identiﬁcationofthe gale geneanda gale homologand ... ·...

JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5916–5924 Vol. 178, No. 200021-9193/96/$04.0010Copyright q 1996, American Society for Microbiology

Identification of the galE Gene and a galE Homolog andCharacterization of Their Roles in the Biosynthesis ofLipopolysaccharide in a Serotype O:8 Strain of

Yersinia enterocoliticaDOROTHY E. PIERSON* AND SHARON CARLSON

Department of Microbiology, University of Colorado Health Sciences Center, Denver, Colorado 80262

Received 25 April 1996/Accepted 12 August 1996

A clone that complements mutations in Yersinia enterocolitica lipopolysaccharide (LPS) core biosynthesis wasisolated, and the DNA sequence of the clone was determined. Three complete open reading frames and onepartial open reading frame were located on the cloned DNA fragment. The first, partial, open reading framehad homology to the rfbK gene. The remaining reading frames had homology to galE, rol, and gsk. Analysis ofthe galE homolog indicates that although it can complement an Escherichia coli galE mutant, its primaryfunction in Y. enterocolitica is not in the production of UDP galactose but, instead, some other nucleotide sugarrequired for LPS biosynthesis. This gene has been renamed lse, for LPS sugar epimerase. The rol homolog hasbeen demonstrated to have a role in Y. enterocolitica serotype O:8 O-polysaccharide antigen chain lengthdetermination. An additional galE homolog has been identified in Y. enterocolitica by homology to the E. coligene. The product of this gene has UDP galactose 4-epimerase activity in both E. coli and Y. enterocolitica. Thisgene is linked to the other genes of the galactose utilization pathway, similar to what is seen in other membersof the family Enterobacteriaceae. Although Y. enterocolitica O:8 strains are reported to have galactose as aconstituent of LPS, a strain containing a mutation in this galE gene does not exhibit any LPS defects.

Lipopolysaccharide (LPS) biosynthesis has been well char-acterized biochemically in a number of gram-negative bacteria(31, 38). The genes encoding the enzymes involved in LPSbiosynthesis have been identified from many bacteria (31).Several LPS genes have been found to be clustered in loci thatcarry genes required for synthesis of one or another portion ofthe LPS molecule. For example, the genes for O-antigen bio-synthesis are often found in a single locus, separate from thegenes for core biosynthesis. In addition, genes have been iden-tified that have a role not only in LPS biosynthesis but in otherpathways as well. In the members of the family Enterobacteri-aceae, three major LPS gene clusters have been identified. Thenumber of LPS biosynthetic genes in these clusters ranges from10 to 20. Genes required for functions other than LPS biosyn-thesis in these organisms are rarely found in these gene clus-ters.Synthesis of the O-polysaccharide antigen of LPS is a com-

plicated process that involves not only assembly of the singlesubunits but also their polymerization into long chains contain-ing multiple repeated subunits (37). Polymerization of subunitsrequires a specific enzyme, O-antigen polymerase. Fully poly-merized O side-chain repeats are ligated to the lipid A-corecomplex by the action of the O-antigen ligase. The repeatlength of the O-antigen side chain is carefully controlled ineach organism, usually resulting in a bimodal distribution oflengths. This control is mediated by a protein, called Rol (orCld) (3–5). Mutations in the rol (or cld) gene result in LPS Oside-chain lengths that are essentially random. There is somesuggestion that mutations affecting chain length distribution

may reduce bacterial resistance to serum killing (28). No ad-ditional effects of rol mutations have been demonstrated otherthan the altered appearance of LPS profiles by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE).In the majority of gram-negative bacteria, galactose utiliza-

tion occurs by the Leloir pathway (1). Galactose entering thecell is converted to UDP galactose by the products of the galKand galT genes. The galE gene product, UDP galactose 4-epi-merase, catalyzes both the conversion of UDP galactose toUDP glucose and the reverse reaction. UDP galactose formedcan serve as the galactose donor for both core and O-antigenpolysaccharide biosynthesis in the production of LPS. galEmutants, therefore, cannot produce wild-type LPS structureson their cell surface. Addition of small amounts of galactose tothe growth media of these mutants results in the production ofsufficient UDP galactose to restore wild-type LPS production.However, galE mutants fed excess galactose accumulate UDPgalactose, which is toxic to the cell. Neisseria gonorrhoeae andN. meningitidis, two gram-negative bacteria that do not utilizegalactose as a carbon source, also have galE homologs (13, 29).Indeed, N. meningitidis has two galE genes, although one ap-pears to be a pseudogene (13). galE mutants of these organ-isms also produce abnormal LPS but are not galactose sensi-tive, in all likelihood because they lack the other enzymes ofthe Leloir pathway.In Escherichia coli and some of the other members of the

family Enterobacteriaceae, the galE gene is found as part of thegalactose operon, a set of genes encoding proteins required forutilization of galactose as a carbon source (1, 11, 22). In othergram-negative bacteria that can degrade galactose, such asErwinia amylovora and Haemophilus influenzae, the galE geneis not found in a galactose utilization operon (1, 11, 15–17, 22).In H. influenzae, the galE gene is associated with genes that areunlinked on the E. coli chromosome (15).Yersinia enterocolitica is a gram-negative bacterium that can

* Corresponding author. Mailing address: Department of Microbiol-ogy, University of Colorado Health Sciences Center, Campus BoxB175, 4200 E. Ninth Ave., Denver, CO 80262. Phone: (303) 315-5285.Fax: (303) 315-6785. Electronic mail address: [email protected].

5916

on Septem

ber 14, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

cause disease in humans and animals. The genes for O-antigenbiosynthesis have been identified and have been shown in anO:3 isolate of Y. enterocolitica to be expressed only at temper-atures below 308C (2). In Y. enterocolitica O:8 serotype strain8081c, expression of O antigen is also temperature regulated.However, it has not been determined whether the temperatureregulation occurs at the level of transcription in the O:8 strainas it does in the O:3 strain. We have described the isolation ofmutants of Y. enterocolitica 8081c with increased cell surfaceexposure of an outer membrane protein, called Ail, that isinvolved in bacterial entry into mammalian cells. These mu-tants have altered LPS core biosynthesis (23). Here we de-scribe the characterization of a locus that complements two ofthe mutants to fully wild-type LPS. This locus lies downstreamof the rfb locus and contains the Y. enterocolitica rol gene, aswell as a homolog of the galE gene. We also demonstrate thatY. enterocolitica is similar to several other members of thefamily Enterobacteriaceae in that it has another galE gene,linked to galT, galK, and galM, the other genes of the galactoseutilization operon.

