imaging neural stem cell fate in mouse

UNIT 5A.1Imaging Neural Stem Cell Fate in MouseModel of Glioma

Khalid Shah1

1Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts

ABSTRACT

This unit describes a protocol for following the fate of stem cells in real time in a mousemodel of glioma. Stem cells and tumor cells can be transduced with lentiviral vectorsbearing two different luciferases, firefly luciferase (Fluc) and Renilla (Rluc) luciferase,respectively. With the cells labeled in this manner, bioluminescence imaging can be usedto study the fate of stem cells in glioma-bearing brains in vivo. Curr. Protoc. Stem CellBiol. 8:5A.1.1-5A.1.11. C© 2009 by John Wiley & Sons, Inc.

Keywords: neural stem cell � bi-modal vector � luciferase � fluorescent proteins �

glioma � in vivo imaging

INTRODUCTION

Several studies have demonstrated the effectiveness of neural stem cell (NSC) transplan-tation in the treatment of neurodegenerative diseases, including spinal cord injury andbrain tumors (Snyder and Macklis, 1995; Ehtesham et al., 2002; Lindvall et al., 2004;Hofstetter et al., 2005; Iwanami et al., 2005; Shah et al., 2005). This unit describes a pro-tocol for simultaneously imaging the fate of engineered NSC and glioma cells in a mouseglioma model. NSC and glioma cells transduced with lentiviral vectors bearing differentcombinations of fluorescent and bioluminescent proteins can be grown as monolayersand maintained over several passages. The unit begins with a method for transducingNSC and glioma cells with bimodal lentiviral vectors for stable expression of these fluo-rescent and bioluminescent markers in vitro, followed by transplantation of fluorescentand bioluminescent glioma cells and NSC in mice, and, finally, sequential bioluminescentimaging of NSC fate and glioma progression in mice. The integration of different com-binations of bioluminescent and fluorescent proteins into NSC and glioma cells makesit possible to distinguish different populations of cells after intracranial transplantation.Lentiviral vector transduction of cells is followed by cell sorting, which is necessary toobtain a pure population of different fluorescent cell types. The protocol details viraltransduction, surgical preparation, craniotomy, cell implantation, animal recovery, andimaging procedures to study stem cell kinetics and migration to malignant brain tumors.

NOTE: All solutions and equipment coming into contact with live cells must be sterile.

NOTE: All culture incubations should be performed in a humidified 37◦C, 5%, CO2

incubator unless otherwise specified.

NOTE: Viral transductions on human stem cells and glioma cells and cell culture proce-dures are performed in a biosafety level (BL)-2 facility in a laminar-flow hood.

BASICPROTOCOL 1

ENGINEERING STEM CELL AND GLIOMA LINES

This protocol is used for transducing human NSC and human glioma cells with lentiviralvectors bearing bioluminescent and fluorescent markers for stable expression of thesemarkers in vitro and in vivo. Both cell types are transduced with lentiviral vectors bearingunique combinations of fluorescent and bioluminescent markers, and cells are sorted bycell sorter.

Current Protocols in Stem Cell Biology 5A.1.1-5A.1.11Published online March 2009 in Wiley Interscience (www.interscience.wiley.com).DOI: 10.1002/9780470151808.sc05a01s8Copyright C© 2009 John Wiley & Sons, Inc.

GeneticManipulation ofStem Cells

5A.1.1

Supplement 8

Imaging NeuralStem Cell Fate inMouse Model of

Glioma

5A.1.2

Supplement 8 Current Protocols in Stem Cell Biology

Materials

Human neural stem cells (NSC; Rubio et al., 2000)NSC culture medium (see recipe)0.25% (w/v) trypsin/EDTA (Invitrogen)Human glioma cells (Gli36; Shah et al., 2004)Glioma cell culture medium: DMEM containing 10% FBS and 1×

penicillin/streptomycinPlasmid for NSC cells: lentiviral plasmid bearing a fusion between GFP and Fluc

(GFP-Fluc; Shah et al., 2008)Plasmid for glioma cells: lentiviral plasmid bearing a fusion between Rluc and

DsRed2 (Rluc-DsRed2; Shah et al., 2008)Phosphate-buffered saline (PBS; e.g., Invitrogen)NSC culture medium (see recipe) containing 8 μg/ml polybrene (add from 8 mg/ml

polybrene stock in PBS; Fisher)Glioma cell culture medium (see above) containing 8 μg/ml polybrene (add from

8 mg/ml polybrene stock in PBS; Fisher)

5-cm culture dishes (Corning)Fluorescence microscope with appropriate filters for GFP and rhodamineCell sorter (e.g., FACScalibur from BD Biosciences)

Additional reagents and equipment for fluorescence-activated cell sorting(Robinson et al., 2009)

Culture cells and lines1a. For human fetal neural stem cell line: Culture human fetal neural stem cell line

(NSC), derived from the human diencephalic and telencephalic regions of 10 to10.5 weeks gestational age from an aborted human Caucasian embryo, in NSCculture medium in a 5-cm culture dish at 37◦C in a humidified incubator, to 70% to80% confluency.

These cells are grown as monolayers and are passaged every 4 days by trypsinizing cellsin 0.25% trypsin/EDTA. Cells are centrifuged 10 min at 300 × g and plated at 20%density in NSC culture medium.

The in vitro and in vivo properties of NSC (including the absence of transformation,clonality, multipotency, stability, and survival) have been described in detail elsewhere(Rubio et al., 2000; Villa et al., 2004; Navarro-Galve et al., 2005).

1b. For human glioma cell line: Culture Gli36, a human glioma cell line whose in vitroand in vivo characteristics have been described elsewhere (Shah et al., 2004, 2005)in glioma cell culture medium at 37◦C to 70% to 80% confluency.

Glioma cells grow as monolayers and are passaged every 4 days by trypsinizing cells in0.25% trypsin/EDTA. Cells are seeded at 20% density in glioma cell culture medium.

2. When cells reach 70% to 80% confluency, subculture cells at a 1:4 (NSC) or 1:5(glioma cell) ratio.

Prepare lentiviral vectors3. Use the CS-CGW transfer plasmid–based lentiviral vector system (Miyoshi et al.,

1998) to create lentiviral transfer vectors bearing fusions between Renilla luciferase(Rluc) and Discosoma Red (DsRed2) proteins (LV-Rluc-DsRed2) and lentiviralvectors bearing fusions between firefly luciferase (Fluc) and green fluorescent protein(GFP; LV-GFP-Fluc).

The construction of LV-GFP-Fluc and LV-Rluc-DsRed2 is described in detail elsewhere(Shah et al., 2008).


5A.1.3

Current Protocols in Stem Cell Biology Supplement 8

4. Amplify the cDNA sequences encoding GFP-Fluc fusion and Rluc-DsRed2 fusionby PCR (Kramer and Coen, 2001) and ligate in-frame into NheI/XhoI-digestedCS-CGW plasmid (Shah et al., 2008).

5. Produce lentiviral vectors (Shah et al., 2008).

6. Titer the viruses (Shah et al., 2008) and store in PBS at −80◦C.

Perform viral transduction and cell sortingFor NSC

7a. Plate NSC at 60% confluency in a 5-cm dish.

8a. At a time point 18 hrs later, transduce NSC with LV-GFP-Fluc (at MOI = 1) inNSC culture medium containing 8 μg/ml polybrene.

9a. Confirm viral transduction by visualizing cells for GFP expression by fluorescencemicroscopy 36 to 48 hr after transduction.

10a. At 72 hr after transduction, perform single-cell sorting based on GFP fluorescence,using a cell sorter (also see Robinson et al., 2009) to obtain a monoclonal cellpopulations. Culture sorted cells in NSC culture medium.

We use BD FACScalibur cell sorter (BD Biosciences).

For glioma cells7b. Plate glioma cells at 40% confluency in a 5-cm dish.

8b. 18 hr later, transduce glioma cells with LV-Rluc-DsRed2 (at MOI = 1) in gliomacell culture medium containing 8 μg/ml polybrene.

9b. Confirm viral transduction by visualizing cells for DsRed2 expression by fluores-cence microscopy 48 hr after transduction.

10b. At 72 hr after transduction, trypsinize cells using trypsin/EDTA, wash the cellstwice with PBS (each time centrifuging 10 min at 300 × g), and perform single-cellsorting based on rhodamine fluorescence using a cell sorter (also see Robinsonet al., 2009) to obtain monoclonal cell populations. Culture sorted cells.

SUPPORTPROTOCOL

BIOLUMINESCENCE IMAGING IN CULTURE

This protocol is used for bioluminescence imaging of NSC and glioma cells express-ing different combinations of bioluminescent and fluorescent markers in vitro (seeFig. 5A.1.1).

Materials

NSC and glioma cells bearing bioluminescent and fluorescent markers (BasicProtocol 1)

NSC culture medium (see recipe)150 mg/ml D-luciferin stock (firefly luciferase substrate; Biotium, cat. no. 10110-1;

http://www.biotium.com) in PBSGlioma cell culture medium: DMEM containing 10% FBS1 mg/ml coelenterazine stock (substrate for Renilla luciferases; Biotium, cat. no.

10102-2; http://www.biotium.com) in ethanol

48- or 96-well clear-bottom black-walled plateBioluminescence imaging system with IVIS-200 or IVIS-100 (Caliper;

http://www.caliperls.com/) or similar bioluminescence imaging system


Glioma

5A.1.4


Figure 5A.1.1 Fluorescence and bioluminescence characteristics of NSC (A) and glioma cells(B) in culture. NSC and glioma cells were transduced in culture with LV-GFP-Fluc and Lv-Rluc-DsRed2, respectively, at MOI = 1, and visualized for GFP (A) or DsRed2 (B) ßuorescence. (C,D)Different concentrations of NSC expressing GFP-Fluc (1.0�1.5 × 105) and glioma cells (1.5�6× 105) expressing Rluc-DsRed2 were plated, and, 12 hr later, cells were incubated with 150μg/ml D-luciferin or 1 μg/ml of coelenterazine and imaged under the CCD with a scan time of1 min. MagniÞcation, 20×. Adapted from Shah et al. (2008), with permission from Society forNeuroscience.

To image the bioluminescence of transduced NSC1a. Using a black-walled, clear-bottom 96-well tissue culture plate, seed NSC at several

densities spanning 1000 to 10,000 cells per well in 100 μl NSC culture medium,to determine the correlation between the number of transduced NSC and the fireflyluciferase bioluminescence signal. Incubate.

2a. At a time point 18 to 24 hr later add D-luciferin (substrate for firefly luciferase) tothe culture medium at a 1/10 volume, for a final concentration of 0.15 mg/ml, usinga multichannel pipettor.

Dilute from a 150 mg/ml D-luciferin stock.

3a. Rock the plate and take images in bioluminescence imager with the appropriateexposure.

For firefly luciferase, peak light production from intact cells occurs ∼10 min after substrateaddition.

To image bioluminescence imaging of transduced glioma cells1b. Using a black-walled, clear-bottom 96-well tissue culture plate, seed glioma cells at

several densities ranging from 1000 to 10,000 cells per well in 100 μl glioma cellculture medium to determine the correlation between number of transduced gliomacells and Renilla luciferase bioluminescence signal. Incubate.

2b. At a time point 18 to 24 hr later, add coelenterazine (substrate for Renilla luciferase)to the culture medium at a 1/10 volume, for a final concentration of 0.1 μg/ml, usinga multichannel pipettor.


5A.1.5


The 1 mg/ml ethanol stock of coelenterazine is first diluted to an appropriate concentrationwith PBS before being added to the culture medium.

3b. Rock the plate and take images in bioluminescence imager with the appropriateexposure.

Peak bioluminescence from Renilla luciferases occurs rapidly within the first minute afteradding coelenterazine.

BASICPROTOCOL 2

CELL TRANSPLANTATION AND IMAGING

This protocol is used for transplantation and subsequent imaging of NSC and glioma cellsexpressing different combinations of bioluminescent and fluorescent markers in mice. Italso describes the dual imaging of NSC fate and glioma progression in the mouse gliomamodel.

NOTE: All protocols involving live animals must be reviewed and approved by anInstitutional Committee for Ethical Animal Care and Use (IACUC) and must conformto government regulations for the care and use of laboratory animals.

NOTE: Mouse surgical procedures are performed in a surgical room designated foranimal surgeries. Proper aseptic techniques should be used accordingly.

Materials

SCID mice (6-to 8-weeks-old; Charles River Laboratories)Anesthetics: ketamine and xylazine (also see Donovan and Brown, 1998)Betadine solution (Bruce Medical; http://www.brucemedical.com/)70% isopropyl alcohol (Fisher)Phosphate-buffered saline (PBS), sterileGli36-Rluc-DsRed2 glioma cells (Basic Protocol 1)Bone wax (Ethicon)Coelenterazine (100 μg/animal in 150 μl saline; Biotium, cat. no. 10102-2)D-luciferin (150 μg/g body weight in 150 μl saline; Biotium, cat. no. 10110-1)

Animal shaverStereotaxic frame (Harvard Apparatus, cat. no. 726049)Stereo dissecting microscope: variable magnification (1 to 4.5; Nikon)Fine scissors (Fine Science Tools, cat. no. 14084-08)Forceps, angled and straight and ultrafine angled (Fine Science Tools)Cotton-tipped applicatorsHand-held micro-drill (Fine Science Tools, cat. no. 18000-17) with 0.45-mm round

drill burr (VWR)10-μl Hamilton gastight 1701 syringe with 26-G needle4–0 vicryl sutures or surgical staplesBioluminescence imaging system with IVIS-200 or IVIS-100 (Caliper;

http://www.caliperls.com/) or similar bioluminescence imaging system

Additional reagents and equipment for anesthesia of mice (Donovan and Brown,1998)

Anesthetize the animal1. Grasp the animal firmly with one hand and anesthetize by injecting ketamine and

xylazine intraperitoneally (Donovan and Brown, 1998).

The ideal dosage for each animal will vary primarily based upon the animal’s body mass(120 mg/kg ketamine and 16 mg/kg xylazine) and age.


Glioma

5A.1.6


Figure 5A.1.2 Anesthetized mouse in a stereotaxic device being implanted with glioma cells.

2. Use the toe-pinch method to assess the level of sedation by firmly applying pressureto the animal’s toe pads and observing whether or not there is a demonstration of apain response by the animal. Also monitor breathing and posture.

3. Secure animal on a stereotactic head frame placed under a stereo dissecting micro-scope and shave dorsal surface of the animal’s head (see Fig. 5A.1.2).

4. Disinfect the shaved area by applying two alternating coatings with Betadine and70% isopropyl alcohol.

5. Using scissors and forceps, remove the skin from the disinfected region and use adry cotton swab to completely remove the periosteum membrane from the exposedskull surface. Keep the skull moist by frequent application of sterile PBS followingthe removal of the periosteum.

6. For glioma cell implantations, use a handheld micro-drill to drill through thebone at the location of the proposed implantation site until the cortical surface isexposed.

Implant tumor cells7. Place 4 to 5 μl of Gli36-Rluc-DsRed2 glioma cells (100,000 cells) in a 10-μl 26-G

Hamilton Gastight 1701 syringe and insert the needle to a specified depth into theleft frontal lobe.

In our experiments we have used the following stereotactic coordinates: 2.5 mm lateraland 0.5 mm caudal to bregma; depth 2.5 mm from dura.

8. Implant cells over a period of 4 min with 30-sec intervals.

Care should be taken to consistently implant tumors at the same location and depth tofacilitate bioluminescence interpretation from within this relative point source.

9. After implantation is complete, wait for 5 min and remove needle over a period of10 min with intervals of 1 min.

10. Seal the burrow hole with bone wax and close the wound with 4–0 vicryl sutures orsurgical staples.


5A.1.7


Figure 5A.1.3 NSC migrate into gliomas in vivo. Bioluminescence imaging of mice implantedwith GFP-Fluc expressing NSC in mice with established Rluc-DsRed2 gliomas. Fluc images ofmice on day 3 (A), day 7 (B), and day 10 (C), and Rluc image on day 10 (D). Adapted from Shahet al. (2008) with permission from Society for Neuroscience.

Image in vivo tumor cell bioluminescenceImaging can be performed 24 hr after cell implantation.

11. Anesthetize mouse by injecting the appropriate dose of ketamine and xylazine in-traperitoneally (see step 1).

12. Use the toe-pinch method to assess the level of sedation by firmly applying pressureto the animal’s toe pads and observing whether or not there is a demonstration of apain response by the animal. Also monitor breathing and posture.

It is slightly more difficult, yet equally important, to monitor anesthesia during imagingas during surgery. During extended time-course sessions, imaging may be jeopardizedby a possible toe-pinch reaction and it may be more appropriate to monitor the animal’sbreathing and posture.

13. First, acquire a surface image of each animal using dim polychromatic illumination.Next, measure the spatial distribution of luciferase activity within the mouse brainby photon count recording using IVIS-200 or IVIS-100 or similar bioluminescenceimaging system (see Fig. 5A.1.3), according to the manufacturer’s instructions.

14. Image mice for Rluc activity by injecting 100 μg coelenterazine (in 150 μl saline)intravenously via the tail vein and record photon counts 5 min later over a 5-minperiod using IVIS-200 or IVIS-100 or similar bioluminescence imaging system (seeFig. 5A.1.3) according to the manufacturer’s instructions.

Implant stem cells15. Anesthetize the same animals implanted with glioma cells with the appropriate dose

of ketamine and xylazine (see step 1).

16. Secure on a stereotactic head frame placed under a stereo dissecting microscope.

17. Using a handheld micro-drill, drill hole in the contralateral, right frontal lobe at thefollowing coordinates: 2.5 mm lateral and 0.5 mm caudal to bregma; depth 2.5 mmfrom dura.

Depending on the migrating ability and speed of migration, NSC can be placed at anydistance from the gliomas in order to assess migration of NSC to gliomas in the brain.In our studies, we have placed the NSC in the contralateral right frontal lobe of theglioma-bearing mice in order to follow migration of NSC toward gliomas.


Glioma

5A.1.8


18. Place 4 to 5 μl of NSC expressing GFP-Fluc (NSC-GFP-Fluc; 500,000 cells) in a10-μl 26-G Hamilton Gastight 1701 syringe and implant cells over 4 min with 30-secintervals.

19. Wait 5 min and withdraw the syringe over 10 min, with 1-min intervals.

Image in vivo stem cell bioluminescence20. To image mice for firefly luciferase (Fluc) activity, inject the mice intraperitoneally

with 150 μg/g body weight D-luciferin (in 150 μl saline).

21. Acquire images 10 min after D-luciferin administration over a period of 5 min.

22. Measure the spatial distribution of luciferase activity within the brain of the animalby recording photon counts using IVIS-200 or IVIS-100 or similar bioluminescenceimaging system (see Fig. 5A.1.3), according to the manufacturer’s instructions.

Mice can be imaged every day for Fluc and Rluc activity. Typical exposure times varybetween 1 and 10 min. If imaging for both, screen for Rluc activity and then Fluc activity.Allow a 24-hr period between imaging sessions to make sure there is no residual luciferaseactivity from the previous session.

Allow the animal to recover23. Observe the animal for recovery. Make certain the animal is restrained and that it

cannot cause harm to itself. When the animal is maintaining its own normal bodytemperature and has a reflexive response to toe-pinch stimulation, return it to a cleanand unoccupied cage.

For the most part, the animal should survive the procedure despite the absence of anexternal heat source. The usual recovery time for this procedure can range from 2 to12 hr. If the animal has not resumed normal grooming and eating behavior beyond thistime frame, it may require additional medical attention or euthanasia.

Analyze data24. Use the software accompanying the imaging equipment to perform the region of

interest (ROI) analysis.

In our studies, following data acquisition, post-processing and visualization is performedusing a home-written program with image display and analysis suite developed in IDL(Research Systems Inc.). Regions of interest are defined using an automatic intensity con-tour procedure to identify bioluminescence signals with intensities significantly greaterthan the background. The mean, standard deviation, and sum of the photon counts in theseregions are then calculated. For visualization purposes, the bioluminescence images arefused with the corresponding white-light surface images as a transparent pseudocoloroverlay, permitting correlation of areas of bioluminescence activity with anatomy. Main-taining a standard region of interest within an experiment (or series of experiments) isimportant to facilitate comparison of mouse imaging data.

REAGENTS AND SOLUTIONSFor culture recipes and steps, use sterile tissue culture–grade water. For other purposes, usedeionized, distilled water or equivalent in recipes and protocol steps. For suppliers, see SUPPLIERS

APPENDIX.

NSC culture medium

DMEM/F-12 (Invitrogen) supplemented with:0.6% (w/v) D-glucose (Sigma-Aldrich)0.5% (w/v) AlbuMax (Life Technologies)0.5% (w/v) L-glutamine (Life Technologies)20 ng/ml recombinant human FGF (R & D Systems)

continued


5A.1.9


20 ng/ml recombinant human EGF (R & D Systems)1× N2 supplement (Invitrogen)1% (w/v) nonessential amino acids (Cellgro)1 mM sodium pyruvate (Cellgro)26 mM sodium bicarbonate)

COMMENTARY

Background InformationNeural stem cells (NSC) are defined by

their ability to self-renew and give rise to ma-ture progenitors of neural lineages. The abil-ity of NSC to migrate to diseased areas of thebrain has been documented (Snyder and Mack-lis, 1995: Aboody et al., 2000; Tang et al.,2003; Shah et al., 2005). Their capacity to dif-ferentiate into all neural and glial phenotypes(Gage, 2000) provides a powerful tool for tar-geting the treatment of both diffuse and lo-calized neurologic disorders. Several studieshave demonstrated the effectiveness of NSCtransplantation in the treatment of neurode-generative diseases, including spinal cord in-jury and brain tumors (Snyder and Macklis,1995; Ehtesham et al., 2002; Lindvail et al.,2004; Hofstetter et al., 2005; Iwanami et al.,2005; Shah et al., 2005). Taking advantage oftheir homing properties, NSC have also beenmodified to deliver selective anti-neoplasticproteins (Ehtesham et al., 2002; Shah et al.,2005), although with mixed results. Whilethese studies demonstrate the feasibility ofNSC-based therapy, cellular delivery of thera-peutic proteins via NSC grafts will likely re-quire long-term transgene expression. In vivoassays, which permit rapid assessment of thefate of transplanted stem cells, will be usefulin designing future stem-cell-based therapies.

Bioluminescence imaging exploits theemission of visible photons at specific wave-lengths based on energy-dependent reactionscatalyzed by luciferases. It is a powerfulmethod for detecting and quantifying thespatial and temporal occurrence of cellularand molecular events and can be efficientlyused for longitudinal comparison of cell sur-vival and migration. Luciferases from Renilla(Rluc) and firefly (Fluc) have different sub-strates, coelenterazine and D-luciferin, respec-tively, and can be imaged in tumors in thesame living mouse with kinetics of light pro-duction being separable by timed injections ofthese two substrates (Shah et al., 2005). Thisdual-imaging approach has direct applicationsin studying gene expression from vectors andsimultaneously monitoring therapeutic effectsin vivo.

Critical Parameters andTroubleshooting

An efficient and robust way to follow cellsboth in culture and in vivo is to transduce themwith lentiviral vectors expressing fusions ofbioluminescent and fluorescent marker genes.These vectors have the ability to integratetransgenes into the genome of dividing andnondividing cells (Naldini et al., 1996) andprovide means of efficient long-term expres-sion in cells and their progeny without usingany antibiotic selection marker. The fluores-cent marker serves to determine the efficiencyof transduction, and, in conjunction with thebioluminescent marker, serves as an in vivocell-tracking protein. Furthermore, the expres-sion of fluorescent markers in different cellpopulations also aids in performing patholog-ical analysis on tissue sections in sacrificedanimals.

Knowing the depth and optical propertiesof the tissue through which the light will passis essential in calculating numbers of cellsneeded to obtain a detectable signal. Gen-erally, firefly luciferase light will be attenu-ated approximately 10-fold for each centime-ter of tissue, but optically dense tissues such asliver will attenuate light much more than skin,bone, or lung. Thus, the number of luciferase-expressing cells and their localization withinthe body is critical in obtaining a detectablesignal to follow fate of cells in vivo; the deeperthe tumors are within the body, or the deeperthe intracranial tumor, the greater the signalattenuation. For example, in subcutaneous tu-mors, cell numbers as low as 1000 fireflyluciferase–expressing cells can be detected.Also, D-luciferin has more favorable biodis-tribution than coelenterazine, and an intraperi-toneal injection of luciferin is much more re-producible than the tail vein injection that isrequired for delivering coelenterazine.

Transplanting cells expressing Fluc andRluc in various sites, using various gene de-livery vectors and transgenic models, demon-strates the high accessibility of D-luciferin(Fluc substrate) to various tissues, includingthe brain. On the other hand, coelenterazine


Glioma

5A.1.10


is also accessible to many tissues because ofits diffusable nature (Lorenz et al., 1996), butits distribution in the intact brain is limitedby drug-transport proteins, which can hinderin vivo imaging of Renilla luciferase (Pichleret al., 2004). This problem may be overcomeby injecting mice with a blood-brain barrier(BBB) disrupter, e.g., mannitol. Also, mousefur attenuates and scatters light, and this effectis most pronounced in black mice. This prob-lem may be overcome by using nude mice orshaving animals over the region(s) of interestfor imaging.

Luciferase imaging in mice offers the pos-sibility of imaging mice serially. To per-form repetitive imaging of mice, the usershould take into account that luciferase lev-els in mice peak ∼10 min after intraperi-toneal. injection, then decline slowly to back-ground levels by 6 to 8 hr post injection(Paroo et al., 2004). Coelenterazine has amore rapid kinetic course in mice. There-fore, maximum imaging signal for Renillaluciferases is obtained immediately after in-jecting coelenterazine through intravenous orintra-cardiac routes (Bhaumik and Gambhir,2002). For imaging two different molecularevents simultaneously, for example, stem cellfate and glioma volumes in the same mouse,it is advisable to image Renilla luciferase ac-tivity first, and then image firefly luciferaseactivity.

Bioluminescence signal from mice im-planted with NSC-expressing bioluminescentproteins in the brain varies with the presenceand absence of tumors, and in different mice.We have previously shown that human neu-ral stem cell survival is much improved inSCID mice as compared to nude mice (Shahet al., 2008), which could be attributed to thefact that SCID mice (lacking functional T andB cells) are more immune-compromised thannude mice (which lack functional T cells only),and this may implicate immune rejection as afactor in NSC survival in the brain. Our studiesalso reveal the persistence of NSC in the brainsof tumor-bearing mice as compared to nor-mal mice, implying that glioma cells or hostresponse may modulate human stem cell sur-vival either through secretion of growth fac-tors or by inhibition of molecules involvedin foreign cell rejection. While designing ex-periments for imaging human stem cell fatein mouse tumor models, the choice of mouseand the tumor cell type should be taken intoconsideration.

Anticipated ResultsThe protocols in this unit generate useful

information on the fate of NSC in a mousemodel of glioma, and are suitable for a num-ber of other disease models. Both stem cellsand glioma cells can be easily transduced withlentiviral vectors, and bioluminescence imag-ing can be used to study the fate of stem cells indifferent disease models in vivo. Glioma cellsurvival is higher than NSC survival in mice.Furthermore, we have shown that the presenceof glioma cells improves the survival of NSCin the brain.

Time ConsiderationsIt takes 1 week for glioma cells and 2

weeks for NSC to grow before they aretransduced with lentiviral vectors. Gliomacells are implanted 2 to 3 days after lentivi-ral transduction, and transduced NSC areimplanted 3 to 4 days after glioma cell im-plantation. Both glioma cells and NSC can befollowed in real time in vivo for a period of 3to 4 weeks before glioma growth results in themortality of animals.

Literature CitedAboody, K.S., Brown, A., Rainov, N.G., Bower,

K.A., Liu, S., Yang, W., Small, J.E., Herrlinger,U., Ourednik, V., Black, P.M., Breakefield, X.O.,and Snyder, E.Y. 2000. Neural stem cells displayextensive tropism for pathology in adult brain:Evidence from intracranial gliomas. Proc. Natl.Acad. Sci. U.S.A. 97:12846-12851.

Bhaumik, S. and Gambhir, S.S.. 2002. Opticalimaging of Renilla luciferase reporter gene ex-pression in living mice. Proc. Natl. Acad. Sci.U.S.A. 99:377-382.

Donovan, J. and Brown, P. 1998. Anesthesia. Curr.Protoc. Immunol. 27:1.4.1-1.4.5.

Ehtesham, M., Kabos, P., Gutierrez, M.A., Chung,N.H., Griffith, T.S., Black, K.L., and Yu, J.S.2002. Induction of glioblastoma apoptosis us-ing neural stem cell-mediated delivery of tumornecrosis factor-related apoptosis-inducing lig-and. Cancer Res. 62:7170-7174.

Gage, F.H. 2000. Mammalian neural stem cells.Science 287:1433-1438.

Hofstetter, C.P., Holmstrom, N.A., Lilja, J.A.,Schweinhardt, P., Hao, J., Spenger, C.,Wiesenfeld-Hallin, Z., Kurpad, S.N., Frisen, J.,and Olson, L. 2005. Allodynia limits the useful-ness of intraspinal neural stem cell grafts: Di-rected differentiation improves outcome. Nat.Neurosci. 8:346-353.

Iwanami, A., Kaneko, S., Nakamura, M., Kane-mura, Y., Mori, H., Kobayashi, S., Yamasaki,M., Momoshima, S., Ishii, H., Ando, K., Tan-ioka, Y., Tamaoki, N., Nomura, T., Toyama, Y.,and Okano, H. 2005. Transplantation of human


5A.1.11


neural stem cells for spinal cord injury in pri-mates. J. Neurosci. Res. 80:182-190.

Kramer, M.F. and Coen, D.M. 2001. Enzymaticamplification of DNA by PCR: Standard proce-dures and optimization. Curr. Protoc. Mol. Biol.56:15.1.1-15.1.14.

Lindvall, O., Kokaia, Z., and Martinez-Serrano, A.2004. Stem cell therapy for human neurodegen-erative disorders: How to make it work. Nat.Med. 10:S42-S50.

