DETERMINATION OF CHANGES IN SEQUENCE IN FABA BEAN LINES
Paul Motunrayo Adunola
Master’s Thesis.
Master’s Programme in Agricultural Sciences, University of Helsinki, Department of Agricultural
Sciences
Department
IDENTIFICATION OF SEED-BORNE LIPOXYGENASE GENES AND THE DETERMINATION OF CHANGES IN
SEQUENCE IN FABA BEAN LINES
Subject
emission of volatile compounds associated with the generation of off-flavours. This is an are important factor limiting the
acceptance of faba bean (Vicia faba) I foods. This study aimed at using bioinformatic tools to identify seed-borne
lipoxygenase (LOX) genes and to design a biological tool using molecular techniques to find changes in sequence in faba
bean lines. LOX gene mining by Exonerate sequence comparison on the whole genome sequence of faba bean was used
to identify six LOX genes containing Polycystin-1, Lipoxygenase, Alpha-Toxin (PLAT) and/or LH2 LOX domains. Their
sequence properties, evolutionary relationships, important conserved LOX motifs and subcellular location were analysed.
The LOX gene proteins identified contained 272 – 853 amino acids (aa). The molecular weight ranged from 23.67 kDa in
Gene 6 to 96.45 kDA in Gene 1. All the proteins had isoelectric points in the acidic range except Genes 6 and 7 which
were alkaline. Only one gene had both LOX conserved domains with aa sequence length similar with that found in soybean
and pea LOX genes and isoelectric properties with soybean LOX3. Phylogenetic analysis indicated that the genes were
clustered into 9S LOX and 13S LOX types alongside other seed LOX genes in some legumes. Five motifs were found,
and sequence analysis showed that three genes (Gene 1, 2 and 3) contained the 38-aa residue motif that includes five
histidine residues [His-(X)4-His-(X)4-His-(X)17-His-(X)8-His]. The subcellular localization of the lipoxygenase proteins
was predicted to be primarily the cytoplasm and chloroplast. Primers covering ~1.2 kb were designed, based on the
conserved region of Genes 1, 2 and 3 nucleotide sequences. Gel electrophoresis showed the PCR amplification of the seed
LOX gene at the expected region for twelve faba bean lines. Phylogenetic analysis showed evolutionary divergence among
faba bean lines for sequenced and amplified region of their respective seed LOX alleles.
Keywords
Where deposited
3
2.0 LITERATURE REVIEW ..................................................................................................................... 7
2.2 Nutritional and anti-nutritional properties of faba bean ............................................................... 9
2.3 Lipoxygenase ...................................................................................................................................... 9
2.3.2 Catalytic property of plant lipoxygenase ............................................................................... 11
2.5 Lipoxygenase activity control ......................................................................................................... 14
2.6 Bioinformatics .................................................................................................................................. 15
3.2 Seed LOX sequences in legumes and phylogenetic analysis ........................................................ 17
3.3 Identification of conserved motifs and subcellular localization .................................................. 18
3.4 Primer design ................................................................................................................................... 18
3.5 Primer amplification in faba bean lines......................................................................................... 19
3.7 Analysis of faba bean seed for LOX DNA sequence ..................................................................... 20
4.0 RESULTS ............................................................................................................................................. 21
4.1 Sequence identification and structural feature of putative faba bean seed LOX genes ............ 21
4.2 Physical and chemical properties of faba bean LOX proteins .................................................... 29
4.3 Protein position similarity search .................................................................................................. 29
4.4 Phylogenetic analysis and structure of aligned genes ................................................................... 31
4.5 Identification of conserved motifs .................................................................................................. 33
4.6 Gene amplification ........................................................................................................................... 35
4.7 Phylogenetic analysis of selected faba bean lines seed LOX ........................................................ 36
5.0 DISCUSSION ....................................................................................................................................... 40
6.0 CONCLUSION .................................................................................................................................... 44
7.0 ACKNOWLEDGEMENT .................................................................................................................. 45
8.0 REFERENCES .................................................................................................................................... 46
9.0 APPENDICES ...................................................................................................................................... 57
1.0 INTRODUCTION
Faba bean (Vicia faba L.) is receiving attention in recent times across Europe, Australia and Africa as
an alternative source of plant protein (Paull et al., 2006; De Visser et al., 2014; Warsame et al., 2018;
Bulti et al., 2019) owing to high dependence on soybean with its fluctuations in market price and
productivity. Faba bean is well-adapted to regions where soybean performs poorly in Europe and
Africa and could help to reduce carbon emissions (Björnsdotter et al., 2020). Faba bean is a quality
source of plant-based protein for vegetarians and animal feed with high seed protein content of about
30% of dry weight (Duc et al., 2011) and high yield (1.92 tonnes/ha global average, FAO, 2020). It is
a rich source of dietary fiber (7-11%), carbohydrate (40-46%) and lipids (~1%) (Heuze et al., 2018).
The lipids of dry faba bean contains about 46 to 64% linoleic acid (Ryu et al., 2017) and 4.8% α-
linolenic acid (Lizarazo et al., 2015) which is similar to that obtained in soybean. Faba bean contains
L-3,4-dihydroxy-phenylalanine (DOPA), a natural plant source of the neurotransmitter dopamine used
in drug development for the treatment of Parkinson’s disease (Fox et al., 2014). Despite the enormous
potential of this crop, breeding activities and research to enhance its qualities for food, tolerance to
biotic and abiotic stresses, industrial and ecological purposes are still limited.
Flavour is one of the important food quality characteristics that influence consumers’ preference and
acceptance of a food product (Clark, 1998; Spence, 2015). Generally, in legumes crops like faba bean,
beany/grassy off-flavour can be perceived during and after processing (Kumari et al., 2015). The
presence of anti-nutrient factors coupled with off-flavours are the major limitations for the acceptance
of this crop as a source of plant-based protein (Day, 2013, Mandal et al., 2013). Lipoxygenase enzymes
that contribute significantly to storage protein in legume seeds have been identified to cause the
emission of volatile compounds associated with these off-flavours (Mandal et al., 2014). Seed
lipoxygenase is responsible for the auto-, photo- and enzymatic oxidative catalysation of
polyunsaturated fatty acid like linoleic and α-linolenic acids containing 1, 4-Z,Z-pentadiene to form
hydroperoxides (Ho and Chen, 1994; Rawal et al., 2020). Ketone compounds and volatile aldehyde
are short-chained products generated by hydroperoxide lyase metabolism of the formed
hydroperoxides. Some representative compounds released in soybean are n-hexanal, 3-cis-hexenal,
2(1-pentenyl)furan, and ethyl vinyl ketone (Rackis et al., 1979; Mellor et al., 2010) while that of pea
include hexanal, 1-hexanol, 3,5-octadien-2-one, and nonanol (Trikusuma et al., 2020). Similarly, faba
bean products have been reported to demonstrate the LOX pathways in its seed (Oomah et al., 2014),
during processing (Lampi et al., 2020) and storage (Jiang et al., 2016).
5
Most studies on seed-borne lipoxygenases of legumes have been carried out on soybean and pea. There
is knowledge gap in the study of seed lipoxygenase in many leguminous crops, particularly, faba beans,
common beans and chickpeas despite their growing importance (Roland et al., 2017). The
classification of faba bean by Chang and McCurdy (1985) as a plant with medium level of LOX
activity reiterates the importance for more robust study for the crop to understand the LOX pathway,
propound specific processing designs and breeding of superior varieties that will increase the crop
value.
Genetic elimination of seed lipoxygenase in faba bean becomes necessary for improving its
acceptability by consumers and adoption for industrial purposes. Premised on the success obtained for
soybean and pea, the identification of seed LOX genes in faba bean will assist in breeding and selecting
varieties that lack the potential of generating off-flavours or has significantly low off-flavours.
Nevertheless, studies have found that pea and soybean with LOX-free seeds have been able to
optimally carry out all physiological functions without defects (Hajika et al. 1992; Wang et al. 1999).
The absence of seed lipoxygenase in soybean does not reduce seed protein content in comparison with
normal lines (Narvel et al., 1998).
The use of traditional breeding techniques for developing LOX free genotypes in soybean have been
deemed laborious, expensive, destructive, technical and ineffective especially for discriminating
between heterozygote and recessive individuals (Axelrod et al., 1981; Suda et al. 1995; Narvel et al.
2000; Kumar and Rani, 2019). Hence, the combination of bioinformatics tools and molecular
techniques are suitable alternatives and have been useful in elucidating physiological and molecular
functions of LOX genes in pear (Pyrus communis) (Li et al., 2014), poplar (Populus spp) (Chen et al.,
2015), apple (Malus domestica) (Song et al., 2016), cotton (Gossypium spp) (Shaban et al., 2018), tea
(Camellia sinensis) (Zhu et al., 2018), raddish (Raphanus sativus) (Wang et al., 2019) and tartary
buckwheat (Fagopyrum tataricum) (Ji et al., 2020). In soybean, the level of similarities and
conservation of sequences between LOX gene containing regions was found to be high (Shin et al.
2008) using bioinformatics and molecular techniques. Therefore, there is need to study the seed LOX
gene in faba bean to identify the homolog phylogenetic similarities with other legumes, conserved
regions and their sub-cellular localization. This information will be useful in identifying the genes
regulating off-flavours in Faba bean and for designing molecular tools for breeding purposes.
6
1.1 Aims of the study
This study aimed at using bioinformatic tools to find seed-borne lipoxygenase genes in faba bean and
to design tools using molecular techniques to find changes in sequence or expression. It explored the
understanding of the molecular structure and evolutionary phylogeny between putative seed LOX
genes in faba bean and some selected soybean and pea seed LOX genes. Sequence analysis for gene
identification, structural analysis for LOX domains, protein properties, phylogenetic relationship,
conserved amino acid motifs identification and prediction of subcellular location were conducted. The
information obtained was used to design and test molecular tools for expression in selected faba bean
accessions.
7
2.1 Faba bean production
Faba bean (V. faba) is a leguminous grain crop belonging to the family Fabaceae and also called broad
bean, field bean or horse bean (Crepon et al., 2010). It is a diploid (2n = 12) outcrossing species with
a 13 Gigabase pair (Gbp) genome contained on six chromosomes with a high proportion of
transposable elements (Negruk, 2013; Cooper et al., 2017). It is adapted to diverse environments and
climates with highly variable plant architecture, leaf and seed characteristics (Maalouf et al., 2013).
Faba bean is native to Northern Africa and Southwest Asia (L’Hocine et al., 2020), grown for human
food and animal feed in both developing and industrialized nations. The world production of faba bean
has increased up to two-folds from 2,77 million tonnes in 1992 to 5,43 million tonnes in 2019, chiefly
due to widespread cultivation of the crop in all regions of the world (Figure 1). Based on FAOSTAT
(2020) data, China is the highest producer, followed by Ethiopia, United Kingdom, Australia, France
and Sudan (Figure 2). Even though the crop was introduced to many countries in Europe, the export
of dry faba bean grain is dominated by UK, Australia and France (L’Hocine et al., 2020).