MATERIALS AND METHODS

Bacterial strains and growth media. The E. coli and Y. enterocolitica strainsused in this study are described in Table 1. Bacteria were grown from singlecolonies on LB plates (18) in LB broth (GIBCO). Sugars were added to theserich media at a final concentration of 1, 2, or 5%. Minimal medium, correspond-ing to minimal A medium (18), was prepared in accordance with the manufac-

turer’s (GIBCO) directions. Sugars (galactose, glucose, and glycerol) were addedat a final concentration of 1%. Biotin was added at a final concentration of 10ng/ml. E. coli strains were routinely grown at 378C, and Y. enterocolitica strainswere grown at 308C. Conjugation mixtures were plated on minimal A plates toselect against the multiply auxotrophic E. coli donor. The antibiotics (SigmaChemical Co.) kanamycin and chloramphenicol were added to media at a con-centration of 50 mg/ml, and tetracycline was added at a concentration of 15 mg/mlwhen appropriate.DNA isolation and manipulations. Restriction enzyme digestions, Klenow

reactions, ligations, and PCR amplifications were performed as described bySambrook et al. (30). Restriction enzymes, the Klenow fragment of DNA poly-merase, T4 DNA polymerase, DNA ligase, and DNA linkers were from NewEngland Biolabs. Taq polymerase was from Fisher. Sequenase 2.0 sequencingkits were from United States Biochemicals. Chromosomal DNA was isolated aspreviously described (27). DNA was gel purified on DEAE paper (Schleicher &Schuell) as previously described (40).Construction of subclones of p227. Clone p227 contains a 10.8-kb insert

fragment which complements the LPS defect in four different LPS mutant Y.enterocolitica strains (23). Subclone pDP2271 was constructed by digestion ofp227 with the restriction enzymes ClaI and BglII. A 5.2-kb fragment was gelpurified and then introduced into pGEM7Zf (Promega), which had been di-gested with ClaI and BamHI. pDP2272 has the same 5.2-kb fragment aspDP2271 cloned in pGEM7Zf in the opposite orientation. pDP2272 was con-structed by digesting p227 with ClaI, filling in the site with the Klenow fragmentof DNA polymerase, and ligating on BamHI linkers. The DNA was subsequentlydigested with BglII, and the resulting 5.2-kb fragment was introduced intoBamHI-digested pGEM7Zf.A clone containing just the galE homologous region (the lse gene) from clone

p227 was isolated by PCR amplification of DNA from the clone by using theprimers 59TTACGCATATTAAGAGAGTG39 (bp 905 to 924) and 59ATCAATTTTACCCATACCAA39 (bp 2047 to 2028). The PCR fragment was introducedinto the vector pCRII (Invitrogen), and one clone, pDP2277, that complemented

TABLE 1. Strains and plasmids used in this study

Bacterial strain or plasmid Trait(s) Reference(s) or source

StrainsY. enterocolitica8081c O:8 serotype strain 26DP5102 inv derivative of 8081c 23DP5102 mini-Tn10 2c5 mini-Tn10 derivative of DP5102 23DP5102 Tn5B50 1-2 Tn5B50 derivative of DP5102 23DP5102 Tn5B50 4-2 Tn5B50 derivative of DP5102 23DP5102 Tn5B50 4-3 Tn5B50 derivative of DP5102 23DP8841 8081c DgalE-galT This work

E. coliPL2 Hfr galE28 l2 relA1 spoT1 thi-1 E. coli Genetic Stock CenterSM10(lpir) thi thr leu tonA lacY supE pir R6K recA::RP4-2-Tc::Mu Kmr 20DH5a F2 f80dlacZDM15 endA1 recA1 hsdR17(rk

2 mk2) supE44 thi-1 l2

gyrA96 relA1 D(lacZYA-argF)U16930

Plasmidsp227 10.8-kb Sau3A segment of 8081c chromosomal DNA in pACYC184 23pGEM7Zf Apr PromegapGEM3 Apr PromegapDP2271 5.2-kb ClaI-BglII fragment of p227 in pGEM7Zf This workpDP2272 pDP2271 with 5.2-kb ClaI-BglII fragment in opposite orientation in

pGEM7ZfThis work

pDP2278 4.3-kb SalI-BamHI fragment from p227 in pGEM3 This workpCRII Apr Kmr InvitrogenpDP2277 Y. enterocolitica galE homolog in pCRII This workpI24 E. coli gal operon in pBR322 10pDP2124 E. coli galE gene in pCRII This workpL3SH6 H. influenzae lic-3 locus in pBluescript 15pDP2316 H. influenzae galE gene in pCRII This workpGEM7Zfk pGEM7Zf with Kmr cassette in ScaI site This workpDP841 6.6-kb EcoRI fragment of 8081c chromosomal DNA in pGEM7Zfk This workpACYC184 Cmr Tcr P15A 9pDP842 6.6-kb EcoRI fragment of 8081c chromosomal DNA in pACYC184 This workpFSVDNR Tcr RK6 ori RP4 oriT 7, 25pDP2841 6.6-kb EcoRI fragment of pDP841 with Kmr cassette replacing 1.9-kb

NdeI fragmentThis work

VOL. 178, 1996 YERSINIA ENTEROCOLITICA galE HOMOLOGS 5917

on Septem


.org/D

ownloaded from

http://jb.asm.org/

the mutant phenotype of a galE mutant E. coli strain was used for additionalstudies.A subclone of p227 containing sequences upstream of the ClaI site used for the

isolation of pDP2271 was constructed in pGEM3 (Promega). This subclone,pDP2278, contains a 4.3-kb SalI-BamHI fragment of p227 cloned into these samesites in pGEM3. This clone contains 1,564 bp of sequences found in pDP2271(from the ClaI site to the BamHI site) plus an additional 2.8 kb of upstreamsequences.Cloning of Y. enterocolitica, E. coli, and H. influenzae galE genes. A kanamycin-

resistant derivative of pGEM7Zf, pGEM7k, was constructed by introduction ofa kanamycin resistance cassette (Pharmacia) into the ScaI site in the b-lactamasegene of pGEM7Zf.A Y. enterocolitica galE-specific fragment was prepared by PCR amplification

of Y. enterocolitica chromosomal DNA by using primers 59GCCGGGTTGAAAGCCGTGGG39 and 59ATCACGTGGATGTAGTCGCG39, which correspondto highly conserved sequences internal to the galE genes of seven other gram-negative bacteria. A 450-bp fragment was isolated and used to probe a partialchromosomal library of Y. enterocolitica. This library consisted of EcoRI frag-ments of Y. enterocolitica chromosomal DNA ranging in size from 4.5 to 8 kb,cloned into pGEM7k. A single hybridizing clone containing a 6.6-kb insert, thesame size as the fragment hybridizing to the E. coli galE probe, called pDP841,was isolated. Tetracycline-resistant clone pDP842 was isolated by subcloning the6.6-kb fragment from pDP841 into the EcoRI site of pACYC184.E. coli gal operon clone pI24 was used to isolate the E. coli galE gene. Primers

