432 (12). DIG DNA labeling and detection kit wasucts were investigated by Southern blot analysis andpurchased from Boehringer Mannheim.

‘‘nested’’ PCR. Their results confirmed that PCR prod-Isolation of phage DNA from libraries. Phage DNA templatesucts actually originated from P450 2E1 mRNA in rat

were isolated from above libraries by a minipreparation method tobrain. RT-PCR was also carried out using P450 2E1 be used for PCR amplification. At least 108 independent phage werespecific primers and the size of the product was exactly used for each minipreparation to ensure that P450 2E1 phage shouldas we expected for P450 2E1. These experimental evi- be included even at very low expression.dences should clarify the presence of P450 2E1 in rat PCR primers. Eight oligonucleotides (P1-P8) were designedbrain. q 1997 Academic Press based on the sequence of previously reported rat liver P450 2E1

mRNA (12) as described in Table 1. Relative positions are repre-sented in numbers.

PCR amplification. The PCR mixture contained 100 ng of tem-plate DNA, 125 mM of each of dNTP, 30-60 pmoles of each primer,Cytochrome P450 2E1 (P450 2E1) has been inten-5 units of Taq DNA polymerase in a total 20 ml reaction. PCR (35sively studied in the liver since it is involved in the

metabolic activation of xenobiotics (1). It converts car-bon tetrachloride to cytotoxin and nitrosamines to car-

TABLE 1cinogens (2, 3). Although it has been widely suggestedthat P450 2E1 should be present in extrahepatic tis- Primers Used for Experimentssues, the evidence for the presence of P450 2E1 in brain

Primer Sequence and Localization (number*)is still controversial due to extremely low expression(4, 5). It is inducible by alcohol in the liver, however,

P1 AAGACCAAAGGCCAGCCTTTTGACCCCACit is not known if it is also inducible in the brain or not (sense, 490-518)(6). Immunohistochemical evidences have indicated the P2 CCTGCATCCAGCTTTACAATAA

(sense, 650-671)presence of P450 2E1 in rat brains in some studies (7,P3 TCCGCAAAGTTATTGTAAAGCTGGA8) but not in others (9). It was also reported that P450

(antisense, 656-680)2E1 was not detectable in rat brain by Northern blot P4 AACAGGTCGGCCAAAGTCACanalysis (10). In contrast, Strobel et al. reported that (antisense, 883-902)they amplified a small cDNA fragment from rat glioma P5 ACCACCAGCACAACTCTGAGATATGG

(sense, 919-944)C6 cells by RT-PCR using P450 2E1 specific primersP6 ATGCCCTACATGGATGCTGTGGTGCA(11). However, it needs to be further confirmed. The

(sense, 1051-1076)aim of the present study is to clarify the presence of P7 GAAATAGTCACTGTACTTGAACTTP450 2E1 in rat brain. (antisense, 1270-1293)

P8 CAATTCCATGCGGGCCAGGCCTTCTCC(antisense, 1327-1353)

1 To whom correspondence may be addressed. M. Y. Fax: 82-53-580-5537. E-Mail: ymin@kmucc.keimyung.ac.kr.; K-H. Y. Fax: 82- * Numbers represent the relative positions of primers when com-

pared to the nucleotide sequence of rat liver P450 2E1 mRNA (12).42-822-9690. E-Mail: khyou@hanbat.chungnam.ac.kr.

0006-291X/97 $25.00Copyright q 1997 by Academic PressAll rights of reproduction in any form reserved.

254

AID BBRC 6084 / 6919$$$$61 01-14-97 12:23:45 bbrcg AP: BBRC

Vol. 231, No. 2, 1997 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. Result of RT-PCR. Template was the reverse-transcribedcDNA from male adult Sprague–Dawley. Primer pair was P2 andFIG. 1. Results of electrophoresis (A) and Southern blot analysisP4. M represents the 123 bp ladder as a size marker.(B) of PCR products. Templates were phage DNA from Stratagene

library (lanes 1, 3) and Clontech library (lane 2). Primer pairs wereP1-P8, P5-P8, P6-P7 for lanes 1, 2, 3, respectively. The 100 bp ladderwas used as a size marker (M) and was also used as a negative cDNA libraries. To isolate recombinant phage DNA ascontrol for Southern blot analysis.

template more than 108 independent phage were in-fected for each minipreparation to ensure that we wereincluding P450 2E1 phage if it was expressed in thecycles) was carried out as follows: 30 sec. at 947C, 30 sec. at 427C

and 1 min. at 727C. PCR products were subjected to electrophoresis brain even at very low level. Combinations of sense andon a 1% agarose gel. DNA was transfered to Hybond N/ nylon mem- antisense primers, which were P1-P8, P5-P8 and P6-brane for Southern blot analysis, if necessary. P7, were used for initial amplification and results are