Previously, Asia and Africa are significant leading producing areas, but total production from
European countries in the past 5 years is almost equivalent to that obtained in Africa while production
in America and Oceania remain low except in Australia. The upsurge in production in Europe is
primarily attributed to the need to supplement protein production in animal feed (De Visser et al.,
2014). Egypt, China, Iran, India, Pakistan, Syria and Iraq are the dominant import market for human
consumption of faba bean even though this is relatively small (300,000 tonnes/year)
(Gnanasambandam et al., 2012). Progress made with the broader knowledge of the biology, ecology,
agronomy and genetics of faba bean has translated to global average yield increase by more than two-
fold (1.92 tonnes/ha) in 2019 compared to 0.9 tonnes/ha obtained in the 1960s (Maalouf et al., 2013;
FAOSTAT, 2020).
8
Figure 1: World production of faba bean from 1992 to 2019 (Source: FAOSTAT, 2020)
Figure 2: The main faba bean-producing countries in 2019 (Source: FAOSTAT, 2020)
9
2.2 Nutritional and anti-nutritional properties of faba bean
Faba bean seeds differ in weight (0.2 to 2.6 g of dry matter), shape (round small-medium and flat
large), nutritional and anti-nutritional composition (Crepon et al., 2010). Large seeds are often
cultivated for human consumption, especially in western and southern European regions as fresh or
dry seeds while small-medium seeds are often grown for feeding animals or sometimes as human food
with wider range of cultivation (Crepon et al., 2010; Maalouf et al., 2018). Faba bean is a good dietary
source of fiber, protein, vitamins and minerals (Ofuya and Akhidue, 2005). Studies by Duc et al. (1999)
and Suvant et al. (2004) showed the crude protein (294 – 319 g/kg), starch (412 – 443 g/kg), crude
fiber (87 – 99 g/kg), carbohydrate (35 – 39 g/kg), fat (13 – 20 g/kg), lysine (19.5 – 20.3 g/kg),
methionine (2.6 – 2.7 g/kg), cysteine (3.6 – 3.9 g/kg) and tryptophan (2.7 g/kg) contents in faba bean.
The seeds of faba bean contain tannins in the seed coat as well as vicine and convicine in the
cotyledons, and these have been demonstrated in several studies to have anti-nutrient effects on
humans and animals (Grosjean et al., 2000; Suvant et al., 2004; Purves et al., 2017). In high-tannin
faba bean seed, condensed tannin and vicine + convicine contents were 6.6 g/kg and 8.3 g/kg
respectively while in low tannin cultivars, the corresponding figures were 0.1 g/kg and 7.6 g/kg
respectively (Duc et al., 1999; Suvant et al., 2004). Tannins impair nutrient digestion, hence,
interfering with the absorption of bioavailable substances that are beneficial to the body (Hendek and
Bektas, 2018). Vicine and convicine are toxic to those humans who have a genetic defect leading to
deficiency in erythrocyte-located glucose-6-phosphate dehydrogenase (Crepon et al., 2010). However,
breeding activities over the past 30 years have resulted in the development of faba bean low contents
of either tannins and or vicine + convicine with high protein digestibility and increased energy value,
important in human food and animal feed (Duc et al., 1997). The incorporation of faba bean in human
diet has been associated with reduced plasma LDL-cholesterol levels (Fruhbeck et al., 1997). Beside
anti-nutritional properties that have previously limited faba bean utilization, the crop shares
unfavourable nutritional quality (bean/grassy flavour and aroma) with other leguminous seeds.
2.3 Lipoxygenase
Lipoxygenase, a non-haem iron-containing dioxygenase class that catalyses hydroperoxidation of
polyunsaturated fatty acids (PUFAs), has been identified to be responsible for the release of
10
undesirable beany and grassy off-flavour during and after the processing of faba bean and other legume
seeds (Loiseau et al., 2001; Roland et al., 2017). The unsaturated fatty acids are primarily linoleic and
linolenic acids which can be oxidised both enzymatically and non-enzymatically. Enzymatic off-
flavour formation occurs when hydroperoxides are produced by spontaneous auto-oxidation of
unsaturated fatty acids in the presence of atmospheric oxygen by free radical chain reactions (Roland
et al., 2017). Non-enzymatic production of off-flavours occur following amino acids and sugar heating
(Maillard reactions) by thermal degradation of phenolic acids, thermal and oxidative degradation of
carotenoids, thermal degradation of thiamine or solvent contamination after extraction (MacLeod et
al., 1988).
LOX-catalysed degradation of polyunsaturated fatty acids in legumes causes the release of undesirable
off-flavours. Initially, hydroperoxides released are further broken down into different LOX-derived
grassy, beany and green off-flavours compounds such as hexanal, 3-cis-hexenal, n-pentylfuran, 2(1-
pentenyl)furan, and ethyl vinyl ketone (Rackis et al., 1979; MacLeod et al., 1988). In addition,
MacLeod et al. (1988) reported that lipase enzyme hydrolyses lipids into oxidation-susceptible free
fatty acids, which contributes to off-flavour generation in legumes. Maccarrone et al. (1994) and
Baysal and Demirdoven (2007) classified LOXs into type 1, with pH in the alkaline region and specific
for oxidation of free fatty acids, and type 2, with pH close to neutral and causing co-oxidation of
carotenoids. Factors that influence off-flavour release in legumes include variable cultivar, crop year,
cropping location, storage condition i.e., presence of volatile and non-volatile compounds
(Malcolmson et al., 2014).
2.3.1 Structure of plant lipoxygenase
Lipoxygenase (LOX) is present in plants, animals, fungi and some cyanobacteria (Ivanov et al., 2010;
Garreta et al., 2013). It is used for lipid mobilization which play important role in the production of
energy by initiating lipid mediator biosynthesis pathways and the formation of growth regulatory and
pest resistance compounds (Skrzypczak-Jankun et al., 1997). The primary structures of plant
lipoxygenases are mono polypeptide chains, with high molecular weight (90 - 110 kDa) compared to
mammalian LOX (~ 75 kDa) (Skrzypczak-Jankun et al., 1997; Shi et al., 2020).
11
LOX is made up of two distinct protein domains, the N-terminal that consists of a beta-barrel domain
(known as PLAT – Polycystin-1, Lipoxygenase, Alpha-Toxin), has a molecular weight of about 30
kDa and an unclear function, and the C-terminal that contains an iron catalytic domain and has a
molecular weight of about 65 kDa (Shi et al., 2020). The sequence of the C-terminal portion of plant
lipoxygenase enzyme overlaps with mammalian enzymes, sharing the same single nonheme iron atom
cofactor (Skrzypczak-Jankun et al., 1997). There is little variation in the molecular weight of many
plant lipoxygenases, for example, in dry pea seed (93 kDa) (Szymanowska et al., 2009), mung bean
(97 kDa) (Aanangi et al., 2016) and soybean (94 – 97 kDa) (Shi et al., 2020).
Using soybean LOX-1 as a model, the 853 amino acid residues is made up of 160 amino acid residues
of N-terminal domain and 693 amino acid residues of C-terminal domain composed of Fe3+ active site,
23 α helixes and 2 antiparallel β plates (Shi et al., 2020). The iron plays a redox role in the catalytic
mechanism (Funk et al., 1990). Water has been experimentally proven to be one ligand to iron in the
ferric, iron(III) form of LOX in soybean lipoxygenase-1 (GmLOX 1). The iron cofactor in GmLOX 1
is enveloped at the center and surrounded by three histidines, chain carboxyl C-terminal isoleucine and
asparagine which is about 45 to 50 amino acid long (Minor et al., 1996; Newcomer and Brash, 2015).
2.3.2 Catalytic property of plant lipoxygenase
In a plant cell, LOX catalyses the oxygenation of the carbon chain of C18 PUFAs (Nemchenko et al.,
2006). Based on their nomenclature (Figure 3), plant 9-LOX and 13-LOX oxygenate the 9-carbon and
13-carbon of linoleic (18:2) or α-linolenic (18:3) acids, respectively (Newcomer and Brash, 2015). The
mechanism for LOX catalysis is initiated when free radical hydrogen atoms leave linoleic or α-
linolenic acids (substrates) and iron ions are reduced concurrently. Peroxide free radicals are formed
when the substrate free radicals are oxygenated, complemented by oxygen transformation into oxygen
free radicals. An enzyme-active form of LOX is finally formed when Fe2+ reduces peroxide free
radicals in LOX to form hydrogen peroxide and Fe3+ is formed via the oxidation of iron (Murphy,
2008). In the plant, the activity of lipoxygenase on isolated PUFA is highest for linoleic acid as lower
activities were obtained for α-linolenic, arachidonic acid and methyl linoleate while no activity was
detected for oleic acid (Skrzypczak-Jankun et al., 2009; Shi et al., 2020).
12
Figure 3: Lipoxygenase oxidation of PUFA to form 9- and 13-hydroperoxylinoleic acid (Adapted
from Loiseau et al., 2001). Red rectangles indicate the oxygenation of the 9th and 13th
carbon of linoleic acid that result in the formation of 9- and 13-hydroperoxylinoleic
acids, respectively.
2.3.3 Biological function of plant lipoxygenase
The expression of LOX gene occurs throughout the plant’s life (Shi et al., 2020). The multiple
biological function of LOXs has been identified in some plant physiological processes including seed
germination, growth and development, stem formation, nodule formation in legumes, plant response
to pathogen and abiotic stresses, wounding, fruit maturation and senescence (Todd et al., 1992; Farmer
and Ryan, 1992; Kato et al., 1993; Slusarenko, 1996; Mauch et al., 1997; Shi et al., 2020). In plants,
some LOX isoenzymes serve as vegetative storage protein (Loiseau et al., 2001). It is also found in
the legume seeds, associated with off-flavour generation and plays important role in their germination
though soybean seed lacking lipoxygenase have demonstrated no germination defects (Figure 4)
(Loiseau et al., 2001).
Lipoxygenase is crucial in the biosynthesis of prostaglandins, jasmonates, abscisic acid and traumatin
(Sheng et al., 2000; Shi et al., 2020). Lipoxygenase contributes to a plant’s vegetative growth, notably
cell elongation or degradation, by changing the composition of the cell membrane phospholipid
(Droillard et al., 1993). The enzymes are often located in the outer region of the organ where they play
13
a host defence role against biotic stress from pathogens, as demonstrated in pea roots against cyst
nematode (Leone et al., 2001; War et al., 2012). The expression of the LOX gene can be induced by
salicylic acid, chitin and potassium jasmonate, some of which are the component of LOX metabolic
pathway (Ruan et al., 2019) and activators of plant defense system against pathogens (Göbel et al.,
2001)
Figure 4. LOXs have active roles in several processes during plant life (Adapted from Porta and
Rocha-Sosa, 2002). Emphasis is on the release of off-flavour in plant mediated by seed-
borne LOXs.