Lorenz, W.W., Cormier, M.J., O’Kane, D.J., Hua,D., Escher, A.A., and Szalay, A.A. 1996. Expres-sion of the Renilla reniformis luciferase genein mammalian cells. J. Biolumin. Chemilumin.11:31-37.

Miyoshi, H., Blomer, U., Takahashi, M., Gage, F.H.,and Verma, I.M. 1998. Development of a self-inactivating lentivirus vector. J. Virol. 72:8150-8157.

Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulli-gan, R., Gage, F.H., Verma, I.M., and Trono, D.1996. In vivo gene delivery and stable transduc-tion of nondividing cells by a lentiviral vector.Science 272:263-267.

Navarro-Galve, B., Villa, A., Bueno, C., Thompson,L., Johansen, J., and Martinez-Serrano, A. 2005.Gene marking of human neural stem/precursorcells using green fluorescent proteins. J. GeneMed. 7:18-29.

Paroo, Z., Bollinger, R.A., Braasch, D.A., Richer,E., Corey, D.R., Antich, P.P., and Mason, R.P.2004. Validating bioluminescence imaging as ahigh-throughput, quantitative modality for as-sessing tumor burden. Mol. Imaging 3:117-124.

Pichler, A., Prior, J.L., and Piwnica-Worms, D.2004. Imaging reversal of multidrug resistancein living mice with bioluminescence: MDR1P-glycoprotein transports coelenterazine. Proc.Natl. Acad. Sci. U.S.A. 101:1702-1707.

Robinson, J.P., Darzynkiewicz, Z., Hoffman, R.,Nolan, J.P., Orfao, A., Rabinovitch, P.S., andWatkins, S., (eds.). 2009. Current Protocols inCytometry. John Wiley & Sons, Hoboken, N.J.

Rubio, F.J., Bueno, C., Villa, A., Navarro, B., andMartinez-Serrano, A. 2000. Genetically perpet-uated human neural stem cells engraft and dif-ferentiate into the adult mammalian brain. Mol.Cell Neurosci. 16:1-13.

Shah, K., Tung, C.H., Yang, K., Weissleder, R.,and Breakefield, X.O. 2004. Inducible releaseof TRAIL fusion proteins from a proapoptoticform for tumor therapy. Cancer Res. 64:3236-3242.

Shah, K., Bureau, E., Kim, D.E., Yang, K., Tang,Y., Weissleder, R., and Breakefield, X.O. 2005.Glioma therapy and real-time imaging of neuralprecursor cell migration and tumor regression.Ann. Neurol. 57:34-41.

Shah, K., Hingtgen, S., Kasmieh, R., Figueiredo,J.L., Garcia-Garcia, E., Martinez-Serrano, A.,Breakefield, X., and Weissleder, R. 2008. Bi-modal viral vectors and in vivo imaging revealthe fate of human neural stem cells in exper-imental glioma model. J. Neurosci. 28:4406-4413.

Snyder, E.Y. and Macklis, J.D. 1995. Multipo-tent neural progenitor or stem-like cells may beuniquely suited for therapy for some neurode-generative conditions. Clin. Neurosci. 3:310-316.

Tang, Y., Shah, K., Messerli, S.M., Snyder, E.,Breakefield, X., and Weissleder, R. 2003. In vivotracking of neural progenitor cell migration toglioblastomas. Hum. Gene Ther. 14:1247-1254.

Villa, A., Navarro-Galve, B., Bueno, C., Franco, S.,Blasco, M.A., and Martinez-Serrano, A. 2004.Long-term molecular and cellular stability ofhuman neural stem cell lines. Exp. Cell Res.294:559-570.

UNIT 5A.2Functional Analysis of Adult Stem CellsUsing Cre-Mediated Lineage Tracing

Diana L. Carlone1

1Children’s Hospital Boston, Harvard Medical School, Boston, Massachusetts

ABSTRACT

Lineage-tracing has been used for decades to establish cell fate maps during development.Recently, with the advent of genetic lineage-tracing techniques (employing Cre-lox re-combination), it has been possible to permanently mark progenitor/stem cell populationswithin somatic tissues. In addition, pulse-chase studies have shown that only stem cellsare capable of producing labeled progeny after an extensive period of chase. This unitfocuses on the protocols used to target putative adult stem cells in vivo. Using thesetechniques, one should be able to functionally confirm or deny the stem cell capacity ofa given cell population. Curr. Protoc. Stem Cell Biol. 9:5A.2.1-5A.2.15. C© 2009 by JohnWiley & Sons, Inc.

Keywords: tamoxifen-inducible Cre recombination � lineage contribution �

reporter activity � whole-mount analysis

INTRODUCTION

Adult stem cells are elusive in many tissues. The promise of cell-based therapeutics forthe treatment of human disease must first begin with the identification of functionallyimportant stem cell populations. It is generally accepted that stem cells have the capacityfor self-renewal and multi-lineage contribution within a given tissue. The Cre-lox systemmay be used to permanently mark cells of interest so that they can be observed for whatthey give rise to. If they give rise to no other lineages, they are not stem cells. If they giverise to multiple lineages, and subsequently are shown to self-renew, they are identifiedas stem cells.

This unit focuses on lineage-tracing analysis using tamoxifen-inducible Cre-lox technol-ogy (Fig. 5A.2.1) to define the contribution of specific cell populations. This techniquehas been successfully employed to mark progenitor/stem cell populations in adult tis-sues. A detailed description of the Cre-lox system can be found elsewhere (Rossant andMcMahon, 1999; Nagy, 2000; Branda and Dymecki, 2004). Briefly, Cre recombinasecauses recombination of 34-bp loxP sequences and thus deletion of the intervening se-quence (Fig. 5A.2.1). It is important to note that the orientation of the loxP sequences withrespect to one another determines the recombination outcome (for a review, see Brandaand Dymecki, 2004). Both loxP sequences must be in the same orientation for properexcision. Alteration in the orientation results in inversion of the intervening sequenceand lack of deletion. While this technology is primarily used to induce tissue-specificknockout of genes in mice, when used to activate reporter genes it can indelibly markdiscrete cell populations. The addition of inducible components such as the tamoxifen-inducible Cre recombinase (CreER) to the system further allows for the study of temporalrelationships between cell populations.

Lineage tracing studies typically involve the use of double transgenic mice containingboth a Cre-expressing transgene and a Cre reporter transgene. Cells are permanentlymarked during an initial Pulse and the contribution of their progeny to specific celllineages is then determined during a period of Chase. Multiple strategies have been

Current Protocols in Stem Cell Biology 5A.2.1-5A.2.15Published online May 2009 in Wiley Interscience (www.interscience.wiley.com).DOI: 10.1002/9780470151808.sc05a02s9Copyright C© 2009 John Wiley & Sons, Inc.


5A.2.1

Supplement 9

Cre-MediatedLineage Tracing

5A.2.2


IoxP

IoxP

IoxP

gene X

Cre recombinase

IoxP

ATAACTTCGTATAGCATACATTATACGAAGTTAT

A

B

Figure 5A.2.1 Schematic of the Cre-lox system. (A) The sequence for the loxP site is shown.The underlined sequence is the 8-bp core sequence where recombination occurs, and two flanking13-bp inverted repeats. (B) Schematic of a transgene in which gene X is flanked by two loxP sites.In the presence of Cre recombinase the gene X is deleted leaving only a single loxP.

LacZOR

X

Z/AP reporter

tamoxifen

hPAP

hPAP

Rosa26R reporter

LacZ

CreERT

cell-specific

promoter

LacZ

stop

Figure 5A.2.2 Schematic of bigenic mouse model systems used for lineage tracing. To performtracing studies, tamoxifen-inducible CreERT transgenic mice are crossed with either Rosa26R(left) or Z/AP (right) reporter mice. In the absence of ligand, β-galactosidase (LacZ) reporteris not expressed in the Rosa26R mice while Z/AP mice express LacZ. Upon administration oftamoxifen, recombination occurs in a cell-specific manner resulting in either LacZ (left) or humanplacental alkaline phosphatase (hPAP; right) expression. Once labeled, cells can then be chasedto determine their contribution to distinct lineages.


5A.2.3


developed to indelibly mark cells for cell fate mapping. One strategy employs the useof a loxP-flanked dominant transcriptional stop sequence located upstream of a reportergene. Following Cre-mediated deletion of this stop sequence, constitutive and perma-nent expression of the reporter gene is induced (see Fig. 5A.2.2; Rosa26R reportermouse; Soriano, 1999). Another strategy involves the use of tandem reporter genes withthe first gene flanked by loxP sites. Under baseline conditions, only the first gene isexpressed constitutively. In this scheme, Cre-recombination removes the first gene, al-lowing the permanent expression of the second (see Fig. 5A.2.2; Z/AP reporter mouse;Lobe et al., 1999). In this unit, the protocols used for analysis of two commonly employedtransgenes—β-galactosidase and alkaline phosphatase—are described.

BASICPROTOCOL

WHOLE-MOUNT ANALYSIS OF ββ-GALACTOSIDASE ACTIVITY

This protocol focuses on whole-mount analysis followed by immunohistochemistry todemonstrate that a discrete population of cells contributes to distinct differentiated lin-eages. To perform these studies, double transgenic mice containing both a tamoxifen-inducible cell-specific CreER transgene and a Cre reporter transgene (β-galactosidaseor alkaline phosphatase reporter) are used. As outlined in Critical Parameters, the choiceof the Cre transgene as well as the reporter mouse line is dependent upon the scientificquestion being asked. An example of whole-mount analysis using the β-galactosidasereporter mouse line (Rosa26R) is illustrated in Figure 5A.2.3. While whole-mount anal-ysis has the advantage of allowing for the detection of reporter activity in the context ofthe intact tissue, it does require subsequent histological analysis to confirm the identityof the marked cells. In this protocol, immunohistochemical analysis is performed usingdifferentiation-specific antibodies to demonstrate the contribution of reporter-positivecells to specific cell lineages. Alternatively, if applicable, histological analysis usingspecific stains such as periodic acid-Schiff (PAS), which recognizes carbohydrates intissue sections, can be used to demonstrate histologically that reporter-positive cells aredifferentiated (see Fig. 5A.2.3C-E).

NOTE: While validation of lineage contribution through immunohistochemical analysisof lacZ-stained regions is described, it is possible to co-label cells fluorescently usingboth differentiation-specific antibodies and β-galactosidase-specific antibodies usingeither paraffin or frozen sections.

Materials

Tamoxifen-inducible Cre :: Rosa26R or Z/AP bigenic miceTamoxifen or 4-hydroxytamoxifen (see recipe)Negative control mice (oil-treated bigenic or treated monogenic mice)Positive control mice (Rosa26; Jackson Laboratories cat. no. 002292)Phosphate-buffered saline, Ca++- and Mg++-free (CMF-PBS)LacZ fixative, wash, and staining buffers (see recipes)32% (w/v) paraformaldehyde solution (EMS cat. no. 15714-S)35% 70%, 80%, 90%, 95%, and 100% ethanolXyleneParaffin10 mM sodium citrate, pH 6.03% H2O2, optionalAvidin and biotin blocking solutions (Vector Laboratories cat. no. SP-2001)Normal serum (species selection should match that of the secondary antibody;

Sigma)Differentiation-specific antibodiesVectastain ABC Elite kit (species-specific kits are available dependent upon the

primary antibody; Vector Laboratories)


5A.2.4


A

DC E

B

Figure 5A.2.3 Whole-mount and sectional analysis demonstrate lineage tracing in the small intestine. (A,B) Whole-mount analysis of LacZ staining in the intestine following tamoxifen treatment (2-week chase) at low (A; 2×) and high (B;11.25×) magnification. (C) Frozen sectional analysis of β-galactosidase activity in the small intestine following a 4-weekchase. Tissue was subsequently stained with periodic acid-Schiff to detect lineage contribution. Magnification is 40×.(D,E) Histological analysis of lineage contribution by LacZ-positive cells in the small intestine following tamoxifen treat-ment. Following whole-mount analysis, LacZ-positive regions were paraffin embedded and sections were counterstainedwith periodic acid-Schiff. Co-labeling of LacZ and periodic acid-Schiff corresponds to goblet (D) and Paneth (E) cells.Magnification is 60×.

DAB substrate kit (Vector Laboratories cat. no. SK-4100)Nuclear Fast Red (Sigma cat. no. N3020)Cytoseal XYL mounting medium (Richard-Allan Scientific cat. no. 8312-4)

1.5-ml microcentrifuge tubes or 6-well tissue culture platesPlatform shaker37◦C incubatorMicrotomeMicroscope slidesCoplin jarsPressure cooker, microwave, or water bathCoverslips

NOTE: Unless indicated, all steps in this protocol are performed at room temperature.

Induce Cre expression1. Treat tamoxifen-inducible Cre :: Rosa26R bigenic mice with tamoxifen and control

mice with oil. Collect tissue of interest after treatment (pulse) followed by a periodof chase.

Bigenic mice are obtained by crossing tamoxifen-inducible Cre mice and commer-cially available β-galactosidase reporter Rosa26R mice (Jackson Laboratories cat. no.003310).


5A.2.5


The dosage, route, and frequency of tamoxifen administration are dependent upon mul-tiple factors, which are outlined in the Critical Parameters section and will need tobe empirically determined for each Cre-expressing transgene and tissue of interest. Inaddition, the appropriate treatment should label single cells that can then be chased todetermine their contribution to specific lineages. The length of chase is dependent uponmultiple factors as described in Critical Parameters.

2. Wash tissue with ice-cold CMF-PBS to remove any contaminants and place intoeither a 1.5-ml microcentrifuge tube or 6-well tissue culture plate depending uponthe size of tissue to be analyzed.

Tissue from oil-treated bigenic or tamoxifen-treated monogenic mice should be used as anegative control to confirm specificity of the reaction. In addition, tissue from the Rosa26mouse, which constitutively expresses β-galactosidase (Zambrowicz et al., 1997), can beused as a positive control.

If necessary, tissues can be cleaned and washed for 5 to 10 min in cold CMF-PBS buffercontaining 0.02% (v/v) NP-40 and 0.5 mM DTT prior to fixation. It has been found that thisreduces background LacZ staining especially in whole-mount analysis of gastrointestinaltissues.

The size/thickness of the tissue can affect the penetration of the staining solution therebyaltering the efficiency of labeling. Therefore, using a small tissue biopsy, bisecting thetissue or, if necessary, gently poking holes into the tissue will increase the penetration. If,however, the entire tissue needs to be assayed, then analysis can be performed on tissuesections (see Alternate Protocol 2). Alternatively, if the tissue is thin enough, it can be pro-cessed intact while mounted on paraffin in tissue culture dishes using insect pins (Fine Sci-ence Tools). This approach is routinely used for whole-mount analysis of small intestine.

Fix tissues3. Fix tissue in LacZ fixative solution for 1 hr on ice with shaking.

To increase penetration and decrease background, the detergent NP-40 (0.02%) can beadded to the fixative. Generally, a mild fixative such as glutaraldehyde is used; however,other fixatives can be used, including 4% (w/v) paraformaldehyde, or a combination offixatives such as 0.2% (v/v) glutaraldehyde/2.0% (v/v) formaldehyde in CMF-PBS.

CAUTION: Some fixatives can inhibit or diminish β-galactosidase activity; therefore, itmay be necessary to test alternative fixatives.

4. Wash tissue three times with CMF-PBS for 10 min each on ice with shaking.

Stain for LacZ activity5. Wash with LacZ wash buffer for 10 min on ice with shaking.

6. Incubate tissue in LacZ staining buffer from 1 to 24 hr at 37◦C in the dark, untila dark color from the substrate reaction is seen, while the background is relativelyunstained.

The reaction is light sensitive so incubate sample in the dark. Generally, the reaction isstopped within 24 hr.

The reaction can also be performed at lower temperatures such as 30oC, which hasbeen shown to reduce background staining. However, a longer incubation time may benecessary.

7. To stop reaction, wash two to three times with CMF-PBS for 20 min each at roomtemperature with shaking.

8. To preserve tissue and staining, re-fix tissue with 4% paraformaldehyde in CMF-PBSfor 1 to 2 hr (longer if necessary) at 4◦C with shaking.

9. Place tissue in CMF-PBS and store at 4◦C.

Fixed tissue can be stored 3 to 6 months at 4◦C without diffusion of the LacZ stain.


5A.2.6


Prepare tissues for immunohistochemical confirmation of lineages10. Dehydrate whole-mount stained tissue through an ethanol series (35%, 70%, 90%,

100%) and xylene. Incubate the tissue two times in each solution, 1 hr each time.Embed in paraffin.

The amount of time to dehydrate tissue may vary with the size of the tissue.

Paraffin sections are used to confirm the contribution of a marked cell to distinct lineagesbecause they allow better tissue histology than frozen sections.

11. Cut 4-μm sections and mount onto microscope slides.

12. Rehydrate sections through two changes of xylene, 3 min each, followed by twochanges of 100% ethanol, 2 min each, and then through an ethanol series (95%,90%, 80%, and 70%), 1 min each, using Coplin jars.

All steps involving histological slides are performed using Coplin jars.

13. Wash with CMF-PBS for 5 min with shaking.

For histological analysis of reporter positive cells, paraffin sections after rehydration canbe counterstained with Nuclear Fast Red (see below).

Retrieve antigens14. Perform antigen retrieval by boiling slides in 10 mM sodium citrate, pH 6.0, for 10

min using a pressure cooker, microwave, or water bath.

Fixatives such as paraformaldehyde form protein cross-links that may mask antigenic sitesgiving negative (or weak) immunohistochemical results. Therefore, the antigen retrievalstep unmasks the antigens/epitopes in paraffin sections. This buffer is commonly used andworks well with most antibodies.

15. Allow slides to cool in buffer for 45 to 60 min.

16. Wash slides two to three with CMF-PBS, 5 min each, with shaking.

Treat to reduce background17. (Optional) Incubate slides in 3% H2O2 for 15 min with shaking.

This step blocks endogenous peroxidase activity. Because not all tissues exhibit endoge-nous activity, this step is optional depending upon the tissue of interest.

18. Wash slides three times with CMF-PBS, 5 min each, with shaking.

19. Incubate slides with avidin and biotin blocking solutions, 15 min each, with shaking.Wash three times with CMF-PBS in between each step.

Like peroxidase activity, some tissues exhibit endogenous biotin activity; therefore, thisstep is also optional depending upon the tissue of interest.

20. To reduce non-specific background, block sections with 1% to 5% normal serum inCMF-PBS for 15 to 30 min with shaking.

The exact percentage of serum to be used needs to be determined empirically for eachantibody. In addition, the normal serum used should be from the same species as thesecondary antibody. If necessary, 0.1% to 0.3% Triton X-100 can be used in the blockingsolution to further decrease background.

Immunostain slides21. Incubate sections with primary antibody at appropriate dilution in blocking solution

for 1 hr at room temperature to overnight at 4◦C.

The exact incubation conditions for each antibody must be empirically determined.



5A.2.7


23. Incubate with biotinylated secondary antibody (Vectastain Elite ABC kit) at appro-priate dilution in blocking solution per the manufacturer’s instructions for 30 min at37◦C.

Selection of appropriate Vectastain Elite ABC kit is dependent upon the species used togenerate the primary antibody.


Detect antibody binding25. Incubate sections with ABC reagent 30 min at 37◦C.


27. Incubate slides in 3,3′-diaminobenzidine (DAB) substrate solution for 1 to 5 min.

The DAB solution yields a brown substrate color.

Alternatively, the VIP substrate solution (Vector Laboratories cat. no. SK-4600) can beused and yields a purple substrate color. In addition, the precise incubation time must bedetermined empirically for each antibody.

28. To stop reaction, wash slides with water for 5 min with shaking.

29. If necessary, counterstain sections with Nuclear Fast Red solution for 30 sec to 1 min.

This solution is light sensitive. Nuclear Fast Red is diluted 1:1 with distilled water, filtered,and stored for 3 to 6 months at room temperature. This stain can be reused multiple timesand re-filtered as needed.

30. Dehydrate slides for 2 min each using 70%, 90%, and 100% ethanol and xylene.

31. Mount slides with coverslips using Cytoseal XYL mounting medium.

ALTERNATEPROTOCOL 1

WHOLE-MOUNT ANALYSIS OF ALKALINE PHOSPHATASE ACTIVITY

Although many researchers use LacZ staining to permanently trace the contribution ofstem cells, Cre/lox reporter mice utilizing other reporters such as the enzyme, alkalinephosphatase, can also be used in whole-mount analysis. This protocol can therefore beused as an alternative approach to define the role of a discrete cell population as stemcells using lineage tracing technology.

Additional Materials (also see Basic Protocol)

Alkaline phosphatase fixative solution (see recipe)AP buffer (see recipe)BM Purple AP substrate (Roche Diagnostics cat. no. 11 442 074 001)PTM buffer (see recipe)70◦ to 75◦C incubator

Collect tissue1. Treat tamoxifen-inducible Cre :: Z/AP bigenic mice with tamoxifen and collect tissue

at pulse and chase time points.

As indicated in the Basic Protocol, tissue from oil-treated bigenic or tamoxifen-treatedmonogenic mice should be used as a negative control. In addition, constitutively expressingalkaline phosphatase mice can be used as a positive control.

If appropriate, alkaline phosphatase and LacZ can be detected in the same tissue. Stainingfor β-galactosidase must be performed first due to its sensitivity to heat, which is usedto reduce endogenous alkaline phosphatase activity (see step 4). After X-gal staining,tissue should be rinsed well with CMF-PBS prior to performing the alkaline phosphataseprotocol.


5A.2.8


Fix tissue2. Fix tissue with alkaline phosphatase fixative solution for 30 min on ice with shaking.

3. Wash tissue three times with CMF-PBS, 10 min each, on ice with shaking.

4. Heat-inactivate endogenous alkaline phosphatase activity by incubating in CMF-PBS30 min at 70◦ to 75◦C.

5. Wash with CMF-PBS 10 min at room temperature with shaking.

Detect AP activity6. Wash with AP buffer 10 min at room temperature with shaking.

7. Stain with BM Purple AP substrate up to 36 hr at 4◦C, until a dark color from thesubstrate reaction is seen.

Incubation at room temperature will accelerate the reaction but may result in diffusion ofthe stain.

8. Wash tissue three times with PTM buffer, 10 min each, at room temperature withshaking.

9. To preserve the staining, re-fix the tissue with 4% paraformaldehyde in CMF-PBSfor 1 to 2 hr (longer if necessary) at 4◦C with shaking.

10. Place tissue in CMF-PBS and store for 3 to 6 months at 4◦C.

For immunohistochemical analysis to confirm lineage contribution, tissues can be pro-cessed similar to LacZ-stained whole-mount tissue, see Basic Protocol, step 10.

ALTERNATEPROTOCOL 2

SECTIONAL ANALYSIS FOR ββ-GALACTOSIDASE OR ALKALINEPHOSPHATASE ACTIVITY

Although whole-mount analysis allows for reporter detection in the intact tissue, analysisof tissue sections for reporter activity identifies the specific marked cell histologically.This protocol can therefore be used as an alternative approach or, in many instances,in combination with whole-mount analysis to further define the role of a discrete cellpopulation as stem cells using lineage tracing technology (see Fig. 5A.2.3).

Additional Materials (also see Basic Protocol)

Tissue-Tek OCT (Sakura, cat. no. 4583)0.2% glutaraldehyde/2 mM MgCl2 in CMF-PBS0.2% glutaraldehyde in CMF-PBSAP buffer (see recipe)5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) solution

(see recipe or Vector Laboratories cat. no. SK-5400)

CryomoldsCryostat70◦ to 75◦C incubator

Analyze sections for reporter activity1. Isolate tissue following chase and pulse time points as determined in whole-mount

analysis and place directly into cryomolds containing Tissue-Tek OCT and freezeon dry ice.

Alternatively, tissues can be fixed in 4% paraformaldehyde for 1 to 2 hr on ice, incubatedin 0.6 M sucrose overnight at 4oC, and then embedded in OCT. Sucrose acts as a cry-oprotectant to minimize ice crystal damage, allowing for better microscopic morphology.

The heating process used during the embedding of tissue for paraffin sections inactivatesβ-galactosidase; therefore, all sectional analysis is performed using frozen sections.


5A.2.9


2. Section tissue (10-μm), dry up to 2 hr at room temperature, and store at −20◦C.

Stain for β-galactosidase activity

3a. Fix slides in 0.2% glutaraldehyde/2 mM MgCl2 in CMF-PBS for 10 min on ice withshaking.

Alternative fixatives such as 4% paraformaldehyde may be used; however, as indicatedwith the whole-mount analysis, reporter activity may vary with harsher fixatives.

4a. Wash slides two to three times with LacZ wash buffer, 10 min each, at room temper-ature with shaking.

5a. Incubate in LacZ staining buffer 1 to 24 hr at 37◦C in the dark.

6a. To stop the reaction, wash slides three times with CMF-PBS, 10 min each, followedby a quick rinse in water at room temperature.

7a. Counterstain sections with Nuclear Fast Red solution for 30 sec to 1 min.

8a. Dehydrate slides for 2 min each using 70%, 90%, and 100% ethanol and xylene.

9a. Mount slides with coverslips using Cytoseal XYL mounting medium.

Stain sections for alkaline phosphatase activity

3b. Fix slides in 0.2% glutaraldehyde in CMF-PBS for 10 min on ice with shaking.

4b. Wash slides three times with CMF-PBS, 5 min each, at room temperature withshaking.

5b. Inactivate endogenous alkaline phosphatase by incubating slides in CMF-PBS for30 min at 70◦ to 75◦C.

6b. Wash slides with CMF-PBS for 10 min at room temperature with shaking.

7b. Wash slides with AP buffer for 10 min at room temperature with shaking.

8b. Stain slides with BCIP/NBT solution for 10 to 30 min at room temperature.

Staining solution should be placed directly onto the slides. Sensitivity of substrate can beincreased by lengthening the incubation time.

9b. Wash slides in CMF-PBS and process as indicated above in steps 7a through 9a.

REAGENTS AND SOLUTIONSFor all solutions, use deionized, distilled water or equivalent in recipes and protocol steps. Unlessindicated, all solutions are made up in water. Suppliers for non-common chemicals are indicated.

Alkaline phosphatase fixative solution

0.2% (v/v) glutaraldehyde50 mM EGTA, pH 7.3100 mM MgCl20.02% (v/v) NP-400.01% (w/v) sodium deoxycholatePrepare fresh

To increase the penetration of alkaline phosphatase (AP) substrates, 0.02% NP-40 and0.01% sodium deoxycholate have been added to the fixative.

AP buffer

10 mM Tris·Cl, pH 9.5100 mM NaCl

continued


5A.2.10


10 mM MgCl2Store up to 1 year at room temperature

LacZ fixative solution

0.2% (v/v) glutaraldehyde2 mM MgCl2CMF-PBSPrepare fresh

LacZ staining buffer

0.5 mg/ml X-gal (stock is 40 mg/ml in dimethylformamide)5 mM K3Fe(CN)6

5 mM K4Fe (CN)6-3H2OLacZ wash buffer (see recipe)Prepare fresh

Staining buffer should be made fresh each time. Use CMF-PBS at approximately pH 7.4for all steps. If necessary, use CMF-PBS at pH 8.0 for LacZ staining buffer to decreasebackground β-galactosidase activity.

LacZ wash buffer

2 mM MgCl20.01% (w/v) deoxycholate0.02% (v/v) NP-40CMF-PBSStore up to 1 year at room temperature

NBT/BCIP stain solution

100 mM Tris·Cl, pH 9.5100 mM NaCl50 mM MgCl20.01% (w/v) sodium deoxycholate0.02% (v/v) NP-40337 μg/ml nitroblue tetrazolium salt (NBT; Sigma cat. no. N6876)175 μg/ml 5-bromo-4-chloro-3-indolyl phosphate, disodium salt (BCIP; Sigma cat.

no. B1026)Prepare fresh

PTM buffer

0.1% (v/v) Tween-202 mM MgCl2CMF-PBSStore up to 1 year at room temperature

Tamoxifen or 4-hydroxytamoxifen

Resuspend tamoxifen (Sigma cat. no. T5648) or 4-hydroxytamoxifen (70% Z iso-mer, 30% E isomer 4-OHT; Sigma cat. no. H6278) at a concentration of 10 to 20mg/ml in peanut oil (Indra et al., 1999; Kuhbandner et al., 2000). Add 500 μl of100% ethanol to 100 mg of tamoxifen followed by 9.5 ml of peanut oil. Dispenseinto aliquots and store for up to 4 weeks at −20◦C.

Corn oil can also be used to resuspend tamoxifen or 4-OHT.

Tamoxifen is fairly soluble while 4-OHT requires sonication or heating. Both will precipitateat cold temperatures; therefore, it may be necessary to heat or resonicate prior to use.


5A.2.11


COMMENTARY

Background InformationThe identification of tissue progenitor/stem

cells requires demonstrating both their self-renewal potential and their capacity to con-tribute to multiple cell lineages within a tis-sue. While current studies use genetic modelsto experimentally demonstrate stem cell func-tion, the scientific literature is full of alternateand historical approaches to map the fate ofa cell (reviewed in Stern and Fraser, 2001).Early studies focused on deciphering cell lin-eage using a variety of techniques to followcells and their descendants. For example, en-dogenous expression of alkaline phosphataseby germ cells allowed for tracing of these cellsthroughout development (Chiquoine, 1954). Inaddition, direct visualization by the use of pig-mentation differences among cells has allowedfor the construction of lineage trees in develop-ing organisms, including the complete cell fatemap of the nematode, Caenorhabditis elegans(Sulston et al., 1983; Thomas et al., 1996). Thistechnique is limited however by an inability toidentify and trace single cells over time andthe problems inherent to increasingly opaqueembryos.