59TTTCGCATCTTTGTTATGCT39 and 59GATTAAATTGCGTCATGGTC39were used to PCR amplify DNA from clone pI24. This DNA was introduced intothe vector pCRII, and a clone that complemented the galE mutant phenotype ofstrain PL2 was used for further studies.The H. influenzae galE gene was isolated by PCR amplification of the lic-3

clone pL3SH6 by using primers 59AGTCTCAATAATTAACAAGG39 and 59AATGTTTAGCATTCTTCTTC39. The DNA was introduced into the vector pCRII,and a clone that complemented the galE mutation in strain PL2 was used forfurther studies.Sequencing and analysis. The clones pDP2271 and pDP2272 were digested

with ClaI and KpnI. Digested DNAs were then subjected to directed deletions byusing an Erase-a-Base kit (Promega) in accordance with the manufacturer’sdirections. The DNA sequence was determined by the dideoxy sequencingmethod with a Sequenase 2.0 kit (United States Biochemicals). Overlappingsequences and DNA and protein homologies were identified by using the com-puter program DNASIS v2.0 (Hitachi Software Engineering).DNA hybridizations. Chromosomal DNA was digested with EcoRI or HincII,

subjected to electrophoresis, and transferred to nitrocellulose (Schleicher &Schuell). Colonies from a library containing EcoRI fragments of Y. enterocoliticaDNA (see below) were transferred to nitrocellulose by standard methods (30). Aprobe specific for the E. coli galE gene was isolated by digestion of plasmid pI24with EcoRV and HindIII, followed by gel elution (40) of a 590-bp fragmentinternal to the galE gene. A Y. enterocolitica galE gene-specific probe was pre-pared by gel elution of the 6.6-kb EcoRI fragment of clone pDP841. Probes werelabeled with [32P]dCTP (Du Pont/NEN) by nick translation (30). Blots wereprobed at either high stringency (50% formamide, 428C) or low stringency (20%formamide, 378C) as described by Miller et al. (19).Construction of a Y. enterocolitica galE mutant. The 6.6-kb EcoRI fragment of

pDP841 was subcloned into the suicide vector pFSVDNR. A 1.9-kb internal NheIfragment containing the galE gene and a portion of the galT gene was deletedand replaced with a kanamycin resistance gene cassette (Pharmacia), formingpDP2841. pDP2841 was introduced into Y. enterocolitica 8081c by mating with E.coli SM10(lpir) containing the clone. Kanamycin-resistant transconjugants wereselected on minimal A medium. Tetracycline-sensitive segregants were examinedby Southern analysis for retention of the mutant allele.Galactose sensitivity assays. Bacteria from an overnight culture were inocu-

lated 1:100 in minimal media containing 1% glycerol. Once the cultures begangrowing, they were split in half and either galactose or glucose was added to afinal concentration of 1%. The A600 of each culture was then monitored every 30min.LPS analysis. LPS was prepared from bacteria grown to the stationary phase

as previously described (23). Samples were boiled for 5 min prior to electro-phoresis on a 15% polyacrylamide gel containing 4 M urea. Gels were stainedwith silver after pretreatment with periodic acid as previously described (35).UDP galactose 4-epimerase assay. Bacteria were grown to the late log phase

in minimal medium containing glycerol as the carbon source. Cultures were theninduced for 1 h with 1% galactose. Extracts of the cultures were made bysonication in 15 mM phosphate buffer (5 mM Na2HPO4, 10 mM KH2PO4), pH6.5. The protein concentration of extracts was determined with a Bio-Rad pro-tein assay kit. Enzyme activity was assayed by a modification of the method ofWilson and Hogness (39). Assays were performed in a 1-ml reaction volumecontaining 100 mg of protein, 0.5 mM NAD, 0.25 mM UDP galactose, and 0.025U of UDP glucose dehydrogenase (all from Sigma). The change in A340 wasmeasured over a 6-min period. An A340 change of 1 U/min corresponds to theformation of 162 nmol of NADH. Enzyme units are expressed as nanomoles ofNADH formed per minute per milligram of protein.Nucleotide sequence accession number. The EMBL/GenBank accession num-

ber of the 5.2-kb fragment from p227 is U43708.

RESULTS

Analysis of the sequence of a 5.2-kb clone that complementsthe LPS phenotype of mutants DP5102 mini-Tn10 2c5 andDP5102 Tn5B50 1-2.We previously described a 10.8-kb clone,called p227, that could complement the LPS defect in fourdifferent LPS mutant Y. enterocolitica strains originally identi-fied by their increase in Ail-mediated entry into mammaliancells in vitro (23). A subclone of p227, called pDP2271, wasconstructed by insertion of a 5.2-kb ClaI-BglII fragment fromp227 into the vector pGEM7Zf (Fig. 1). This subclone couldcomplement the mutant phenotype of two of the four strains,DP5102 mini-Tn10 2c5 and DP5102 Tn5B50 1-2. The DNAsequence of the 5.2-kb fragment was determined. Three com-plete open reading frames and one partial open reading frame,all predicted to be transcribed in the same direction, werefound on the cloned DNA. The open reading frames werecompared to sequences in the database by using the programDNASIS v2.0. The first open reading frame was a partial openreading frame with 67% homology to rfbK, the O-antigen geneencoding phosphomannomutase of Vibrio cholerae (34) and anumber of other bacteria (31). The next open reading framewas 63% homologous to the galE gene of H. influenzae. Thepredicted protein from this sequence shares a high degree ofhomology with UDP galactose 4-epimerase from a large num-ber of bacteria and Saccharomyces cerevisiae. As describedbelow, this gene is not the galE gene and was named lse (LPSsugar epimerase) to avoid confusion. The protein predicted tobe encoded by the third open reading frame had homology tothe Rol proteins of Y. pseudotuberculosis (33% identity, 77%similarity), E. coli, Shigella flexneri, and Salmonella typhi-murium. As had been seen for these other Rol proteins (4), theprotein predicted from this open reading frame has two highlyhydrophobic regions, one at the N terminus and the other atthe C terminus (14), suggesting localization of Y. enterocoliticaRol to the inner membrane, as has been demonstrated for theS. flexneri Rol protein (21). The DNA sequence encompassingthe final open reading frame had 73% homology to the gskgene of E. coli. The product of gsk, guanosine kinase, has notbeen shown to have a role in LPS biosynthesis (12). The rolgene is located in the rfb locus in a number of different bacte-ria. However, the linkage of these genes to gsk has been foundonly in the rfb locus of the related bacterium Y. pseudotuber-culosis (33) and in the lic-3 locus of H. influenzae, which isrequired for LPS biosynthesis in that organism (15). Anotherstrain of Y. enterocolitica, O:3 strain 6471/76, has a locus re-quired for LPS outer core biosynthesis, called trs, that has gskat the distal end (32). However, the trs locus differs from thatidentified here in that trs does not contain a rol gene.Locations of Tn insertions in DP5102 mini-Tn10 2c5 and