Southern blot analysis. DNA membrane was prehybridized at summarized in Fig. 1A. Phage DNA templates were557C for 1 h, then hybridized with DIG labeled rat liver 2E1 cDNA from Stratagene library (lanes 1, 3) and Clontech li-probe at 607C for 18 h. Procedures for prehybridization, hybridiza-

brary (lane 2), respectively. DNA bands were amplifiedtion, DNA labeling and color detection were carried out as per manu-and they were 870 bp (lane 1), 440 bp (lane 2) and 240facturer’s instructions.bp (lane 3) in size as expected based on the reportedRT-PCR. mRNA was isolated from the brains of male adultrat liver P450 2E1 mRNA (12). PCR products were thenSprague-Dawley rats using the kit from Stratagene as per manufac-

turer’s protocols. RT-PCR was performed in one step reaction using subjected to Southern blot analysis with a 1223 bpPre-RT/PCR kit (Korea Biotech, Korea) containing 20 units of M- BglII-PstI fragment of rat liver P450 2E1 cDNA as aMLV reverse transcriptase, 2.5 units of thermostable DNA polymer- probe (12). Signals were strongly detected for all PCRase and its own buffer in 20 ml volume as per manufacturer’s direc-

DNA bands except for the size marker (Fig. 1B).tions. Briefly, 10 pmoles of primers P2, P4 and 80 ng of mRNA wereFor the closer examination ‘‘nested’’ PCR was carriedmixed with reagents in the kit, then subjected to the program as

follows: 10 min. at 577C, 1 h. at 427C, 5 min. at 947C (1 cycle), then out using the longest first-round PCR product (870 bp,30 sec. at 947C, 30 sec. at 507C, 1 min. at 727C (30 cycle). RT-PCR lane 1 of Fig. 1A) as template. Primer pairs were combi-products were routinely reamplified to get enough amount of DNA nations among P1 and other primers that were locatedfor further analysis by using same pair of primers (P2 and P4). Ten

internal to the first primers (P1 and P8). As summa-ml reaction was examined by 1.5% agarose gel electrophoresis.rized in Fig. 2, 870 bp, 810 bp, 440 bp, 240 bp, 190 bpwere amplified for primer pairs P1-P8, P1-P7, P5-P8,RESULTS AND DISCUSSIONP6-P7, P1-P3, respectively. Their size exactly matchedup to what they should be if they were originated fromTo clarify the expression of P450 2E1 in rat brain weP450 2E1 mRNA.applied PCR method for the screening of rat brain

RT-PCR was also performed using reverse-tran-scribed cDNA template from the brain of male adultSprague-Dawley rat. Primers were P2 and P4. Ampli-fied result was 250 bp, as expected, which confirms theexpression of P450 2E1 in rat brain again (Fig. 3).

These experimental evidences clearly demonstratethat we amplified cDNA fragments which correspondto P450 2E1 in rat brain. This result should clarify thelong-term question on the expression of P450 2E1 inrat brain.

ACKNOWLEDGMENTSFIG. 2. Results of ‘‘nested’’ PCR. Template was the longest first-round PCR product (870 bp, lane 1 of Fig. 2). Primer pairs were P1-P8, P1-P7, P5-P8, P6-P7, P1-P3 for lanes 1, 2, 3, 4, 5, respectively. We thank Dr. Il-Soo Moon (Dongguk University, Korea) for his

kind support and generous assistance. This research was supportedM represents the 100 bp ladder as a size marker.

255

AID BBRC 6084 / 6919$$$$62 01-14-97 12:23:45 bbrcg AP: BBRC

Vol. 231, No. 2, 1997 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

by a grant 94-0401-06-01-3 from Korea Science and Engineering 6. Umeno, M., Song, B. J., Kozak, C., Gelboin, H. V., and Gonzalez,F. J. (1988) J. Biol. Chem. 263, 4956–4962.Foundation (1994).

7. Hansson, T., Tindberg, N., Ingelman-Sundberg, M. I., andKohler, C. (1990) Neuroscience 34, 451–463.REFERENCES

8. Cammer, W., Downing, M., Clarke, W., and Schenkman, J. B.(1991) J. Histochem. Cytochem. 39, 1089–1094.

1. Koop, D. R., and Tierney, D. J. (1990) BioEssays 12, 429–435.9. Anandatheerthavarada, H. K., Shankar, S. K., Bhamre, S.,

2. Wrighton, S. A., Thomas, P. E., Ryan, D. E., and Levin, W. (1987) Boyd, M. R., Song, B. J., and Ravindranath, V. (1993) Brain Res.Arch. Biochem. Biophys. 258, 292–297. 601, 279–285.

3. Kawajiri, K., and Fujii-Kuriyama, Y. (1991) Jpn. J. Cancer Res. 10. Komori, M. (1993) Biochem. Biophys. Res. Commun. 196, 721–82, 1325–1335. 728.

4. Davis, J. F., and Felder, M. R. (1992) J. Biol. Chem. 268, 16584– 11. Geng, J., and Strobel, H. W. (1993) Biochem. Biophys. Res. Com-16589. mun. 197, 1179–1184.

12. Song, B. J., Gelboin, H. V., Park, S. S., Yang, C. S., and Gonzalez,5. Peng, H. M., Porter, T. D., Ding, X., and Coon, M. J. (1991) Mol.Pharmacol. 40, 58–62. F. J. (1986) J. Biol. Chem. 261, 16689–16697.

256

AID BBRC 6084 / 6919$$$$62 01-14-97 12:23:45 bbrcg AP: BBRC