To combat these problems, a variety of ap-proaches have been taken to mark cells. Theuse of vital dyes to trace living cells was at-tempted but was found to be ineffective due totheir water solubility, which resulted in trans-fer of dye to unrelated cells. Eventually, multi-colored carbocyanine dyes were generated,which are lipid soluble/water insoluble andlocalize within the cell membrane (Axelrod,1979; Serbedzija et al., 1989; Yablonka-Reuveni, 1989; Eagleson and Harris, 1990).While cells readily take up these dyes, itproved difficult to mark single cells, thus thistechnique has been used to track the fate ofcell populations. Additional strategies haveincluded the use of radiolabeled compoundsto mark cells prior to introduction into em-bryos as well as the generation of interspecieschimeras (e.g., chick/quail), which relies uponspecies-specific differences in cell pigmenta-tion and size to distinguish between donor andhost cells (Le Douarin, 1973; Dupin et al.,1998).

Marking and tracing of single cells in bothvertebrates and invertebrates have been ac-complished by single-cell injection with inerttracers such as the enzyme horseradish per-oxidase, or fluorescently-labeled compoundssuch as dextran or lysine (Weisblat et al., 1978;Lawson et al., 1986; Gimlich and Braun, 1985;

Peralta and Denaro, 2003). While technicallychallenging, very elegant cell fate mapping ispossible with such approaches. The biggestdisadvantage is that the tracer becomes dilutedin dividing cells.

To determine the fate of cells that mightmigrate during development, colloidal gold-labeled monoclonal antibodies were devel-oped and used to track the descendant of cellsthat express a common surface antigen regard-less of their position in the embryo (Stern andCanning, 1990). Antigen-expressing cells in-ternalize the antibody/gold complex and pass iton to their descendants. However, the markercan only be detected for a few divisions. Toovercome this problem, several groups de-veloped retroviral vectors that would labelcells through the introduction of marker genes,e.g., alkaline phosphatase or β-galactosidase(Cepko et al., 1984; Sanes et al., 1986). Dilutedviral stock solutions, as well as replication-deficient strains, were subsequently employedto increase the probability that marked cellswould be clonally derived. This approach hasbeen used to trace cell lineages in the ner-vous system (Cepko et al., 1984; Price et al.,1987). Given that viral targeting is not cell-type-specific, these lineage-mapping studiesmust be performed retrospectively. In addi-tion, it is impossible to rule out that adja-cent cells were not also initially labeled viaan independent infection event. To addressthis, complex retroviral libraries were gener-ated (Golden et al., 1995) with the belief thatthe infection was a random event and thus itwould be highly unlikely that adjacent cellswould be infected by the same retrovirus. Dis-tinction between the various retroviruses couldbe confirmed by PCR. Although this approachincreased the rigor, the analysis remained ret-rospective and required that each cell type beanalyzed by PCR to determine their related-ness to neighboring labeled cells. Therefore,this method required the ability to isolate thecell types of interest. Alternatively, sponta-neous DNA recombination events (+/− mu-tagens) have been used to retrospectively tracecells via activation of marker expression intransgenic mice (Bonnerot and Nicolas, 1993;Bjerknes and Cheng, 1999).

Once labeled, cells are transplanted intoadult animals to demonstrate cell fate map-ping. The contribution of a putative stem cellto various cell lineages is assessed throughanalysis of marker expression or, alternatively,identification of the Y chromosome when


5A.2.12


male donor cells were injected into femalerecipients. This approach has been used tostudy hematopoietic stem engraftment andmulti-lineage contribution.

While these approaches have yielded im-portant insight into cell fate, increasingly,the use of site-specific recombinase systemssuch as Cre-lox has become the gold stan-dard for cell lineage studies. This technol-ogy allows for the control over the temporaland spatial marking of selective cell popula-tions through the use of gene-specific promot-ers to regulate recombinase expression (for re-view see Sauer, 1998; Nagy, 2000; Branda andDymecki, 2004). To regulate the onset of Creexpression independent from endogenous reg-ulatory elements, inducible Cre recombinaseshave been generated that allow for refinedlabeling of specific single cells in responseto ligand administration (Furth et al., 1994;Feil et al., 1996; Kellendonk et al., 1996;Rivera et al., 1996; Brocard et al., 1998;Danielian et al., 1998; Utomo et al., 1999;Schonig et al., 2002). Specifically, in thetamoxifen-inducible Cre-lox system (used inthis unit), Cre recombinase (CreER) is fused toa mutated ligand-binding domain of the estro-gen receptor, which specifically binds tamox-ifen and not the endogenous estrogen. In theabsence of ligand, CreER is retained withinthe cytoplasm. Upon tamoxifen administra-tion, the CreER protein translocates to the nu-cleus where it excises the loxP-targeted site.Furthermore, the commercial availability ofa variety of Cre-reporter mouse lines, whichupon recombination express colorimetric, en-zymatic, or fluorescent proteins, allows forgreater diversity in the use of lineage-tracingto define stem cells.


While the lineage-tracing approach candemonstrate “stemness” of a particular cellpopulation, it does require some a prioriknowledge. First, one must determine whethera specific gene selectively marks the cell of in-terest. Second, determine whether a Cre mouseline already exists in which the promoter ofthe gene of interest regulates Cre recombi-nase expression. Preferably this line shouldbe inducible, allowing for controlled temporalmarking of the cell. Third, determine the Crereporter mouse line to be used. The choice ofwhich Cre reporter line to use is dependentupon several things including whether the re-porter is expressed in the cell and tissue ofinterest as well as the type of analysis that

will be performed. Although most reportersare considered to be ubiquitously expressed,it has been found that is not always the case;therefore, when possible, confirming the ex-pression of the reporter in the cell of interest isoptimal. In addition, while this unit focuses onβ-galactosidase and alkaline phosphatase re-porters, fluorescent Cre reporter mouse lineshave been used to trace lineage contribu-tion. Generally, colorimetric and enzymaticreporters are convenient to use for confirminglineage contribution by a stem cell; however,fluorescent reporters have the added advantageof allowing for single-cell isolation and analy-sis via flow cytometry. The following Websitescontain additional information on the variousCre and Cre reporter mouse lines availablefor lineage tracing: The Jackson Laboratory:http://www.jax.org or Dr. Andras Nagy’s labo-ratory Website: http://www.mshri.on.ca/nagy.

Although stem cells have been identified intissues that are highly regenerative such as theskin, intestine, and blood, adult stem cells inother tissues may require some type of regen-erative stimulus such as injury to awaken them.Therefore, prior knowledge of the mecha-nism(s) involved in stem cell activation withinthe tissue of interest will be advantageous be-fore performing lineage tracing studies.

Administration of the inducing agent variesdepending upon the model system used. In thecase of the tamoxifen-inducible Cre mousemodels, tamoxifen can be administration in-traperitoneally (i.p.), subcutaneously (s.c.),and orally (p.o.) as well as by pellet implants.The amount and length of administration ishighly dependent upon the strength and ex-pression pattern of the promoter regulatingthe Cre recombinase and will have to be de-termined empirically by each researcher. Ta-moxifen is generally given at a dose of 1 to2 mg/day i.p. for up to 5 days. Analysis ofreporter activity is determined at the end ofthe pulse period (1 to 3 days after the lastinjection) at which time cell-specific labelingshould be detected. It is important to note thatthis regimen should be used as a starting pointand modifications in either length of deliveryand/or dosage may be necessary dependingupon the tissue of interest. If weak or no la-beling is detected, then increasing the doseof tamoxifen may be warranted. Alternatively,4-hydroxytamoxifen (4-OHT), a metabolite oftamoxifen, which exhibits a more potent activ-ity, may be used instead to increase labeling.However, tamoxifen is often preferred over 4-OHT because it is more soluble in solutionand less costly. It is worth noting that high


5A.2.13


levels of tamoxifen or 4-OHT administered i.p.can have deleterious affects on mice. Varyingthe timing or mode of administration can cir-cumvent this problem, e.g., administering i.p.injections every other day instead of daily orinjecting s.c. or p.o. instead of i.p.

Once labeled, the time period in whichto analyze the cell’s contribution to variousprogeny (chase) must be determined. The ex-act time is dependent upon the tissue of interestas well as whether the stem cell population re-quires a regenerative stimulus to induce newlineage development. For a general reference,the chase can range from weeks to months. Asindicated in the Basic Protocol, contribution ofthe marked stem cell to differentiated progenycan be confirmed by co-localization of thereporter with differentiation-specific markersby immunohistochemistry or immunofluores-cence (depending upon the reporter). Thisapproach however relies upon the availabil-ity of specific antibodies. If none are avail-able, alternative approaches may be used suchas differentiation-specific gene marker anal-ysis of isolated reporter-positive cells usingflow cytometry. As indicated earlier, multi-ple fluorescent reporter mouse lines are avail-able as well as commercially available flowcytometric kits for β-galactosidase activity(Invitrogen).

High background LacZ staining may be dueto endogenous enzymatic activity, which hasbeen reported in a variety of tissues. Endoge-nous β-galactosidase is normally active at lowpH (∼4) while bacterial β-galactosidase is ac-tive at a more neutral pH. Therefore, increas-ing the pH of CMF-PBS in the LacZ wash andstaining buffers should decrease backgroundLacZ staining. CMF-PBS at a pH between 7.4and 8.0 is usually used. Extreme alkaline con-ditions (pH 8.5 to 9.0), however, can inhibitbacterial β-galactosidase activity. In addition,the incubation temperature and time can affectbackground staining. Minimizing the reactiontime to 2 hr and reducing the temperaturefrom 37◦C to room temperature dramaticallyreduces background staining. It is importantto note that the optimal staining conditionsfor each tissue needs to be determined empir-ically using both positive and negative controltissues.

There are several possible explanations fora lack of or low reporter activity. As a gen-eral rule, tissues from positive control miceare used as a control to validate that the as-say is functioning correctly. Absence of re-porter activity may be due to either the re-

porter or the Cre recombinase not being ex-pressed in the cell type of interest. To con-firm the cellular specificity of Cre recombinaseexpression, in situ hybridization or immuno-histochemical analysis may be performed. Asindicated above, although most reporters arebelieved to be globally expressed upon recom-bination, variegated expression both across tis-sues and within select tissues has been found.Therefore, confirmation of reporter expres-sion in the cell and tissue of interest is es-sential before performing lineage tracing ex-periments. This can be done by assessing re-porter activity in a positive control mouse suchas Rosa26 (Zambrowicz et al., 1997), whichexpresses β-galactosidase from the same ge-nomic locus as the Cre reporter mouse line,suggesting comparable control elements. Al-ternatively, decreased penetration may affectthe staining efficiency in whole-mount analy-sis. This can be addressed by either analyzingsmaller tissue pieces, addition of detergents,or alternatively performing sectional analysis.Finally, low levels of reporter activity may bedue to low efficiency of recombination. Thestrength of the promoter and the number ofcells expressing the gene of interest can af-fect the efficiency of labeling. Increasing thedosage and/or altering the administration regi-men may yield higher recombination efficien-cies. Alternatively, it may be necessary to use adifferent inducible system such as the doxycy-cline system (Schonig et al., 2002) to increasethe relative efficiency.

Anticipated ResultsIn response to tamoxifen administration, re-

porter activity should be detected in a smallpopulation of cells preferably single cells atthe pulse time point. If multiple cells are la-beled, then decreasing the tamoxifen dosageor length of administration should yield sin-gle cells. Depending upon the tissue, whole-mount analysis of single cells may be difficult;therefore, confirmation of single cells may re-quire sectional analysis. Following this, if acell functions as a stem cell, then contributionof label to other cell types including differenti-ated cells within a defined time period shouldbe observed.

Time ConsiderationsThe time period required to detect lineage

contribution depends upon a number of factorsincluding the regenerative nature of the tissue.For example, the intestine is highly regenera-tive and turns over every 4 to 5 days; therefore,


5A.2.14


it would require a relatively short chase periodto detect stem cells. Alternatively, a more qui-escent stem cell population may take muchlonger to be activated and would therefore re-quire an extended time period before lineagecontribution would be detected. In addition, itis important to note that the requirement of in-ducing regeneration by tissue injury (therebyactivating a stem cell population) can furtherextend the chase time period. Thus, a generaltime-frame for conducting these experimentsrelies upon the tissue of interest and will haveto be determined by each researcher. It maytake a chase weeks to months to detect a stemcell contribution.

Literature CitedAxelrod, D. 1979. Carbocyanine dye orientation

in red cell membrane studied by microscopicfluorescence polarization. Biophys. J. 26:557-573.

Bjerknes, M. and Cheng, H. 1999. Clonal anal-ysis of mouse intestinal epithelial progenitors.Gastroenterology 116:7-14.

Bonnerot, C. and Nicolas, J.F. 1993. Clonal anal-ysis in the intact mouse embryo by intragenichomologous recombination. C.R. Acad. Sci. III316:1207-1217.

Branda, C.S. and Dymecki, S.M. 2004. Talkingabout a revolution: The impact of site-specificrecombinase on genetic analyses in mice. Dev.Cell 6:7-28.

Brocard, J., Feil, R., Chambon, P., and Metzger,D. 1998. A chimeric Cre recombinase inducibleby synthetic, but not natural ligands of gluco-corticoid receptor. Nucleic Acid Res. 26:4086-4090.

Cepko, C.L., Roberts, B.E., and Mulligan, R.C.1984. Construction and applications of a highlytransmissible murine retrovirus shuttle vector.Cell 37:1053-1062.

Chiquoine, A.D. 1954. The identification, origin,and migration of the primordial germ cells inthe mouse embryo. Anat. Rec. 118:135-146.

Danielian, P.S., Muccino, D., Rowitch, D.H.,Michael, S.K., and McMahon, A.P. 1998. Mod-ification of gene activity in mouse embryos inutero by a tamoxifen-inducible form of Cre re-combinase. Curr. Biol. 8:1323-1326.

Dupin, E., Ziller, C., and Le Douarin, N.M. 1998.The avian embryo as a model in developmentalstudies: Chimeras and in vitro clonal analysis.Curr. Top. Dev. Biol. 36:1-35.

Eagleson, G.W. and Harris, W.A. 1990. Mapping ofthe presumptive brain regions in the neural plateof Xenopus laevis. J. Neurobiol. 21:427-440.

Feil, R., Brocard, J., Mascrez, B., LeMeur,M., Metzger, D., and Chambon, P. 1996.Ligand-activated site-specific recombination inmice. Proc. Natl. Acad. Sci. U.S.A. 93:10887-10890.

Furth, P.A., St. Onge, L., Boger, H., Gruss,P., Gossen, M., Kistner, A., Bujard, H., andHennighausen, L. 1994. Temporal control ofgene expression in transgenic mice by atetracycline-responsive promoter. Proc. Natl.Acad. Sci. U.S.A. 91:9302-9306.

Gimlich, R.L. and Braun, J. 1985. Improved fluo-rescent compounds for tracing cell lineage. Dev.Biol. 109:509-514.

Golden, J.A., Fields-Berry, S.C., and Cepko, C.L.1995. Construction and characterization of ahighly complex retroviral library for lineageanalysis. Proc. Natl. Acad. Sci. U.S.A. 92:5704-5708.

Indra, A.K., Warot, X., Brocard, J., Bornert, J.M.,Xiao, J.H., Chambon, P., and Metzger, D. 1999.Temporally controlled site-specific mutagenesisin the basal layer of the epidermis: Comparisonof the recombinase activity of the tamoxifen-inducible Cre-EFT and Cre-ERT2 recombinases.Nucleic Acids Res. 27:4324-4327.

Kellendonk, C., Tronche, F., Monaghan, A.-P.,Angrand, P.-O., Stewart, F., and Schutz, G. 1996.Regulation of Cre recombinase activity by thesynthetic steroid RU486. Nucleic Acids Res.24:1404-1411.

Kuhbandner, S., Brummer, S., Metzger, D.,Chambon, P., Hofmann, F., and Feil, R. 2000.Temporally controlled somatic mutagenesis insmooth muscle. Genesis 28:15-22.

Lawson, K.A., Meneses, J.J., and Pedersen, R.A.1986. Cell fate and cell lineage in the endodermof the presomite mouse embryo, studied with anintracellular tracer. Dev. Biol. 115:325-339.

Le Douarin, N. 1973. A biological cell labelingtechnique and its use in experimental embryol-ogy. Dev. Biol. 30:217-222.

Lobe, C.G., Koop, K.E., Kreppner, W., Lomeli, H.,Gertsenstein, M., and Nagy, A. 1999. Z/AP, adouble reporter for Cre-mediated recombina-tion. Dev. Biol. 208:281-292.

Nagy, A. 2000. Cre recombinase: The universalreagent for genome tailoring. Genesis 26:99-109.

Peralta, M. and Denaro, F.J. 2003. The horseradishperoxidase technique for cell lineage studies.Cell Mol. Biol. 49:1371-1375.

Price, J., Turner, D., and Cepko, C. 1987. Lin-eage analysis in the vertebrate nervous systemby retrovirus-mediated gene transfer. Proc. Natl.Acad. Sci. U.S.A. 84:156-160.

Rivera, V.M., Clackson, T., Natesan, S., Pollock, R.,Amara, J.F., Keenan, T., Magari, S.R., Phillips,T., Courage, N.L., Cerasoli, F., Hot, D.A., andGilman, M. 1996. A humanized system for phar-macological control of gene-expression. Nat.Med. 2:1028-1032.

Rossant, J. and McMahon, A. 1999. “Cre”-atingmouse mutants: A meeting review on con-ditional mouse genetics. Genes Dev. 13:142-145.

Sanes, J.R., Rubenstein, J.L.R., and Nicolas,J-F. 1986. Use of a recombinant retrovirus to


5A.2.15


study post-implantation cell lineage in mouseembryos. EMBO J. 5:3133-3142.

Sauer, B. 1998. Inducible gene targeting in miceusing the cre/lox system. Methods 14:381-392.

Schonig, K., Schwenk, F., Rajewsky, K., andBujard, H. 2002. Stringent doxycycline de-pendent control of CRE recombinase in vivo.Nucleic Acids Res. 30:e134.

Serbedzija, G.N., Bronner-Fraser, M., and Fraser,S.E. 1989. A vital dye analysis of the timingand pathways of avian trunk neural crest cellmigration. Development 106:809-816.

Soriano, P. 1999. Generalized lacZ expression withthe ROSA26 Cre reporter strain. Nat. Genet.21:70-71.

Stern, C.D. and Canning, D.R. 1990. Origin of cellsgiving rise to mesoderm and endoderm in chickembryo. Nature 343:273-275.

Stern, C.D. and Fraser, S.E. 2001. Tracing the lin-eage of tracing cell lineages. Nat. Cell Biol.3:E216-E218.

Sulston, J.E., Schierenberg, E., White, J.G., andThomson, J.N. 1983. The embryonic cell lin-eage of the nematode Caenorhabditis elegans.Dev. Biol. 100:64-119.

Thomas, C., DeVries, P., Hardin, J., and White,J. 1996. Four-dimensional imaging: Computervisualization of 3D movements in living speci-mens. Science 273:603-607

Utomo, A.R., Nikitin, A.Y., and Lee, W.H. 1999.Temporal, spatial, and cell type-specific controlof Cre-mediated DNA recombination in trans-genic mice. Nat. Biotechnol. 17:1091-1096.

Weisblat, D.A., Sawyer, R.T., and Stent, G.S. 1978.Cell lineage analysis by intracellular injectionof a tracer enzyme. Science 202:1295-1298.

Yablonka-Reuveni, Z. 1989. The emergence ofthe endothelial cell lineage in the chick em-bryo can be detected by uptake of acetylatedlow density lipoprotein and the presence of avon Willebrand-like factor. Dev. Biol. 132:230-240.

Zambrowicz, B.P., Imamoto, A., Fiering, S.,Herzenberg, L.A., Ker, W.G., and Soriano, P.1997. Disruption of overlapping transcripts inthe ROSA βgeo 26 gene trap strain leads towidespread expression of β-galactosidase inmouse embryos and hematopoietic cells. Proc.Natl. Acad. Sci. U.S.A. 94:3789-3794.

UNIT 5A.3Magnetic Resonance Imaging of HumanEmbryonic Stem Cells

Jaehoon Chung,1 Mayumi Yamada,1 and Phillip C. Yang1

1Stanford University School of Medicine, Stanford, California

ABSTRACT

Magnetic resonance imaging (MRI) may emerge as an ideal non-invasive imaging modal-ity to monitor stem cell therapy in the failing heart. This imaging modality generatesany arbitrary tomographic view at high spatial and temporal resolution with exquisiteintrinsic tissue contrast. This capability enables robust evaluation of both the cardiacanatomy and function. Traditionally, superparamagnetic iron oxide nanoparticle (SPIO)has been widely used for cellular MRI due to SPIO’s ability to enhance sensitivityof MRI by inducing remarkable hypointense, negative signal, “blooming effect” onT2*-weighted MRI acquisition. Recently, manganese chloride (MnCl2) has been re-ported by our laboratory for its ability as a contrast agent to track biological activityof viable cells. Hyperintense, positive signals can be achieved from the Mn2+-labeledstem cells on T1-weighted MRI acquisition. Cytotoxicity is a potential drawback ofMn2+ labeling of the cells. However, in our laboratory the labeling method has beenoptimized to minimize cytotoxic effects. This article describes two different magneticlabeling methods of human embryonic stem cells (hESC) using SPIO and MnCl2. Curr.Protoc. Stem Cell Biol. 10:5A.3.1-5A.3.9. C© 2009 by John Wiley & Sons, Inc.

Keywords: human embryonic stem cell (hESC) � magnetic resonance imaging (MRI) �

superparamagnetic iron oxide (SPIO) � manganese

INTRODUCTION

Magnetic resonance imaging (MRI) may emerge as an ideal non-invasive imaging modal-ity to monitor stem cell therapy in the failing heart. This imaging modality generates anyarbitrary tomographic view at high spatial and temporal resolution with exquisite intrin-sic tissue contrast. This capability enables robust evaluation of both the cardiac anatomyand function. Traditionally, superparamagnetic iron oxide nanoparticle (SPIO) has beenwidely used for cellular MRI due to SPIO’s ability to enhance sensitivity of MRI byinducing remarkable hypointense, negative signal, “blooming effect” on T2*-weightedMRI acquisition (Fig. 5A.3.1). Recently, manganese chloride (MnCl2) has been reportedby our laboratory for its ability as a contrast agent to track biological activity of vi-able cells. Hyperintense, positive signals could be achieved from the Mn2+-labeled stemcells on T1-weighted MRI acquisition (Fig. 5A.3.2). Cytotoxicity was a potential draw-back of Mn2+ labeling of the cells but in our laboratory, the labeling method has beenoptimized to minimize cytotoxic effects. This article describes two different magneticlabeling methods of human embryonic stem cells (hESC) using SPIO (Basic Protocol)and MnCl2 (Alternate Protocol).

NOTE: All procedures must be performed in a sterile cell culture hood. All solutions andequipment in contact with live cells must be sterile, and aseptic technique must be usedaccordingly.

NOTE: All culture incubations must be performed in a humidified 37◦C, 5% CO2

incubator unless otherwise specified.

Current Protocols in Stem Cell Biology 5A.3.1-5A.3.9Published online August 2009 in Wiley Interscience (www.interscience.wiley.com).DOI: 10.1002/9780470151808.sc05a03s10Copyright C© 2009 John Wiley & Sons, Inc.


5A.3.1

Supplement 10

MagneticResonance

Imaging of hESCs

5A.3.2


*a

b

de

c

Figure 5A.3.1 Magnetic resonance imaging of SPIO-labeled human embryonic stem cellsat a coronal view. The different quantities of SPIO-labeled hESC (a) 2 million, (b) 1 million,(c) 0.5 million, (d) 0.1 million, (e) 0.05 million, and control (non-labeled designated with an *).

i ii iii iv v vi vii

Figure 5A.3.2 3 × 106 MnCl2-labeled hESC at an axial view using the following concentrations:(i) control [0.9% (w/v) sodium chloride solution only], (ii) 0.01 mM, (iii) 0.05 mM, (iv) 0.10 mM,(v) 0.50 mM, (vi) 1.00 mM, and (vii) 3.00 mM. Dose-appropriate increase in T1-weighted positivecontrast is seen up to 1.00 mM. hESC are indicated by a black arrow.

BASICPROTOCOL

DIRECT MAGNETIC LABELING OF HUMAN EMBRYONIC STEM CELLS(hESC) USING SPIO

Direct labeling of hESC with SPIO is a convenient and robust method. This techniquerequires the addition of transfection agents such as protamine sulfate, poly-L-lysine(PLL) or electroporation to increase efficiency of labeling (Frank et al., 2002; Suzukiet al., 2007). Here we introduce a protocol using protamine sulfate (PS). The dextran-coated SPIO particles carry a negative charge. By coating SPIO with positively chargedPS, neutral or slightly positive electrical charge can be formed on the surface of theSPIO-PS complex. Consequently, electrostatic interaction between the cell membraneand SPIO-PS complex enhances cellular uptake of SPIO-PS complex via mechanismsincluding endocytosis, membrane disruption, or passive diffusion.

Materials

H9 hESC (WiCell)hESC medium (see recipe)SPIO (Feridex, Bayer Healthcare Pharmaceuticals)


5A.3.3


Protamine sulfate (PS, American Pharmaceutical Partners)Phosphate-buffered saline, calcium- and magnesium-free (CMF-PBS; see recipe)Heparin sodium (Fujisawa)Phantom (see recipe)

Matrigel-coated 100-mm tissue culture dishes (BD Biosciences; coat dishesaccording to manufacturer’s instructions)

0.2-ml PCR tubesSigna 3T Excite HD scanner (GE Health System) and an array knee coil with GRE

or SPGR sequence

1. Two days prior to the experiment, seed hESC onto Matrigel-coated 100-mm tissueculture dishes in 10 ml hESC medium.

This procedure will allow removal of MEF and recovery of hESC culture.

2. One day prior to the experiment, dilute SPIO with hESC culture medium at a finalconcentration of 50 μg/ml.

3. Add clinical grade PS to the SPIO-containing medium to a final concentration of6 μg/ml. Shake the mixture vigorously for 5 to 10 min.

This procedure will enhance coating of SPIO with PS, generating SPIO-PS complex.

4. Incubate hESC with SPIO-containing medium overnight (8 to 12 hr) in the incubator.

This incubation time varies depending on the cell types. We could achieve satisfactorylabeling of hESC, human mesenchymal stem cells (hMSC), and mouse embryonic stemcells (mESC) after an 8-hr incubation.

5. Wash hESC two times, each time with 15 ml CMF-PBS.

6. Dilute heparin sodium with CMF-PBS to a final concentration of 10 U/ml. WashhESC once with 15 ml heparin sodium–containing CMF-PBS.

This procedure will allow elimination of SPIO-PS complex on the extracellular surface.

7. Suspend 2 × 106 hESC in 200 μl of CMF-PBS and transfer cell pellet to a 0.2-mlPCR tube. For the negative control, put the same number of non-labeled hESC inone PCR tube.

The SPIO-labeled cell pellet will look dark-brown in color (Fig. 5A.3.3).

8. Place the PCR tubes onto the phantom gently to make sure no air is trapped in betweenthe PCR tubes and the phantom to minimize any artifact from the air (Fig. 5A.3.3).

The phantom will stabilize the PCR tubes and will prevent artifacts from the surroundingair. Air can induce hypointense signal on T2-weighted sequences.

If a crack is noted on the phantom, it can be filled up with water to prevent artifacts.

9. Scan the hESC using T2-weighted sequences.

We scan cells using Signa 3T Excite HD scanner and an array knee coil with GRE orSPGR sequence and the following parameters: TR (repetition time) = 100 to 200 msec,TE (echo time) = 20 to 30 msec, FOV (field of view) = 12 × 12 cm, and matrix = 192 ×192, NEX 1.

MRI parameters should be optimized for different cell types, SPIO concentration, andmagnetic field strength.

For in vivo experiments, follow the same labeling method from steps 1 to 6 above. Then,transplant the optimal number of cells in the organ of interest. In our laboratory, 0.5 ×106 SPIO-labeled hESC are injected into the mouse heart for the myocardial infarctionmodel.

MagneticResonance

Imaging of hESCs

5A.3.4


Figure 5A.3.3 Phantom for cellular imaging. The phantom is solidified within a plastic container.Any size plastic container can be used where PCR tubes can be placed stably. PCR tubescontaining SPIO-labeled hESC cell pellets were placed onto the phantom. SPIO-labeled cellshave a brown color (red arrows) and negative control, non-labeled cells look whitish (black arrow).

ALTERNATEPROTOCOL

DIRECT LABELING OF HUMAN EMBRYONIC STEM CELLS USINGMANGANESE CHLORIDE

SPIO has been employed to track and localize the transplanted stem cells with highsensitivity. However, this method does not monitor the viability of transplanted stemcells (Kraitchman et al., 2003). On the other hand, MnCl2 has been known to enterviable cells via voltage-gated calcium (Ca2+) channels. When the cells are biologicallyactive, MnCl2 accumulates intracellularly to generate a T1-shortening effect to inducea hyperintense, bright signal on T1-weighted MRI acquisition (Aoki et al., 2006). Thefollowing protocol is for direct labeling of hESC using manganese and a T1-weightedMRI sequence.

Materials

H9 hESC (WiCell)hESC medium (see recipe)TrypLE express (Invitrogen)MnCl2 (Sigma)0.9% (w/v) sodium chloride (9 mg sodium chloride/ml of distilled water)Phantom (see recipe)

Matrigel-coated 100-mm tissue culture dishes (BD Biosciences; coat dishesaccording to manufacturer’s instructions)

Hemacytometer15-ml conical tubes0.2-ml PCR tubesSigna 3T Excite HD scanner (GE Health System)

1. Two days prior to the experiment, seed hESC onto Matrigel-coated 100-mm tissueculture dishes in 10 ml hESC medium.


5A.3.5


2. On the day of experiment, remove the culture medium from the dish. Add 1.5 mlof TrypLE express and incubate the cells 5 min. Add 10 ml of culture mediumand dissociate the cells by pipetting up and down several times. Wash the cells bycentrifuging 5 min at 100 × g, room temperature. Resuspend the cells in culturemedium and count cells using a hemacytometer.