DP5102 Tn5B50 1-2. The transposon insertions in both mu-tants DP5102 mini-Tn10 2c5 and DP5102 Tn5B50 1-2 fall intothe lse open reading frame (Fig. 1B). To determine if themutant phenotypes were due to loss of the product of this openreading frame or to polar effects on downstream gene expres-sion, a clone containing just this open reading frame was con-structed (see Materials and Methods). This clone, pDP2277,was introduced into DP5102 mini-Tn10 2c5 and DP5102Tn5B50 1-2 and LPS profiles were examined (Fig. 2). TheDP5102 miniTn10 2c5 mutant phenotype was fully comple-mented to the wild type (Fig. 2A), indicating that the insertionaffected only the lse gene and not any downstream gene ex-pression. In contrast, introduction of the clone into DP5102Tn5B50 1-2 resulted in full-length LPS, but the distribution ofO-antigen side-chain length differed from that of the wild type(Fig. 2B). Instead, the LPS of DP5102 Tn5B50 1-2, containing

5918 PIERSON AND CARLSON J. BACTERIOL.

on Septem


.org/D

ownloaded from

http://jb.asm.org/

the clone of lse, resembled that of a rol mutant. That is, thelonger the O-antigen side-chain repeat, the lower its frequencyon the cell surface, in contrast to the wild-type situation, inwhich certain O side-chain lengths predominate. Introductionof clone pDP2271, containing lse, rol, and gsk sequences intoDP5102 Tn5B50 1-2 resulted in complementation to a fullywild-type phenotype. Although the insertion sites of the trans-posons in the two mutants were similar, the Tn5B50 insertionwas polar whereas the mini-Tn10 insertion was not. Tn5B50has a constitutively expressed neomycin phosphotransferasepromoter at one end oriented to transcribe outwards, awayfrom the end of the transposon. In the insertion mutantDP5102 Tn5B50 1-2, the Tn5B50 insertion is oriented suchthat the promoter is transcribed opposite to the direction oftranscription of lse and rol. This constitutive expression oppo-site to the correct direction of transcription may reduce thelevel of expression of rol sufficiently to result in a Rol2 phe-notype. Alternatively, the Tn5B50 insertion may be in a pro-moter for rol.Identification of the site of the mutations in DP5102 Tn5B50

4-2 and DP5102 Tn5B50 4-3. Clone pDP2271 did not comple-ment the mutant phenotypes of DP5102 Tn5B50 4-2 andDP5102 Tn5B50 4-3. However, preliminary mapping suggestedthat the insertions in these two mutants were closely linked tothe locus described here. Sequence analysis indicates that bothinsertions are located in the rfbK homolog, the partial open

reading frame found in clone pDP2271 (Fig. 1). As the full rfbKgene is not found on clone pDP2271, it is not surprising thatthis clone did not complement these mutants. A clone lackinglse, but likely to contain the full rfbK gene, was isolated bysubcloning a 4.3-kb SalI-BamHI fragment from p227 (Fig. 1).This clone, pDP2278, complements both mutants (Fig. 2C),suggesting that the mutant phenotype was due solely to theinsertion in the rfbK gene and not to any effects on downstreamgene expression.Analysis of the role of lse by complementation of an E. coli

galE mutant. UDP galactose is toxic to bacteria at high con-centrations. galE mutants cannot convert UDP galactose toUDP glucose. Thus, addition of galactose to galE mutants islethal because of the accumulation of excess UDP galactose(1). Plasmid p227, containing the putative galE gene (nowcalled lse), was introduced into E. coli PL2, containing thegalE28 allele. This strain was then examined for growth onmedia containing either 1% glucose or 1% galactose (Fig. 3).Growth of PL2 was inhibited on media containing galactose.Both p227 and a plasmid containing the E. coli galactoseoperon as a control (pI24 [10]) complemented the growthdefect on galactose. PL2 containing the Y. enterocolitica DNAdid not grow as well on galactose as did PL2 containing the E.coli DNA. However, the growth rate of the PL2 strain with theY. enterocolitica clone in media containing galactose was thesame as that in media containing glucose, suggesting that the

FIG. 1. Map of p227 and its subclones. (A) Restriction map of the DNA insert of clone p227. The heavy arrows indicate the genes rfbK, lse, rol, and gsk and theirdirection of expression. The dashes on the rfbK arrow indicate that the sequence of only a portion of this gene has been determined. Abbreviations: Bg, BglII; B, BamHI;C, ClaI; S, SalI. pDP2271 and pDP2272 contain the BglII-ClaI fragment in pGEM7Zf in opposite orientations. pDP2277 contains a PCR fragment corresponding tothe lse gene cloned in pCRII. pDP2278 contains the BamHI-SalI fragment in pGEM3. Plac indicates the lac promoter, and the arrowhead indicates the direction oftranscription from the promoter. (B) Enlarged view of the 5.2-kb insert of pDP2271 of which the nucleotide sequence was determined. Positions of transposon insertionsin the mutants DP5102 mini-Tn10 2c5, DP5102 Tn5B50 1-2, DP512 Tn5B50 4-2, and DP512 Tn5B50 4-3 are marked 2c5, 1-2, 4-2, and 4-3, respectively. The arrowheadabove 1-2 indicates the orientation of expression from the neomycin phosphotransferase promoter from the Tn5B50 insertion at that site.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