2.4 Legume seed lipoxygenase
Lipoxygenase have been postulated to be present in the seeds of most plant species (Loiseau et al.,
2001) even though they were popularly studied in cereals and legumes. Fourteen important legumes
were classified by Chang and McCurdy (1985) into three classes based on their in-vitro lipoxygenase
activity. Soybean, cowpea (Vigna unguiculata) and lentil (Lens culinaris) were classified as high-level
activity species; V. faba, pea (Pisum sativum L.), and five common bean (Phaseolus vulgaris) biotypes
(red kidney bean, black bean, navy bean, pinto bean and great northern bean) were classified as
medium-level activity species and mung bean (Phaseolus aureus), lima bean (Phaseolus lunatus) and
chickpea (Cicer arietinum) were classified as low-level activity species.
Seed LOXs in soybean represent 1-2% of the protein constituent and exists in three isoenzymatic forms
(LOX 1, LOX 2, LOX 3) (Kumar and Rani, 2019), each of which has a distinct isoelectric point (5.7
14
to 6.4), substrate specificity, product formed and stability (Siedow, 1991). Soybean LOX-1 is a 94 kDa
(838 amino acids) isoform that has the highest activity at pH 9 and converts linoleic acid to a 13-
hydroperoxide compound. LOX-2 is a 97 kDa (865 amino acids) isoform characterized by maximum
activity at 6.8 and forms 9- and 13-hydroperoxide derivatives. LOX-3 is a 96.5 kDa (857 amino acids)
isoform, demonstrates broad activity around pH 7.0 and produces a 9- hydroperoxide compound
(Maccarrone et al., 1994; Skrzypczak-Jankun et al., 1997; Loiseau et al., 2001).
Pea contains two seed lipoxygenase isoforms, labelled LOX 2 and LOX 3 based on their sequence
similarity to soybean (Ealing and Casey, 1989), both with about 95 kDa molecular weight. Their
production in pea seed is approximately in equal proportion with continuous accumulation until the
late stages of embryogenesis (Domoney et al., 1990; Sanz et al., 1993; Loiseau et al., 2001). Sanz et
al. (1993), Hilbers et al. (1995) and Clemente et al. (2000) reported that chickpea, lentil, faba bean
and kidney bean contain two major lipoxygenases, one that converts linoleic acid to produce 13-
hydroperoxide (thus equivalent to LOX 3), and a second that converts linoleic acid to 9- and 13-
hydroperoxides and 9- and 13-ketodienes (thus equivalent to LOX 2).
The presence of LOX pathways and lipase activities (triacylglycerol acylhydrolase, EC 3.1.1.3)
associated with off-flavour production during processing have been reported in the seed of faba bean
(Oomah et al., 2014; Yang et al., 2017). Lampi et al. (2020) reported the apparent potential of LOX
to form volatile lipid oxidation in the LOX pathway in faba bean seeds. They further reported that pH
and the presence of free fatty acid (FFA) affect the profile of volatile lipid oxidation products in the
LOX pathway.
2.5 Lipoxygenase activity control
In legumes, several methods and technologies such as blanching, dry heating and steam employed for
controlling oxidation and temperature that activate LOX enzymes have not been successful for use in
food processing industries because of the development of new off-flavours and the modification of
protein functions (Roland et al., 2017). The use of soaking treatment, germination, solvent extraction,
fermentation, ultrafiltration, and enzymatic treatment have been reported in several studies to improve
legume flavour although they have also resulted in loss of soluble protein (Chango et al., 1995) and
insufficient lipid/off-flavour removal or prevention (Heng et al., 2004). Off-flavour protein isolates in
15
faba bean and pea were minimized using isoelectric washing and defatting (Schultz et al. 1988). A
detailed report by Wang (2020) revealed that isoelectric washing reduced off-flavours in pea, but it
has both positive and negative effects on the chemical composition, protein functionality and protein
quality of the processed food product. However, Jiang et al. (2016) found that dry heating faba bean
for 1.5 minutes in the microwave resulted in successful reduction of LOX enzymatic activities,
enhanced milling properties and protein solubility preservation. Despite the promising potential of all
these treatments, they are quite expensive to adopt. This necessitates the use of genetic approach to
reduce or eliminate off-flavours in faba bean which has been successful in soybean and pea (Forster et
al., 1999, Reinprecht et al., 2011).
Based on the foregoing, genetic elimination of seed LOX in faba bean becomes necessary for
improving its acceptability by consumers and adoption for industrial purposes. Premised on the success
obtained for soybean and pea, the identification of seed LOX genes in faba bean will assist in breeding
and selecting varieties that lacks the potential of generating off-flavours or has significantly low off-
flavours. The alternative roles of LOX in physiological processes in plant have been extensively
studied and discussed in the previous sub-section. Nevertheless, studies have found that pea and
soybean with LOX free seeds have been able to optimally carry out all physiological functions without
defects (Hajika et al., 1992; Wang et al., 1999).
Seed LOX is primarily localized in the parenchyma cells (Wang et al., 1999) and in the epidermal cells
(Vernooy-Gerritsen et al., 1984) in soybean, for example. Thus, seed LOX serves more as storage
protein to support growth metabolism than the presumed involvement in the synthesis of jasmonic acid
during seedling development (Loiseau et al., 2001). Hence, the development of biological tools
(molecular markers) for the detection of LOX genes in faba bean seed for a simple genotyping assay
based on PCR and gel electrophoresis will assist in breeding seed LOX-free varieties in the future.
2.6 Bioinformatics
Over the past two decades, there has been a reduction in the price and an increase in the speed of
obtaining genomic information using next-generation sequencing (NGS). This has resulted in the
generation of high volume of Deoxyribonucleic acid (DNA) sequencing data and numerous genomic
projects (Chan et al., 2017). Gene annotation is a crucial step for genomic sequence after the genome
16
assembly process (Chan et al., 2017) and it is necessary for downstream bioinformatics analyses and
for designing genomic tools for biological assays (Foissac et al., 2008). Bioinformatics is used to solve
molecular problems by integrating the knowledge of mathematics, statistics, computer science,
biochemistry, informatics and artificial intelligence (Qader and Al-Khafaji, 2014). The discovery of
protein-coding genes enables gene prediction (structure, function, behaviour and interaction) for better
understanding of biological mechanisms (Foissac et al., 2008; Qader and Al-Khafaji, 2014). Gene
finders employ computational tools such as (a) Neural Network (Ying et al., 1996), (b) Conditional
Random Field (De Caprio et al., 2007), (c) Support Vector Machine (Schweikert et al., 2009) and (d)
Hidden Markov Model (HMM) (Ter-Hovhannisyan et al., 2008) or some combination of these
(Cantarel et al., 2008), for predicting protein-coding genes. These programs are trained using known
or existing gene models, which could lead to a biased outcome (Goel et al., 2013; Seaver et al., 2014).
Nevertheless, HMMs program have been reported to be the most accurate gene finder (Foissac et al.,
2008).
Bioinformatics tools have been used in diverse plant species to annotate genes. This approach was
used to characterize and understand the structure and evolutionary history of the LOX gene family in
pear and 23 LOX genes were identified (Li et al., 2014). Chen et al. (2015) identified and characterized
20 putative LOX genes in the poplar genome. Song et al. (2016) used bioinformatics approach to
identify 122 LOX genes in seven legume genomes and establishing phylogenetic relationships. Zhu et
al. (2018) identified 11 LOX genes in tea, examined their phylogenetic relationships and carried out
comparisons with other plants. Ji et al. (2020) used bioinformatic tools to identify 11 lipoxygenase
genes in Tartary buckwheat, systematically predicted their gene structure, protein properties and
phylogenetic relationships among their family members.
17
3.0 MATERIALS AND METHODS
3.1 LOX gene mining
LOX gene mining was initially carried out by using Exonerate on queries from Glycine max
(NP_001235189.1 lipoxygenase, VLXC KRH47066, LOX-1.1 KRH23266, LOX-1 KRH23267,
LOX-2 KRH23265 and LOX-3 KRH10050) and V. faba (CAA97845.1 lipoxygenase) lipoxygenase
proteins of different targets to identify similarities in the faba bean whole sequence based on the
Hedin/2 genome assembly in progress at the University of Helsinki, Finland. LOX genes (DNA) from
the Hedin/2 genome assembly and RNAseq sequences (cDNAs) were converted to amino acid
sequences using Expasy (https://web.expasy.org/translate/).The genes were inspected to confirm the
presence of Pfam (PF00305) LOX domain using InterProScan program v. 83.0
(https://www.ebi.ac.uk/interpro/search/sequence/), Simple Modular Architecture Research Tool
(http://smart.embl-heidelberg.de/), Pfam v. 33.1 (https://pfam.xfam.org/search/sequence) and NCBI
conserved domain tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Protein sequences
domain were rejected. The length, weight and isoelectric point, instability index and Grand average of
hydropathicity (GRAVY) of the selected genes were calculated using the protoparam program
(https://web.expasy.org/protparam/) while DNA length was obtained using the molbiotools DNA
calculator (http://www.molbiotools.com/dnacalculator.html).
Position specific similarity search was carried out with PSI-BLAST program ("Position-Specific
Iterated BLAST") (https://www.ebi.ac.uk/Tools/sss/psiblast/) to find Glycine max (Gm) and Pisum
sativum (Ps) seed LOX sequences significant similar to the faba bean putative LOX genes in
UniPortKB/Swiss-Prot database in order to uncover evolutionary relationships.
The molecular evolutionary history of the putative LOX gene sequences of faba bean was examined
by investigating their phylogenetic relationships with other seed LOX genes in legumes. Seed LOX
amino acid sequences were downloaded for Soybean LOX 1 (P08170), LOX 2 (P09439), LOX 3
(P09186) and LOXX (P24095) along with Pea LOX 2(P13856) and LOX 3 (P09918) from EMBL-
EBI Uniprot database v. 2020_6 (https://www.uniprot.org/). Seed LOX amino acid sequences were
also downloaded for 9S LOX Vigna radiata, LOX 3 V. unguiculata, LOX 1 Lens culinaris, LOX 3
Glycine soja, LOX 2 Lupinus angustifolius, LOX 2 Arachis hypogea, LOX 2 Arachis ipaensis, LOX
3 Cajanas cajan, 9S LOX Medicago truncatula, LOX 3 Cicer arietinum, LOX 3 Mucuna pruriens,
LOX 3 Abrus precatorius and LOX 3 Vigna unguiculata from the National Center for Biotechnology
Information (NCBI) database. Twenty-four seed LOX amino acid sequences were analyzed including
the six faba bean LOX genes. ClustalW program web tool (https://www.genome.jp/tools-bin/clustalw)
and MEGA-X software were used for phylogenetic analysis. Data obtained from ClustalW multiple
sequence alignment (MSA) was used to construct a phylogenetic tree using the neighbour-joining
method with 1000 bootstrap replications. The structures of the aligned genes were visualized using the
Constraint-based multiple alignment tool on NCBI
(https://www.ncbi.nlm.nih.gov/tools/cobalt/cobalt.cgi) and GSDS 2.0 online tool (http://gsds.gao-
lab.org/).