3. Aliquot 3 × 106 hESC into one 15-ml conical tube.

4. Dissolve fresh MnCl2 with 0.9% sodium chloride solution to make a 0.1 mMMnCl2 solution.

IMPORTANT NOTE: Always make a fresh MnCl2 solution. MnCl2 is easily degraded insolution.

5. Incubate the cells with 5 ml 0.1 mM MnCl2 for 30 min. Incubate negative controlcells in 5 ml 0.9% sodium chloride alone.

6. Centrifuge the cells 5 min at 100 × g, room temperature. Aspirate the supernatantand wash the labeled cells twice, each time with 15 ml CMF-PBS.

7. Suspend each pellet in 200 μl CMF-PBS and transfer into 0.2-ml PCR tubes.

Manganese-labeled pellets are usually white.

For in vivo experiments, transplant these labeled cells in an organ of interest.

8. For an in vitro experiment, place the PCR tubes onto the phantom as described above(step 8 from the Basic Protocol).

9. Perform MRI scanning with T1-weighted spin echo sequence with the followingparameters: TR; Repetition time = 800 msec. TE; Echo time = minimum, FOV;field of view = 12 × 12 cm; matrix = 192 × 192, NEX 1.

MRI parameters should be optimized for the contrast effect depending on the cell typeand magnetic field.

Comparable magnetic labeling efficiency has been achieved with different hESC mediasuch as DMEM/F-12 (Invitrogen) or mTeSR (STEMCELL Technologies).


APPENDIX.

Human embryonic stem cell medium (500 ml)

400 ml Knockout DMEM (Invitrogen)100 ml Knockout serum replacement (Invitrogen)5 ml of 10 mM non-essential amino acids (Invitrogen)5 ml of 200 mM L-glutamine (Invitrogen)3.5 μl of 14.3 M 2-mercaptoethanol (Sigma)10 μg/ml recombinant human bFGF (R&D system)Store up to 1 week at 4◦C

Phantom

0.7% (w/v) agar (Sigma)1% (w/v) copper sulfate (Sigma)Make solution with distilled water and microwave at medium high for 5 minSolidify in any plastic container before usage (Fig. 5A.3.3)Store up to 6 months at room temperature

MagneticResonance

Imaging of hESCs

5A.3.6


Phosphate-buffered saline, calcium- and magnesium-free (CMF-PBS)

0.144 g KH2PO4

9.0 g NaCl0.795 g Na2HPO4·7H2OH2O to 1 literAdjust to pH 7.4, if necessaryStore indefinitely at room temperature

COMMENTARY

Background InformationMagnetic resonance imaging (MRI) excites

hydrogen protons, using a computerized pro-gram called the pulse sequence, to acquireand process the signal released from the ex-cited protons. A pulse sequence consists ofradiofrequency and gradient pulses which arecarefully controlled in duration and timing togenerate images of interest. In MRI, the criti-cal properties are proton density and two ba-sic relaxation times described as spin-latticeand spin-spin relaxation times denoted as T1and T2, respectively. Relaxation time refersto the time required for the excited tissue toreturn to the equilibrium state after a radiofre-quency pulse is applied. T1 and T2 dependon the proton density of each tissue. Fluid haslonger T1 while fat has a shorter T1. T2 is usu-ally shorter than T1 for a given tissue. Fluidhas longer T2 while fat has a shorter T2. T2*refers to the effect of additional field inho-mogeneity, which contributes to the dephas-ing signal. T2* is usually shorter than T2. Ingeneral, tissues with a long T2 give high signalintensities in T2-weighted images while a longT1 generates a weak signal. Exquisite intrin-sic contrast achieved in MRI due to the differ-ences in these relaxivity properties generatesdetailed images of the anatomy and morphol-ogy. Deeply located tissues in small animalscan be visualized with high sensitivity by anMRI system. The location and number of thereceive coil, the configuration of the coil ele-ment, and the magnetic field strength all playimportant roles. However, the ability of MRIto acquire images from any arbitrary tomo-graphic plane enables detection of the cellsin small animals with high sensitivity. In ourlaboratory, we image SPIO-labeled hESC inan 8-week-old SCID mouse using a 3.0 Teslaclinical scanner (Fig. 5A.3.4).

Superparamagnetic iron oxide nanoparti-cles (size ∼100 nm) can induce a strong mag-netic field inhomogeneity (dephasing signal)in the hydrogen atoms of water moleculesduring magnetic resonance imaging. WhenSPIO are taken up by the cells, the nanopar-

ticles create significant dephasing of pro-tons, which consequently reduce T2* relax-ation times. These properties enable robustvisualization of SPIO-labeled cells throughstrong hypointense, negative signals describedas the blooming effect (Bulte et al., 2001).Our data show significant contrast by in vitroMRI 14 days after labeling hESC with SPIO.In vivo MRI showed SPIO-induced contrast20 days following transplantation of SPIO-labeled hESC in the mouse heart. Despitehigh sensitivity in the detection of the cellsin the range of 10-9 mole/liter, this bloom-ing effect may produce a large signal void atthe region of interest to confound the MRIsignal from the surrounding artifact and cor-rupt the anatomical details or the physiolog-ical function of the target tissue. Moreover,in vivo experiments have demonstrated thatSPIO-labeled cells provide high sensitivity todetect the anatomical location of the cells.However, SPIO labeling does not provide anybiologic information such as the viability oftransplanted cells because of the non-specificuptake by the macrophages of the residualSPIO particles in the surrounding tissue fromdead SPIO-labeled cells (Chen et al., 2008; Liet al., 2008). To address these limitations, ourlaboratory developed the Mn2+ labeling proto-col for stem cells. Mn2+ is transported into thecellular cytoplasm of biologically active cellsthrough a voltage-gated Ca2+ channel. Thesechannels have high affinity for Ca2+ and itsanalog, such as Mn2+, to accumulate withinthe cytoplasm by binding to specific sites onnucleic acid and intracellular proteins. Intra-cellular Mn2+ induces a T1-shortening effect,which allows clear delineation of the cells ofinterest with hyperintense, positive signal (Linand Koretsky, 1997). Therefore, this contrastmechanism enables correlation between cellu-lar viability and a T1-weighted positive signal.Our data shows Mn2+-induced contrast effectis noted for 4 to 5 days after in vivo labeling(Fig. 5A.3.5). After these cells die, Mn2+ dif-fuses passively out of these dead cells. Con-sequently, decreased concentration of Mn2+


5A.3.7


Figure 5A.3.4 In vivo MRI of hESC transplanted into the murine myocardium. Following directlabeling of hESC with SPIO and protamine sulfate, 0.5 × 106 hESC were transplanted into the leftventricle as indicated by negative dephasing signal (black arrow). This mouse was scanned usinga 3T clinical MRI scanner (GE Healthcare System).

results in reduced T1-shortening effect and thecontrast effect is lost.

Currently, two distinct classes of iron ox-ide particles are available based on the hydro-dynamic particle size. The mean diameter ofSPIO is ∼100 nm. Ultrasmall superparamag-netic iron oxide particles (USPIO) are ∼40 to50 nm. Both nanoparticles have similar chem-ical structures consisting of dextran coating toprevent destabilization and agglomeration ofthe colloidal suspension to enhance solubilityin aqueous or biological media. Because ofthis chemical structure, both of these agentsare biocompatible and SPIO is FDA-approvedfor imaging of liver lesions. Our studies haveshown that mouse and human embryonic stemcell viability and differentiation capacity arenot altered with SPIO labeling. However, otherstudies reported in vitro differentiation capac-ity of mesenchymal stem cells into chondro-cyte lineage was reduced after SPIO labelingin a dose-dependent manner, whereas os-teogenic and adipogenic differentiation wasintact (Kostura et al., 2004).

Direct SPIO labeling of hESC is sim-ple and straightforward. Higher efficiency ofiron-oxide labeling is achieved by adding

transfection agents such as PLL, PS or lipofec-tamine. All these transfection agents neutral-ize the negatively charged SPIO to facilitatethe attraction and binding of slightly positiveor neutral complex to the negatively chargedcell membrane. The mechanisms by whichthese complexes enter the cell have not beencompletely investigated but they probably in-clude endocytosis, invagination, or diffusion.Similarly, MnCl2 is a simple, robust, and safemethod to label hESC. Mn2+ is an essentialtrace element in the human body with electro-chemical properties analogous to Ca2+. Usingthe voltage-gated Ca2+ channels, not only arethe hESC localized with T1-weighted, posi-tive signal, but the biological properties of thecells can also be determined. Nevertheless, thesensitivity/ability to detect cells is still higherwith SPIO-labeled cells.

However, drawbacks also exist for thesecontrast agents. First, the SPIO method re-quires long incubation times. To overcome thisproblem, advanced labeling methods such asmagnetoelectroporation or magnetosonopora-tion have been reported (Walczak et al., 2005).In both methods, either a high-voltage electri-cal pulse or ultrasound was used to incorporate

MagneticResonance

Imaging of hESCs

5A.3.8


SPIO into the cytoplasm for a shorter timewith a higher efficiency. Our data, however,demonstrated that electroporation alters thedifferentiation capability of mouse embryonicstem cells. In addition, the intracellular con-centration of SPIO is diluted gradually withcell division or death. Second, at high dosesof MnCl2, hESC toxicity occurs at the cellularlevel and systemic effects on neurologic andcardiovascular functions have been reported.These untoward effects of MnCl2, however,have been overcome by concurrent calciumsupplementation (Bruvold et al., 2005).

The most successful optical method forimaging small numbers of transplanted cells inexperimental models is bioluminescence. Thesensitivity reaches 10−15 to 10−17 mole/literenabling detection of 100 cells. This modal-ity utilizes an internal biological light source,such as luciferase, which can be detectedwithin the tissues of small animals using sen-sitive low-light imaging systems. Specific tar-geting of luciferase transgene expression inrestricted cells and tissues of interest has al-lowed the localization and tracking of cellfate for studying a variety of disease pro-cesses. The CCD camera of the BLI is ca-pable of detecting a minimum radiance of100 photons per second per cm2 per steradian(photons/sec/cm2/sr) and achieves a minimalimage pixel resolution of 50 μm (Wu et al.,2003). High reproducibility (within ±8% SDfrom mean values) and detection sensitivityof this bioluminescence system for monitor-ing luciferase reporter gene expression hasbeen demonstrated in vivo (Wu et al., 2001).While optical imaging detects signals fromnear-cellular level, this technique is limitedto small animal imaging due to limited depthpenetration of 1 to 2 cm, spatial resolutionof 3 to 5 mm, and temporal resolution of

seconds to minute (Auerbach et al., 1999).Clinical implementation of this technique(bioluminescence imaging) is not feasible.

Critical ParametersAlthough direct hESC labeling is simple

and convenient, incubation time with SPIOand MnCl2 needs to be optimized. Satisfac-tory labeling of hESC could be achieved in an8 to 12 hr incubation time with SPIO and inhalf an hour with MnCl2 without cytotoxicity.Excessive incubation time does not increaseSPIO or MnCl2 uptake into cells but it doesincreases cytotoxicity.

TroubleshootingSPIO labeling is more sensitive than

MnCl2. With the imaging method describedabove, 50,000 hESC could be visualizedwith SPIO, while manganese chloride requires∼106 hESC for direct MR visualization using a3 Tesla clinical scanner. Care should be takento make an MRI phantom as homogeneousas possible to remove any potential source ofbackground artifacts such as air bubbles orcracks within the gelatin-based phantom.

Anticipated ResultsHypointense, dark signals can be generated

from the SPIO-labeled cells on T2*-weightedsequences (Fig. 5A.3.1). A visually distinctcontrast can be observed starting at a magneticfield as low as 0.3T. Similarly, remarkable hy-perintense, positive signals can be producedfrom the manganese-labeled hESC using T1-weighted sequences (Fig. 5A.3.2). Significantbright signals can be achieved at a magneticfield as low as 1.5T.

Time ConsiderationThe entire procedure will take ∼72 hr from

preparation of cells to MRI scanning of labeled

Figure 5A.3.5 In vivo manganese enhanced MRI of mESC transplanted into the murine right hindlimb. The positive signal generated by mESC following intravenous administration of manganeseis indicated by a black arrow. This mouse was scanned using a 3T clinical MRI scanner (GEHealthcare System).


5A.3.9


cells. Labeling incubation time can be opti-mized from 4 to 12 hr with SPIO and from 30min to 1 hr with MnCl2. The MnCl2 solutionmust also be prepared on the day of cell la-beling. Excessive incubation time may inducecytotoxicity.

Literature CitedAoki, I., Takahashi, Y., Chuang, K.H., Silva, A.C.,

Igarashi, T., Tanaka, C., Childs, R.W., andKorefsky, A.P. 2006. Cell labeling for magneticresonance imaging with the T1 agent manganesechloride. NMR Biomed. 19:50-59.

Auerbach, M.A., Schoder, H., Hoh, C., Gambhir,S.S., Yaghoubi, S., Sayre, J.B., Silverman, D.,Phelps, M.E., Schelbert, H.R., and Czernin, J.1999. Prevalence of myocardial viability asdetected by positron emission tomography inpatients with ischemic cardiomyopathy. Circu-lation 99:2921-2926.

Bruvold, M., Nordhoy, W., Anthonsen, H.W.,Brurok, H., and Jynge, P. 2005. Manganese-calcium interactions with contrast media for car-diac magnetic resonance imaging: A study ofmanganese chloride supplemented with calciumgluconate in isolated Guinea pig hearts. Invest.Radiol. 40:117-125.

Bulte, J.W., Douglas, T., Witwer, B., Zhang, S.C.,Strable, E., Lewis, B.K., Zwicke, H., Miller, B.,van Geleren, P., Moscovitz, B.M., Duncan, I.D.,and Frank, J.A. 2001. Magnetodendrimers al-low endosomal magnetic labeling and in vivotracking of stem cells. Nat. Biotechnol. 19:1141-1147.

Chen, I.Y., Greve, J.M., Gheysens, O., Willmann,J.K., Rodriguez-Porcel, M., Chu, P., Sheikh,A.Y., Faranesh, A.Z., Paulmurugen, R., Yang,P.C., Wu, J.C., and Gambhir, S.S. 2008. Compar-ison of optical bioluminescence reporter geneand superparamagnetic iron oxide MR contrastagent as cell markers for noninvasive imaging ofcardiac cell transplantation. Mol. Imaging Biol.11:178-187.

Frank, J.A., Zywicke, H., Jordan, E.K., Mitchell,J., Lewis, B.K., Miller, B., Bryant, L.H. Jr., andBulte, J.W. 2002. Magnetic intracellular label-

ing of mammalian cells by combining (FDA-approved) superaramagnetic iron oxide MR con-trast agents and commonly used transfectionagents. Acad. Radiol. 9:S484-S487.

Kostura, L., Kraitchman, D.L., Mackay, E.M.,Pittinger, M.F., and Bulte, J.W. 2004. Feridex la-beling of mesenchymal stem cells inhibits chon-drogenesis but not adipogenesis or osteogenesis.NMR Biomed. 17:513-517.

Kraitchman, D.L., Heldman, A.W., Atalar, E.,Amado, L.C., Martin, B.J., Pittenger, M.F.,Hare, J.M., and Bulte, J.W. 2003. In vivomagnetic resonance imaging of mesenchymalstem cells in myocardial infarction. Circulation107:2290-2293.

Li, Z., Suzuki, Y., Huang, M., Cao, F., Xie, X.,Connolly, A.J., Yang, P.C., and Wu, J.C. 2008.Comparison of reporter gene and iron particlelabeling for tracking fate of human embryonicstem cells and differentiated endothelial cells inliving subjects. Stem Cells 26:864-873.

Lin, Y.J. and Koretsky, A.P. 1997. Manganese ionenhances T1-weighted MRI during brain acti-vation: An approach to direct imaging of brainfunction. Magn. Reson. Med. 38:378-388.

Suzuki, Y., Zhang, S., Kundu, P., Yeung, A.C.,Robbins, R.C., and Yang, P.C. 2007. In vitrocomparison of the biological effects of threetransfection methods for magnetically labelingmouse embryonic stem cells with ferumoxides.Magn. Reson. Med. 57:1173-1179.

Walczak, P., Kedziorek, D.A., Gilad, A.A., Lin, S.,and Bulte, J.W. 2005. Instant MR labeling ofstem cells using magnetoelectroporation. Magn.Reson. Med. 54:769-774.

Wu, J.C., Sundaresan, G., Iyer, M., and Gambhir,S.S. 2001. Noninvasive optical imaging of fire-fly luciferase reporter gene expression in skele-tal muscles of living mice. Mol. Ther. 4:297-306.

Wu, J.C., Chen, I.Y., Sundaresan, G., Min, J.J., De,A., Qiao, J.H., Fishbein, M.C., and Gambhir,S.S. 2003. Molecular imaging of cardiac celltransplantation in living animals using opticalbioluminescence and positron emission tomog-raphy. Circulation 108:1302-1305.

UNIT 5A.4Lineage Tracing in the IntestinalEpitheliumNick Barker1 and Hans Clevers1

1Hubrecht Institute for Developmental Biology and Stem Cell Research, and UniversityMedical Center Utrecht (UMCU), Utrecht, The Netherlands

ABSTRACT

This unit describes the theory and detailed protocols for performing in vivo lineage trac-ing from Lgr5+ve intestinal stem cells using an Lgr5-EGFP-ires-CreERT2/Rosa26lacZmouse model. Lineage tracing can be initiated in mice at any age by administering limit-ing doses of the hormone tamoxifen. This activates the lacZ reporter gene in the Lgr5+vestem cells, which subsequently transmit this permanent genetic mark to their progenyas they repopulate the epithelium during normal homeostasis. Because the Lgr5+ve cellsare long-lived, self-renewing stem cells, they continuously generate lacZ progeny, whichcontribute to tissue renewal over the entire lifetime of the mouse. The same protocolscan be applied to performing in vivo lineage tracing from other Lgr5+ve stem cell pop-ulations, including those in the hair-follicle and stomach. Curr. Protoc. Stem Cell Biol.13:5A.4.1-5A.4.11. C© 2010 by John Wiley & Sons, Inc.

Keywords: Lgr5 � in vivo lineage tracing � stem cell � intestine

INTRODUCTION

The biology of the intestine is very well understood, yet the identity of the intestinalstem cells has remained elusive because of a lack of speciÞc markers (Barker et al.,2008). The authors recently identiÞed the Wnt target gene Lgr5 as a speciÞc markerfor a restricted population of proliferating cells at the crypt base in both the smallintestine and colon (Barker et al., 2007). In the small intestine, these Lgr5+ve cells arewedge-shaped cells called crypt base columnar cells (CBC), which are candidate stemcells found intermingled with the differentiated Paneth cells (Cheng and Leblond, 1974;Bjerknes and Cheng, 1981). To assess the stem cell potential of these Lgr5+ve cells, amouse model was generated in which an EGFP-ires-CreERT2 expression cassette wasinserted immediately downstream of the transcription start site of the endogenous Lgr5promoter. The Lgr5+ve cells in this mouse consequently express an EGFP tag that allowsvisualization of them within the intestine using confocal microscopy and also allows usto efÞciently isolate them for in vitro analysis using FACS. The same Lgr5+ve cells alsoexpress a tamoxifen-inducible Cre (catalyzes recombination) enzyme that allows for invivo lineage tracing when the mice are crossed with inducible reporter mice such asRosa26lacZ (Soriano, 1999; Fig. 5A.4.1). Using this approach, it has been shown that alacZ reporter gene activated in the Lgr5+ve cells is rapidly inherited by daughter cells,which constantly re-populate the intestinal epithelium as renewal occurs over the lifetimeof the animal. In conclusion, this showed that the Lgr5+ve cells are the true stem cells ofthe intestine. Using a similar approach, it was also shown that Lgr5+ve populations inother tissues such as the hair-follicle (Jaks et al., 2008) and stomach (Barker et al., 2010)are adult stem cell populations responsible for maintaining tissue homeostasis.

This unit provides step-by-step instructions for performing this in vivo lineage tracingusing the Lgr5-EGFP-ires-CreERT2/Rosa26lacZ mouse model. The preparation andadministration of the tamoxifen hormone (see Support Protocol) is described. There are

Current Protocols in Stem Cell Biology 5A.4.1-5A.4.11Published online May 2010 in Wiley Interscience (www.interscience.wiley.com).DOI: 10.1002/9780470151808.sc05a04s13Copyright C© 2010 John Wiley & Sons, Inc.


5A.4.1

Supplement 13

Lineage Tracingin the Intestinal

Epithelium

5A.4.2


A

B

C

Lgr5 ve stem cell

EGFPPOS

LACZNEG

LGR5 5 UTR EGFP IRES PolyA

LACZSTOPSA AyloPZcal62R

CRE-ERT2

Lgr5 ve daughter cell


LACZSA AyloPZcal62R

CRE-ERT2

Lgr5 ve daughter cell

EGFPNEG

LACZPOS


LACZSA AyloPZcal62R

CRE-ERT2

Lgr5 ve stem cell

EGFPPOS

tamoxifen

LACZPOS


LACZSA AyloPZcal62R

CRE-ERT2

Figure 5A.4.1 Image outlining in vivo lineage tracing using the Lgr5-EGFP-ires-CreERT2/Rosa26-lacZ mice. (A) Intesti-nal stem cells harboring the Lgr5-EGFP-ires-CreERT2 transgene express both EGFP and the CreERT2 enzyme. In theabsence of tamoxifen, the CreERT2 enzyme is sequestered by heat-shock proteins in the cytoplasm. As a result, the lacZreporter gene remains switched off due to the presence of a transcriptional roadblock. (B) Following induction, tamoxifenis taken up by the Lgr5+ve intestinal stem cells and complexes with the CreERT2 protein in the cytoplasm. This releasesthe CreERT2 enzyme from its heat-shock chaperones and allows it to enter the nucleus and catalyze the excision of thetranscriptional roadblock from the lacZ reporter gene via Cre/loxP-mediated recombination. The lacZ reporter gene is con-sequently permanently switched on in the Lgr5-EGFP+ve stem cells. (C) These EGFP+ve/lacZ+ve stem cells subsequentlydivide to generate Lgr5-EGFP−ve progeny, which therefore inherit the genetic lacZ mark. These lacZ+ve progeny rapidlyre-populate the intestinal epithelium, allowing their appearance and fate to be tracked over time.

protocols for optimal isolation and Þxation (see Basic Protocol 1) and lacZ staining of theintestines (see Basic Protocol 2). Finally, whole-mount (see Basic Protocol 3) and tissuesection (see Basic Protocol 4) protocols for analyzing the lacZ staining are described.

NOTE: All protocols using live animals must Þrst be reviewed and approved by an Insti-tutional Animal Care and Use Committee (IACUC) and must follow ofÞcially approvedprocedures for the care and use of laboratory animals.


5A.4.3


BASICPROTOCOL 1

ISOLATION AND FIXATION OF THE INTESTINE

To visualize lineage tracing in the intestine, it is necessary to dissect, Þx, and lacZ stainthe tissue from tamoxifen-treated Lgr5-EGFP-CreERT2/Rosa26lacZ mice.

Materials

Tamoxifen-treated Lgr5-ires-CreERT2/Rosa26-lacZ mice (see Support Protocol)Gluteraldehyde lacZ Þxative (see recipe) or paraformaldehyde lacZ Þxative (seerecipe)

Phosphate-buffered saline lacking Ca2+ and Mg2+ (CMF-PBS)

3-ml syringes and 21-G needles50-ml centrifuge tubeRolling platform

1. Dissect the intestines from a tamoxifen-treated mouse and place into a petri dishcontaining 20 ml cold Þxative.

2. Equally divide the freshly isolated intestine into proximal, middle, distal, and colonsegments and immediately ßush with 3 ml ice-cold gluteraldehyde Þxative to removefeces using a 3-ml syringe with a 21-G needle attached.

An adult mouse small intestine is typically 40-cm long. The proximal segment is deÞnedas the 12 to 14 cm immediately adjacent to the stomach. The distal segment is deÞned asthe 12 to 14 cm immediately adjacent to the caecum. The intervening 12 to 14 cm deÞnesthe middle segment. The colon is typically 7- to 8-cm long and is deÞned as the segmentfrom the caecum to the rectum.

The intestine is very susceptible to degradation following death because of its largemicrobial load. It is therefore crucial to isolate this tissue, ßush thoroughly, and initiateÞxation as soon as possible.

3. Place each intestinal segment into a separate 50-ml centrifuge tube containing 50 ml(∼20-fold excess) of ice-cold gluteraldehyde Þxative.Gluteraldehyde lacZ Þxative generally delivers optimal lacZ stains, but is incompatiblewith the majority of immunohistochemical procedures. PFA lacZ Þxative can be used inplace of gluteraldehyde lacZ Þxative when lacZ/antibody co-stains are required.

4. Fix the intestines by constant mixing on a rolling platform for 2 hr at 4◦C.Fixation times are critical�over-Þxation can destroy lacZ activity in the tissue.

5. Remove the Þxative and wash the intestines two times for 10 min each in 50 mlCMF-PBS at room temperature on a rolling platform. Proceed to Basic Protocol 2.

SUPPORTPROTOCOL

TAMOXIFEN-INDUCTION OF IN VIVO LINEAGE TRACING

In these studies, tamoxifen is used to induce the lineage tracing from the Lgr5+ve in-testinal stem cells. The tamoxifen is prepared from a powder and injected into theLgr5-EGFP/CreERT2/Rosa26lacZ mice.

Materials

Tamoxifen powder (Sigma, cat. no. T-5648), stored at least 1 year at 4◦C100% ethanolSunßower oil (supermarket variety)Adult Lgr5-iresCreERT2/Rosa26-lacZ mice (6 to 8 weeks old, ∼25 g; JacksonLaboratory)

37◦C incubator1-ml syringe and 25-G needle (BD Microlance)


Epithelium

5A.4.4


1. Dissolve the tamoxifen powder at 100mg/ml in 100% ethanol by extensive vortexingat room temperature.

2. Add sunßower oil to achieve a 10 mg/ml tamoxifen/oil emulsion by extensive vor-texing and store 0.4-ml aliquots up to 2 years at −20◦C.

3. Pre-warm the tamoxifen stock (10 mg/ml) to 37◦C and thoroughly vortex to ensurea homogenous emulsion.

4. Inject adult Lgr5-ires-CreERT2/Rosa26-lacZmice intraperitoneally (i.p.)with 100μlof 10 mg/ml tamoxifen (40 mg/kg) using a 1-ml syringe and 25-G needle. Houseinduced mice under standard conditions.

BASICPROTOCOL 2

ββ-GALACTOSIDASE (lacZ) STAINING TO VISUALIZE INTESTINAL STEMCELLS

The LacZ+ve progeny of the Lgr5+ve stem cells are visualized in the intestine by β-galactosidase staining.

Materials

Fixed, freshly isolated intestines from tamoxifen-treated mice (see BasicProtocol 1)

Equilibration buffer (see recipe)β-galactosidase (lacZ) substrate (see recipe)Phosphate-buffered saline lacking Ca2+ and Mg2+ (CMF-PBS)4% (w/v) paraformaldehyde (PFA; see recipe)

Rolling platform50-ml centrifuge tubes

1. Following the Þnal wash of the intestines (see Basic Protocol 1), remove the CMF-PBS from the intestinal sections and add 50 ml equilibration buffer to each tube.Allow the intestines to equilibrate by constant mixing on a rolling platform 30 minat room temperature.

2. Transfer the intestines to a 50-ml centrifuge tube containing 50 ml of freshly-madelacZ substrate and allow the staining reaction to proceed with constant mixing on arolling platform overnight at room temperature in the dark.

X-gal (5-bromo-4-chloro-3-indolyl-β-galactosidase) is light-sensitive and incubationwith this substrate and the subsequent post-Þxation in 4% PFA should therefore beperformed in the dark.

3. Remove the staining solution and wash the intestines two times for 10 min each in50 ml CMF-PBS at room temperature on a rolling platform in the dark.

4. Remove CMF-PBS and add 50 ml (∼20-fold excess) of 4% PFA to each tube and Þxthe intestines by constant mixing on a rolling platform overnight at 4◦C in the dark.Optimal Þxation is achieved using a minimum 20-fold excess of 4% PFA at 4◦C.

5. Remove the Þxative and wash the intestines two times for 10 min each in 50 mlCMF-PBS at room temperature on a rolling platform. Proceed to Basic Protocol 3.

BASICPROTOCOL 3

WHOLE-MOUNT ANALYSIS OF lacZ STAINING IN THE INTESTINE

Whole-mount segments of intestine are examined for the lacZ+ve progeny of the Lgr5+vestem cells. The tissue is embedded in agarose, sectioned using a vibratome, and analyzedunder a stereo microscope.


5A.4.5


Materials

Fixed and stained intestinal sections from tamoxifen-treated mice (see BasicProtocol 1)

Phosphate-buffered saline lacking Ca2+ and Mg2+ (CMF-PBS)4% low-melting-point agarose (Invitrogen, cat. no. 16520-100), pre-warmed to40◦C

Glue (Bison, http://www.bison.nl, cat. no. Bi2058)

Dissection pinsCardboardPetri dishesStereo microscope (e.g., Olympus SZX9) linked to a digital cameraPlastic basemolds (Klinipath, cat. no. 3051-P)ScalpelVibratome (Microm model HM650V)Vibratome knives (Gillette, cat. no. 10)Starfrost microscope slidesCoverslips (Menzel-Glaser)

1. To gain a global view of lacZ staining in the intestine, cut open a 1-cm piece fromeach intestinal segment along its length and pin it out onto a piece of cardboard withthe inner surface (the surface epithelium) facing upwards.

2. Submerge the cardboard in a petri dish containing CMF-PBS and take whole-mountphotos of the surface epithelium using a stereo microscope (e.g., Olympus SZX9)linked to a digital camera, with surface illumination (Fig. 5A.4.2).

3. To generate a more detailed overview of the lacZ staining present on local areas ofsurface epithelium, cut open a∼1-cm piece of intestine along its length, lay it ßat ina tissue mold, and add 4% low-melting-point agarose until the tissue is completelysubmerged.