poor growth was not due to the carbon source, but rather thatthe Y. enterocolitica clone affected the overall health of the cell,for reasons that are not known. As galE mutants do not pro-duce UDP galactose, which serves as the galactose donor forLPS biosynthesis, the LPS profiles of these same strains wereexamined to determine if the Y. enterocolitica lse gene couldrestore normal LPS core production to E. coli K-12. PL2 con-taining either the E. coli gal operon or Y. enterocolitica clonep227 had identical LPS core structures, larger than that of theparental strain (data not shown). Taken together, these datasuggest that the Y. enterocolitica lse gene has UDP galactose4-epimerase activity, at least when cloned into E. coli. To

demonstrate definitively this activity of the cloned gene in E.coli, a UDP galactose 4-epimerase assay was performed. Ex-tracts of PL2 containing either the E. coli galE gene (pDP2124)or the Y. enterocolitica lse gene (pDP2277), isolated by PCR asdescribed in Materials and Methods, were isolated. The UDPgalactose 4-epimerase activity of the extracts was determinedby the method of Wilson and Hogness (39). In this method,UDP glucose produced from UDP galactose by the epimerasepresent in extracts is removed from the reaction by UDP glu-cose dehydrogenase, simultaneously reducing NAD to NADH,which can be measured spectrophotometrically. PL2 contain-ing the Y. enterocolitica lse gene had activity as measured bythis assay (Table 2). In the clones used, the Y. enterocoliticagene is oriented opposite to the lac operon promoter, whereasthe E. coli galE gene should have been expressed from the lacoperon promoter. Therefore, it is difficult to compare directlythe levels of activity produced by the two different genes. How-ever, it is clear that the Y. enterocolitica gene does produce aprotein that has detectable UDP galactose 4-epimerase activ-ity.Phenotypic analysis of Y. enterocolitica mutant 2c5. To de-

termine if the true function of the lse gene in Y. enterocoliticais as an UDP galactose 4-epimerase, the wild type and a trans-poson mutant strain were examined for the phenotypes ex-pected of a galEmutant. DP5102 mini-Tn10 2c5 and its parent,DP5102, were grown in the presence of 1% glucose and 1%galactose to examine galactose sensitivity. Both strains grewequally well in both media (data not shown), suggesting thatthe mutant strain does not accumulate UDP galactose. Inaddition, the mutant strain was able to grow on galactose as thesole carbon source (data not shown), indicating that the defectin the mutant either did not affect the Leloir pathway or that

FIG. 2. Analysis of LPS of transposon insertion mutants of DP5102. LPS samples were prepared by proteinase K treatment of extracts of stationary-phase culturesof the strains indicated. Samples were subjected to electrophoresis on a 15% polyacrylamide gel containing urea. Gels were stained with silver. Positions of the coreand O-polysaccharide side chains are indicated. (A) DP5102 mini-Tn10 2c5 containing the plasmids indicated. (B) DP5102 Tn5B50 1-2 containing the plasmidsindicated. (C) DP5102 Tn5B50 4-2 and DP5102 Tn5B50 4-3 containing the plasmids indicated.

FIG. 3. Galactose sensitivity assay. The growth of E. coli galE mutant strainPL2 containing either the E. coli gal operon clone pI24 or the Y. enterocoliticaclone p227 was examined in minimal media containing 1% galactose or 1%glucose.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

Y. enterocolitica has an alternative pathway for galactose utili-zation. The mutant and wild-type strains were grown in mediacontaining 1 to 4% glucose or galactose to examine the effecton LPS biosynthesis in these strains. Neither sugar had anyeffect on the LPS profile of the mutant (Fig. 4A), furthersuggesting that there is no block in the conversion of UDPglucose to UDP galactose in the mutant. Introduction of theE. coli galE gene also had no effect on the LPS profile of themutant strain (Fig. 4B). UDP galactose 4-epimerase assayswere performed on the mutant and wild-type strains. Similarenzyme activity levels were detected in the two strains (Table3), indicating that the lse gene identified by the mini-Tn10insertion in DP5102 mini-Tn10 2c5 is not the true galE gene ofY. enterocolitica.By comparison to published sequences, the lse gene had the

highest homology with the galE gene of H. influenzae. In ad-dition, analysis of the locus contained in p227 had suggestedsimilarity to the H. influenzae lic-3 locus, a locus involved inLPS biosynthesis in that organism that contains both a galEand a gsk homolog. The H. influenzae lic-3 locus and a clonecontaining just the H. influenzae galE gene, isolated by PCR

(pDP2316), were introduced into the Y. enterocolitica mutantDP5102 mini-Tn10 2c5. In contrast to the results seen with theE. coli galE gene, introduction of the H. influenzae galE genecomplemented the LPS defect in the Y. enterocolitica mutantstrain (Fig. 4C).Evidence for another galE gene in Y. enterocolitica. The fact

that mutant strain DP5102 mini-Tn10 2c5 still had UDP ga-lactose 4-epimerase activity suggested that there is anothergalE gene in Y. enterocolitica. To identify this other galE gene,a fragment internal to the galE gene of E. coli was used toprobe Y. enterocolitica chromosomal DNA. Under low-strin-gency conditions, a homolog of the E. coli galE gene wasdetected (Fig. 5). The fact that the E. coli galE gene picks upthe same-size fragments in DP5102 and DP5102::mini-Tn102c5 indicates that this homolog is not the gene identified by thetransposon insertion in mutant DP5102 mini-Tn10 2c5. Initialcloning attempts with the E. coli galE gene as a probe provedfutile, as the endogenous E. coli galE gene cross-reacted withthe probe. Instead, a Y. enterocolitica-specific probe was madeby PCR amplification of Y. enterocolitica chromosomal DNAwith degenerate primers corresponding to well-conserved re-gions of published galE sequences from seven different organ-isms. The resulting DNA fragment was used as a probe of apartial library of Y. enterocolitica chromosomal DNA to pickout a single clone, called pDP841. pDP841 hybridized to thesame-size fragment as did the original E. coli galE probe (Fig.5B). A partial DNA sequence of this clone (24) shows approx-imately 80% homology at the DNA level with the galE genefrom E. coli.Analysis of the Y. enterocolitica galE gene clone. The new

galE homolog clone, pDP841, was introduced into the E. coligalE mutant PL2, and the resulting strain was tested for UDPgalactose 4-epimerase activity after galactose induction. PL2containing pDP841 had high levels of enzyme activity (Table2), indicating that the gene cloned encodes a UDP galactose4-epimerase. No activity was detectable without galactose in-duction (data not shown), indicating that expression of the Y.enterocolitica galE gene is regulated by galactose. As expectedfrom the observation that pDP841 has UDP galactose 4-epi-merase activity, this Y. enterocolitica clone complemented all ofthe galE phenotypes of the E. coli mutant (data not shown). Inaddition, the cloned DNA restored the ability of galT and galKmutant E. coli strains to grow on galactose (data not shown),suggesting that the full gal operon is present on the clonedDNA fragment. This hypothesis is supported by partial DNAsequence analysis of the clone (24), which indicates that thereare sequences homologous to the galE, galT, and galM genesfound on the clone.Analysis of phenotypes of a galE mutant of Y. enterocolitica.