3.3 Identification of conserved motifs and subcellular localization
The putative seed LOX genes were analysed for conserved motifs using MEME v 5.3.0 (http://meme-
suite.org/tools/meme) including seed LOX protein sequences from soybean (LOXs 1, 2, 3 and X) and
pea (LOXs 2 and 3). The web server of MEME was used to draw five motifs from the protein sequences
using minimum 6 and maximum 50 motif width, respectively. A 3D structure of the faba bean LOX
gene with complete sequence was modelled. This model was predicted using swiss model protein
structure homology-modelling server (https://www.expasy.org/resources/swiss-model) (Bienert et al.,
2017) and its secondary structural position was analysed based on the soybean LOX-3 model. The
subcellular localization of faba bean putative seed LOX genes were predicted using WoLF PSORT
program (https://wolfpsort.hgc.jp/), Cell-PLoc program (http://www.csbio.sjtu.edu.cn/bioinf/Cell-
PLoc/) and SoftBerry (http://www.softberry.com/berry.phtml).
Three primer sets were derived using Primer3 v. 4.1.0 (https://primer3.ut.ee/) and NCBI Primer-Blast
(https://www.ncbi.nlm.nih.gov/tools/primer-blast/) based on the conserved region of Gene 1, 2 and 3
nucleotide sequences. The position of the primers is shown in Table 1. However, to have a larger
(5357(try123R)) of gene 3 was synthesized.
Table 1: Primer sets from the faba bean seed LOX Genes 1, 2 and 3
Gene Primer Sequence (5’ => 3’) Length Start GC%
1 Forward AGAGGCTGATAGCTTTGGTCC 21 209 52.38
Reverse GTCGCGATAGTGTGGAAGCA 20 446 55.00
2* Forward** TTGGTTGAACACTCACGCTG 20 341 50.00
Reverse TACCCTCAGCATTGACCAGG 20 498 55.00
3 Forward AAGAGGAATGGCGGTTGAGG 20 605 55.00
Reverse** GGGAATGCCTCGGAAAGTCA 20 1346 55.00
* In the synthesized primer, the 16th nucleotide (C in red) in the forward primer of Gene 2 was changed
to Y because of dissimilarity between the three genes when aligned (See Appendix 1).
** Gene 2 forward primer and Gene 3 reverse primer were synthesized as 5356(try123F) and
5357(try123R), respectively, and used in seed LOX gene amplification in faba bean lines.
3.5 Primer amplification in faba bean lines
DNA was extracted from seed samples of twelve lines of faba bean, namely Alexia, Aurora, Babylon,
Chinese line, Duc line, Fatima, Fuego, Hedin, ILB938, Link 2-1, Melodie and Misr. The master mix
of PCR reactions (50 µl) include 3 µl 10 x Dream Taq PCR buffer with Magnesium chloride (MgCl2),
1.25 µl 5356(try123F) and 5357(try123R) primers, 1.0 µl 10 mM dNTP, 34.5 µl sterile water, 1.0 µl
Taq polymerase enzyme. 1 µl DNA was pipetted into labelled tubes including a negative control
(sterile water) and 49 µl of the PCR master mix was added to each sample. The samples were covered
and placed in the wells of the PCR machine. Amplification was initiated at 94°C for 2 minutes,
followed by 35 cycles of denaturing at 94°C for 30 seconds, primer annealing at 54°C for 30 seconds,
elongation time at 72°C for 1 minutes 30 seconds and termination time at 72°C for 5 minutes.
For the gel, 4.2g of agarose was mixed with 300 ml of 1 x TAE (40 mM Tris-acetate, 15 µl EDTA (10
mg/ml)) running buffer and dissolved by heating in a microwave for 2 min. After the solution had
cooled, 15 µl of ethidium bromide was added. The melted agarose was poured into the gel mold,
allowed to solidify for 10 minutes at room temperature, and transferred to a gel electrophoresis
apparatus. 20 µl of each sample were loaded into the wells along with 5 µl of 1kb Gene ladder. The
20
apparatus was covered and connected to 80 V and 2250 mA of current for 2 hours 20 minutes. After
electrophoresis, the gel was exposed to UV light and pictures of the bands were taking using the gel
documentation system.
After gel electrophoresis, the remaining PCR products were purified using GeneJET PCR Purification
Kit (Thermo Scientific, Vantaa, Finland). A 3 µl sample of the amplicon of each line was cloned into
a mix of 1 µl of pGEM T Vector, 5 µl of 2 x ligation buffer and 1 µl of T4 DNA Ligase and left for
ligation for 1 hour 30 minutes. 3 µl of ligated sample was added to 30 µl of JM 109 cells and left on
ice for 30 minutes. Heat shock of 40 seconds at 42°C was used for transformation and the samples
were returned to the ice for 2 minutes, then 250 µl of SOC media was added and the bacteria were
grown at 37 C in a shaking incubator for 30 minutes. 100 µl of the cell suspension was pipetted into
a dry LB/amp plate, spread uniformly and incubated at 37 C overnight. A colony with white coloration
was suspended in 100 µl colony buffer. PCR amplification was carried following the PCR program in
the preceding section (modified for cycle number = 23) to confirm the presence of LOX gene insert
and amplification at the desired band size (1.2 kb). A Thermo Scientific miniprep kit (Thermo
Scientific, Vantaa, Finland) was used to produce plasmid DNA. Quantity and quality of DNA was
checked using nanodrop machine.
3.7 Analysis of faba bean seed for LOX DNA sequence
The DNA of the seed LOX genes of faba bean was sequenced by Eurofins Genomic, Germany. The
DNA sequences were cleaned of primer sequences of the promoters (SP6 and T7 of pGEM T Vector)
and T7 sequence was read from opposite end (as reverse complement strand using
https://www.bioinformatics.org/sms/rev_comp.html) of the cloned insert of SP6. The sequences were
trimmed at the 5’ and 3’ end to have a matching sequence length for all the faba bean lines. The
prepared sequences were subjected to MSA using the ClustalW program and visualized with GeneDoc.
Phylogenetic tree analysis was performed using the neighbour-joining method implemented in the
MEGA-X software for multiple substitutions and a 1000 bootstrap data set.
4.0 RESULTS
4.1 Sequence identification and structural feature of putative faba bean seed LOX genes
The LOX genes in faba bean were identified using InterProScan and SMART (Pfam: PF00305) web
server against 66 gene sequences (twenty-three LOX DNAs and forty-three RNAseq sequences
(cDNAs)) obtained from the faba bean (Hedin/2) genome query. Six putative LOX genes that
contained the LOX and/or PLAT/LH domains were identified and retained (Figure 5a-f). Genes 1, 2,
3, 7 and 10 were from RNAseq while Gene 6 was from the Hedin/2 genome assembly. All the six seed
LOX genes except Gene 6 contained LOX domain 3, LOX 1 binding site and Linoleate 9S-
Lipoxygenase-4. Only Genes 1, 6 and 7 contained a PLAT/LH2 domain and Lipase/Lipoxygenase
superfamily domain. Genes 1 and 7 combined lipoxygenase domain 3, PLAT/LH2, Lipase/Lipoxygenase
superfamily, Lipoxygenase superfamily, LOX 3 superfamily and Linoleate 9S-Lipoxygenase-4 domains. Gene
1 was a full-length sequence, showing no loss of conserved regions in the N- and C-terminal domains
(Table 2). In contrast, Genes 2 and 3 lacked the conserved region in the N-terminal domain, while
Genes 6, 7 and 10 lacked the conserved region in the C-terminal domain.
22
(a)
23
(b)
24
(c)
25
(d)
26
(e)
27
(f)
Figure 3. (a), Gene 1; (b), Gene 2; (c), Gene 3; (d), Gene 6; (e), Gene 7; (f), Gene 10.
Important codes: PF00305 (Pfam); PS51393 (LOX 3); IPR042057 (PLAT/LH2); SSF49723 (Lipase/Lipoxygenase superfamily); SSF48484
(Lipoxygenase superfamily); PS51393 (LOX 3); IPR027433 (LOX 3 superfamily); PS00081 (LOX 2 conserved site); PS00711
(LOX 1 binding site); PTHR11771:SF122 (Linoleate 9S-Lipoxygenase-4); PTHR11771:SF118 (Seed Linoleate 9S-Lipoxygenase-
4); SSF4923/G3DSA:2.060.60.20 (Lipase/Lipoxygenase superfamily)
28
Table 2: NCBI CD-Blast showing the completeness of the conserved domain (CD) in the faba bean putative genes
Gene From To E-Value Bit score Accession Short name Incomplete
1 1 853 0.00 1392.10 cl33468 PLN02336 superfamily -
2 1 436 0.00 861.80 cl37981 Lipoxygenase superfamily N
3 1 436 0.00 849.85 cl37981 Lipoxygenase superfamily N
6 1 183 0.00 56.23 cl33468 PLN02336 superfamily C
7 1 404 0.00 562.38 cl33468 PLN02336 superfamily C
10 1 272 0.00 453.48 cl37981 Lipoxygenase superfamily C
Note: The incomplete column indicates whether there is any missing part of the amino acid sequence of the genes at either N- or C- terminus as compared
to the CD reference sequence. Sequence with more than 20% alignment omission of the CD is registered as incomplete.
Where -: indicates complete domain, N: incomplete at the N-terminus, C: incomplete at the C-terminus.
29
4.2 Physical and chemical properties of faba bean LOX proteins
The open reading frames of the faba bean LOX (VfLOX) genes were between 624 bp in Gene 6 to
2559 bp in Gene 1 while their corresponding LOX proteins contained 272 – 853 amino acids (Table
3). The molecular weight ranged from 23.67 kDa in Gene 6 to 96.45 kDA in Gene 1. The theoretical
isoelectric points were 5.36 – 9.28. All the proteins had isoelectric points in the acidic range except
Genes 6 and 7 which were alkaline. Genes 6 (33.09) and 7 (30.71) recorded the lowest instability index
while Genes 2 (51.00) and 10 (52.99) recorded the highest instability index. All VfLOXs had negative
grand average of hydropathicity except Gene 6 (0.096).