4. Allow the agarose to set (∼20 min), then remove the agarose/tissue block from themold, and trim it to a perfect square using a scalpel blade.

5. Glue the block to the cutting platform of the vibratome so that the piece of intestineis perpendicular to the knife (i.e., side-on).

A B

Figure 5A.4.2 Whole-mount analysis of in vivo lineage tracing in the small intestine. (A) Low-power image showing the presence of multiple lacZ+ve epithelial units throughout the small intestine600 days post-induction. (B) LacZ+ve epithelial units visible on a 150-μm vibratome section of smallintestine 5 days post-induction.


Epithelium

5A.4.6


6. Cut 150- to 200-μm sections (typically containing two to three crypts plus associatedsurface epithelium) and carefully transfer them to a microscope slide.

7. Place a coverslip over the sections to ensure that they remain ßat and take whole-mount pictures as detailed above (Fig. 5A.4.2).

BASICPROTOCOL 4

DETAILED ANALYSIS OF lacZ STAINING ON TISSUE SECTIONS

Tissue sections are prepared for closer analysis of lacZ expression.

Materials

Intestinal tissue (see Basic Protocol 1)Tissue dehydration solutions: 70%, 80%, 96%, and 100% ethanoln-Butanol (Baker, cat. no. 8017)Liquid parafÞn (60◦C)De-wax solvent (xylene; Klinipath, cat. no. 4055-9005)Tissue rehydration solutions: 100%, 96%, 90%, 80%, 70%, 60%, 50%, and 25%ethanol

0.1% (w/v) Neutral Red in ddH2OPertex mounting medium (Histolab)

Tissue cassettes (Klinipath)Metal molds on an embedding stationHeated forcepsCold plate (−12◦C)Microtome40◦C water bathStarfrost microscope slidesHot-plate (∼55◦C)Slide racks (Klinipath)Coverslips (Menzel-Glaser)Digital camera connected to a standard light microscope

1. Transfer the remaining intestinal tissues to a Klinipath tissue cassette and label thefront panel clearly using a pencil.

2. Dehydrate the tissues by immersing the cassette in a 20-fold volume of 70% ethanolfor 2 hr at 4◦C. Refresh the 70% ethanol after 1 hr. Repeat this procedure using96% ethanol and then 100% ethanol.

Once tissues are transferred to 70% ethanol, they can be stored for up to 3 months at 4◦C.The ethanol dehydration series cannot be interrupted after this stage.

All dehydration steps using ethanol are performed at 4◦C to ensure a gradual reductionin hydroxyl (water) bonds within the tissue, thereby reducing tissue damage.

3. Transfer the tissue cassettes to a 20-fold volume of n-butanol and incubate for 2 hrat room temperature.

Following dehydration in the ethanol series, n-butanol must be used to remove the lasttraces of ethanol. Incubation in xylene will result in a loss of lacZ staining in the tissue.

4. Remove the tissue cassettes from the n-butanol and blot them onto tissues to removeany excess solvent.

5. Immerse the cassettes into 60◦C liquid parafÞn overnight.

6. Remove the tissue cassettes from the liquid parafÞn and transfer them into metalmolds on an embedding station. Carefully orient the tissues within the parafÞn using

5A.4.7


heated forceps and then transfer the parafÞn blocks to a−12◦C cold-plate for 30 minto allow them to solidify.

7. Prepare 6-μm thick sections using a microtome and transfer to a clean 40◦C waterbath. Allow the sections to spread out on the water and then ßoat them onto the uppersurface of frosted microscope slides.

8. Dry the slides 1 hr on a 55◦C hot-plate.

9. Transfer the slides into a slide rack and de-wax them two times by immersion inxylene, for 5 min each time.

10. Rehydrate the tissue sections by serial immersion in ethanol as follows:

1 min 100% ethanol (two times)1 min 96% ethanol1 min 90% ethanol1 min 80% ethanol1 min 70% ethanol1 min 60% ethanol1 min 50% ethanol1 min 25% ethanol1 min ddH2O.

CBA

FED

SI DAY 1 SI DAY 10 SI DAY 128

COLON DAY 1 821 YAD NOLOC01 YAD NOLOC

Figure 5A.4.3 High-resolution examples of short-term and long-term lineage tracing in the small intestine and colon.(A) Isolated Lgr5-lacZ+ve stem cells present at the crypt base in the small intestine 1 day post-induction (black arrow). (B)Epithelial units in the small intestine partially populated by lacZ+ve progeny 5 days post-induction. LacZ+ve Paneth cells aretypically not observed at these early time-points (red arrows). (C) Epithelial units in the small intestine entirely populatedby lacZ+ve progeny 128 days post-induction. (D) Isolated Lgr5-lacZ+ve stem cells present at the colon crypt base 1 daypost-induction (black arrow). (E) Epithelial units in the colon partially populated by lacZ+ve progeny 5 days post-induction.(F) Epithelial units in the colon entirely populated by lacZ+ve progeny 128 days post-induction.


Epithelium

5A.4.8


11. Counterstain by immersion in 0.1% Neutral Red solution for 1 min.

Neutral Red is a counterstain that colors both the nucleus and cytoplasm red, generatingan optimal contrast against the blue lacZ stain.

12. Quickly rinse the slides in 100% ethanol, three times for 30 sec each time, to removeexcess Neutral Red counterstain and then transfer to xylene, incubate two times for2 min each time.

13. Place a coverslip over the sections and seal it in place using Pertexmountingmedium.

14. Photograph the sections using a digital camera connected to a standard light micro-scope (Fig. 5A.4.3).

REAGENTS AND SOLUTIONSFor culture recipes and steps, use sterile tissue culture�grade water. For other purposes, usedeionized, distilled water or equivalent in recipes and protocol steps. For suppliers, see SUPPLIERSAPPENDIX.

β-galactosidase (lacZ) substrate

5 mM K3Fe(CN)6 (see recipe)5 mM K4Fe(CN)6·3H2O (see recipe)2 mM MgCl2 (see recipe)0.02% (v/v) NP40 (see recipe)0.1% (v/v) sodium deoxycholate (see recipe)1 mg/ml X-gal in CMF-PBS (see recipe)Prepare fresh and keep in the dark at room temperature

Ethylene glycol tetraacetic acid

Prepare 500 mM ethylene glycol tetraacetic acid (EGTA; Sigma) in ddH2O. Adjustthe pH to 7.2 using NaOH. Store indeÞnitely at room temperature.

Equilibration buffer

2 mM MgCl2 (see recipe)0.02% (v/v) NP40 (see recipe)0.01% (w/v) sodium deoxycholate in CMF-PBS (see recipe)Store indeÞnitely at room temperature

Gluteraldehyde lacZ Þxative

1% (v/v) formaldehyde0.2% (v/v) gluteraldehyde0.02% (v/v) NP40 in CMF-PBS (see recipe)Prepare fresh and keep on ice

Magnesium chloride

Prepare a 1 M magnesium chloride (MgCl2) stock in CMF-PBS. Store indeÞnitelyat room temperature.

NP40

Prepare a 10% (v/v) NP40 stock in CMF-PBS. Store indeÞnitely at room tempera-ture.

Paraformaldehyde, 4% (w/v)

Dissolve 40 g paraformaldehyde (PFA; Sigma, cat. no. P6148) per liter of CMF-PBS and heat to 60◦C with constant stirring. Store up to 2 weeks (short-term) at4◦C or up to 6 months (long-term) at �20◦C.


5A.4.9


Paraformaldehyde lacZ Þxative

4% (w/v) paraformaldehyde (PFA; see recipe)15 mM EGTA, pH 7.2 (see recipe)2 mM MgCl2 in CMF-PBS (see recipe)Prepare fresh and keep on ice

Potassium hexacyanoferrate II trihydrate (K4Fe(CN)6·3H2O)Prepare a 200 mM potassium hexacyanoferrate II trihydrate (K4Fe(CN)6·3H2O;Sigma, cat. no. P3289) stock in CMF-PBS. Store up to 2 weeks at 4◦C.

Potassium hexacyanoferrate III (K3Fe(CN)6)

Prepare a 200 mM potassium hexacyanoferrate III (K3Fe(CN)6; Sigma, cat. no.P8131) stock in CMF-PBS. Store up to 2 weeks at 4◦C.

Sodium deoxycholate

Prepare a 10% (w/v) sodium deoxycholate stock in ddH2O. Store indeÞnitely atroom temperature.

X-gal

Prepare a 50 mg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-galactosidase; Invitro-gen, cat. no. 15520-018) stock in dimethylformamide (Sigma ACS grade 3, cat. no.19937), dispense into 5-ml aliquots, and store up to 6 months at −20◦C.

COMMENTARY

Background InformationThe inner lining of the small intestine is ar-

ranged intomultiple functional units of colum-nar epithelium comprising Þnger-like villi thatprotrude into the gut lumen, surrounded byßask-shaped invaginations called crypts ofLeiberkuhn (Stappenbeck et al., 2003; Sanchoet al., 2004). These villi serve to maximizethe surface area available for efÞcient absorp-tion of digested food and water exiting thestomach. In the large intestine (colon), a ßatsurface epithelium replaces these villi, reßect-ing its primary role in compacting undigestedfood remnants into stool/feces rather thanabsorption.The intestinal epithelium is probably the

most rapidly renewing tissue in adults, un-dergoing a complete cycle of renewal every5 days. This self-renewal is driven by a smallpopulation of self-renewing, multipotent stemcells located at the base of crypts (Bjerknesand Cheng, 1999). These stem cells gener-ate a transient population of rapidly prolifer-ating cells (the transit amplifying cells) thatdivide two to three times as they migrateupwards before differentiating into the ma-jor cell types present on the surface epithe-lium as they exit the crypts. These differenti-ated cells (comprising absorptive enterocytes,mucus-secreting goblet cells, and much rarer

hormone-secreting enteroendocrine cells) per-form their essential functions as they continuemigrating along the surface epithelium untilÞnally dying by programmed cell death after5 days. A fourth differentiated cell type in thesmall intestine called the Paneth cell escapesthis upward migration and instead differenti-ates as it moves to the very base of the crypt.This cell lives up to 8 weeks and secretes an-timicrobial lysozyme and cryptdins as part ofthe gut immune system. Lysozyme-secretingPaneth cells are not present in the colon, al-though cellswith a similar function are thoughtto be present.In vivo lineage tracing in the Lgr5-ires-

CreERT2/Rosa26-lacZ mouse model centerson the inducible activation of a stably-integrated lacZ reporter gene in the Lgr5+ve

stem cell populations. Daughter cells derivedfrom the lacZ+ve Lgr5 populations inherit thisgenetic lacZ mark, allowing their appearanceand fate to be tracked in the correspondingtissue over time. This approach has been suc-cessfully used to demonstrate the stem cellfunction of Lgr5+ve cells in adult small intes-tine, colon, hair-follicle, and pyloric stomach.In the absence of tamoxifen induction, the

Cre-ERT2 enzyme present exclusively in theLgr5+ve stem cells is efÞciently sequesteredby heat-shock proteins in the cytoplasm. The


Epithelium

5A.4.10


Rosa26lacZ reporter gene in the nucleus con-sequently remains switched off by virtue ofthe presence of a transcriptional roadblock se-quence ßanked by loxP sites (Fig. 5A.4.1).Intraperitoneal injection of limiting doses

of tamoxifen releases the Cre-ERT2 enzymefrom its heat-shock protein chaperones and al-lows it to accumulate in the nucleus of iso-lated Lgr5+ve cells. Here, it rapidly mediatesexcision of the transcriptional roadblock bycatalyzing recombination across the ßankingLoxP sites. The lacZ reporter gene is therebyactivated in the Lgr5+ve cells and subsequentlytransmitted to their progeny as they repopulatethe tissue during normal homeostasis (Barkerand Clevers, 2007; Fig. 5A.4.1). Because theLgr5+ve cells are long-lived, self-renewingstem cells, they continuously generate lacZprogeny, which contribute to tissue renewalover the entire lifetime of the mouse.LacZ reporter gene activity is visualized

within the tissue using a 5-bromo-4-chloro-3-indolyl-β-galactosidase substrate, which iscatalyzed to a blue product by the lacZenzyme.

Critical Parameters andTroubleshootingIn the Lgr5-EGFP-ires-CreERT2mouse in-

testine, clusters of crypts silence the knock-inallele in a region-dependent fashion. The per-centage of EGFP-ires-CreERT2+ve crypts con-sequently decreases from the proximal smallintestine (∼70%) to the distal small intes-tine (∼30%). Such variegated expression oftransgenes is commonly observed in the in-testine. Importantly, however, no variegatedexpression is observed in other Lgr5+ve tis-sues, including the skin and stomach (nor isit observed in the intestine of an independentLgr5-lacZ knockinmodel that the authors haveused during the course of our studies).The Lgr5-EGFP-ires-CreERT2 mice are

only viable as heterozygotes (i.e., one wild-type allele must always be present). In vivolineage tracing is therefore always performedwith Lgr5-EGFP-ires-CreERT2het/Rosa26-lacZhet/hom mice.In principle, in vivo lineage tracing can be

performed using Lgr5-EGFP-ires-CreERT2mice in combination with any inducible re-porter mouse strain that is activated using stan-dard Cre/loxP technology.The dose of tamoxifen used to induce adult

Lgr5-EGFP-ires-CreERT2/Rosa26-lacZ mice(estimated at 25 g total weight) is selectedto achieve stochastic activation of the lacZreporter gene within the Lgr5+ve population

of the intestine (to demonstrate that a singleLgr5+ve stem cell is responsible for drivingthe renewal of all cell types present onthe crypt/villus epithelium). Higher dosesof tamoxifen may be used to increase thefrequency of lineage tracing if desired.

Anticipated ResultsLacZ+ve Lgr5 stem cells at the crypt base

should Þrst be observed 12 to 16 hr after induc-tion. LacZ+ve Lgr5-derived transit amplifyingcells will subsequently become visible in thecrypts within 2 to 3 days.Expect to observe lacZ+ve progeny

throughout the crypts and the associatedsurface epithelium 7 to 10 days post-induction. Typically, lacZ+ve enterocytes (al-kaline phosphatase-positive) and goblet cells(PAS-positive) are present at this time-pointbecause these exhibit the highest rate ofturnover. Paneth cells (lysozyme-positive)have a much lower turnover rate and lacZ+ve

examples are typically observed in the small-intestine only 3 to 4 weeks post-induction. Atthese early time-points, the surface epitheliumin the small intestine contains both lacZ+ve

and lacZ−ve progeny, creating a mosaic pat-tern (Fig. 5A.4.3B). This occurs because thesurface epithelium is being supplied with cellsfrom multiple crypts containing both lacZ+ve

and lacZ−ve stem cells.After 60 to 80 days, the entire surface ep-

ithelium of tracing units is typically comprisedof lacZ+ve cells, reßecting the fact that thelacZ+ve stem cell population has become dom-inant (with respect to the lacZ−ve stem cells)in the crypts supplying this intestinal unit.Given that the Lgr5+ve cells are long-lived,

self-renewing stem cells, the frequency oflacZ+ve epithelial units present will remainconstant even after the intestinal epitheliumhas undergone multiple rounds of completerenewal. Thus, expect to see multiple tracingunits even 24 months after induction.

Time ConsiderationsFollowing isolation of the intestines, the

entire lacZ staining/Þxation/embedding proce-dure should take ∼4 days.Once embedded in parafÞn the tissues

can be stored long-term at room temperaturewithout loss of lacZ stain.

Literature CitedBarker, N. and Clevers, H. 2007. Tracking down thestem cells of the intestine: Strategies to identifyadult stem cells. Gastroenterology 133:1755-760.


5A.4.11


Barker, N., van Es, J.H., Kuipers, J., Kujala, P.,van den Born, M., Cozijnsen, M., Haegebarth,A., Korving, J., Begthel, H., Peters, P.J., andClevers, H. 2007. IdentiÞcation of stem cells insmall intestine and colon by marker gene Lgr5.Nature 449:1003-1007.

Barker, N., van de Wetering, M., and Clevers,H. 2008. The intestinal stem cell. Genes Dev.22:1856-1864.

Barker, N., Huch, M., Kujala, P., van de Wetering,M., Snippert, H.J., van Es, J.H., Sato, T.,Stange, D.E., Begthel, H., van den Born, M.,Danenberg, E., van den Brink, S., Korving, J.,Abo, A., Peters, P.J., Wright, N., Poulsom, R.,and Clevers, H. 2010. Lgr5(+ve) stem cellsdrive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell 6:25-36.

Bjerknes, M. and Cheng, H. 1981. The stem cellzone of the small intestinal epithelium III. Evi-dence from columnar, enteroendocrine, and mu-cosal cells in the adult mouse. Am. J. Anat.160:77-91.

Bjerknes, M. and Cheng, H. 1999. Clonal analy-sis of intestinal epithelial progenitors.Gastroen-terology 116:7-14.

Cheng, H. and Leblond, C.P. 1974. Origin, differ-entiation, and renewal of the four epithelial celltypes in the mouse small intestine. V. Unitariantheory of the origin of the four epithelial celltypes. Am. J. Anat. 141:537-561.

Jaks, V., Barker, N., Kasper, M., van Es, J.H.,Snippert, H.J., Clevers, H., and Toftgard, R.2008. Lgr5 marks cycling, yet long-lived,hair follicle stem cells. Nat. Genet. 40:1291-1299.

Sancho, E., Batlle, E., and Clevers, H. 2004.Signaling pathways in intestinal developmentand cancer. Annu. Rev. Cell Dev. Biol. 20:695-723.

Soriano, P. 1999. Generalized lac-Z expressionwiththe ROSA26 Cre expression strain. Nat. Genet.21:70-71.

Stappenbeck, T.S., Mills, J.C., and Gordon, J.I.2003. Molecular features of adult mouse smallintestinal epithelial progenitors. Proc. Natl.Acad. Sci. U.S.A. 100:1004-1009.

UNIT 5B.1Generation of Human Embryonic StemCell Reporter Knock-In Lines byHomologous Recombination

Richard P. Davis,1,2 Catarina Grandela,1,3 Koula Sourris,1 TanyaHatzistavrou,1 Mirella Dottori,4 Andrew G. Elefanty,1 Edouard G.Stanley,1 and Magdaline Costa1

1Monash Immunology and Stem Cell Laboratories, Monash University, Clayton, Australia2Department of Anatomy and Embryology, Leiden University Medical Centre, Leiden,The Netherlands3Laboratory of Experimental Oncology and Radiobiology (LEXOR), Center forExperimental Molecular Medicine, Academic Medical Center, The Netherlands4Centre for Neuroscience and Dept of Pharmacology, The University of Melbourne,Parkville, Australia

ABSTRACT

This unit describes a series of technical procedures to form clonal human embryonicstem cell (hESC) lines that are genetically modified by homologous recombination. Todevelop a reporter knock-in hESC line, a vector is configured to contain a reporter geneadjacent to a positive selection cassette. These core elements are flanked by homolo-gous sequences that, following electroporation into hESCs, promote the integration ofthe vector into the appropriate genomic locus. The positive selection cassette facili-tates the enrichment and isolation of genetically modified hESC colonies that are thenscreened by PCR to identify correctly targeted lines. The selection cassette, flanked byloxP sites, is subsequently excised from the positively targeted hESCs via the transientexpression of Cre recombinase. This is necessary because the continued presence of thecassette may interfere with the regulation of the reporter or neighboring genes. Finally,these genetically modified hESCs are clonally isolated using single-cell deposition flowcytometry. Reporter knock-in hESC lines are valuable tools that allow easy and rapididentification and isolation of specific hESC derivatives. Curr. Protoc. Stem Cell Biol.11:5B.1.1-5B.1.34. C© 2009 by John Wiley & Sons, Inc.

Keywords: human embryonic stem cells � hESCs � gene targeting �

homologous recombination � fluorescent reporter gene

INTRODUCTION

This unit describes a series of procedures to form clonal genetically modified humanembryonic stem cell (hESC) lines in which DNA sequences encoding fluorescent or otherreporter genes are inserted into the genome by homologous recombination. Consequently,the reporter gene mirrors the expression pattern of the endogenous gene it replacesbecause it is regulated by the same transcriptional mechanisms. Targeting of reportergenes into the loci of lineage-specific transcription factors has facilitated the isolationand enrichment of specific cell types from differentiating mouse and human embryonicstem cells that would otherwise be unobtainable (Ying et al., 2003; Fehling et al., 2003;Ng et al., 2005; Micallef et al., 2005, 2007; Gadue et al., 2006; Davis et al., 2008a).

A combination of molecular biology and specialized cell culturing techniques are requiredto create a reporter knock-in hESC line (Fig. 5B.1.1). The gene-targeting vector is a keyelement in these procedures, and factors to be taken into consideration when constructing

Current Protocols in Stem Cell Biology 5B.1.1-5B.1.34Published online November 2009 in Wiley Interscience (www.interscience.wiley.com).DOI: 10.1002/9780470151808.sc05b01s11Copyright C© 2009 John Wiley & Sons, Inc.

GenericManipulation ofStem Cells

5B.1.1

Supplement 11

Generation ofhESC ReporterKnock-In Lines

5B.1.2


Electroporate hESCs with targeting vectorand select for stably transfected cells

(Basic Protocol 1)

Enzymatically expandhESCs (UNIT 1C.1)

Design and construct a targetingvector (Strategic Planning)

Following selection, isolate and expandthe hESC colonies (Support Protocol 1)

Extract DNA and screen by PCR for targetedhESCs (Support Protocols 2 and 3)

Transfer the targeted hESCcolony into organ culture

dishes and expandenzymatically (UNIT 1C.1)

Confirm:1) targeting by Southern blot

analysis or DNA sequencing;2) stem cell phenotype

(UNITS 1B.3 and 1B.4);3) normal karyotype.

Yes

Is there a correctly targeted hESC colony?

Isolate and expand the hESCs colonies(Support Protocol 1)

Remove the positive selection cassette from hESCsby transient transfection with the Cre-expression

vector. Select for transfected hESCs (Basic Protocol 2)

Extract DNA and screen by PCRfor loss of the selection cassette and

non-integration of Cre-expression plasmid(Support Protocols 2 and 3)

Yes

Does a hESC colony satisfy theabove requirements?

No

No

Figure 5B.1.1 (continues on next page)


5B.1.3


Transfer hESC colony into organ culturedishes and expand into bulk culture

(UNIT 1C.1)

Clonally derive sublines by single-celldeposition flow cytometry

(Support Protocol 4)

Transfer the reporter hESC line intoorgan culture dishes (UNIT1C.1)

Cryopreserve stocks ofthe hESC line

Determine the fidelity of thereporter gene expression

Maintain and expand thehESC line (UNIT 1C.1)

Confirm:1) targeting by Southern blot

analysis or DNA sequencing;2) stem cell phenotype

(UNITS 1B.3 and 1B.4);3) normal karyotype.

Isolate and expand the resultinghESCs colonies (Support Protocol 1)

Cont...

Extract DNA and screen by PCR to confirmline is targeted, has lost the positive

selection cassette, and there is non-integrationof Cre-expression plasmid (Support Protocols 2 and 3)

Yes

Does a hESC colony satisfy theabove requirements?

No

Figure 5B.1.1 (continued) A schematic representation of the sequence of procedures to generatea clonal reporter knock-in hESC line in which the positive selection cassette has been removedfrom the genome. Where possible, reference is made to either the relevant protocol or section inthis unit to perform the step, or to another appropriate unit.

the targeting vector are detailed in the Strategic Planning section. This section alsodescribes methods for maintaining and enzymatically expanding hESCs.

The stable integration of the targeting vector into hESCs by electroporation and thesubsequent isolation of these cells by drug selection are described in Basic Protocol 1.Support Protocol 1 outlines the process involved in picking and replicating the drug-resistant hESC colonies, and this is followed by methods detailing the extraction ofDNA from the colonies (Support Protocol 2 or the Alternate Protocol). A PCR screeningstrategy is then employed to identify the gene-targeted hESC colonies (Support Protocol3). The new hESC lines that contain the correct genetic modification are maintained asmechanically passaged colonies (UNIT 1C.1), and are also expanded enzymatically for thedeletion of the positive selection cassette as described (UNIT 1C.1).


5B.1.4


Elements located within the positive selection cassette can interfere with the expressionof both the reporter gene and neighboring endogenous genes (Hug et al., 1996; Phamet al., 1996; Scacheri et al., 2001; R. Davis, A.G. Elefanty, and E.G. Stanley, unpub.observ.). Therefore, a procedure for a Cre recombinase–mediated excision of the positiveselection cassette from the targeted hESC lines is detailed in Basic Protocol 2. Finally,Support Protocol 4 describes a method for the clonal isolation and expansion of thesegene-targeted hESCs using the single-cell deposition function of a flow cytometer.

These protocols were employed to generate multiple independent MIXL1GFP/w hESClines (Davis et al., 2008a). The expression of green fluorescent protein (GFP) during thedirected differentiation of these hESCs enabled cells expressing the transcription factorMIXL1 to be identified and isolated. These techniques have also been successfully usedto generate reporter knock-in hESC lines targeted at nine additional loci (Costa et al.,2007; A.G. Elefanty and E.G. Stanley, unpub. observ.).

STRATEGIC PLANNING

Design of the Targeting Vector

This section outlines some of the general principles to consider when designing thegene-targeting vector. A detailed description of the techniques and methods used toengineer a targeting vector are beyond the scope of this unit, but are available in otherpublications (Struhl, 2001; Elion et al., 2007; Thomason et al., 2007). The standardconstituents of a targeting vector for the generation of a reporter knock-in hESC lineinclude a promoterless reporter gene followed by a positive selection cassette comprisingof a constitutively active promoter that regulates the expression of an antibiotic-resistancegene. These core elements are flanked by two arms that are homologous to the targetlocus (Fig. 5B.1.2). Given that the gene-targeting vectors are routinely introduced intoESCs by electroporation in a linearized form, at least one unique restriction enzymesite is located outside the homologous sequences. This is typically at the junction of thehomologous arms and the plasmid backbone.

The reporter gene is typically a fluorescent marker, such as GFP or red fluorescentprotein (RFP), which lacks a 5′-untranslated region and an ATG start codon. Therefore,the coding sequence of the reporter gene is placed in frame with the initiation codon of thetarget gene. This measure improves the likelihood of recapitulating the expression profileof the endogenous gene. Targeting the reporter gene to the 5′ end of the coding sequencealso ensures that no wild-type polypeptide is translated upstream to the reporter gene,resulting in the deliberate ablation of expression of that allele and preventing the creationof a dominant negative allele. The sequences inserted into the genome generally replacea minimal portion of an exon to avoid the disruption of the RNA splicing sequences andthe loss of introns. It is also recommended to avoid targeting into alternatively splicedexons.

While the optimal length of the homologous sequences for gene targeting in hESCshas not been thoroughly investigated, the inclusion of one homology arm greater than6 kb improves the targeting frequency (Zwaka and Thomson, 2003; Costa et al., 2007).Targeting vectors generally contain one long and one short homology arm. The shorterhomology arm must be long enough to facilitate recombination, but short enough toscreen stable transfectants for recombination events by PCR. In practice, we have foundthat this homology arm should lie between 2 and 4 kb in size, while the combined lengthsof the two arms should be 10 to 14 kb in size. Although longer homology arms canimprove the targeting frequency, vectors >18 kb in length can limit both the propagationof standard bacterial strains and the repertoire of unique restriction enzyme sites availableto linearize the vector prior to electroporation.


5B.1.5


*5’

hom

olog

yar

m

reporter pos select.

3’ homology

arm

vector backbone

*ne

g.se

lect

.

Figure 5B.1.2 Plasmid map describing the possible structure of the targeting vector to generatea knock-in hESC line by homologous recombination. Two genomic fragments (5′ homology armand 3′ homology arm) flank a reporter gene (green arrow) lacking an initiation codon, and apositive selection cassette (blue rectangle). The reporter gene is placed in frame with the ATGstart codon included in the 5′ homology arm. The red triangles represent loxP sequences that flankthe positive selection cassette. A negative selection cassette (purple rectangle) can be includedin the construct if desired. Unique restriction sites (marked as *) are located within the plasmidbackbone to linearize the targeting construct prior to electroporation.

The homology arm sequences may also affect the success of homologous recombination.While targeting vectors containing nonisogenic sequences decrease the frequency ofhomologous recombination up to 20-fold in mESCs (te Riele et al., 1992; van Deursenand Wieringa, 1992), the efficiency of gene targeting in hESCs appears similar regardlessof the origin of the homology arms. Practically, this also means that the same knock-invector will target a given locus in different hESC lines at similar frequencies (Costa et al.,2007).

Following recombination, positive selection cassettes are required to permit identifi-cation of stably transfected hESCs, which occur at a frequency between 1 in 104-105 electroporated cells. The neomycin phosphotransferase gene (neo) is highly ex-pressed in hESCs when regulated by the mouse phosphoglycerate kinase (PGK) pro-moter (R. Davis, A.G. Elefanty, and E.G. Stanley, unpub. observ.), and this selec-tion cassette is routinely used by the authors when transfecting hESCs. Addition-ally, if the hESCs are being cultured on mouse embryonic fibroblast feeder cells,geneticin (G418)-resistant mouse lines are readily available. As an alternative, theneo gene may also be replaced with the hygromycin B phosphotransferase (hph)gene and the antibiotic hygromycin B used to enrich for stably transfected hESCs(L. Azzola, A.G. Elefanty, and E.G. Stanley, unpub. observ.). In correctly targeted clones,retention of the positive selection cassette in the genome can influence expression of thetarget locus and of neighboring genes (Hug et al., 1996; Pham et al., 1996; Scacheri et al.,2001; R. Davis, A.G. Elefanty, and E.G. Stanley, unpublished observations). Therefore


5B.1.6


flanking the cassette with loxP sequences allows for subsequent removal by transientexpression of Cre recombinase (Gu et al., 1993).

Replacement-type targeting vectors can also include a negative selection cassette, such asthe herpes simplex virus thymidine kinase (HSVTK) gene, to allow for selection againstrandom integrants and enrich for targeted recombinants (Zwaka and Thomson, 2003).This cassette is located outside the region of homology to the target gene, normally atthe end of the short homology arm.