A mutation was introduced into the Y. enterocolitica galE geneby homologous recombination (described in Materials andMethods). In the mutant DP8841, a 1.9-kb NheI fragmentcontaining all of the galE gene and a portion of the down-stream galT sequences was replaced with the kanamycin resis-

FIG. 4. LPS profiles of mutant DP5102 mini-Tn10 2c5 under different con-ditions. Silver-stained gels of LPS samples subjected to SDS-PAGE. (A) LPSisolated from strain DP5102 mini-Tn10 2c5 grown in LB broth containing noadditions (indicated by minus sign), 2% glucose (glc), or 2% galactose (gal), asindicated. (B) LPS extracted from strain DP5102 mini-Tn10 2c5 containingeither the E. coli galE gene or the Y. enterocolitica galE homolog. (C) LPS sampleof DP5102 mini-Tn10 2c5 containing the H. influenzae galE gene.

TABLE 2. UDP galactose 4-epimerase assays of an E. coli galEmutant containing different galE clones

StrainaUDP galactose4-epimeraseactivityb

PL2 pCRII ................................................................................... 0PL2 pDP2277............................................................................... 29.2PL2 pDP2124............................................................................... 301PL2 pDP841................................................................................. 283a Bacteria were grown in minimal media containing glycerol and subjected to

1 h of induction in the presence of galactose.b Activity is defined as nanomoles of NADH formed per minute per milligram

of protein. Values given are for a single experiment and are representative ofmultiple experiments.

TABLE 3. UDP galactose 4-epimerase assays ofY. enterocolitica strainsa

StrainUDP galactose4-epimeraseactivity

DP5102 ........................................................................................... 69DP5102 mini-Tn10 2c5................................................................. 75DP8841 ........................................................................................... 0a See Table 2 footnotes.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

tance gene cassette. The mutant genotype was confirmed bySouthern analysis (data not shown). Strain DP8841 was exam-ined for phenotypes expected of a galEmutant. As a portion ofthe galT gene is missing in the mutant, this strain would not beexpected to be galactose sensitive, and it was not (data notshown). The mutant was examined for UDP galactose 4-epi-merase activity with and without galactose induction. No UDPgalactose 4-epimerase activity was detectable in the mutantstrain (Table 3). Introduction of the wild-type locus, on atetracycline-resistant derivative of pDP841 called pDP842, re-stored the wild-type phenotype. No activity was detected in anyof the strains without galactose induction (data not shown).Despite the absence of UDP galactose 4-epimerase activity,the mutant strain DP8841 had a normal LPS profile as deter-mined by SDS-PAGE analysis (data not shown).

DISCUSSION

A region of Y. enterocoliticaO:8 strain 8081c involved in LPSbiosynthesis was isolated and characterized. Four independenttransposon insertion mutations that resulted in an abnormalLPS phenotype mapped to this region. The region has genesfor O-antigen and core polysaccharide biosynthesis, includingthose required for the production of nucleotide sugars foraddition to the growing LPS chain, as well as a gene, rol,involved in addition of the correct number of O-antigen sidechains to the LPS molecule. An additional gene, called gsk, wasidentified by DNA homology. The gsk gene encodes guanosinekinase, an enzyme involved in guanosine salvage, not LPSbiosynthesis (12). The structure of this locus in Y. enterocolitica

is similar to that in a number of other bacteria, including Y.pseudotuberculosis, E. coli, S. flexneri, and H. influenzae (4, 15,21, 32, 33). Although there is great similarity in the ways thesegene clusters are organized, different sugars are incorporatedinto the final LPS structure and the predominant O-antigenside-chain lengths of the various bacteria differ. Thus, thegenes encode similar, but not identical, functions in their re-spective hosts. A similar locus, called trs, has been identified inY. enterocolitica O:3 serotype strain 6471/76 (32). The locusdescribed here differs from trs in that the trs locus does notcontain a rol gene. In the LPS profile of O:3 strains, no char-acteristic repeating O side-chain pattern like that of the O:8strain is revealed by SDS-PAGE analysis (2). Therefore, theO:3 strain may not require Rol for assembly of the O-polysac-charide side chain, explaining the absence of the rol gene fromthe trs locus.Mutations in individual open reading frames confirmed that

the galE homolog lse is involved in the formation of LPSmolecules having normal O side chains and core sugars. Asseemed likely from the homology, the rol gene was demon-strated to be involved in the production of LPS with a bimodaldistribution of O-antigen side-chain lengths. In this O:8 sero-type strain of Y. enterocolitica, the predominant O-antigenside-chain repeat lengths were 6 to 10 and 16 to 20. A locussimilar to the one described here has been identified by Zhanget al. (41). Those investigators identified the rol gene as rfc,encoding O-antigen polymerase. Our experiments, which ex-amined the role of this gene in Y. enterocolitica, support theidentification of this gene as the Y. enterocolitica serotype O:8rol gene.The lse gene identified is predicted to encode a protein with

a high degree of homology with the product of the galE gene,UDP galactose 4-epimerase. This homology extends over theentire length of the protein. Of the 29 amino acids that areshown by the crystal structure of E. coli UDP galactose 4-epi-merase to be within the binding pocket for the NAD cofactorand the substrate (6), 23 are conserved in the galE homolog.The three amino acids that have been shown to be involveddirectly in NAD binding are also conserved. As might be ex-pected from this homology, lse has UDP galactose 4-epimeraseactivity when cloned into E. coli. However, despite the highdegree of homology, Lse does not exhibit UDP galactose 4-epi-merase activity in Y. enterocolitica. The detection of UDP ga-lactose 4-epimerase activity from lse in E. coli, but not in Y.enterocolitica, is likely due to the high level of expression of thisgene in E. coli from a high-copy-number plasmid. The actualUDP galactose 4-epimerase of Y. enterocolitica is encoded by asecond galE homolog. This galE homolog, the true galE gene,is linked to genes that produce proteins involved in the Leloirpathway for utilization of galactose as a carbon source.The function in Y. enterocolitica of the lse gene identified by

the transposon insertion in DP5102 mini-Tn10 2c5 is unknown.Unlike the case for N. meningitidis, both of the galE homologsidentified appear to be functional genes in Y. enterocolitica.The predicted protein product also shares homology with otherenzymes involved in LPS biosynthesis from a number of otherorganisms. The homologs include CDP tyvelose 2-epimerase(24% identical, 65% similar), dTDP-D-glucose-dehydratase(25% identical, 63% similar), UDP-N-acetylglucosamine epi-merase (23% identical, 37% similar), and ADP L-glycero-D-mannoheptose epimerase (19% identical, 50% identical). OneO:8 serotype strain of Y. enterocolitica is reported to have ninedifferent sugars (36), including galactose, as components of itsLPS, raising the possibility that the lse gene is involved in thesynthesis of the nucleotide sugar donor of one of these nineother sugars. Which of these other sugars is the true substrate