Table 3: Descriptive information about the putative LOXs in faba bean
Name Protein ORF
* GRAVY: Grand average of hydropathicity
ORF: Open Reading Frame
4.3 Protein position similarity search
Gene 1 demonstrated higher sequence identity and positivity with GmLOX 3 (73%, 85%) and PsLOX
3 (72%, 84%) than with other soybean and pea LOXs (Table 4). Genes 2 and 3 showed similarly high
sequence identity (73 – 75%) and positivity (84 – 86%) with GmLOX 3 and PsLOX, while Gene 7
showed slightly lower values. Gene 10 had nearly perfect sequence identity and positivity with PsLOX
3. In contrast, Gene 6 showed less than 60% position similarity with any of the soybean and pea LOXs.
30
Table 4: Position specific iterative sequence similarities between faba bean, soy (Gm) and pea
(Ps) seed LOXs
Gene 1 GmLOX 1 (13S) 64 78 0
GmLOX 2 (9S) 66 81 0
GmLOX 3 (9S) 73 85 0
GmLOX X (9S) 66 80 0
PsLOX 2 (9S) 68 81 0
PsLOX 3 (9S) 72 84 0
Gene 2 GmLOX 1 (13S) 66 83 0
GmLOX 2 (9S) 68 84 0
GmLOX 3 (9S) 75 86 0
GmLOX X (9S) 70 83 0
PsLOX 2 (9S) 69 83 0
PsLOX 3 (9S) 74 86 0
Gene 3 GmLOX 1 (13S) 66 82 0
GmLOX 2 (9S) 68 84 0
GmLOX 3 (9S) 75 85 0
GmLOX X (9S) 69 84 0
PsLOX 2 (9S) 68 84 0
PsLOX 3 (9S) 73 85 0
Gene 6 GmLOX 1 (13S) 56 65 5.0E-14
GmLOX 2 (9S) 39 48 3.0E-20
GmLOX 3 (9S) 36 48 9.0E-16
PsLOX 2 (9S) 42 51 7.0E-26
PsLOX 3 (9S) 49 64 4.0E-11
Gene 7 GmLOX 1 (13S) 62 72 2.0E-16
GmLOX 2 (9S) 63 75 3.0E-17
GmLOX 3 (9S) 70 82 0
GmLOX X (9S) 62 76 3.0E-17
PsLOX 2 (9S) 65 79 4.0E-18
PsLOX 3 (9S) 69 81 0
Gene 10 GmLOX 1 (13S) 63 78 2.0E-12
GmLOX 2 (9S) 71 84 1.0E-13
GmLOX 3 (9S) 86 94 2.0E-17
GmLOX X (9S) 67 82 8.0E-13
PsLOX 2 (9S) 71 84 1.0E-13
PsLOX 3 (9S) 96 99 0
31
4.4 Phylogenetic analysis and structure of aligned genes
Phylogenetic analysis (Figure 6) revealed that 18 of the seed LOXs were characterised as 9S protein
type and 6 (Soy LOX 1, Soy LOX 2, LOX 2 A. hypogea, LOX 2 A. ipaensis, LOX 2 pea and VfLOX
Gene 6) as 13S or 9/13S protein type. Hence, the LOX gene are divided primarily into LOX 2 and
LOX 3 groups with at least 50% bootstrap support, made up of 6 sub-groups. LOX 3 of G. soja, G.
max, V. unguiculata, C. cajan, M. pruriens, A. precatorius, C. arietinum and P. sativum clustered with
VfLOX Gene 10 in the first sub-group while 9S-LOX M. truncatula and LOX 1 L. culinaris were
closely aligned with VfLOX 1, 2, 3 and 7 in the second sub-group. This indicates that most of the faba
bean lipoxygenase genes belong to LOX 3. Sub-group three consisted of LOXX G. max, 9S-LOX V.
radiata and LOX 2 L. angustifolius while VfLOX Gene 4 was alone in sub-group four. LOX 2 A.
ipaensis and LOX 2 A. hypogea clustered in sub-group five while LOX 2 P. sativum, LOX 1 G. max
and LOX 2 G. max clustered in sub-group six.
GSDS analysis (Figure 7) showed that Gene 6 had two UTRs and two exons. The conserved position
of Gene 2 after MSA introduced two gaps into Genes 1 and 7. Genes 1, 2, 3, 7 and 10 did not contain
any introns. Genes 1, 2, 3, 7 and 10 are derived from cDNAs which explains why they do not contain
introns. From this result, it is possible that a full-length LOX gene is fragmented into Genes 7 and 2
or 3 because MSA showed identical sequences between them (Appendix 2).
32
32
Figure 6: Phylogenetic analysis of seed LOX genes in legume (Red circles: VfLOX genes)
Figure 7: Full-length gene structure of Putative LOX genes in faba bean
33
33
4.5 Identification of conserved motifs
Five conserved motifs were identified, most of which were shared with the soybean and pea LOXs
(Figure 8). Motifs 1, 2 and 3 are in the C- terminus of the genes while Motifs 4 and 5 are conserved
on the N-terminus of the genes. Motif 1 is 50 amino acid residues long and includes five histidine
residues [His-(X)4-His-(X)4-His-(X)17-His-(X)8-His] from position 7 to position 44 on the motif in
VfLOX Genes 1, 2 and 3. Motifs 2 and 3 are also made up of 50 amino acid residues found in VfLOX
Genes 1, 2 and 3 and shared with soybean and pea LOXs. Motif 4, made up of 42 amino acid residues,
was found in VfLOX Genes 1, 6 and 7 while Motif 5, of 50 amino acid residues, was found in VfLOX
Genes 1, 7 and 10.
The three-dimensional structure of VfLOX Gene 1 was modelled since it was the only gene with a
complete amino acid sequence that was similar to that found in soybean and pea LOX genes. The
predicted structure showed the N-terminal domain forming a β-barrel (residues 1-151 aa) and the C-
terminal domain (residues 152-853 aa) forming a bundle of helices (Figure 9). It contains Fe II with 5
amino acid residues within 4 and 3,4-Dihyroxybenzoic acid ligands with 12 amino acid residues
within 4. The predicted structure of VfLOX Gene 1 showed much closer structural similarity to
GmLOX 3 than to GmLOX 2. MSA of VfLOX Genes 1, 2 and 3 with GmLOXs 1, 2 and 3 and PsLOX
1 and 2 showed that VfLOX Gene 1 contained the five conserved amino acid residues essential for
iron binding (Appendix 3) at positions H.513, H.518, H.704, N.708 and I.853.
The predicted subcellular localization of Genes 1, 7 and 10 was the cytoplasm, while Genes 2 and 3
were predicted to be localized in the cytoplasm and chloroplast and Gene 6 was in the cytoplasm,
chloroplast and peroxisome (Table 5).
34
34
(a.)
Motif 1 Motif 2 Motif 3 Motif 4 Motif 5
Figure 8: (a.) Motifs 1, 2, 3, 4 and 5 showing the conserved amino acids between faba bean (Gene
1, 2, 3, 6, 7 and 10), Soybean (LOX1, LOX2, LOX3 and LOXX) and Pea (LOX2 and
LOX3) and (b.) the location of the discovered motifs on the genes
Note: Red triangles denote histidine residues [His-(X)4-His-(X)4-His-(X)17-His-(X)8-His]
from position 7 to position 44 in Motif 1
35
35
Figure 9: Ribbon diagram of the three-dimensional structure of the putative faba bean seed LOX
Gene 1: (a.) the conserved β-Barrel structure (Blue) and C-terminus domain (Red) (b.)
Iron-binding site (red and white) with 5 amino acid residues with 4 and 3,4-
Dihyroxybenzoic acid ligand (tiny purple balls) with 12 amino acid residues with 4.
Table 5: Subcellular localization of putative seed LOX genes in faba bean
Gene WoLF PSort Cell-PLoc SoftBerry Decision
1 Cy Cy Cy Cy
2 Cy Ch Cy/Ch Cy
3 Cy Ch Cy/Ch Cy
6 Ch Cy/Ch Cy Ch
7 Cy Cy Cy Cy
10 N Cy Cy Cy
Key: Ch – Chloroplast; Cy – Cytoplasm; N – Nucleus
4.6 Gene amplification
Primers that covered about 1.2 kb were designed, based on the conserved region of Genes 1, 2 and 3.
Gel electrophoresis (Figure 10) showed the PCR amplification of the faba bean seed LOX genes were
obtained with the expected sizes (~ 1.2 kb) for all twelve lines. The amplification intensity varied
among the lines.
36
36
Figure 10: Gel electrophoresis image showing seed LOX gene amplification in faba bean lines (~
1.2 kb)
4.7 Phylogenetic analysis of selected faba bean lines seed LOX
DNA sequence length obtained for the Faba bean lines differed; Alexia (144 bp), Aurora (1239 bp),
Babylon (567 bp), Chineseline (1187 bp), Ducline (1104 bp), Fatima (1159 bp), Fuego (1156 bp),
Hedin (1197 bp), ILB938 (1142 bp), Link2-1 (1199 bp), Melodie (1187 bp) and Misr (1246 bp). Alexia
and Babylon DNA sequences were excluded from further analysis because their sequences were
apparently incomplete. The remaining sequences were converted to amino acids and subjected to MSA
(Appendix 4) to elucidate the phylogenetic relationships (Figure 11), identify conserved motifs (Figure
12) and determine their subcellular localization (Table 6).
The tree showed that the lines fell into two major groups, group 1 including Chinese line, Duc line,
Hedin, ILB938, Link2-1 and Melodie and Misr, and group 2 including Aurora, Duc line, Fatima and
Fuego. ILB938 and are closely related to each other but shared recently common ancestors with
Melodie and Misr. Chinese line and Hedin were closely related to each other but shared recent common
ancestors with Link2-1. Aurora was not directly grouped with any line but was the most closely related
to Fatima and Fuego, which in turn diverged from the other lines but were grouped closely together.
Five motifs of about 41 to 50 aa were shared between the faba bean lines. Motifs 1 and 2 are highly
conserved in all the lines while motifs 3 and 4 were similarly shared by all the lines except Fatima.
Aurora, Fatima and Fuego did not share Motif 5. Fatima and Melodie LOX were predicted to be
localized in the chloroplast/cytoplasm and plasma membrane, respectively; Chinese line, Hedin and
Misr LOX were predicted to be in the cytoplasm; ILB938, Link2-1, Duc line LOX were predicted to
be in the chloroplast while the predicted subcellular location of Aurora and Fuego LOX were not
clearly defined.
37
37
Figure 11: Phylogenetic tree analysis of faba bean lines seed LOX
38
38
(a.)
(b.)
Legend
1 2 3 4 5 Motif 1 Motif 2 Motif 3 Motif 4 Motif 5
Figure 12: (a.) Motif 1, 2, 3, 4 and 5 showing the conserved amino acids between the ten faba bean
lines seed LOX and (b.) the location of the discovered motifs on the genes
39
39
Table 6: Subcellular localization of faba bean lines seed LOX
Lines WoLF PSort Cell-PLoc SoftBerry Decision
Melodie Ch/Cy Ch Cy Ch/Cy
Hedin Cy Ch Cy Cy
ILB938 Ch Ch Ch Ch
Aurora E/Ch Ch Cy *
Fuego Ch Ch/N Cy *
Fatima Pm Ch Cy *
Key: Pl – Plasma membrane; Ch – Chloroplast; Cy – Cytoplasm; E – Extracellular; N – Nucleus
* - Not clearly predicted.