Culturing the hESCs

The adaptation of the hESCs to enzymatic passaging using either trypsin or TrypLESelect (Invitrogen) is essential for success in the protocols described. Without such pre-conditioning, disaggregation of hESCs to a single-cell suspension results in extensivecell death (UNIT 1C.1). Protocols for the adaptation and expansion of enzymatically pas-saged hESCs are described in detail in UNIT 1C.1 and UNIT 1D.3. Only hESCs that haveundergone 5 to 10 enzymatic passages should be used in Basic Protocols 1 and 2, andSupport Protocol 4.

Validation of hESC Reporter Knock-in Lines

The protocols in this unit describe the generation of hESC reporter lines by homolo-gous recombination, identification of correctly targeted clones, removal of the selectablemarker, and single-cell cloning of the cell line. However, before any hESC reporter lineis used for experimentation, further screening procedures are required to validate the cellline.

Southern blot analysis of the putatively targeted hESC clones can confirm that thedesired recombination events have occurred at both the 5′ and 3′ ends, and that thecells contain only a single copy of the reporter gene. A detailed description of Southernblotting is outside the scope of this unit. In brief, genomic DNA extracted from the hESCcolonies is digested with restriction enzymes, electrophoresed on an agarose gel, andtransferred to a membrane. This membrane is hybridized with radiolabeled probes to thegene locus that lies external to the region of homology with the targeting vector, andthe labeled DNA fragments detected using either a phosphoimager or X-ray film. Suchprobes serve to identify correctly targeted alleles by virtue of size differences betweenhybridizing fragments generated by wild-type and targeted alleles. These size differencesarise because of the incorporation of additional DNA sequences and/or new restrictionenzyme sites associated with the introduction of the reporter gene and selectable markersequences into the native locus. In addition, a radiolabeled probe that hybridizes withthe coding sequence of the reporter gene can confirm that only a single integration eventoccurred.

The genetically manipulated hESC line must also maintain the characteristics of a stemcell. The cells should be regularly analyzed by flow cytometry for the expression of apanel of stem cell markers including transcription factors, such as OCT4 and NANOG,and the cell surface antigens, such as SSEA3 and 4, Tra-1-60, Tra-1-81, and CD9(UNIT 1B.3). Additionally, when the genetically modified hESCs are injected into the testesof immunodeficient mice, they should form multi-lineage teratomas (UNIT 1B.4). Thekaryotype should also be periodically checked to confirm that no karyotypic abnormalitieshave been introduced during the genetic manipulations. It is recommended that thisanalysis, to at least the level of G-banding, be performed by a clinical cytogeneticsfacility.

NOTE: The following protocols are performed in either a Class I (laminar-flow) biosafetycabinet or a Class II biohazard hood.


5B.1.7


NOTE: All materials and reagents that come into contact with live cells must be sterile andproper aseptic technique must be used when handling the cells or setting up experiments.

NOTE: All incubations are performed in a 37◦C, 5% CO2 humidified incubator, unlessotherwise specified.

BASICPROTOCOL 1

ELECTROPORATION OF hESCs AND SELECTION OFANTIBIOTIC-RESISTANT hESCs

Electroporation is the most common means of generating targeted mESC lines (Giudiceand Trounson, 2008). While the number of reports describing gene targeting by ho-mologous recombination in hESCs is currently limited, the majority of these have alsoutilized electroporation (Zwaka and Thomson, 2003; Costa et al., 2007; Irion et al.,2007; Davis et al., 2008a; Braam et al., 2008). This protocol describes the procedure forelectroporating hESCs with a linearized gene-targeting vector, followed by the positiveselection of stably transfected colonies. It is recommended that the neo gene be includedin the positive selection cassette, allowing for the drug geneticin (G418) to be used asthe selection agent.

Materials

hESCs in 150-cm2 tissue culture flasks at enzymatic passage 5 to 10 (see UNIT 1C.1)in hESC medium (see recipe)

150-cm2 gelatinized tissue culture flasks (see recipe) preseeded with mitoticallyinactivated MEFs at 1 × 104/cm2 for passaging hESCs prior to electroporation

MEF medium (see recipe)Trypsin (see recipe) or TrypLE Select cell dissociation enzyme (Invitrogen)hESC medium (see recipe), 37◦CPhosphate-buffered saline without CaCl2 and MgCl2 (CMF-PBS; Invitrogen)0.4% (w/v) Trypan blue (Fluka)Soybean trypsin inhibitor (see recipe; Invitrogen), optionalLinearized targeting vector (see Strategic Planning) in Tris/EDTA (TE) buffer (see

recipe) for transfection60-mm gelatinized tissue culture dishes preseeded with 2 × 104/cm2 mitotically

inactivated MEFsGeneticin/G418 Selective Antibiotic (Invitrogen)Mitotically inactivated, irradiation-treated (UNIT 1C.3) G418-resistant mouse

embryonic fibroblasts (MEFs; Conner, 2000)

37◦C water bathGene Pulser cuvette, 0.4-cm electrode gap, sterile (Bio-Rad, cat. no. 165-2088)15- and 50-ml sterile centrifuge tubesRefrigerated centrifugeGilson pipettors (John Morris Scientific) or equivalent, with sterile (plugged) tipsTissue culture microscope with phase contrast objectives and phase ringsHemacytometer (Neubauer)Electroporator (Gene Pulser II System; Bio-Rad)Sterile Pasteur pipets

Prepare hESCs prior to electroporation (day −1, day 0)1. On the day prior to electroporation, enzymatically dissociate the hESCs from two

150-cm2 flasks and replate onto two fresh 150-cm2 flasks preseeded with MEFs atlow density (1 × 104 MEFs/cm2 in 20 ml MEF medium), using either 2 ml trypsinor 2 ml TrypLE Select per 150-cm2 flask (Fig. 5B.1.3A).

It is critical that hESCs are adapted to enzymatic passaging using either trypsin orTrypLE Select prior to beginning this protocol. The enzymatic expansion of hESCs from


5B.1.8


A B

C D

Figure 5B.1.3 Photomicrographs of hESCs expanded in bulk culture, after electroporation, dur-ing drug selection, and following selection. Some groups of hESCs or individual colonies in panels(A), (B), and (C) are outlined by black-dotted lines. (A) hESCs in bulk culture grown on MEFs atreduced density on day of electroporation. (B) hESCs on the day following electroporation. (C)hESCs 5 days after electroporation, just prior to antibiotic selection. (D) A hESC colony following5 days of selection. (A) through (D) Original magnification 50×.

stock cultures maintained by mechanical passaging is described in detail in UNIT 1C.1. Thecells should be enzymatically disaggregated every 3 or 4 days, and split no more than ata ratio of 1:2. Generally, after the first 4 or 5 enzymatic passages, the hESCs will havebeen expanded into two 150-cm2 flasks.

The hESCs are passaged onto fresh MEFs at a ratio of 1:1 on the day prior to theelectroporation to ensure that the cells are actively dividing and to remove dead anddying cells. Seeding the flasks with a reduced density of MEFs (1 × 104 MEFs/cm2

compared with 2 × 104 MEFs/cm2), results in a partial depletion of feeder cells.

2. At a time point ∼2 to 3 hr before the electroporation, aspirate the medium and re-feedthe cells with fresh hESC medium.

3. At a time point ∼2 hr before the electroporation, place a 10-ml aliquot of CMF-PBSon ice and a 40-ml aliquot of hESC medium in a water bath at 37◦C.

4. Place the Gene Pulser electroporation cuvette on ice.

Harvest the cells5. Harvest the hESCs passaged the day before. First, aspirate the hESC medium and

then rinse the flasks with 5 to 10 ml CMF-PBS.

6. Add 2 ml of trypsin or TrypLE Select to each 150-cm2 flask and ensure that thedissociation solution coats the surface of the cells. Incubate 4 min at 37◦C in theincubator. Check that the hESCs dislodge from the flasks with gentle tapping.

If the cells are dissociated with trypsin, then a neutralization step is required. Add 1 mlof soybean trypsin inhibitor to each flask and swirl to mix. A specific neutralizing agentis not required for TrypLE Select.


5B.1.9


7. Add 8 ml of hESC medium to each flask, mix, and transfer the contents of the twoflasks to a single 50-ml centrifuge tube.

8. Pellet the cells by centrifuging the tube 3 min at 480 × g, at 4◦C, and aspirate thesupernatant.

9. Resuspend the hESCs in 10 ml of CMF-PBS and transfer the cell suspension to a15-ml centrifuge tube.

10. Using a Gilson pipettor, mix 10 μl of the cell suspension with 10 μl trypan blue.Load 10 μl onto a hemacytometer and, using a tissue culture microscope, perform acell count (UNIT 1C.3). Subtract the total MEF number (3 × 106) from the count.

A total of 1 × 107 hESCs is required per electroporation.

Two 150-cm2 flasks seeded with MEFs at a density of 1 × 104/cm2 will contain ∼3 ×106 MEFs. After subtracting the MEF count, a semi-confluent 150-cm2 flask of hESCstypically contains between 6–8 × 106 hESCs. Therefore the yield from two such flasks(∼12–16 × 106 hESCs) will provide enough hESCs for a single electroporation (∼10 ×106 hESCs). The remaining hESCs can be replated onto a new flask seeded with MEFs atthe regular density (2 × 106 MEFs/cm2) to maintain the undifferentiated culture. If thereare ∼2–4 × 106 hESCs remaining, these should be plated onto a 75-cm2 flask, while a150-cm2 flask should be used if there are in excess of 4 × 106 hESCs.

Prepare the cells with the targeting vector for electroporation11. Centrifuge the cells again for 3 min at 480 × g, 4◦C, aspirate the supernatant, and

resuspend 1 × 107 hESCs in a final volume of 750 μl ice-cold CMF-PBS.

12. Using a Gilson pipettor, add 50 μl of TE buffer containing between 10 and 20 μg ofthe linearized gene-targeting vector to the electroporation cuvette.

13. Carefully transfer the hESC suspension into the cuvette using a pipettor, ensuringthat the DNA-containing TE buffer and hESCs are evenly resuspended.

14. Place the cuvette containing the DNA and cell suspension mix on ice for 5 min.

Electroporate the cells15. Wipe the outside of the cuvette to remove any water or ice before electroporating the

cells at 250 V and 500 μF (Costa et al., 2007).

Other groups have achieved successful transfection of the plasmid by electroporating thehESCs at 320 V and 200 μF (Zwaka and Thomson, 2003), or 320 V and 250 μF (Braamet al., 2008). In our laboratory, our conditions have been used to target at least 9 loci(Costa et al., 2007; A.G. Elefanty and E.G. Stanley, unpub. observ.).

Plate the electroporated cells16. Using a Pasteur pipet, transfer the contents of the cuvette to a 50-ml centrifuge tube

containing 10 ml of prewarmed hESC medium.

17. Centrifuge the electroporated cells 3 min at 480 × g, room temperature (20◦ to25◦C).

18. Carefully aspirate the supernatant and gently resuspend the pellet in 15 to 18 ml ofprewarmed hESC medium.

Steps 16 to 18 remove cellular debris that could impair the viability of the survivinghESCs.

19. Plate the cell suspension into five or six 60-mm dishes preseeded with 2 × 104

MEFs/cm2, and incubate the dishes in a humidified incubator at 37◦C, 5% CO2

(Fig. 5B.1.3B).


5B.1.10


The number of 60-mm dishes that the electroporated hESCs are plated into is dependenton the proportion of hESCs that survive the electroporation procedure. This percentagenot only varies between hESC lines, but also reflects the degree to which the cells haveadapted to the enzymatic passaging prior to electroporation. Plating the hESCs into fiveor six 60-mm dishes usually ensures the hESC density is low enough that the cells canbe left to recover and proliferate for 4 to 5 days before beginning selection. If the hESCcultures are confluent in less than 4 days, plate the cells into a larger number of 60-mmdishes when performing future electroporations.

20. Two days after the electroporation, gently aspirate the medium containing the deadcells from each dish and replace with 4 ml of fresh hESC medium per dish. Repeatthis daily.

Select for geneticin-resistant hESCs (day 4 or 5)21. Supplement 200 ml of hESC medium with the drug geneticin (G418) so that the final

concentration is 50 μg/ml.

The recommended final concentration of G418 to use is 50 μg/ml; however, the optimalconcentration for selection may vary for different hESC lines. Prior to performing anelectroporation, determine the minimum concentration of G418 required to eliminateG418-sensitive hESCs within 5 days of addition.

For 1 week of selection, 200 ml of hESC medium containing G418 should be sufficientstock. This medium has a limited lifespan of 7 days.

22. Apply 50 μg/ml G418 selection to the hESCs when the dishes are ∼60% to 80%confluent with hESCs (4 or 5 days following electroporation; Fig. 5B.1.3C).

A 60-mm dish that is semi-confluent with nontransfected hESCs should also be placedunder selection as a control.

23. Change the selection medium daily.

Frequent medium changes are necessary during selection to remove the dead cells.

24. Four days into selection, supplement the dishes with fresh MEFs at 1 × 104

MEFs/cm2. Resuspend the required number of MEFs in 20 ml hESC medium con-taining G418 and dispense evenly over all the dishes, such that each dish contains atotal volume of 4 ml.

MEFs can support hESC growth for ∼1 week, and so the dishes will need to be sup-plemented with additional MEFs during the protocol to maintain densities of ∼2 × 104

MEFs/cm2. This should be done either 8 days after the initial plating of the electroporatedhESCs (Fig. 5B.1.3D), or if the MEF density appears low after the onset of selection.Supplementation with fresh MEFs is required even if the MEFs are G418 resistant.

Remove the selection agent25. Following 7 days of G418 selection, return to culturing the G418-resistant cells in

hESC medium without G418.

After 7 days, the control 60-mm dish should contain no residual viable hESCs. If livehESCs remain on the control dish, continue G418 selection on all dishes until colonytransfer (∼18 days post electroporation). Alternatively, the dose of G418 required to killcontrol hESCs may need to be re-titrated.

26. Allow the colonies to grow for approximately a further 7 days, changing the hESCmedium daily.

The colonies are ready to transfer to 48-well tissue culture plates (Support Protocol 1)when they are ∼2 mm in diameter. If the cells begin to differentiate, they should betransferred sooner.


5B.1.11


SUPPORTPROTOCOL 1

PICKING AND EXPANDING ANTIBIOTIC-RESISTANT hESC COLONIES

This protocol describes transferring and expanding individual genetically modified hESCcolonies that emerge on the 60-mm dishes following the selection procedures describedin Basic Protocols 1 and 2. Approximately 7 to 9 days after the withdrawal of theselection agent from the culture medium, each hESC colony is mechanically passagedinto a well of a 48-well tissue culture plate (Fig. 5B.1.4A,B). In our experience, thenumber of antibiotic-resistant colonies after Basic Protocol 1 may vary from 50 to morethan 300 per 107 electroporated hESCs. One week after the initial transfer, the hESC-containing plates are then duplicated, with one plate destined for extraction of DNA toperform the PCR screen (Support Protocols 2 and 3), while the other plate will serve tomaintain the hESC colonies in culture until positive clones are identified.

Materials

Flat-bottomed 48-well tissue culture plates, gelatinized (see recipe) and preseededwith mitotically inactivated MEFs at 2 × 104/cm2

Mitotically inactivated, irradiation-treated (UNIT 1C.3) mouse embryonic fibroblasts(MEFs; Conner, 2000)

MEF medium (see recipe)hESC medium (see recipe)

60-mm tissue culture dishes containing drug-resistant hESC colonies from eitherBasic Protocol 1 or 2

26-G, 1/2-in. (0.45 × 13–mm) needles1-ml syringe200-μl pipet tipsGilson pipettors (John Morris Scientific) or equivalent, with sterile (plugged) tipsStereomicroscope

Prepare 48-well tissue culture plates for transfer of the hESC colonies (day −1)1. Estimate the total number of individual, undifferentiated hESC colonies to be picked

from the tissue culture dishes. Seed enough 48-well plates with ∼0.75 × 106 (MEFsin 12 ml MEF medium, 250 μl/well) MEFs/plate, such that each hESC colony canbe transferred to an individual well.

These 48-well plates are designated the “Primary” plates.

Figure 5B.1.4 Photomicrographs of a hESC colony being transferred and expanded. (A) 25×magnification of a hESC colony sliced into a grid pattern prior to dislodgement and transfer to awell on a 48-well plate. (B) Transferred pieces from a single hESC colony grown for 7 days in awell on a 48-well plate.


5B.1.12


It is recommended that one person should not pick more than 150 hESC colonies at a timedue to the difficulty in maintaining and processing large numbers of colonies later in thePCR screening (Support Protocol 3). If the electroporation performed in Basic Protocol1 has been particularly successful, a pair of researchers can manage to pick, replicate,and process a larger number of antibiotic-resistant colonies.

Pick hESC colonies (day 0)2. Aspirate the MEF medium from the 48-well plates pre-seeded with MEFs, and

dispense 200 μl fresh hESC medium into each well.

3. Aspirate the hESC medium from the 60-mm dishes containing the hESC coloniesand supplement with 4 ml of fresh hESC medium.

4. Using a 26-G needle attached to a 1-ml syringe, cut a hESC colony in a grid motifto generate a minimum of 16 small pieces (Fig. 5B.1.4A). Detach the pieces fromthe dish by flicking them off with the needle, or with a 200-μl pipet tip attached to apipettor.

These procedures are performed under a zoom-focus stereomicroscope.

5. Using a 200-μl pipet, collect all the pieces and transfer them into a well on one ofthe “Primary” 48-well plates.

6. Discard the 26-G needle and 200-μl pipet tip after harvesting the hESC colony.

7. Repeat steps 4 to 6 to harvest the remaining hESC colonies on the tissue culturedishes.

Select well-spaced colonies to avoid cross-contamination of clones. Avoid picking coloniesthat are significantly smaller than the majority of the colonies. Smaller colonies can beleft to expand longer on the 60-mm plates and picked several days later when larger.

8. Replace the hESC medium in the wells daily with 200 μl of fresh medium per well.

Within 2 days of picking, the hESCs should be visible with the formation of multiplecolonies in each well.

Replicate the hESC-containing 48-well plates (days 5 to 7)9. Between 5 and 7 days after picking the hESC colonies, verify that the wells are

approaching confluence (Fig. 5B.1.4B). Prepare two sets of 48-well plates withMEFs (as described in step 1). Label one set of plates “DNA,” and the other set“Maintenance.”

10. The next day, replace the MEF medium on the multi-well plates labeled “DNA” and“Maintenance” with 100 μl of fresh hESC medium.

11. Replace the hESC medium on the 48-well plates labeled “Primary” with 300 μl ofhESC medium.

12. Using a plugged 200-μl pipet tip attached to a pipettor, scrape the bottom of a wellon a “Primary” plate in a criss-cross fashion until the hESC colonies have detached.Examine the well under a stereomicroscope to confirm that the hESC colonies havebroken into small cell clumps.

If the hESCs have not fragmented into small clumps, pipet the cells up and down to try tobreak up the colonies.

13. Transfer 100 μl of the well contents to a 48-well plate labeled “Maintenance,” andthe remaining 200 μl to the corresponding well on the plate labeled “DNA.” Expel airbubbles into the medium to assist in identifying wells that contain passaged hESCs.Discard the 200-μl pipet tip after use.


5B.1.13


Uneven distribution of the hESC clones between the 48-well plates allows the plateslabeled “DNA” to be processed and screened by PCR before the hESCs on the “Mainte-nance” plates have reached confluence and need to be passaged.

If the hESCs in the wells of the “Primary” plate are confluent, and if there are fewerthan 48 hESC clones to screen, it is often convenient to directly isolate DNA for PCRscreening at this stage without further expanding the cell numbers. Instead of seeding thecells into the wells of the “DNA” plate, transfer the hESC clones into individually labeledmicrocentrifuge tubes, and pellet the cells by centrifuging 3 min at 480 × g, 4◦C. Thegenomic DNA can be isolated using the method described in the Alternate Protocol.

14. Repeat steps 12 and 13 to transfer all remaining hESC colonies.

15. The next day, replace the medium on all plates with 200 μl of fresh hESC medium.Change the hESC medium daily.

16. Approximately 6 days after duplicating the hESC clones, the hESCs on the “DNA”-labeled plates will be confluent enough to isolate sufficient DNA for PCR screening(Fig. 5B.1.4B). Proceed to Support Protocol 2 for instructions on how to processthese plates.

17. While screening the hESCs to identify clones that contain the correct genetic modi-fication, continue to change the hESC medium daily on the “Maintenance” plates.

If the majority of hESC-containing wells on the “Maintenance” plates are more than 80%confluent, or the hESC colonies have begun to differentiate before the PCR screening iscomplete, the cells will need to be passaged. This is performed as described in steps 9 to14, but not in duplicate.

SUPPORTPROTOCOL 2

PREPARATION OF GENOMIC DNA FROM hESCs GROWING IN 48-WELLTISSUE CULTURE PLATES

To maximize the quantity of genomic DNA obtained from the genetically modified hESCclones, the cells can be let to overgrow and the plates should only be harvested whenthe majority of the clones are confluent. This protocol describes a simple, but effective,method of DNA extraction from hESCs growing in 48-well plates. This DNA is then usedin a PCR screen to identify hESC colonies that contain the correct genetic modification. Insome cases, the PCR screen is not sensitive enough to identify positive clones from DNAisolated using this method. Under these circumstances, the DNA should be extractedfrom the hESCs incorporating a phenol/chloroform extraction step as described in theAlternate Protocol.

Materials

48-well tissue culture plates labeled “DNA,” containing confluent hESC colonies(from Support Protocol 1, step 13)

Phosphate-buffered saline without CaCl2 and MgCl2 (CMF-PBS; Invitrogen)DNA lysis buffer containing 200 μg/ml proteinase K (see recipe)100% (v/v) and 70% (v/v) ethanolTris/EDTA buffer (TE buffer; see recipe)

Temperature-adjustable incubatorCentrifuge with multi-well plate spinner attachmentBlotting paperGilson pipettors (John Morris Scientific) or equivalent, with sterile (plugged) tips

1. Aspirate the medium from the plates assigned for DNA extraction and rinse the wellswith 200 μl CMF-PBS.


5B.1.14


2. Add 100 μl DNA lysis buffer containing 200 μg/ml proteinase K to each well andincubate 3 hr at 55◦C.

Approximately 5 ml of lysis buffer is required for each plate.

Alternatively, the plates can be incubated overnight at 37◦C.

3. Add 250 μl of 100% ethanol to each well and mix by gently tapping the plate.

Mix the solutions until a DNA precipitate is visible in each well.

4. Centrifuge the plates 15 min at 3000 × g for 15 min, room temperature, to pellet theDNA in the bottom of each well.

5. Decant the supernatant by carefully inverting the plate on blotting paper.

Take care to ensure that the DNA precipitates remain in the wells.

6. Add 250 μl of 70% ethanol to each well. Centrifuge the plates again 15 min at 3000× g, room temperature, to ensure the DNA is pelleted on the bottom of the wells.

This step removes residual salt from the DNA pellet.

7. Remove the 70% ethanol solution from each well. First, invert the plate on blottingpaper and then carefully remove any residual ethanol in each well using a 200-μlpipet with a plugged tip attached. Leave the DNA to air dry for no more than 10 minat room temperature.

Use a different 200-μl plugged tip for each well.

8. Resuspend the DNA in 100 μl of TE buffer and incubate for 3 to 4 hr at 55◦C todissolve the pellet.

The DNA can be stored for at least 3 months at 4◦C.

ALTERNATEPROTOCOL

ISOLATION OF GENOMIC DNA FROM hESCs USINGPHENOL/CHLOROFORM EXTRACTION

This protocol describes an alternative method of isolating genomic DNA from hESCsgrown in multi-well plates. A phenol/chloroform extraction is included to improve thequality of the genomic DNA. This approach should be considered if no hESC clonescontaining the desired genetic modification are identified when DNA is isolated usingthe techniques described in Support Protocol 2, or it is already known that the genomicfragment is difficult to amplify in the PCR screening strategy. This protocol can also beused to give high-quality DNA directly from cells on the primary plate if all the wellscontaining hESCs are confluent, and if there are fewer than 48 clones to screen, saving∼1 week of culturing time (as described in Support Protocol 1). If there are more than48 clones, it is difficult for one person to process all of the samples using this procedure.

Materials

48-well tissue culture plates containing confluent hESC colonies (Support Protocol1, step 13) or microcentrifuge tubes containing clumps of hESCs (SupportProtocol 1, step 13, annotation)

DNA lysis buffer containing 200 μg/ml proteinase K (see recipe)Phenol/chloroform/isoamyl alcohol (25:24:1) solution saturated with 10 mM

Tris·Cl, pH 8.0/1 mM EDTA70 %(v/v) and 100% (v/v) ethanolTrypsin/EDTA buffer (TE buffer; see recipe)

1.5-ml microcentrifuge tubesVortex mixerMicrocentrifuge55◦C incubator


5B.1.15


1. Aspirate the medium from the hESC clones growing on the 48-well plates labeled“DNA.”

If the hESCs are in microcentrifuge tubes (from Support Protocol 1), pellet the cells bycentrifuging 3 min at 480 × g, 4◦C, before removing the medium.

2. Add 100 μl DNA lysis buffer containing 200 μg/ml proteinase K to each clone andincubate for ∼3 hr at 55◦C.

Alternatively, incubate overnight at 37◦C.

3. Transfer the contents of each well to individual 1.5-ml microcentrifuge tubes.

Label the tubes such that the corresponding hESC clone can be identified on the “Main-tenance” multi-well plate. If the hESCs are already in microcentrifuge tubes, skip step 3and proceed to step 4.

4. Add an equal volume of phenol/chloroform/isoamyl alcohol solution to each tube,vortex to mix well, and then centrifuge the tubes 10 min at 10,000 × g, roomtemperature.

5. Carefully transfer the top layer containing the DNA to a new 1.5-ml microcentrifugetube containing 250 μl of 100% ethanol. Mix the solutions until the DNA precipitates.

6. Pellet the DNA by microcentrifuging 10 min at maximum speed, room temperature.

7. Carefully remove the supernatant and wash the DNA pellet with 250 μl of 70%ethanol. Ensure all ethanol is removed by leaving the DNA pellet to air dry for10 min.

8. Resuspend each sample in 50 μl TE buffer, and incubate for 3 to 4 hr at 55◦C toallow the DNA to dissolve.

9. Store the DNA samples for at least 6 months at 4◦C.

SUPPORTPROTOCOL 3

PCR IDENTIFICATION OF TARGETED hESC CLONES

To identify targeted hESC clones, a PCR screening strategy is employed. This techniqueenables a large number of clones to be screened rapidly. The PCR screen is designedto amplify a novel junction fragment created by the correct homologous recombinationevent. One primer should anneal to sequences located in either the positive selectioncassette or in the reporter gene (see Table 5B.1.1 for a list of recommended primers),while the second primer should prime from the target chromosomal sequences just beyondthe homologous sequences used in the targeting vector (Fig. 5B.1.5). This method is alsoutilized to identify hESC clones in which the positive selection cassette has been excisedfrom the genome (Basic Protocol 2), and to identify targeted lines following clonalisolation (Support Protocol 4).

The robustness of the PCR amplification is in part related to the distance between the twoprimers and the composition of the DNA sequence being amplified. It is recommendedthat the amplified product be between 2 and 4 kb in length, and not contain long GCstretches. The addition of DMSO to the reaction may also assist in the amplification.Sequences of a similar size can be amplified from the wild-type locus (for exampleusing primer ’b’ in Fig. 5B.1.5 and another primer binding to the wild-type locus ∼4 kbupstream) to assist in the optimization of the PCR reaction. The authors recommendusing Platinum Taq DNA Polymerase High Fidelity (Invitrogen), and have found thatthis enzyme mixture regularly amplifies 1- to 5-kb sequences from genomic DNA usingthe reaction mixture listed in Table 5B.1.2.


5B.1.16


Table 5B.1.1 Primers Known to Anneal to Fluorescent Marker Genes and Drug-Resistance Cassettes

Gene Sequences are 5′ to 3′ Annealingtemperature

Direction ofamplification

GFP GTGCTGCTGCCCGACAACCACTACCCGGTGAACAGCTCCTCGCCCTTGC

60◦C62◦C

FWD (5′ to 3′)REV (3′ to 5′)

RFP CACAACACCGTGAAGCTGAAGGTGACGTCACCTTCAGCTTCACGGTGTTGTG

65◦C65◦C

FWD (5′ to 3′)REV (3′ to 5′)

neo CGATGCCTGCTTGCCGAATATCATG 60◦C FWD (5′ to 3′)

hph CTCCGCATTGGTCTTGACCAACTC 60◦C FWD (5′ to 3′)

Cre Recombinase

exon 1 exon 2

reporter pos. select

pos. selectreporter

reporter

exon 2

exon 2

targeting vector

wild-type allele

targeted allele

a b

c b

Figure 5B.1.5 A schematic representation of homologous recombination between the targetingvector and the wild-type allele. The wild-type allele represents a typical target gene containing twoexons. The targeting vector contains sequences homologous to the genomic locus (orange linesand rectangles), as well as sequences encoding a reporter gene (green arrow), loxP sites (redtriangles), and a positive selection cassette (blue rectangle). Homologous recombination betweenthe wild-type allele and the targeting vector replaces a segment of exon 1 in the wild-type allele.A PCR assay is used to detect gene-targeted clones with primers (black arrows) corresponding tosequences within the positive selection cassette (a) and the endogenous wild-type allele (b). Onlycorrectly targeted alleles will yield a PCR product. Following expression of Cre recombinase in thecells, the positive selection cassette is removed from the targeted allele. The loss of the positiveselection cassette is confirmed by a second PCR using the same endogenous primer (b) and aprimer corresponding to sequences within the reporter gene (c).

If any correctly targeted hESC clones are identified from the PCR screen, these cell linesshould be maintained as colonies that are mechanically passaged, and stocks of eachline frozen in liquid nitrogen. Genetically manipulated hESCs that are kept and grownas colonies retain their stem cell characteristics and are indistinguishable in appearancefrom the parental lines (Costa et al., 2005; Davis et al., 2008a).