FIG. 5. Identification of another galE homolog in Y. enterocolitica. Chromo-somal DNAs of strain DP5102 and its LPS mutant derivative DP5102 mini-Tn102c5, digested with either EcoRI orHincII, were subjected to electrophoresis. TheDNAs were transferred to nitrocellulose and probed. Molecular size markers areindicated in kilobases on the left. Lanes: 1, plasmid pDP841 digested with EcoRI;2, DP5102 digested with EcoRI; 3, DP5102 mini-Tn10 2c5 digested with EcoRI;4, DP5102 digested with HincII; 5, DP5102 mini-Tn10 2c5 digested with HincII.Probes: A, fragment internal to the E. coli galE gene; B, insert fragment of Y.enterocolitica gal operon clone pDP841.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

of the enzyme remains to be determined. Our observation thatthe H. influenzae galE gene complements the mutant pheno-type of DP5102::mini-Tn10 2c5 suggests that the product of thegalE gene in H. influenzae has alternative activities in additionto its UDP galactose 4-epimerase activity, similar to our ob-servations for the homologous gene in Y. enterocolitica.As has been shown for four other members of the family

Enterobacteriaceae, E. coli, S. typhimurium, S. typhi, and Kleb-siella pneumoniae (8, 11, 22), the Y. enterocolitica galE gene islinked to three other genes involved in galactose utilization,the galT, galK, and galM genes. The linkage to galT and galKwas demonstrated by showing that the clone that contained thegalE gene could complement galT and galKmutant strains of E.coli. The galM linkage was demonstrated by DNA sequenceanalysis that showed a galM homolog at one end of the clonedDNA segment. In all likelihood, by analogy with the othersystems, the galE gene is part of the gal operon. As has beendemonstrated in the other Enterobacteriaceae, the expressionof the Y. enterocolitica galE gene is inducible by galactose.Curiously, although it has been reported that galactose is a

component of Y. enterocolitica O:8 LPS (36), the galE mutantdoes not have any gross LPS phenotype alterations. As noUDP galactose 4-epimerase activity was detected in the galEmutant, it is not that lse was compensating for the loss of thetrue galE gene. It is possible that this strain of Y. enterocoliticadoes not have galactose as a component of its LPS. An alter-native explanation is that another, closely related sugar mayreplace galactose in the final LPS structure and that this dif-ference cannot be detected by gross analysis of LPS. Thesealternatives can be distinguished by detailed chemical analysisof the composition of the LPSs of these various strains.By analogy with other LPS mutant Y. enterocolitica strains, it

is likely that lse mutants are unable to establish infection inanimal models of disease. galE mutants of S. typhimurium arebeing tested as vaccine candidates because they lack normalLPS. As the Y. enterocolitica galE mutants have apparentlynormal LPS, it is not known if they will be able to establishinfection or be analogous to the S. typhimurium strains that areuseful as vaccine candidates.

ACKNOWLEDGMENTS

We thank D. Maskell, S. Adhya, and the E. coli Genetic StockCenter for plasmids and strains. We also thank K. Escudero and P.Debbie for critical review of the manuscript.This work was supported by grant AI31948, awarded by the National

Institutes of Health.

REFERENCES

1. Adhya, S. 1987. The galactose operon, p. 1503–1512. In F. C. Neidhardt, J. L.Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger(ed.), Escherichia coli and Salmonella typhimurium: cellular and molecularbiology, vol. 2. American Society for Microbiology, Washington, D.C.

2. Al-Hendy, A., P. Toivanen, and M. Skurnik. 1991. The effect of growthtemperature on the biosynthesis of Yersinia enterocolitica O:3 lipopolysac-charide: temperature regulates the transcription of the rfb but not the rfaregion. Microb. Pathog. 10:81–86.

3. Bastin, D. A., G. Stevenson, P. K. Brown, A. Haase, and P. R. Reeves. 1993.Repeat unit polysaccharides of bacteria: a model for polymerization resem-bling that of ribosomes and fatty acid synthetase, with a novel mechanism fordetermining chain length. Mol. Microbiol. 7:725–734.

4. Batchelor, R. A., P. Alifano, E. Biffali, S. I. Hull, and R. A. Hull. 1992.Nucleotide sequences of the genes regulating O-polysaccharide antigenchain length (rol) from Escherichia coli and Salmonella typhimurium: proteinhomology and functional complementation. J. Bacteriol. 174:5228–5236.

5. Batchelor, R. A., G. E. Haraguchi, R. A. Hull, and S. I. Hull. 1991. Regula-tion by a novel protein of the bimodal distribution of lipopolysaccharide inthe outer membrane of Escherichia coli. J. Bacteriol. 173:5699–5704.

6. Bauer, A. J., I. Rayment, P. A. Frey, and H. M. Holden. 1992. The molecularstructure of UDP-galactose 4-epimerase from Escherichia coli determined at2.5A resolution. Proteins 12:372–381.

7. Bliska, J. B., K. Guan, J. E. Dixon, and S. Falkow. 1991. Tyrosine phosphatehydrolysis of host proteins by an essential Yersinia virulence determinant.Proc. Natl. Acad. Sci. USA 88:1187–1191.

8. Bouffard, G. G., K. E. Rudd, and S. L. Adhya. 1994. Dependence of lactosemetabolism upon mutarotase encoded in the gal operon in Escherichia coli.J. Mol. Biol. 244:269–278.

9. Chang, A. C. Y. C., and S. N. Cohen. 1978. Construction and characterizationof amplifiable multicopy DNA cloning vehicles derived from the P15A cryp-tic miniplasmid. J. Bacteriol. 134:1141–1156.