Characteristic off-flavours generation has been reported during and after the processing of faba bean
seeds, therefore, this study was carried out to identify the seed-borne LOX genes regulating this trait
and design a biological tool using bioinformatics approach. Seed-borne LOX genes associated with
the generation of off-flavours have been well elucidated in soybean and pea. Using HMM algorithm
in SMART Pfam and InterPro, six putative faba bean seed LOX and/or PLAT/LH-domain containing
genes were identified. Physical and chemical properties, protein position similarity search,
phylogenetic analysis, structural analysis, motif identification, and prediction of subcellular
localization were carried out on these genes.
The six putative faba bean LOX genes identified differed in their protein length, theoretical PI,
instability index, hydropathicity, amino acid sequences, and ORF length of the nucleotide sequences.
This suggests that there are differences in biological and functional diversification as well as
expression patterns of the seed borne LOXs in faba bean. Similar findings in soybean were reported
by Dubbs and Grimes (2000) and Porta and Rocha-Sosa (2002), suggesting that differences in the
function of various lipoxygenase isoenzymes arise from differences in their optimal pH, substrate
specificity, and subcellular localization. VfLOX Gene 1 (853 aa) is the only full-length gene identified
and has an amino acid sequence length similar to that found in soybean seed LOXs 1, 2, and 3 (838 to
865 aa) and pea seed LOX 2 and 3 (861 – 864 aa). This VfLOX has an isoelectric point of pH 6.93,
which is very close to the pH 7.0 reported for soybean seed LOX 3 (Skrzypczak-Jankun et al., 1997).
The molecular weight of VfLOX Gene 1 (96.5 kDa) falls within the range reported in soybean and pea
seed LOXs (94 – 97 kDa) (Sanz et al., 1993; Skrzypczak-Jankun et al., 1997; Loiseau et al., 2001).
VfLOX Gene 2 and 3 lacked the N-terminus LOX domain and VfLOX Gene 6, 7, and 10 lacked the
C-terminus LOX domains, which possibly explains why their isoelectric points were extreme. Chen et
al. (2015) also reported that in poplar, LOX protein isoelectric properties vary, and that this variation
indicates the difference in individual LOX ionic strength, pH, and optimal performance in the presence
of a reducing agent.
Phylogenetic analysis showed the evolutionary relationship between the VfLOX genes and different
legume seed lipoxygenases. VfLOX Genes 1, 2, 3, and 7 were highly related to 9S-LOX of M.
truncatulata and LOX 1 of L. culinaris while VfLOX Genes 6 and 10 were closely related to LOX 2
41
41
of pea and LOX 3 of pea, respectively. Evolutionary divergence in the gene phylogenetic tree may
indicate functional role differences and genes sharing the same cluster may share common functions
(Zhu et al., 2018). As earlier discussed, plant lipoxygenases are divided into 9-LOX or 13-LOX
subfamilies (Brash, 1999), and VfLOX Genes 1, 2, 3, 7, and 10 were grouped with the 9S-lipoxygenase
type while VfLOX Gene 6 was grouped with the 13S-lipoxygenase type. This suggests that all the
identified putative seed lipoxygenase genes in faba bean should be 9S-lipoxygenases except VfLOX
Gene 6. Based on their sequence characteristics and evolutionary relationship with other LOXs,
VfLOX Gene 6 demonstrates the characteristics of LOX 2, and VfLOX Genes 1, 2,3, 7, and 10 have
the characteristics of LOX 3. MSA revealed a 6-amino acid sequence similarity between VfLOX Gene
7 from the N-terminus and VfLOX Genes 2 and 3 from the C-terminus suggesting that this could be
another VfLOX gene or a variant of VfLOX Gene 1. This is further supported by the fact that VfLOX
Gene 1 differed slightly by 2 amino acids in this region. The fragmentation of the gene during RNAseq
could be the probable reason for this observation.
When the intron/exon structure was examined, similarity was found in the shared exon/intron structure
for all the identified genes. Only VfLOX Gene 6 showed the presence of UTR in each of its open
reading frames. VfLOX Genes 1, 2, 3, 7 and 10 harbour no introns which is expected because the
sequence analysed were cDNAs. Lack of introns was also reported in poplar LOX5 by Chen et al.
(2015). Takashima et al. (2011) stated that the absence of introns in a gene might be because of recent
intron acquisition.
N-terminal PLAT domain (Pfam01477) and C-terminal lipoxygenase domain (Pfam00305) are the two
lipoxygenase domains present in plants (Shin et al., 2012). In this study, only VfLOX Gene 1 of the
six putative faba bean seed LOX genes contained both plant lipoxygenase domains. Swissport
modelling based on GmLOX3 showed that VfLOX Gene 1 conformed to the same tertiary protein
structure. His 499 and His 504 in LOX 1 in soybean are primarily required for lipoxygenase activity
(Weaver, 2000) while His 532 in LOX 2 corresponds to His 504 in LOX 1 and His 518 in LOX 3 due
to variable amino acid sequence length. The corresponding histidines were at H513 and H518 in
VfLOX Gene 1, thus being slightly different from soybean LOX 1 and LOX 2 and closely related to
soybean LOX 3.
42
42
In this study, the lipoxygenase domain located within the C-terminal binding domain was more
conserved than other parts of the faba bean seed LOX sequences. The sequence of the N-terminal
region was variable and less conserved in terms of length and amino acid composition. Similar results
were reported by Schneider et al. (2007) and Liu et al. (2011) in cucumber. The closely related genes
had common motif composition, which suggests similarities in functionality among the lipoxygenase
proteins.
A set of key residues (H513, H518, H704, N708, I853), found in three of the putative faba bean seed
lipoxygenase genes (VfLOX Genes 1, 2, and 3), aligns with a set that has been found in the primary
structure of the soybean LOX 1 and LOX 2 isozymes (Shibata et al., 1987, 1988). The histidine
residues (His499, His504, His690, Asn694, and Ile839 in soy) are essential for iron-binding and the
isoleucine as the C-terminal amino acid act as a monodentate ligand (Steczko et al., 1992; Minor et
al., 1993). Motif 1 of the VfLOX genes was similar to a highly conserved motif in lipoxygenase genes
of cucumber (Zhang et al., 2006; Liu et al., 2011) and poplar (Chen et al., 2015). This region plays an
important role in enzymatic activities and substitution of any of the residues will alter enzyme function.
This suggests that this region can be targeted during studies for functional differentiation within faba
bean lines. It was reported by Chen et al. (2015) that genes that share common motif composition
possess similarities in functional properties while the opposite is true for genes with divergent motif
compositions.
Lipoxygenase is predominantly found in the cytosol (Siedow, 1991) of plants, but non-cytosolic
lipoxygenase has been reportedly located in the nodule and root of faba bean (Porta and Rocha-Sosa,
2002). The subcellular localization of the faba bean seed lipoxygenase proteins was predicted to be
primarily in the cytoplasm and chloroplast. As earlier elucidated, all the genes are 9S-LOX type and
primarily located in the cytoplasm, except the 13S-LOX type VfLOX Gene 6 which was predicted to
be localized in the chloroplast. Similar Shaban et al. (2018) predicted that in cotton, all the 13-LOX
type II genes encode chloroplast proteins, while most 9-LOX and 13-LOX type I proteins are
preferentially localized in the cytoplasm.
When a primer pair was synthesized and used in the amplification of the VfLOX Gene 1, all tested
lines showed amplification of a band about 1.2 kb in size, showing that the marker is effective in
determining the presence/absence of the seed LOX gene in a diverse range of germplasm. This could
43
43
be a useful tool in the search of line(s) that have null-allelic seed-borne LOX genes or low LOX gene
activity. In retrospect, low-LOX genotypes have been developed in soybean (Hajika et al. 1992) and
pea (Casey et al. 1998) with the aid of molecular markers. Further analysis showed phylogenetic
diversity in the amplified LOX genes sequenced from different faba bean lines. Duc line, ILB938,
Link2-1, and Melodie are closely related phylogenetically, shared the same motif composition and are
subcellularly predicted to be localized in the chloroplast. Similarly, though Melodie grouped quite
distantly from Chineseline, Hedin, and Misr, it also shared the predicted subcellular localization in the
cytoplasm. This indicates that the lines are somewhat grouped by their protein structure and similarities
as similarly reported in several studies (Chen et al., 2015; Shaban et al., 2018). Based on their predicted
subcellular localization, it is suggested that all lines with chloroplast localized LOX proteins contain
13S-LOX genes while cytoplasmic localized LOX proteins contain 9S-LOX and 13S-LOX genes. The
catalytic function and hydroperoxide substrate acquisition of lipoxygenase isoforms influence their
activities and subcellular localization. Though all the faba bean lines shared highly similar LOX
protein sequences at the C-terminus region, the N-terminus plays important role in fatty acid-binding
and oxygenation that produces hydroperoxides (Newcomer and Brash, 2015). The N-terminus region
differs greatly among the faba bean lines and this could explain the variation in the predicted
subcellular location of the LOX genes in faba bean lines obtained in this study. Thus, full-length
sequencing of the VfLOX gene for all the lines is necessary to have better insight into their structural
basis and functionalities.
6.0 CONCLUSION
A bioinformatic approach was employed to identify seed-borne LOX genes in faba bean and to design
tools using molecular techniques to find change in gene sequence in different lines. In this study, six
putative seed LOX genes containing either or both Lipoxygenase and PLAT/LH Pfam domains were
identified from the faba bean (Hedin/2) genome sequence. All the VfLOX genes identified fell into
9S-LOX gene type except Gene 6 which was grouped with 13-S LOX gene type. Also, all the VfLOX
genes exhibited strong physical and chemical similarity with soybean seed LOX 3 except Gene 6. Only
VfLOX Gene 1 is a full-length gene (i.e. contain both N-terminus and C-terminus region) and it is
tentatively named VfLOX 3. However, VfLOX Genes 7 and 2 or 3 seemed to be a fragment of another
VfLOX gene or a variant of VfLOX 3 because they showed sequence similarity in the middle after
MSA. Furthermore, sequence variation was found when VfLOX 3 was amplified in twelve faba bean
lines of diverse origins. What remains to be evident is the reason for the observed differences in the
predicted subcellular localization of the LOX gene in the faba bean lines. This could be due to the
insufficiency of the amplified region of the LOX gene (largely lacking the N-terminus region) to give
accurate information about the gene’s catalytic activities and structural basis in the faba bean lines.
Finally, a molecular tool has been developed in this study which can be used in the future for breeding
faba bean with null-allelic seed-borne LOX genes or low seed LOX gene activities.
45
45
7.0 ACKNOWLEDGEMENT
I would like to thank my supervisor, Professor Frederick Stoddard for his guidance and for taking
ample time to correct this thesis. My profound gratitude goes to Professor Alan Schulman for providing
me with all the needed assistance and helping me to understand this research. I would like to thank Dr
Chang Wei and Anne-mari Narvanto for their immeasurable contribution and support.