Materials

PCR master mix (see Table 5B.1.2) containing:Autoclaved, distilled water10× High Fidelity PCR Buffer (Invitrogen)10 mM dNTP mixture (Sigma)50 mM MgSO4


5B.1.17


Forward & Reverse Primers (see Table 5B.1.1)DMSOPlatinum Taq High Fidelity DNA polymerase (Invitrogen)

Genomic DNA from the hESC clones (Support Protocol 2 or the AlternateProtocol)

hESC medium (see recipe)Mitotically inactivated, irradiation-treated (UNIT 1C.3) mouse embryonic fibroblasts

(MEFs; Conner, 2000)MEF medium (see recipe)

0.2-ml nuclease-free PCR tubes1.5-ml nuclease-free microcentrifuge tubesGilson pipettors (John Morris Scientific) or equivalent, with sterile (plugged) tipsMicrocentrifugeDNA thermal cyclerGelatinized organ culture dishes

Additional reagents and equipment for analyzing the amplification products byagarose gel electrophoresis (Voytas, 2001) and maintaining and expandinghESCs by both mechanical and enzymatic passaging (UNIT 1C.1)

Set up and run the PCR1. Organize the PCR tubes in the same layout as the DNA samples, on ice.

2. Determine the total number of DNA samples to screen. Include in this total bothnegative and positive control samples, if available.

A possible negative control DNA sample is genomic DNA from nontransfected hESCs.Generally, a positive control DNA sample is not included. However, if a hESC line haspreviously been successfully targeted at that genomic locus, this can serve as a positivecontrol.

3. Make a PCR master mix in a 1.5-ml nuclease-free microcentrifuge tube, on ice. Asuggested cocktail is listed in Table 5B.1.2.

Optimal concentrations for the PCR master mix will depend on the primer pair used andthe DNA sequence being amplified, and must be determined empirically. This reagentassembly is best performed in a dedicated PCR preparation area using pipettors thathave not been used to aliquot template DNA.

4. Aliquot 18 μl of the master mix into each PCR tube.

Table 5B.1.2 PCR Master Mix

Component Amounta

dH2O (n + 1) × 12.9 μl

10× High Fidelity PCR buffer (n + 1) × 2 μl

50 mM MgSO4 (n + 1) × 1.2 μl

DMSO (n + 1) × 1 μl

10 mM dNTPs (n + 1) × 0.4 μl

250 ng μl−1 forward primer (n + 1) × 0.2 μl

250 ng μl−1 reverse primer (n + 1) × 0.2 μl

5 U μl−1 Platinum Taq High Fidelity DNA polymerase (n + 1) × 0.1 μl

Total (n + 1) × 18 μlan equals the total number of reactions to be performed, including the positive and negative controlsamples.


5B.1.18


5. To each PCR tube, add 2 μl of the appropriate genomic DNA sample.

The DNA solutions are usually between 50 and 200 ng μl−1 and, in the 48-well plates, areoften very viscous. These samples need to be mixed well with the pipet tip before removing2 μl. To assist in tracking the PCR tubes into which the DNA samples have been added,leave the pipet tips containing the template DNA in the tube until all DNA samples havebeen aliquoted. Use a different pipettor to aliquot the DNA samples from the one used toaliquot the PCR master mix reagents.

6. Seal and briefly microcentrifuge the tubes 30 sec at 100 × g, room temperature.

7. Place tubes inside a thermal cycler, and enter cycle conditions. Commonly usedamplification conditions are:

1 cycle: 3 min 94◦C (initialdenaturation)

30 to 40 cycles: 20 sec 94◦C (denaturation)30 sec 50◦ to 62◦C (annealing)1 min (per kb of sequencebeing amplified)

68◦C (extension)

1 cycle: 10 min 68◦C (final extension).

8. Visualize the PCR products by agarose gel electrophoresis (Voytas, 2001), andidentify the hESC clones that have the desired genetic modification.

If none of the hESC clones analyzed appear to be targeted, a second PCR should beperformed using primers to amplify a similar-sized fragment in the same genomic regionfrom the wild-type allele. A correct sized product obtained using this second set of primersindicates that it is unlikely that the absence of a PCR product from the screening PCR wasa consequence of poor DNA template quality or low DNA concentration. If the primersspecific to the wild-type allele fail to amplify the DNA fragment, further purification ofthe hESC DNA samples and/or optimization of the PCR protocol will be required priorto repeating the screening PCR.

Transfer the correctly targeted hESC clones onto organ culture dishes9. Leave the hESC clones with the correct genetic modification to expand on the

“Maintenance” 48-well plates, until the wells are ∼80% confluent (Fig. 5B.1.4B) orthe colonies are beginning to differentiate. Change the hESC medium on the wellsdaily.

Usually the hESC clones will be at this stage of growth by the time the PCR screening iscomplete.

10. One day before transferring the hESC clones, plate mitotically inactivated MEFsonto the center well of gelatinized organ culture dishes at a density of 6 × 104 percm2 in 1 ml of MEF medium.

Prepare enough organ culture dishes with MEFs, such that pieces from each targetedhESC clone can be plated onto two organ culture dishes.

11. On the day of transfer, replace the MEF medium on the organ culture dishes with1 ml of hESC medium.

12. Mechanically fragment a hESC clone to be moved using the same technique de-scribed in step 12 of Support Protocol 1, and distribute the pieces of the clone acrosstwo organ culture dishes.

13. Repeat the above step with all genetically modified hESC clones that are to betransferred to organ culture dishes.

Repeat the PCR screen on all positive clones that are identified to verify that the correctclone has been transferred from the maintenance plate.


5B.1.19


14. Maintain the reporter gene knock-in hESC lines as colonies that are mechanicallypassaged (UNIT 1C.1). Also expand the hESCs as a large-scale expansion by enzymaticpassaging (UNIT 1C.1) for deletion of the positive selection cassette from the targetedlines (Basic Protocol 2).

All targeted knock-in hESC lines generated at this stage should have stocks frozen in liquidnitrogen. A suggested method of cryopreservation is described elsewhere (Reubinoff et al.,2001).

BASICPROTOCOL 2

REMOVING THE POSITIVE SELECTION CASSETTE FROMGENETICALLY MODIFIED hESCs BY TRANSIENT EXPRESSION OF CreRECOMBINASE

Targeting vectors contain positive selection cassettes to facilitate the isolation of stablytransfected cells. Following the isolation and identification of targeted lines, selectioncassettes are removed because their continued presence may cause a number of undesir-able effects. In genetically modified mice, the retention of the positive selection cassettecan interfere with the expression of neighboring endogenous genes (Pham et al., 1996;Scacheri et al., 2001), while in reporter knock-in hESC lines it can result in the mis-expression of the reporter (either by silencing or activating expression of the reporter;R. Davis, A.G. Elefanty, and E.G. Stanley, unpub. observ.). The removal of the posi-tive selection cassette also offers the opportunity to subsequently retarget the remainingwild-type allele and to generate a homozygous knockout hESC line using the originaltargeting vector and drug selection strategy.

If the positive selection cassette is flanked by loxP sites, expression of Cre recombinasein the genetically modified cells catalyzes the excision of the DNA sequence betweenthe loxP sites (Sauer, 1993). This protocol describes a method for the transient transfec-tion of a circular pEFBOS-creIRESpuro vector into hESCs using the lipofection reagentFuGENE 6 (Roche), and is an alternative to the transduction of a recombinant-modifiedCre recombinase protein into the cells (Nolden et al., 2006). The transfected cells con-stitutively express both Cre recombinase and puromycin N-acetyltransferase and areselected for by the addition of the antibiotic puromycin to the hESC medium for 48 hr.This short selection period enriches for cells that have been transiently transfected withthe pEFBOS-creIRESpuro vector and also allows sufficient time for Cre-mediated dele-tion of the antibiotic-resistance cassette to occur. Approximately 12 days after selection,the hESC colonies that have formed can be picked and expanded as described in SupportProtocol 1. DNA is then extracted (Support Protocol 2) and the loss of the positiveselection cassette is confirmed by PCR (Support Protocol 3).

Materials

Gene-targeted hESCs containing a loxP-flanked positive selection cassette ingelatinized 75-cm2 tissue culture flasks between enzymatic passages 5 and10 co-cultured with MEFs pre-seeded at a density of 1.5 × 106/75-cm2 flask

Phosphate-buffered saline without CaCl2 and MgCl2 (CMF-PBS; Invitrogen)Trypsin (see recipe) or TrypLE Select cell dissociation enzyme (Invitrogen)hESC medium (see recipe)60-mm gelatinized tissue culture dishes (see recipe) seeded with 3 × 104/cm2

mitotically inactivated MEFsMitotically inactivated, irradiation-treated (UNIT 1C.3) mouse embryonic fibroblasts

(MEFs; Conner, 2000)FuGENE 6 Transfection Reagent (Roche)DMEM/F12 (Invitrogen)pEFBOS-CreIRESpuro expression vector (GenBank accession number EU693012;

available on request from the authors’ laboratory; e-mail request [email protected] or [email protected])


5B.1.20


Puromycin solution (Sigma), 10 mg/ml

Gilson pipettors (John Morris Scientific) or equivalent, with sterile (plugged) tips37◦C incubator15- and 50-ml sterile centrifuge tubesRefrigerated centrifuge1.5-ml microcentrifuge tubes

Additional reagents and equipment for performing a cell count (Phelan, 2006;UNIT 1C.3), transferring colonies to 48-well tissue culture plates (SupportProtocol 1), extracting DNA from colonies (Support Protocol 2), and screeningextracted DNA by PCR (Support Protocol 3)

Seed feeders onto 60-mm dishes (day −2)1. Supplement five 60-mm dishes with 2 ml gelatin to ensure that the gelatin coats the

surface.

2. Allow to stand for 30 min at room temperature.

3. Aspirate gelatin and seed 6 × 105 feeders/dish in 4 ml MEF medium.

4. Store in a humidified incubator at 37◦C, 5% CO2 until required.

Enzymatically passage genetically modified hESCs (day −1)5. Harvest the genetically modified hESCs cultured in a 75-cm2 flask. Aspirate the

hESC medium and rinse the flask with 5 ml CMF-PBS. Add 2 ml of trypsin orTrypLE Select to the flask and ensure that the dissociation solution coats the surfaceof the cells. Place the flask 4 hr at 37◦C for 4 min and dislodge the hESCs from theflask with gentle tapping.

6. Add 8 ml of hESC medium to the flask and transfer the resuspended hESCs to a15-ml centrifuge tube.

7. Pellet the cells by centrifuging the tube 3 min at 480 × g, 4◦C, and remove thesupernatant.

8. Resuspend the hESC pellet in 5 ml of fresh hESC medium and perform a cell count(Phelan, 2006; UNIT 1C.3). Subtract the number of MEFs (∼0.75 × 106) from thecount to determine the total number of hESCs.

Generally, a semi-confluent 75-cm2 flask will contain ∼4 × 106 hESCs, which is enoughcells to seed five 60 mm-dishes with ∼0.8 × 106 hESCs per dish.

9. Transfer 4 × 106 hESCs to a 50-ml centrifuge tube. Add additional hESC mediumso that the cells are resuspended in a total volume of 20 ml.

10. Distribute 4 ml of the hESC suspension into each of the five 60-mm dishes seededthe day before (steps 1 to 4) with MEFs at a density of 3 × 104 cells/cm2.

11. Return the dishes to a humidified incubator at 37◦C, 5% CO2, and leave the hESCsto attach overnight.

Transfect the Cre recombinase expression vector into the hESCs (day 0)12. Approximately 2 hr before performing the transfection, aspirate the medium on the

60-mm dishes and supplement the cells with 4 ml fresh hESC medium.

The dishes should be no more than 70% confluent with hESCs. If the cells are overconflu-ent, the hESCs may not transfect optimally with FuGENE. In addition, we have observeda reduction in efficacy of puromycin in eliminating untransfected hESCs if the hESCs areoverconfluent at the time of antibiotic selection.


5B.1.21


13. Add 30 μl of FuGENE 6 Transfection Reagent directly to 470 μl DMEM/F12 in asterile 1.5-ml microcentrifuge tube. Mix by flicking the microcentrifuge tube andincubate the complex for 5 min at room temperature

The manufacturer advises that the undiluted FuGENE 6 Transfection Reagent should notcome into contact with the walls of the microcentrifuge tube, as this can adversely affectthe transfection efficiency.

14. Transfer 100 μl of the FuGENE 6/DMEM/F12 mixture into another microcentrifugetube labeled “negative control.”

This solution is applied to the fifth 60-mm dish that serves as a negative control.

15. Pipet 4 μl of a 1 μg/μl stock solution of pEFBOS-creIRESpuro plasmid DNA intothe 400 μl FuGENE 6/DMEM/F12 mixture. Tap the microcentrifuge tube to mix thecontents and leave at room temperature for a further 40 min. Incubate the 100 μlnegative control centrifuge tube for the same period of time.

The pEFBOS-creIRESpuro plasmid preparation must be pure and endotoxin-free.Transfection-grade plasmid preparation can be isolated using the Qiagen plasmid purifi-cation kits.

16. Into four of the hESC-containing 60-mm dishes, add 100 μl of the FuGENE/DNAcomplex mixture dropwise. Add the negative control into the fifth 60-mm dish. Swirlthe dishes to ensure distribution over the entire surface, label all dishes appropriately,and return to the incubator.

A negative control dish of hESCs for the FuGENE transfection is a good indicator of thekinetics and completeness of cell death in response to puromycin.

Select transiently transfected hESCs (day 1)17. Supplement 50 ml of hESC medium with puromycin to a final concentration of

2 μg/ml.

The optimal concentration of puromycin for selection may vary for different hESC lines.A titration should be performed to determine the minimum concentration required toeliminate untransfected hESCs within 48 hr of addition.

For 2 days of selection, 50 ml of hESC medium containing puromycin should be sufficientstock. Discard any unused stock after 2 days.

18. Apply 5 ml of the selection medium to each of the five 60-mm dishes between 24 to36 hr after FuGENE transfection.

The hESCs should be ∼90% confluent.

19. Maintain puromycin selection for 48 hr and change the medium daily.

Frequent medium changes are necessary during selection to remove the dead cells. After48 hr, all the hESCs in the control dish should have died. If the dish still contains viablehESCs, either the concentration of puromycin was not sufficient to eliminate untransfectedhESCs, or the dishes were too confluent with hESCs when selection was started.

20. Following puromycin selection, return to culturing the cells in hESC medium thatdoes not contain puromycin.

If the MEFs preseeded on the 60-mm dishes are puromycin-sensitive, they will need tobe replaced once puromycin selection is stopped. Supplement each dish with ∼0.6 ×106 MEFs resuspended in hESC medium. If the MEFs are puromycin-resistant, onlysupplement with additional MEFs when gaps in the MEF layer appears. Try to maintaina MEF density of ∼2 × 104 viable MEFs/cm2 on the dishes.

21. Allow the colonies to grow for ∼12 days, changing the hESC medium daily.


5B.1.22


22. Once the colonies are ∼2-mm in diameter, transfer a minimum of 24 undifferentiatedcolonies to a 48-well tissue culture plate as described in Support Protocol 1 (steps 2to 8).

23. Then extract DNA from these colonies (Support Protocol 2) and screen it by PCR(Support Protocol 3) to confirm that the positive selection cassette has been removedfrom the hESCs.

This is achieved by choosing a 5′ primer that anneals to sequences within the reportergene, and a 3′ primer to sequences 3′ of the antibiotic-selection cassette (Fig. 5B.1.5).A genomic DNA sample from targeted hESCs that still contain the selection cassette canbe included in the screen to visualize the difference in size between PCR products stillcontaining the positive selection cassette and those in which the cassette has been excised.Additional PCR screens using primers specific to the Cre recombinase expression vectorto verify that the plasmid did not integrate into the genome of the resulting colonies, anda PCR using primers specific to the antibiotic-resistance cassette to exclude the presenceof residual unexcised cells, should be performed. The sensitivity of the hESCs to geneticinand puromycin can also be confirmed later by re-exposing an aliquot of the cells to theselection agents.

Two or three of these reporter knock-in hESC clones that have had the positive selectioncassette removed should be returned to organ culture dishes for maintenance and expan-sion. These lines should also be cloned as described in Support Protocol 4 to ensure thatthe targeted hESC lines used in future applications contain a targeted locus in which theantibiotic selection cassette has been excised.

SUPPORTPROTOCOL 4

CLONAL ISOLATION OF hESCs BY SINGLE-CELL DEPOSITION FLOWCYTOMETRY

The procedures for generating a targeted hESC line and removing the positive selectioncassette support the clonal growth of hESCs. However, they do not necessarily excludethe possibility that the resulting hESC colonies arose from more than one cell. Thisprotocol uses flow cytometry to derive single-cell clones from the existing parentalhESC lines. Despite the low cloning efficiency of hESCs reported in the literature (Sidhuand Tuch, 2006), we routinely achieve a single-cell cloning frequency of 4% to 8% usinghESCs adapted to enzymatic passage as we have described in UNIT 1C.1. Viable hESCsare selected by size gating and exclusion of the dye, propidium iodide (PI), and singlecells are deposited directly into individual wells of 96-well plates using a flow cytometer.Correct gene targeting and absence of the positive selection cassette is confirmed inthe resulting clones by PCR. It is possible to merge this protocol with the procedureto remove the positive selection cassette (Basic Protocol 2), reducing the time requiredto generate the final targeted hESC line. A description of this integrated procedure isprovided elsewhere (Davis et al., 2008b).

Subcloning ensures that the resulting targeted hESC lines consist of cell populationswith identical genetic constitutions. This method is also a useful approach for ensur-ing a homogeneous diploid cell population, and selecting hESC lines with a uniform,undifferentiated morphology.

Materials

0.1% (w/v) gelatin solution (see recipe)Mitotically inactivated, irradiation-treated (UNIT 1C.3) mouse embryonic fibroblasts

(MEFs; Conner, 2000)MEF medium (see recipe)Genetically modified hESCs generated from Basic Protocol 2 in 75-cm2 tissue

culture flasks between enzymatic passages 5 and 10


5B.1.23


75-cm2 gelatinized tissue culture flasks (see recipe) seeded with mitoticallyinactivated MEFs at 1 × 104/cm2 for passaging hESCs prior to cloning

hESC medium (see recipe)Recombinant human FGF2 (see recipe)Phosphate-buffered saline without CaCl2 and MgCl2 (CMF-PBS; Invitrogen)Trypsin (see recipe) or TrypLE Select cell dissociation enzyme (Invitrogen)Propidium iodide (PI) solution (see recipe)Flat-bottomed 48-well tissue culture plates, gelatinized and seeded with mitotically

inactivated MEFs at 0.75 × 106/plateLiquid nitrogen

96-well flat-bottom tissue culture-treated plates and lids37◦C, 5% CO2 incubator15-ml sterile centrifuge tubesRefrigerated centrifuge5-ml sterile round-bottom polystyrene FACS tubes (12 × 75–mm) with 35-μm

cell-strainer caps and with snap lids (Falcon)Parafilm M (Pechiney Plastic Packaging) or equivalentFlow cytometer with single-cell deposition function, e.g., FACSVantageSE-DiVa

system (Becton Dickinson) or equivalentInverted microscopeGilson pipettors (John Morris Scientific) or equivalent, with sterile (plugged) tipsStereomicroscope

Additional reagents and equipment for propagating hESCs in bulk culture(UNIT 1D.3), extracting DNA from colonies (Support Protocol 2), screeningextracted DNA by PCR (Support Protocol 3), maintaining and expanding thegenetically modified lines (UNIT 1C.1), and for cryopreserving hESCs (Reubinoffet al., 2001)

Feeder reduce the hESCs to be subcloned and prepare the 96-well plates (day −1)1. Add ∼50 μl of 0.1% gelatin solution to each well on ten 96-well plates. Leave the

plates at room temperature for 15 min.

2. Aspirate the gelatin solution from the wells.

3. Resuspend MEFs in MEF medium such that the final concentration is 2 × 105

MEFs/ml. Aliquot 50 μl of the MEF-containing medium into each well.

The final density of MEFs is ∼1 × 104 MEFs/well.

4. Passage hESCs for subcloning into a 75-cm2 flask containing MEFs seeded at adensity of 1 × 104/cm2 (UNITS 1C.1 & 1D.3).

Harvest the hESCs as described in steps 1 to 3 of Basic Protocol 2. Resuspend the pelletedhESCs in hESC medium and transfer three-quarters of the cell suspension to the 75-cm2

flask. To maintain the hESC line, the remaining cells can be plated into another tissueculture flask containing MEFs at the normal density (2 × 104 MEFs/cm2).

The passaging of the hESCs onto low-density MEFs increases the hESC:MEF ratio,improving the number of hESC subclones obtained following single-cell deposition.

5. Incubate both the 96-well plates and the flasks containing the passaged hESCs in ahumidified incubator at 37◦C, 5% CO2 overnight.

Subcloning of the gene-targeted hESC line (day 0)6. Supplement 300 ml of hESC medium with additional FGF2 so that the final concen-

tration of FGF2 is 40 ng/ml.


5B.1.24


The higher concentration of FGF2 supports the growth and expansion of the hESCs,and also suppresses the spontaneous differentiation that can occur during the earlyestablishment of the single-cell clones.

7. Aspirate the MEF medium from the wells of the multi-well plates, and aliquot 100 μlof hESC medium containing 40 ng/ml FGF2 into each well. Return the plates to theincubator until required for use with the flow cytometer.

Harvest hESCs8. Harvest the hESCs to be subcloned. Briefly, remove the medium from the 75-cm2

flask, rinse the cells with 5 ml CMF-PBS, add 3 ml of the dissociating agent (eitherTrypLE Select or trypsin) and return the flask to the 37◦C incubator for 4 to 5 min.

9. Gently tap the base of the flask to dislodge the hESCs and add 10 ml hESC medium(without the additional FGF2) to the flask. Mix and transfer this cell suspension to a15-ml centrifuge tube.

10. Pellet the cells by centrifuging the tube for 3 min at 480 × g, 4◦C.

11. Remove the supernatant and resuspend the hESCs in 1 ml of hESC medium (withoutthe additional FGF2).

12. Filter the hESCs by passing the cell suspension through a 35-μm cell-strainer capattached to a sterile FACS tube. To help the dissociated hESCs pass through the cellstrainer, cover the caps with a small square of Parafilm and centrifuge the tube for 3min at 480 × g, 4◦C, to pellet the cells.

This step removes cell clumps and cellular debris and ensures that the hESCs form asingle-cell suspension. Covering the caps the Parafilm helps to keep the cells sterile.

13. Return the tube to the tissue culture hood and discard the Parafilm and cell strainercap.

14. Carefully aspirate the supernatant and resuspend the hESCs in 1.5 ml of hESCmedium supplemented with 40 ng/ml FGF2. To this mixture, also add 15 μl of100 μg/ml propidium iodide (PI) solution. Flick the tube to mix.

15. Recap the FACS tube with a sterile FACS tube cap and store at 4◦C or on ice untilrequired.

Sealing the FACS tube prevents desiccation and keeps the cell suspension sterile.

16. Identify the viable hESCs by size gating and exclusion of PI on a flow cytometerwhose lines have been sterilized. Deposit single cells directly into each well of theten 96-well plates.

Although not routinely used in our laboratory, the cloning efficiency of the hESCs can befurther improved by treating the cells with the Rho-associated kinase inhibitor (ROCKi),Y-27632 (Watanabe et al., 2007). We have had success by adding the inhibitor at 2 μMto the hESC medium in the 96-well plates at the time of sorting.

17. Return the plates to a humidified incubator at 37◦C, 5% CO2.

18. Four days after seeding the plates with hESCs, supplement the medium in each wellwith an additional 50 μl of hESC medium containing 40 ng/ml FGF2.

We do not advocate the continued inclusion of ROCKi in the culture medium.

Identify wells containing hESC colonies (day 8)19. Use an inverted microscope to identify wells containing viable hESC colonies.

Carefully aspirate the medium from these wells and replace with 100 μl of hESC


5B.1.25


medium containing 40 ng/ml FGF2, as well as fresh MEFs at a concentration of 3 ×104 MEFs/ml.

20. Allow the colonies to continue growing. Replace the hESC medium on the wellscontaining viable hESC colonies daily.

When the colonies are ∼2-mm in diameter, the hESCs can be transferred to and expandedon 48-well tissue culture plates as described in step 21. However, if the colonies begin todifferentiate before they reach that size, they should be transferred sooner.

Transfer the hESC colonies onto 48-well plates (between days 16 to 18)21. Determine the total number of viable hESC colonies on the 96-well plates. On

the day before moving the colonies, seed enough 48-well plates with ∼0.75 × 106

MEFs/gelatinized plate (∼2 × 104/cm2) so that each hESC colony can be transferredto an individual well. Incubate the 48-well plates overnight at 37◦C, 5% CO2 to allowthe MEFs to attach.

Generally, we observe between 40 to 80 colonies spread over the ten 96-well plates.

22. Replace the medium on the 48-well plates with 200 μl of hESC medium supple-mented with 10 ng/ml FGF2 per well.

The concentration of FGF2 in the hESC medium can be returned to 10 ng/ml from thisstage onwards.

23. Fragment a hESC colony into multiple small cell clumps with a 200-μl plugged tipattached to a pipettor. Transfer these pieces into a well on one of the 48-well plates.

This can be performed macroscopically and the well on the 96-well plate checked after-wards under a stereomicroscope to confirm that the entire hESC colony detached and wastransferred.

24. Discard the pipet tip after harvesting each colony.

25. Repeat steps 23 and 24 to transfer the remaining hESC colonies growing on the96-well plates.

The 96-well plates can be discarded once all the viable hESC colonies have been trans-ferred.

Maintain and expand the clones26. Maintain replicate and expand the hESC colonies as described in steps 8 to 17 in

Support Protocol 1.

27. Extract DNA from these colonies (Support Protocol 2) and perform a PCR screen(Support Protocol 3) to confirm the subclones are correctly targeted, have the positiveselection cassette excised from the genome, and did not integrate Cre recombinaseinto the genome (Basic Protocol 2, step 21, annotation). Discard any subclones thatare negative for this screen.

28. From the remaining subclones, choose two or three that are growing well and appearundifferentiated in culture, and return these colonies to organ culture dishes.

29. Maintain and expand these genetically modified lines using the protocols describedin UNIT 1C.1.

30. Confirm that these subclones have maintained a stem cell phenotype and a normalkaryotype.

31. Cryopreserve stocks of these lines (Reubinoff et al., 2001).


5B.1.26



APPENDIX.

DNA lysis buffer

100 mM Tris·Cl, pH 8.0200 mM NaCl5 mM EDTA, pH 8.0Add 0.2% (w/v) SDS powder (Sigma) lastAt time of use, dispense the required volume and add 200 μg/ml proteinase K

(see recipe) to the solutionStore the solution without proteinase K at room temperature indefinitely

Gelatin, 0.1% (w/v)

Add 0.5 g of gelatin powder (from porcine skin; Sigma) to 500 ml distilled waterand autoclave to dissolve and sterilize. Store up to 6 months at room temperature.

Gelatinization of plates and flasks

Prior to addition of MEFs, add enough 0.1% (w/v) gelatin solution (see recipe) tocover the base of all plates/flasks. Let stand for 10 min at 37◦C to coat the surfaceand remove by aspiration immediately prior to addition of MEFs.

hESC medium

DMEM/F12 (Invitrogen) containing:20% (v/v) Knockout Serum Replacement (Invitrogen)10 mM non-essential amino acids (Invitrogen)2 mM L-glutamine or GlutaMaxI (Invitrogen)1× penicillin/streptomycin (200× stock; Invitrogen)100 μM 2-mercaptoethanol10 ng/ml FGF2 (see recipe)Filter sterilize using a 0.22-μm Stericup filtration unit (Millipore)Store up to 1 week at 4◦C

MEF medium

DMEM (4.5 g/liter glucose, without L-glutamine and sodium pyruvate; Invitrogen)containing:

10% (v/v) heat-inactivated fetal bovine serum (FBS)2 mM L-glutamine (Invitrogen)1× penicillin/streptomycin (200× stock; Invitrogen)Filter sterilize and store up to 4 weeks at 4◦C

Propidium iodide (PI)

Dissolve PI (Sigma) in CMF-PBS to a final stock concentration of 100 μg/ml (100×stock). Filter sterilize and store for at least 12 months at 4◦C.

Proteinase K

Dissolve proteinase K powder (Sigma) in H2O to a final stock concentration of20 μg/μl (20 mg/ml; 100×). Dispense into 1-ml aliquots and store for at least12 months at –20◦C.

Recombinant human basic fibroblast growth factor (FGF2)

Reconstitute lyophilized rhFGF2 (PeproTech) to a final stock concentration of10 μg/ml in CMF-PBS. Store up to 6 months at –80◦C.


5B.1.27


Soybean trypsin inhibitor

Dissolve the soybean trypsin inhibitor stock powder (Sigma) in CMF-PBS to a finalconcentration of 1 mg/ml. Filter sterilize and dispense into 5- or 10-ml aliquots andstore up to 12 months at −20◦C.

Once thawed, the solution can be stored for 1 to 2 weeks at 4◦C.

Tris/EDTA (TE) buffer, pH 8.0

10 mM Tris·Cl, pH 8.01 mM EDTA, pH 8.0Store the solution at room temperature indefinitely

Trypsin, 0.125% (w/v)

Supplement Trypsin/EDTA [0.25% (w/v) trypsin EDTA.4Na, Invitrogen] with 2%(v/v) chicken serum (Hunter antisera). Decant into 5-ml aliquots and store up to12 months at −20◦C. To use, thaw an aliquot and add an equal volume of CMF-PBS.

Once thawed, the solution can be stored up to 4 weeks at 4◦C.