10. Haber, R., and S. Adhya. 1988. Interaction of spatially separated protein-DNA complexes for control of gene expression: operator conversions. Proc.Natl. Acad. Sci. USA 85:9683–9687.

11. Houng, H.-S., D. J. Kopecko, and L. S. Baron. 1990. Molecular cloning andphysical and functional characterization of the Salmonella typhimurium andSalmonella typhi galactose utilization operons. J. Bacteriol. 172:4392–4398.

12. Hove-Jensen, B., and P. Nygaard. 1989. Role of guanosine kinase in theutilization of guanosine for nucleotide synthesis in Escherichia coli. J. Gen.Microbiol. 135:1263–1273.

13. Jennings, M. P., P. van der Ley, K. E. Wilks, D. J. Maskell, J. T. Poolman,and E. R. Moxon. 1993. Cloning and molecular analysis of the galE gene ofNeisseria meningitidis and its role in lipopolysaccharide biosynthesis. Mol.Microbiol. 10:361–369.

14. Kyte, J., and R. F. Doolittle. 1982. Analysis of the accuracy and implicationsof simple methods for predicting the secondary structure of globular pro-teins. J. Mol. Biol. 157:105–132.

15. Maskell, D. J., M. J. Szabo, P. D. Butler, A. E. Williams, and E. R. Moxon.1991. Molecular analysis of a complex locus from Haemophilus influenzaeinvolved in phase-variable lipopolysaccharide biosynthesis. Mol. Microbiol.5:1013–1022.

16. Maskell, D. J., M. J. Szabo, M. E. Deadman, and E. R. Moxon. 1992. The gallocus from Haemophilus influenzae: cloning, sequencing and the use of galmutants to study lipopolysaccharide. Mol. Microbiol. 6:3051–3063.

17. Metzger, M., P. Bellemann, P. Bugert, and K. Geider. 1994. Genetics ofgalactose metabolism in Erwinia amylovora and its influence on polysaccha-ride synthesis and virulence of the fire blight pathogen. J. Bacteriol. 176:450–459.

18. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

19. Miller, V. L., J. J. Farmer III, W. E. Hill, and S. Falkow. 1989. The ail locusis found uniquely in Yersinia enterocolitica serotypes commonly associatedwith disease. Infect. Immun. 57:121–131.

20. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its usein construction of insertion mutations: osmoregulation of outer membraneproteins and virulence determinants in Vibrio cholerae requires toxR. J.Bacteriol. 170:2575–2583.

21. Morona, R., L. Van Den Bosch, and P. A. Manning. 1995. Molecular, genetic,and topological characterization of O-antigen length regulation in Shigellaflexneri. J. Bacteriol. 177:1059–1068.

22. Peng, H.-L., T.-F. Fu, S.-F. Liu, and H.-Y. Chang. 1992. Cloning and expres-sion of the Klebsiella pneumoniae galactose operon. J. Biochem. 112:604–608.

23. Pierson, D. E. 1994. Mutations affecting lipopolysaccharide enhance Ail-mediated entry of Yersinia enterocolitica into mammalian cells. J. Bacteriol.176:4043–4051.

24. Pierson, D. E., and S. Carlson. 1996. Unpublished data.25. Pierson, D. E., and S. Falkow. 1993. The ail gene of Yersinia enterocolitica has

a role in the ability of this organism to survive serum killing. Infect. Immun.61:1846–1852.

26. Portnoy, D. A., S. L. Moseley, and S. Falkow. 1981. Characterization ofplasmids and plasmid-associated determinants of Yersinia enterocoliticapathogenesis. Infect. Immun. 31:775–782.

27. Redfield, R. J., and A. M. Campbell. 1984. Origin of cryptic lambda proph-ages in Escherichia coli K-12. Cold Spring Harbor Symp. Quant. Biol. 49:199–206.

28. Reeves, P. 1995. Role of O-antigen variation in the immune response. TrendsMicrobiol. 3:381–386.

29. Robertson, B. D., M. Frosch, and J. P. M. van Putten. 1993. The role of galEin the biosynthesis and function of gonococcal lipopolysaccharide. Mol.Microbiol. 8:891–901.

30. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

31. Schnaitman, C. A., and J. D. Klena. 1993. Genetics of lipopolysaccharidebiosynthesis in enteric bacteria. Microbiol. Rev. 57:655–682.

32. Skurnik, M., R. Venho, P. Toivanen, and A. Al-Hendy. 1995. A novel locusof Yersinia enterocolitica serotype O:3 involved in lipopolysaccharide outercore biosynthesis. Mol. Microbiol. 17:575–594.

33. Stevenson, G., A. Kessler, and P. R. Reeves. 1995. A plasmid-borne O-antigen chain length determinant and its relationship to other chain lengthdeterminants. FEMS Microbiol. Lett. 125:23–30.

34. Stroeher, U. H., L. E. Karageorgos, M. H. Brown, R. Morona, and P. A.Manning. 1995. A putative pathway for perosamine biosynthesis is the first


on Septem


.org/D

ownloaded from

http://jb.asm.org/

function encoded within the rfb region of Vibrio cholerae O1. Gene 166:33–42.

35. Tsai, C.-M., and C. E. Frasch. 1982. A sensitive silver stain for detectinglipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119:115–119.

36. Wartenberg, K., J. Lysy, and W. Knapp. 1975. On the sugar content of thelipopolysaccharides of the various strains known as Yersinia enterocolitica.Zentralbl. Bakteriol. Hyg. 230:361–366.

37. Whitfield, C. 1995. Biosynthesis of lipopolysaccharide O antigens. TrendsMicrobiol. 3:178–185.

38. Whitfield, C., and M. A. Valvano. 1993. Biosynthesis and expression ofcell-surface polysaccharides in Gram-negative bacteria. Adv. Microbiol.

Physiol. 35:135–246.39. Wilson, D. B., and D. S. Hogness. 1966. Galactokinase and uridine diphos-

phogalactose 4-epimerase from Escherichia coli. Methods Enzymol. 8:229–240.

40. Winberg, G., and M.-L. Hammarskjold. 1980. Isolation of DNA from aga-rose using DEAE-paper. Application to restriction site mapping of adeno-virus type 16 DNA. Nucleic Acids Res. 8:253–264.

41. Zhang, L., P. Toivanen, and M. Skurnik. 1996. The gene cluster directingO-antigen biosynthesis in Yersinia enterocolitica O:8: identification of thegenes for mannose and galactose biosynthesis and the gene for O-antigenpolymerase. Microbiology 142:277–288.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

identiﬁcationofthe gale geneanda gale homologand ... ·...

Documents