My profound gratitude goes to the European Union for providing the fund that supported my
participation in this degree. I am thankful to the coordinators of Erasmus Mundus Master’s Degree in
Plant Breeding Coordinators, Dr Alicia Ayerdi-Gotor, Professor Teemu Teeri and Aude Martin for
providing me with academic and moral support every time it was needed. I am happy to have met all
my colleagues who have been a family and support system all through this journey. My special thanks
go Umama Hani, Marjus Cyco and Camila Gonzalez for always being there for me.
I would not have made it this far without the prayers and encouragement from my parents, siblings,
extended family, and friends. This success is dedicated to you all. Lastly, I would like to appreciate
the reader of this thesis, thank you.
46
46
8.0 REFERENCES
Aanangi, R., Kotapati, K. V., Palaka, B. K., Kedam, T., Kanika, N. D., and Ampasala, D. R., 2016.
Purification and characterization of lipoxygenase from mung bean (Vigna radiata L.) germinating
seedlings. 3 Biotech, 6(1): 113.
Arese, P. and De Flora, A., 1990. Pathophysiology of hemolysis in glucose-6-phosphate
dehydrogenase deficiency. Seminars in Hematology, 27: 1–40
Axelrod, B., Cheesborough, T. M. and Laasko, S., 1981. Lipoxygenase from soybean. Methods of
Enzymology. 71: 441.
Baysal, T., and Demirdöven, A., 2007. Lipoxygenase in fruits and vegetables: A review. Enzyme and
Microbial Technology, 40(4): 491–496.
Bienert, S., Waterhouse, A., de Beer, T.A.P., Tauriello, G., Studer, G., Bordoli, L., Schwede, T., 2017.
The SWISS-MODEL Repository - new features and functionality. Nucleic Acids Research, 45: 313-
319.
Björnsdotter,E., Nadzieja, M., Chang, W., Escobar-Herrera, L., Mancinotti, D., Angra, D., Khazael,
H., Crocol, C., Vandenberg, A., Stoddard, F., O’Sullivan, D., Stougaard, J., Schulman, A., Andersen,
S. and Geu-Flores, F., 2020. VC1 catalyzes a key step in the biosynthesis of vicine from GTP in faba
bean. bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.966523
Brash, A. R., 1999. Lipoxygenases: occurrence, functions, catalysis, and acquisition of substrate.
Journal of Biological Chemistry, 274(34): 23679–82.
Bulti M., Meseret C. E. and Mulatu W., 2019. Reconsidering the economic and nutritional importance
of faba bean in Ethiopian context. Cogent Food and Agriculture, 5(1): 1-12
Cantarel BL, Korf I, Robb SMC, Parra G, Ross E, Moore B, Holt C, Alvarado AS, Yandell M., 2008.
MAKER: an easy-to-use annotation pipeline designed for emerging model organism genomes.
Genome Research, 18: 188–96.
Chan, KL., Rosli, R., Tatarinova, T.V. et al., 2017. Seqping: gene prediction pipeline for plant
genomes using self-training gene models and transcriptomic data. BMC Bioinformatics, 18: 1–7.
Chang, P.R.Q. and McCurdy, A.R., 1985. Lipoxygenase activity in fourteen legumes. Canadian
Institute of Food Science and Technology Journal, 18: 94–96.
Chango, A., Villaume, C., Bau, H. M., Nicolas, J. P., and Mejean, L., 1995. Fractionation by thermal
coagulation of lupin proteins: Physicochemical characteristics. Food Research International, 28: 91-
99.
Chen Z, Chen X, Yan H, Li W, Li Y, Cai R, et al., 2015. The Lipoxygenase Gene Family in
Poplar: Identification, Classification, and Expression in Response to MeJA Treatment. PLoS ONE,
10(4): 1-13 https://doi.org/10.1371/journal.pone.0125526
Clark, J. E., 1998. Taste and flavour: their importance in food choice and acceptance. Proceedings of
the Nutrition Society (1998), 57: 639-643
Clemente, A., Olias, R. and Olias, J.M., 2000. Purification and characterization of broad bean
lipoxygenase isoenzymes. Journal of Agricultural and Food Chemistry, 48: 1070–1075.
Cooper, J. W. et al., 2017. Enhancing faba bean (Vicia faba L.) genome resources. Journal of
Experimental Botany, 68: 1941–1953.
Crepon, K., Marget, P., Peyronnet, C., Carrouee, B., Arese, P. and Duc, G., 2010. Nutritional value of
faba bean (Vicia faba L.) seeds for feed and food. Field Crops Research, 115: 329–339.
Day, L., 2013. Proteins form land plants – Potential resources for human nutrition and food security.
Trends in Food Science & Technology, 32: 25–42.
De Visser, C. L. M., Schreuder, R., and Stoddard F., 2014. The EU’s dependency on soybean import
for the animal feed industry and potential for EU produced alternatives. Oilseeds and fats, Crops and
Lipids Journal 21: D407 DOI 10.1051/ocl/2014021
DeCaprio D, Vinson JP, Pearson MD, Montgomery P, Doherty M, Galagan JE., 2007. Conrad: gene
prediction using conditional random fields. Genome Research, 17:1389–98.
Domoney C, Firmin JL, Sidebottom C, Ealing PM, Slabas A, Casey R, 1990. Lipoxygenase
heterogeneity in Pisum sativum. Planta, 181: 35–43.
Droillard, M.J., Rouet-Mayer, M.A., Bureau, J.M. and Lauriere, C., 1993. Membrane-associated and
soluble lipoxygenase isoforms in tomato pericarp – Characterization and involvement in membrane
alterations. Plant Physiology, 103: 1211–1219.
Dubbs WE, Grimes HD, 2000. The mid-pericarp cell layer in soybean pod walls is a multicellular
compartment enriched in specific lipoxygenase isoforms. Plant Physiology, 123: 1281–1288
Duc G., Magret, P. and Arese, P., 2011. Breeding priorities for improved nutritional value of Vicia
faba seeds.
Duc, G., 1997. Faba bean (Vicia faba L.). Field Crops Research, 53: 99–109.
Duc, G., Marget, P., Esnault, R., Le Guen, J., Bastianelli, D., 1999. Genetic variability for feeding
value of faba bean seeds (Vicia faba L.): comparative chemical composition of isogenics involving
zero-tannin and zero-vicine genes. Journal Agricultural Science Cambridge Core, 133: 185–196.
Ealing P, Casey, R., 1989. The cDNA cloning of a pea (Pisum sativum) seed lipoxygenase. Sequence
comparisons of the two major pea seed lipoxygenase isoforms. Biochemistry Journal, 264: 929–923.
FAO, 2020. Food and agriculture data. Retrieved December 24, 2020, from
http://www.fao.org/faostat/en/#search/beans
FAOSTAT, 2020. Food and Agriculture Organization of the United Nations.
http://www.fao.org/faostat/en/#home. Visited 27.02.2020.
FAOSTAT, 2018. Retrieved from http://www.fao.org/faostat/en/#data/QC.
Farmer, E.E. and Ryan, C.A., 1992. Octadecanoid precursors of jasmonic acid activate the synthesis
of wound inducible proteinase inhibitors. Plant Cell, 4: 129–134.
Foissac, S., Gouzy, J., Rombauts, S., Mathe, C., Amselem, J., Sterck, L., Van de Peer, Y., Rouze, P.
and Schiex, T., 2008. Genome Annotation in Plants and Fungi: EuGène as a Model Platform. Current
Bioinformatics, 3: 87-97
Forster, C., North, H., Afzal, N., Domoney, C., Hornostaj, A., Robinson, S. D. and Casey, R., 1999.
Molecular analysis of a null mutant for pea (Pisum sativum L.) seed lipoxygenase-2. Plant Molecular
Biology, 39: 1209-1220.
Fox, S. H, and Brotchie, J. M., 2014. Levodopa-induced dyskinesia in Parkinson’s disease. London,
England: Springer, https://doi.org/10.1007/978-1-4471-6503-3
Fruhbeck, G., Monreal, I., Santidrian, S., 1997. Hormonal implications of the hypocholesterolemic
effect of intake of field beans (Vicia faba L.) by young men with hypercholesterolemia. American
Journal Clinical Nutrition, 66: 1452–1460
Funk, M.O., Carroll, R.T., Thompson, J.F., Sands, R.H., Dunham, W.R., 1990. The role of iron in
lipoxygenase catalysis. Journal of the American Chemical Society, 112: 5375–5376.
Garreta A, Val-Moraes SP, Garcia-Fernandez Q, Busquets M, Juan C, Oliver A, Ortiz A, Gaffney BJ,
Fita I, Manresa A, Carpena X., 2013. Structure and interaction with phospholipids of a prokaryotic
lipoxygenase from Pseudomonas aeruginosa. Federation of American Society of Experimental
Biology Journal, 27: 4811–4821.
49
49
Göbel C, Feussner I, Schmidt A, Scheel D, Sanchez-Serrano J, Hamberg M, Rosahl S., 2001. Oxylipin
profiling reveals the preferential stimulation of the 9-lipoxygenase pathway in elicitor-treated potato
cells. Journal of Biological Chemistry; 276(9): 6267-73.
Gnanasambandam, A., Paull, J., Torres, A., Kaur, S., Leonforte, T., Li, H., Zong, X., Yang, T., &
Materne, M., 2012. Impact of molecular technologies on faba bean (Vicia faba L.) breeding strategies.
Agronomy, 2(3): 132–166
Goel N, Singh S, Aseri TC, Goel N, Singh S, Aseri TC., 2013. A review of soft computing techniques
for gene prediction. International Scholarly Research Notices Genomics, 2013: 1–8.
Grosjean, F., Bourdillon, A., Rudeaux, F., Bastianelli, D., Peyronnet, C., Duc, G., Lacassagne, L.,
2000. Valeur alimentaire pour la volaille de fe´veroles isoge´niques (Vicia faba L.) avec ou sans
tannins et avec ou sans vicine. Sciences et Techniques Avicoles 32 : 17–24.
Hajika M, Kitamura K, Igita K, Nakazawa Y., 1992. Genetic relationships among the genes for
lipoxygenase-1, -2 and -3 isozymes in soybean [Glycine max (L.) Merrill] seed. Japan Journal of
Breeding, 42: 787–792
Hendek Ertop M, Bekta M., 2018. Enhancement of bioavailable micronutrients and reduction of
antinutrients in foods with some processes. Food and Health, 4(3): 159-5.
Heng, L., van Koningsveld, G. A., Gruppen, H., van Boekel, M. J. A. S., Vincken, J.-P., Roozen, J. P.,
and Voragen, A. G. J., 2004. Protein-flavor interactions in relation to development of novel protein
foods. Trends in Food Science and Technology, 15: 217-224.
Heuze, V., Tran, G., Delagarde, R., Lessire, M., Lebas, F., 2018. Faba bean (Vicia faba). Feedipedia,
a programme by INRAE, CIRAD, AFZ and FAO. https://www.feedipedia.org/node/4926 Visited:
19/04/2021
Hilbers, M.P., Kerkhoff, B., Finazzi-Agro, A., Veldink, G.A. and Vliegenthart, J.F.G., 1995.
Heterogeneity and developmental changes of lipoxygenase in etiolated lentil seedlings. Plant Science,
111: 169–180.
Ho, C. T., and Chen, Q. Y., 1994. Lipids in food flavors. Lipids in Food Flavors, 2–14. doi:10.1021/bk-
1994-0558.ch001
Ivanov I, Heydeck D, Hofheinz K, Roffeis J, O’Donnell VF, Kuhn H, Walther M., 2010. Molecular
enzymology of lipoxygenases. Arch Biochem Biophys 503:161–174.
Ji, Q., Tianyuan Zhang, Dong Zhang, Shiming Lv and Aijuan Tan, 2020. Genome-wide identification
and expression analysis of lipoxygenase genes in Tartary buckwheat, Biotechnology &
Biotechnological Equipment, 34(1): 273-286, DOI: 10.1080/13102818.2020.1738956
Jiang, Z. Q., Pulkkinen, M., Wang, Y. J., Lampi, A.-M., Stoddard, F. L., Salovaara, H., ...
Sontag-Strohm, T., 2016. Faba bean flavour and technological property improvement by thermal pre-
treatments. LWT – Food Science and Technology, 68, 295–305.
Kato, T., Ohta, H., Tanaka, K. and Shibata, D., 1992. Appearance of new lipoxygenases in soybean
cotyledons after germination and evidence for expression of a major new lipoxygenase gene. Plant
Physiology, 98: 324–330.
Kato, T., Shirano, Y., Iwamoto, H. and Shibata, D., 1993. Soybean lipoxygenase L-4, a component of
the 94-kilodalton storage protein in vegetative tissues – expression and accumulation in leaves induced
by pod removal and by methyl jasmonate. Plant and Cell Physiology, 34: 1063–1072.
Kobayashi, A., Tsuda, Y., Hirata, N., Kubota, K., & Kitamuras, K., 1995. Aroma constituents of
soybean [Glycine max (L.) Merril] milk lacking lipoxygenase isoenzymes. Journal of Agriculture and
Food Chemistry, 43(9): 2449–2452. https://doi.org/10.1021/jf00057a025
Koda, Y., 1992. The role of jasmonic acid and related compounds in the regulation of plant
development. International Review of Cytology, 135: 155–199.
Kumar, V. and Rani, A., 2019. Development of lipoxygenase-3 free Indian soybean using gene-
mutation based molecular markers. Indian Journal of Experimental Biology, 57: 540-544.
Kumarim S., Dahuja, A., Vinutha, T. Lal, S. K., Kar, A. and Rai, D. R., 2015. Changes in the levels
of off-flavour generation in soybean through biotic elicitor treatments. Journal of Agricultural and
Food Chemistry, 63: 700-706.
L’Hocine L., Martineau-Côté D., Achouri A., Wanasundara J.P.D., Loku Hetti Arachchige G.W.,
2020. Broad Bean (Faba Bean). In: Manickavasagan A., Thirunathan P. (eds) Pulses. Springer,
Cham. https://doi.org/10.1007/978-3-030-41376-7_3
Lampi, A., Yang, Z., Mustonen, O. and Piironen, V., 2020. Potential of faba bean lipase and
lipoxygenase to promote formation of volatile lipid oxidation products in food models. Food
Chemistry, 311: 125982
Leone, A., Melillo, M. T., & Bleve-Zacheo, T., 2001. Lipoxygenase in pea roots subjected to biotic
stress. Plant Science, 161(4), 703–717.https://doi.org/10.1016/S0168-9452(01)00458-7
Li, M., Li, L., Dunwell, J.M. et al., 2014. Characterization of the lipoxygenase (LOX) gene family in
the Chinese white pear (Pyrus bretschneideri) and comparison with other members of the
Rosaceae. BMC Genomics, 15, 444. https://doi.org/10.1186/1471-2164-15-444.
Liu S, Liu X, Jiang L., 2010. Genome-wide identification, phylogeny and expression analysis of the
lipoxygenase gene family in cucumber. Genetics and molecular research: GMR. 10(4): 2613–2636.
Lizarazo, C. L., Lampi, A.-M., Liu, J., Sontag-Strohm, T., Piironen, V., and Stoddard, F. L., 2015.
Nutritive quality and protein production from grain legumes in a boreal climate. Journal of the Science
of Food and Agriculture, 95: 2053–2064.
Loiseau, J., Vu, B. L., Macherel , M. and Deunff, Y. L., 2001. Seed lipoxygenases: occurrence and
functions. Seed Science Research, 11: 199–211
Maalouf, F., Hu, J., O’Sullivan, D. M., Zong, X., Hamwieh, A., Kumar, S., & Baum, M., 2018.
Breeding and genomics status in faba bean (Vicia faba). Plant Breeding, 138(4): 465- 473.
Maalouf, F., Nawar, M., Hamwieh, A., Amri, A., Xuxiao, Z., Shiying, B., & Tao, Y., 2013. Faba bean
genetics and genomics and their use in breeding program. In S. Mohar, & B. Tracey (Eds.), Genetic
and genomic resources for grain legume improvement (pp. 113– 136). London, UK: Elseiver Insight.
Maccarrone, M., van Aarie, P.G.M., Veldink, G.A. and Vliegenthart, J.F.G., 1994. In vitro
oxygenation of soybean biomembranes by lipoxygenase-2. Biochimica et Biophysica Acta, 1190:
164–169.
MacLeod, G., Ames, J., and Betz, N. L., 1988. Soy flavor and its improvement. Critical Reviews in
Food Science and Nutrition, 27: 219-400.
Malcolmson, L., Frohlich, P., Boux, G., Bellido, A.-S., Boye, J., and Warkentin, T. D., 2014. Aroma
and flavor properties of Saskatchewan grown field peas (Pisum sativum L.). Canadian Journal of Plant
Science. 94: 1419-1426.
Mandal, S., Dahuja, A. and Santha, I.M., 2014. Lipoxygenase activity in soybean is modulated by
enzyme-substrate ratio. Journal of Plant Biochemistry and Biotechnology, 23: 217–220.
Mandal, S., Dahuja, A., Kar, A., Santha, I.M., 2013. In vitro kinetics of soybean lipoxygenase
with combinatorial fatty substrates and its functional significance in off flavour development, Food
Chemistry, 146: 394-403
Mauch, F., Kmecl, A., Schaffrath, U., Volrath, S., Gorlach, J., Ward, E., Ryals, J. and Dudler, R., 1997.
Mechanosensitive expression of a lipoxygenase gene in wheat. Plant Physiology, 114: 1561–1566.
52
52
Mellor N, Bligh F, Chandler I, Hodgman C., 2010. Reduction of off-flavor generation in soybean
homogenates: A mathematical model. Journal of Food Science, 75: 131-138
Minor W, Steczko J, Bolin JT, Otwinowski Z, et al., 1993. Crystallographic determination of the active
site iron and its ligands in soybean lipoxygenase L-1. Biochemistry, 32: 6320-6323.
Minor, W., Steczko, J., Stec, B., Otwinowski, Z., Bolin, J.T., Walter, R., Axelrod, B., 1996. Crystal
structure of soybean lipoxygenase L-1 at 1.4 Å resolution. Biochemistry, 35:10687– 10701.
Murphy, P., 2008. Soybean proteins. In Soybeans: Chemistry, production, processing, and utilization
(pp. 229–267). 10.1016/ B978-1-893997-64-6.50011-1
Narvel JM, Fehr WR, Weldon LC., 2000. Analysis of soybean seed lipoxygenases. Crop Science, 40:
838–840
Narvel JM, Fehr WR, Welke GA., 1998. Agronomic and seed traits of soybean lines lacking seed
lipoxygenases. Crop Science, 38: 926–928
Negruk, V., 2013. Mitochondrial Genome Sequence of the Legume Vicia faba. Frontiers in Plant
Science, 4(128): 1-8.
Nemchenko, A., Kunze, S., Feussner, I., and Kolomiets, M., 2006. Duplicate maize 13-lipoxygenase
genes are differentially regulated by circadian rhythm, cold stress, wounding, pathogen infection, and
hormonal treatments. Journal of Experimental Botany, 57: 3,767–3,779.
Newcomer, M. E. and Brash, A. R., 2015. The structural basis for specificity in lipoxygenase catalysis.
Protein Science, 24: 298-309
Ofuya, Z.M. and Akhidue, V., 2005. The role of pulses in human nutrition: a review. Journal of
Applied Science, Environment and Management, 9: 99–104.
Oomah, B. D., Razafindrainibe, M., and Drover, J. C., 2014. Headspace volatile components of
Canadian grown low-tannin faba bean (Vicia faba L.) genotypes. Journal of the Science of Food and
Agriculture, 94: 473–481.
Paull J. G., Rose I. A., van Leur J. A. G., Kimber R. B. E. and Seymour M., 2006. Breeding faba beans
for the Australian environment. Proceedings, International Workshop on Faba Bean Breeding and
Agronomy, Córdoba, Spain, 66-69.
Porta, H. and Rocha-Sosa, M., 2002. Plant Lipoxygenases. Physiological and Molecular Features.
Plant physiology, 130: 15-21.
53
53
Purves, R. W., Zhang, H., Khazaei, H., and Vandenberg, A., 2017. Rapid analysis of medically
relevant compounds in faba bean seeds using FAIMS and mass spectrometry. International Journal for
Ion Mobility Spectrometry, 20: 125–135.
Qader, N. N. and Al-Khafaji, H. K., 2014. Motif Discovery and Data Mining in Bioinformatics.
International Journal of Computers and Technology, 13 (1): 4082-4095.
Rackis, J. J., Sessa, D. J., and Honig, D. H., 1979. Flavor problems of vegetable food proteins. Journal
of the American Oil Chemists’ Society, 56: 262-271.
Rackis, J.J., Sessa, D.J. and Honig, D.H., 1979. Flavor problems of vegetable food proteins. Journal
of the American Oil Chemists’ Society, 56: 262–271.
Rawal, R., Kumar, V., Rani, A., and Gokhale, S. M., 2020. Genetic Elimination of Off-Flavour
Generating Lipoxygenase-2 Gene of Soybean through Marker Assisted Backcrossing and Its Effect on
Seed Longevity. Plant Breeding and Biotechnology, 8(2): 163-173.
Reinprecht Y, Luk-Labey SY, Yu K, Poysa VW, Rajcan I, Ablett GR and Peter Pauls K., 2011.
Molecular basis of seed lipoxygenase null traits in soybean line OX948. Theoretical and Applied
Genetics, 122(7): 1247– 1264
Rolad, W. S. U., Pouvreau, L., Curran, J., van de Velde, F., and de Kok, M. T., 2017. Flavor A