COMMENTARY

Background informationHuman embryonic stem cells are de-

rived from the inner cell mass of thepre-implantation blastocyst stage embryo(Thomson et al., 1998; Reubinoff et al., 2000).These cells exhibit two key characteristics.Firstly, they can be maintained and expandedin vitro for extended periods of time as undif-ferentiated cells while preserving their origi-nal karyotype. Secondly, they are pluripotent,and therefore have the capacity to differentiateinto various cell types representing the threegerm layers, both in vivo and in vitro (Amitet al., 2000). The ability to transform hESCsinto multiple lineages in culture provides op-portunities to examine human embryonic de-velopment in vitro, generate specific cells andtissues for therapies or drug screening, andidentify chemical compounds that influence aspecific developmental process.

The identification of a cohort of lineage-specific markers assists in the directed differ-entiation of hESCs towards specific cell types.When appropriate antibodies for specific cell-surface markers are available, fluorescence-activated cell sorting (FACS) may be used topurify viable hESC derivatives. Where anti-bodies for suitable cell surface markers areunavailable, or the lineage-specific markersare intracellular, reporter genes can be targetedto loci whose expression marks critical devel-opmental milestones, facilitating the isolationof viable cell populations that would other-wise be inaccessible. These purified subpop-ulations can then be further differentiated orexpanded in vitro, or transplanted and tracked

in vivo. These approaches have contributedsignificantly to our understanding of lineagespecification in differentiating mouse ESCs(Fehling et al., 2003; Ying et al., 2003; Nget al., 2005; Micallef et al., 2005, 2007; Gadueet al., 2006).

Until recently, similar strategies have beenunachievable with hESCs, partly due to sub-optimal culturing conditions leading to poortransfection and single-cell cloning efficien-cies. However, several studies have now de-scribed the introduction of selectable markersinto hESCs using a variety of different ap-proaches (Giudice and Trounson, 2008, andreferences therein). These include using vec-tors or viruses to randomly integrate reportergenes regulated by lineage-specific promoterfragments into hESCs. While these methodscan introduce new genetic material into thegenome at relatively high frequencies, thereare several caveats associated with random in-tegration, the foremost being that expressionof the reporter may not faithfully reflect ex-pression of the endogenous gene. Other con-cerns include the possibility of disrupting nor-mal gene functions, and that elements otherthan the promoter fragments included in theconstruct may be required for accurate ex-pression of the reporter. Furthermore, unlikemouse ESC lines, in which transgenic lines canbe validated by examining reporter gene ex-pression patterns in chimeric mice, validationof analogous hESC lines relies on examina-tion of reporter expression in vitro or the morelimited in vivo setting afforded by xenogenictransplants.


5B.1.28


Gene targeting utilizes the cellular DNA re-pair machinery to integrate transgenes, such asreporter genes, by homologous recombinationinto a specific site in the genome. The reportergene is regulated in the same manner as the en-dogenous gene from the remaining wild-typeallele and is thus expressed at the same timeand in the same cells. Therefore, although ho-mologous recombination is technically chal-lenging, it produces expression patterns thatmore accurately reflect native gene expressionand is preferable to random integration for theproduction of reporter cell lines.

While electroporation is the chosen methodfor gene targeting in mouse ESCs, initially itwas considered that this technique was un-likely to be successful in hESCs due to theresulting high mortality (Eiges et al., 2001).Modifications to both the culturing of hESCsand to the standard mouse ESC electropora-tion protocol have formed the basis of a suc-cessful targeting method (Costa et al., 2007).While it is possible to obtain homologous re-combinants in hESCs using cationic reagents,this occurs at a very low frequency (10−8;Urbach et al., 2004). Using the electroporationprocedure described in this unit, the stabletransfection frequency is consistently between2 × 10−6 and 5 × 10−5 (i.e., 20 to 500 coloniesper 107 transfected cells), of which 1.3% to14.6% of the stable transfectants are correctlytargeted, depending on the locus and the spe-cific hESC line (Costa et al., 2007). Whilethe stable transfection frequency in hESCs isaround 100-fold lower than what is usuallyobserved in mESCs (Vasquez et al., 2001),the frequency of homologous recombinationwithin stable transfectants appears compara-ble between the two species.

During the differentiation of hESCs, a panelof markers are generally used to screen andidentify lineage-specific cell types. Engineer-ing dual or multiple reporter knock-in hESClines would enable the identification of poolsof cells that share common markers and im-prove our understanding of the molecular andcellular mechanisms that govern lineage spec-ification. Results from these lines of analysescan subsequently be utilized to differentiateunmodified hESC lines to cell types with po-tential clinical applications.


Gene targeting strategyThe generation of reporter knock-in hESC

lines is a challenging task, as illustrated by the

limited number of reports describing success-ful gene targeting in hESCs. In our laboratory,we aim to generate several independent gene-targeted clones in more than one hESC linein order to demonstrate the generalizability ofthe experimental findings.

The planning of the gene targeting strat-egy should consider both vector design andthe processes involved in the characterizationand validation of the newly formed line. TheStrategic Planning section contains guidelinesregarding the structure of the targeting vec-tor. One parameter that appears to influencethe frequency of homologous recombinationin hESCs is the length of the homology arms(Zwaka and Thomson, 2003). Having at leastone homology arm >6 kb improves the tar-geting frequency (Zwaka and Thomson, 2003;A.G. Elefanty and E.S. Stanley, unpub. ob-serv.). However, the origin of the homologyarms does not appear to significantly influ-ence the targeting frequency between differ-ent hESC lines (Costa et al., 2007). The re-duced requirement for the homology arms tobe derived from isogenic DNA may reflectthe lower frequency of polymorphisms that wehave observed between different human DNAisolates compared to DNA from different in-bred mouse strains (R. Davis, A.G. Elefanty,and E.G. Stanley, unpub. observ.). Therefore,we find that commercially available bacterialartificial chromosome DNA is a convenientsource of genomic DNA.

Similar to mouse ESCs, the frequency ofhomologous recombination in hESCs also ap-pears to be locus dependent (Hasty et al., 1994;Costa et al., 2007). If homologous recombina-tion is not obtained after the initial electropo-ration, the experiment should be repeated untilat least 500 stably transfected clones have beenscreened. If targeting is still unsuccessful, wehave achieved success by altering the lengthof the homology arms. Another alternative isto target a different region of the gene. If thegeneration of a targeted line in which the lossof one allele is anticipated to result in hap-lotype insufficiency, targeting the 3′ untrans-lated region of the gene with a vector includingan Internal Ribosomal Entry Site (IRES) up-stream of the reporter coding sequences maycircumvent such a problem.

A fluorescent reporter marker, usually agreen fluorescent (GFP) or red fluorescent(RFP) protein, is the typical reporter geneused to generate a reporter knock-in hESCline (Zwaka and Thomson, 2003; Irion et al.,2007; Davis et al., 2008a). The fluorescent pro-tein provides an easy visual identifier of cells


5B.1.29


corresponding to the desired population, aswell as enabling the quick assessment of howthe differentiating cells respond to differentstimuli. In hESCs, the expression of GFP canpersist beyond the timeframe that the lineage-specific marker is detected, making it alsouseful for lineage tracing experiments (Daviset al., 2008a). In instances where this functionis not desirable, another reporter such as non-functional versions of cell surface receptors(e.g., CD4 or CD25) could be used, as has beendone in mESCs (Yasunaga et al., 2005; Gadueet al., 2006). While cells expressing surfacemarkers cannot be readily visualized, antibod-ies are available that enable the detection andisolation of these cells by immunofluorescenceor flow cytometry. Alternatively, if direct vi-sualization of the reporter knock-in cells is arequirement, then an unstable form of GFP thathas a significantly reduced half-life could beutilized (Corish and Tyler-Smith, 1999). How-ever, the cumulative fluorescence from such aGFP may also be reduced, making direct visu-alization of expressing cells difficult.

Culturing of hESCsA homogeneous population of undifferen-

tiated hESCs is required for these protocols.Most culturing systems consist of hESCsgrown on mitotically inactivated MEFs, whichprovide some of the necessary factors forthe maintenance and survival of hESCs invitro. The quality of the mitotically inactivatedMEFs can therefore significantly affect thehESCs culture. The hESCs should be routinelyanalyzed by flow cytometry for the expressionof a panel of stem cell markers. Experiencein passaging and maintaining undifferentiatedhESCs in bulk culture is recommended beforeembarking on the protocols described in thisunit.

It is vital that the hESCs are adapted toenzymatic passaging as single cells beforebeing transfected or cloned. Care should al-ways be taken when enzymatically harvest-ing the hESCs. The dissociation treatmentshould last only as long as necessary to dis-lodge the cells from the tissue culture plasticware. The clumps can then be gently broken upby trituration into a suspension of (predomi-nantly) single cells. Prolonged enzymatic pas-saging of hESCs can select for cells adaptedto this culturing technique and even result inthe acquisition of chromosomal aberrationsthat offer a selective advantage (Draper et al.,2004). When generating genetically modifiedlines, the parental cell lines should be enzy-

matically passaged no more than 10 timesbefore use.

The hESCs are always passaged the dayprior to an application so that the followingday the cultures are semi-confluent and there-fore actively proliferating before being uti-lized. The cells are also supplemented withfresh medium a few hours before transfectingor cloning the cells.

Following the generation or cloning ofgene-targeted hESC lines, the cells should bereturned to organ culture dishes and main-tained as dense colonies that are mechanicallypassaged once a week. Re-entering the organculture phase reduces the chance of obtainingchromosomally abnormal lines. Stocks of thelines should also be frozen in liquid nitrogen.

Electroporation of the targeting constructand selection of stably transfected hESCs

Viable hESC colonies should emerge in cul-ture within 2 days following electroporation(Fig. 5B.1.3B). Very high mortality levels ob-served following electroporation might be aconsequence of excessive or rough handling ofthe cells throughout the protocol. Also, ensurethe hESCs are resuspended in ice-cold PBSprior to electroporation and later transferred toprewarmed hESC medium (37◦C). The elec-troporated cells should be washed with hESCmedium before plating to remove any cellulardebris that might be detrimental to the surviv-ing hESCs. We believe that these steps im-prove the recovery level of the hESCs fol-lowing electroporation. High concentrationsof plasmid DNA can also adversely affecthESC viability and using a reduced quantityof DNA can lower mortality during electropo-ration, particularly if the cell count is below1 × 107. An endotoxin-free plasmid purifi-cation kit should be used when preparing theplasmid DNA.

Rapid differentiation of the hESCs afterelectroporation suggests that the culture con-ditions may have been suboptimal or the elec-troporation parameters were too harsh. Underthese circumstances, often the cells cannot berescued and it is best to discard the cells andre-commence the electroporation procedure.To minimize the risk of differentiation in fu-ture transfections, the MEF density on thedishes and/or the concentration of FGF2 inthe hESC medium could be increased. In ad-dition, the hESC medium should be changedmore frequently, and the dishes supplementedwith MEFs earlier on during the drug selectionperiod.


5B.1.30


Following selection, drug-resistantcolonies should be visible within 1 week. Ifno colonies have formed, then the positiveselection cassette in the targeting constructmay be nonfunctional. Prior to electropora-tion, the expression of the positive selectioncassette should be confirmed in another celltype, such as the human embryonic kidney(HEK) 293T line. Another possibility forthe absence of hESC colonies is a failure ofthe electroporation procedure to transfect thevector into the cells. An abnormally shorttime constant (e.g., <10 msec when cellsare transfected at 250 V and 500 μF) and/orabsence of a flocculent precipitate of deadcells immediately after the electroporationcan indicate this. A parallel electroporationinto the same hESC line using a vector(such as pEFBOS-GFPneo or human β-actinGFP-IRES-Neo) that has been demonstratedto work in hESCs can be used as a positivecontrol (Costa et al., 2005, 2007).

If the hESCs fail to die during drug selec-tion, it is likely that the drug concentration istoo low and should be increased. Always per-form a titration of the drug on the parentalhESC line to ensure the optimal concentrationis used for selection.

PCR screening to identify hESCs that haveundergone homologous recombination

A PCR-based method for detecting ho-mologous recombinants is the most efficientmethod for screening large numbers of clones,and is very reliable. However, the choice ofPCR primers is one of the most crucial as-pects in achieving the desired sensitivity ofthe PCR screen. The primers should be ∼24 bpin length, with the GC content between 50%and 60%. The GC residues should be equallydistributed throughout the primer, and thereshould be no obvious secondary structuresformed. The presence of either a G or C residueat the 3′ end of the primers provides a morestable extension start site for the Taq DNApolymerase.

The PCR screening strategy also requiresoptimization for each primer pair and locus.One approach is to design a primer against aregion of the endogenous genomic sequencethat is replaced by the targeting vector duringthe recombination event, and use this primerin combination with the endogenous screen-ing primer. The best PCR conditions are thendetermined based on amplifying a similar-sized DNA fragment from the same loci wheretargeting will occur, but from the wild-typeallele.

Alternatively, a PCR optimization strategybased on a “mock knockout construct” can beperformed (Kontgen and Stewart, 1993). Ge-nomic DNA from ∼1 × 106 hESCs is mixedwith ∼1 μg linearized targeting vector and isused as the substrate to determine the best PCRscreening conditions for homologous recom-binants.

The inclusion of genomic DNA samplesfrom the parental hESC lines in the PCR screencan serve as useful controls for false positives.

Removal of positive selection cassetteOnce correctly targeted hESC clones are

obtained and confirmed to be karyotypicallynormal, the positive selection marker is thenremoved from the genomic locus to preventit from interfering with the expression of thereporter and neighboring genes. If the selec-tion cassette is flanked by loxP sequences,then transient transfection of the pEFBOS-creIRESpuro expression vector will result inthe excision of all sequences sandwiched be-tween the loxP sequences.

The drug puromycin is added to the culturemedium to select for hESCs that are expressingthe transfected vector. After 2 days of selec-tion, small clusters of live hESCs should bevisible by microscopy. If no groups of hESCsare visible, steps should be undertaken to con-firm that the vector has transfected into thecells. Co-transfecting a vector carrying a con-stitutively expressed fluorescent reporter canoptimize the transfection protocol. A titra-tion to determine the optimal concentration ofpuromycin required for selection should alsobe performed.

A negative control consisting of a dishof untransfected hESCs should always be in-cluded. These cells should all die within 48 hrof puromycin exposure. If the dishes contain-ing the hESCs transfected with the pEFBOS-creIRESpuro expression vector remain conflu-ent following 2 days of puromycin selection, itis likely that the initial seeding density of thecells was too high for effective selection. Thevector should not be transfected into culturesof hESCs that are >70% confluent or are notgrowing as a monolayer of cells.

Because of the short exposure time topuromycin, this selection method can be usedeven if the supporting MEF cell line ispuromycin sensitive. However, the dishes mustbe replenished with fresh MEFs immediatelypost puromycin selection to support the growthof the remaining viable hESCs.

Again, the initial procedure to identify thehESC clones that have excised the positive


5B.1.31


selection marker from the targeted locus re-lies on PCR-based screening. Using a primeragainst sequences in the reporter gene in com-bination with a primer that matches sequences3′ of the positive selection marker, a PCR prod-uct should be amplified regardless of whetherthe cassette has been excised or not. If no prod-uct is obtained, this suggests that either thePCR conditions were suboptimal, or the orig-inal gene-targeted hESC line was not clonaland included nontargeted hESCs. To optimizethe PCR conditions, include as a positive con-trol a sample of DNA from the gene-targetedhESC line that still contains the positive selec-tion marker.

If the original gene-targeted hESC line isnot clonal, the researcher should continue toscreen colonies that were puromycin-resistantby PCR until they identify clones that are cor-rectly targeted and have lost the positive se-lection cassette. These hESCs will also needto be clonally isolated using single-cell depo-sition flow cytometry.

PCR should be performed to confirm thatthe Cre recombinase expression vector did notintegrate into the genome. It is also recom-mended that the chosen hESC clones be re-exposed to the selection agents to confirmtheir sensitivity. Generally, almost all of thecolonies screened have the positive selectioncassette excised (Davis et al., 2008b).

CloningIt is important that all reporter knock-in

hESC lines that will be used as reagents infuture experiments are clonally isolated. Thisensures that the final cell population is ho-mogeneous with respect to the targeted locusand the excision of the antibiotic-selection cas-sette. For example, a mixed population of tar-geted and nontargeted hESCs could result inthe misclassification of cell types if identifica-tion is based on the expression of the reportergene.

The cloning efficiency of hESCs usingsingle-cell deposition flow cytometry variesbetween cell lines. Always increase the con-centration of FGF2 in the hESC medium to40 ng/ml during cloning. This helps to growand expand colonies from individual hESCsand reduces the level of spontaneous differ-entiation (Amit et al., 2000; Xu et al., 2005).If the colonies still spontaneously differentiateon the 96-well plates, increase the frequencyof hESC medium changes and/or the densityof the mitotically inactivated MEF cells in thewells.

If less than 10 viable hESC colonies areobtained following the isolation of ∼1000 in-dividual hESCs, 2 μM of the Rho-associatedkinase inhibitor, Y-27632, could be added tothe cells following single-cell deposition. Thiscould improve the level of survival of thehESCs; however, the poor cloning efficiencycould also be due to the ratio of MEFs tohESCs being too high in the sorted population.Reducing the concentration of feeder cells bypassaging the hESCs onto a lower density ofMEFs (∼1 × 104/cm2) the day before single-cell cloning reduces the background feedercount. On the day of single-cell deposition, theflasks should be ∼80% confluent with hESCs.

Anticipated ResultsIn most cases, if the guidelines and proto-

cols described in this unit are adhered to, a re-porter knock-in hESC line will be generated inwhich the expression of the reporter accuratelyreflects that of the targeted gene. The hESCswill also retain their stem cell characteristicsand remain karyotypically normal. At the timeof writing, the authors’ laboratory has usedthese protocols to generate reporter knock-inhESC lines at nine different loci, with multipletargeted clones in two independent hESC linesfor most cases.

The electroporation protocol (BasicProtocol 1) should yield stably transfectedhESC clones at a frequency of 20 to 500 per107 input hESCs. However, the frequency ofhomologous recombination amongst thesesurviving clones will vary depending on thevector used and the genomic locus beingtargeted. In the authors’ laboratory, thisfrequency has ranged from 1.3% to 14.6%.

The method for the removal of loxP-flanked positive selection cassettes from thegenome of genetically modified hESC lines(Basic Protocol 2) has proven to be very suc-cessful. On average, 62 puromycin-resistantcolonies are obtained per 1 × 106 hESCstransfected with the pEFBOS-creIRESpuro ex-pression vector, with >95% of the resultingcolonies screened having the selection cassetteremoved.

The cloning efficiency of the hESCs usingsingle-cell deposition flow cytometry is gen-erally between 4% and 8%.

Time ConsiderationsOnce the targeting vector has been con-

structed, it will take a minimum of 6 monthsto generate and validate a reporter knock-inhESC line. However, it could take several more


5B.1.32


months if a correctly targeted hESC clone isnot obtained from the first electroporation at-tempt. On average, it takes 1 year from de-signing and constructing the targeting vectorto having an established and proven targetedreporter knock-in hESC line.

The electroporation and subsequent selec-tion of hESC clones that have integrated thetargeting construct takes ∼2 1/2 weeks. The ex-pansion of these clones and isolation of DNAfor PCR screening requires a further 2 weeksof culturing. This can be reduced by ∼1 weekif DNA is prepared directly from the hESCclones on the “Primary” 48-well plates, prior toreplicating plates. The PCR screen should takeno more than 2 days. Because this entire proce-dure takes ∼1 month, it is recommended thatseveral consecutive electroporations be initi-ated at weekly intervals, even before the PCRscreening results from the first transfection areknown.

Once a correctly targeted hESC clone is ob-tained, it will take at least 4 weeks of culturingto expand the clone for removal of the positiveselection cassette. Additionally, these hESClines should be cryopreserved and karyotyped,and homologous recombination confirmed bySouthern blot analysis.

The procedure for the removal of the pos-itive selection cassette and subsequent confir-mation by PCR will also take ∼1 month. Thetransfection of the pEFBOS-creIRESpuro vec-tor and selection by puromycin requires 5 days.The transfected hESCs then require at least an-other 10 days before they can be transferred to48-well plates for expansion. After the expan-sion of these clones (∼2 weeks), the extractionof DNA and PCR analysis will take 3 days.

The expansion of two or three hESC clonesin which the selection cassette has been re-moved will take another month. The cloningof these lines by single-cell deposition flowcytometry and confirmation that the cells con-tain the correct genetic modification requiresa further 4 weeks. If the cloning protocol isintegrated into the procedure for removing thepositive selection cassette, it is possible to re-duce the length of time required to generate areporter knock-in hESC line by ∼2 months.

AcknowledgementsWe thank Robyn Mayberry, Kathy Koutsis,

and Amana Bruce for the provision of hESCs.This work was supported by the AustralianStem Cell Centre (ASCC), the JuvenileDiabetes Research Foundation (JDRF), andthe National Health and Medical Research

Council (NHMRC) of Australia. AGE is aSenior Research Fellow of the NHMRC.

Literature CitedAmit, M., Carpenter, M.K., Inokuma, M.S., Chiu,

C.P., Harris, C.P., Waknitz, M.A., Itskovitz-Eldor, J., and Thomson, J.A. 2000. Clonally de-rived human embryonic stem cell lines maintainpluripotency and proliferative potential for pro-longed periods of culture. Dev. Biol. 227:271-278.

Braam, S.R., Denning, C., van den Brink, S.,Kats, P., Hochstenbach, R., Passier, R., andMummery, C.L. 2008. Improved genetic ma-nipulation of human embryonic stem cells. Nat.Methods 5:389-392.

Conner, D.A. 2000. Mouse embryo fibroblast(MEF) feeder cell preparation. Curr. Protoc.Mol. Biol. 51:23.22.21-23.22.27.

Corish, P. and Tyler-Smith, C. 1999. Attenuation ofgreen fluorescent protein half-life in mammaliancells. Protein Eng. 12:1035-1040.

Costa, M., Dottori, M., Ng, E., Hawes, S.M.,Sourris, K., Jamshidi, P., Pera, M.F., Elefanty,A.G., and Stanley, E.G., 2005. The hESCline Envy expresses high levels of GFP inall differentiated progeny. Nat. Methods 2:259-260.

Costa, M., Dottori, M., Sourris, K., Jamshidi, P.,Hatzistavrou, T., Davis, R., Azzola, L., Jackson,S., Lim, S.M., Pera, M., Elefanty, A.G., andStanley, E.G., 2007. A method for genetic mod-ification of human embryonic stem cells usingelectroporation. Nat. Protoc. 2:792-796.

Davis, R.P., Ng, E.S., Costa, M., Mossman, A.K.,Sourris, K., Elefanty, A.G., and Stanley, E.G.,2008a. Targeting a GFP reporter gene to theMIXL1 locus of human embryonic stem cellsidentifies human primitive streak-like cells andenables isolation of primitive hematopoietic pre-cursors. Blood 111:1876-1884.

Davis, R.P., Costa, M., Grandela, C., Holland,A.M., Hatzistavrou, T., Micallef, S.J., Li, X.,Goulburn, A.L., Azzola, L., Elefanty, A.G., andStanley, E.G., 2008b. A protocol for removal ofantibiotic resistance cassettes from human em-bryonic stem cells genetically modified by ho-mologous recombination or transgenesis. Nat.Protoc. 3:1550-1558.

Draper, J.S., Smith, K., Gokhale, P., Moore, H.D.,Maltby, E., Johnson, J., Meisner, L., Zwaka,T.P., Thomson, J.A., and Andrews, P.W. 2004.Recurrent gain of chromosomes 17q and 12in cultured human embryonic stem cells. Nat.Biotechnol. 22:53-54.

Eiges, R., Schuldiner, M., Drukker, M., Yanuka,O., Itskovitz-Eldor, J., and Benvenisty, N. 2001.Establishment of human embryonic stem cell-transfected clones carrying a marker for undif-ferentiated cells. Curr. Biol. 11:514-518.

Elion, E.A., Marina, P., and Yu, L. 2007. Construct-ing recombinant DNA molecules by PCR. Curr.Protoc. Mol. Biol. 78:3.17.1-3.17.12.


5B.1.33


Fehling, H.J., Lacaud, G., Kubo, A., Kennedy,M., Robertson, S., Keller, G., and Kouskoff,V. 2003. Tracking mesoderm induction and itsspecification to the hemangioblast during em-bryonic stem cell differentiation. Development130:4217-4227.

Gadue, P., Huber, T.L., Paddison, P.J., and Keller,G.M. 2006. Wnt and TGF-beta signaling are re-quired for the induction of an in vitro modelof primitive streak formation using embry-onic stem cells. Proc. Natl. Acad. Sci. U.S.A.103:16806-16811.

Giudice, A. and Trounson, A. 2008. Genetic modifi-cation of human embryonic stem cells for deriva-tion of target cells. Cell Stem Cell 2:422-433.

Gu, H., Zou, Y.R., and Rajewsky, K. 1993. Indepen-dent control of immunoglobulin switch recom-bination at individual switch regions evidencedthrough Cre-loxP-mediated gene targeting. Cell73:1155-1164.

Hasty, P., Crist, M., Grompe, M., and Bradley, A.1994. Efficiency of insertion versus replacementvector targeting varies at different chromosomalloci. Mol. Cell Biol. 14:8385-8390.

Hug, B.A., Wesselschmidt, R.L., Fiering, S.,Bender, M.A., Epner, E., Groudine, M., and Ley,T.J. 1996. Analysis of mice containing a targeteddeletion of beta-globin locus control region 5′

hypersensitive site 3. Mol. Cell Biol. 16:2906-2912.

Irion, S., Luche, H., Gadue, P., Fehling, H.J.,Kennedy, M., and Keller, G. 2007. Identificationand targeting of the ROSA26 locus in humanembryonic stem cells. Nat. Biotechnol. 25:1477-1482.

Kontgen, F. and Stewart, C.L. 1993. Simple screen-ing procedure to detect gene targeting eventsin embryonic stem cells. Methods Enzymol.225:878-890.

Micallef, S.J., Janes, M.E., Knezevic, K., Davis,R.P., Elefanty, A.G., and Stanley, E.G. 2005.Retinoic acid induces Pdx1-positive endodermin differentiating mouse embryonic stem cells.Diabetes 54:301-305.

Micallef, S.J., Li, X., Janes, M.E., Jackson, S.A.,Sutherland, R.M., Lew, A.M., Harrison, L.C.,Elefanty, A.G., and Stanley, E.G. 2007. En-docrine cells develop within pancreatic bud-likestructures derived from mouse ES cells differ-entiated in response to BMP4 and retinoic acid.Stem Cell Res. 1:25-36.

Ng, E.S., Azzola, L., Sourris, K., Robb, L., Stanley,E.G., and Elefanty, A.G. 2005. The primi-tive streak gene Mixl1 is required for effi-cient haematopoiesis and BMP4-induced ven-tral mesoderm patterning in differentiating EScells. Development 132:873-884.

Nolden, L., Edenhofer, F., Haupt, S., Koch, P.,Wunderlich, F.T., Siemen, H., and Brustle, O.2006. Site-specific recombination in human em-bryonic stem cells induced by cell-permeant Crerecombinase. Nat. Methods 3:461-467.

Pham, C.T., MacIvor, D.M., Hug, B.A., Heusel,J.W., and Ley, T.J. 1996. Long-range disrup-

tion of gene expression by a selectable markercassette. Proc. Natl. Acad. Sci. U.S.A. 93:13090-13095.

Phelan, M.C. 2006. Techniques for mammaliancell tissue culture. Curr. Protoc. Mol. Biol.74:A.3F.1-A.3F.18.

Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson,A., and Bongso, A. 2000. Embryonic stem celllines from human blastocysts: Somatic differen-tiation in vitro. Nat. Biotechnol. 18:399-404.

Reubinoff, B.E., Pera, M.F., Vajta, G., andTrounson, A.O. 2001. Effective cryopreserva-tion of human embryonic stem cells by the openpulled straw vitrification method. Hum. Reprod.16:2187-2194.

Sauer, B. 1993. Manipulation of transgenes by site-specific recombination: use of Cre recombinase.Methods Enzymol. 225:890-900.

Scacheri, P.C., Crabtree, J.S., Novotny, E.A.,Garrett-Beal, L., Chen, A., Edgemon, K.A.,Marx, S.J., Spiegel, A.M., Chandrasekharappa,S.C., and Collins, F.S. 2001. Bidirectional tran-scriptional activity of PGK-neomycin and un-expected embryonic lethality in heterozygotechimeric knockout mice. Genesis 30:259-263.

Sidhu, K.S. and Tuch, B.E. 2006. Derivation ofthree clones from human embryonic stem celllines by FACS sorting and their characteriza-tion. Stem Cells Dev. 15:61-69.

Struhl, K. 2001. Subcloning of DNA fragments.Curr. Protoc. Mol. Biol. 13:3.16.1-3.16.2.

te Riele, H., Maandag, E.R., and Berns, A. 1992.Highly efficient gene targeting in embryonicstem cells through homologous recombinationwith isogenic DNA constructs. Proc. Natl. Acad.Sci. U.S.A. 89:5128-5132.

Thomason, L., Court, D.L., Bubunenko, M.,Costantino, N., Wilson, H., Datta, S., andOppenheim, A. 2007. Recombineering: Geneticengineering in bacteria using homologous re-combination. Curr. Protoc. Mol. Biol. 78:1.16.1-1.16.24.

Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S.,Waknitz, M.A., Swiergiel, J.J., Marshall, V.S.,and Jones, J.M. 1998. Embryonic stem celllines derived from human blastocysts. Science282:1145-1147.

Urbach, A., Schuldiner, M., and Benvenisty, N.2004. Modeling for Lesch-Nyhan disease bygene targeting in human embryonic stem cells.Stem Cells 22:635-641.

van Deursen, J. and Wieringa, B. 1992. Targeting ofthe creatine kinase M gene in embryonic stemcells using isogenic and nonisogenic vectors.Nucleic Acids Res. 20:3815-3820.

Vasquez, K.M., Marburger, K., Intody, Z., andWilson, J.H. 2001. Manipulating the mam-malian genome by homologous recombination.Proc. Natl. Acad. Sci. U.S.A. 98:8403-8410.

Voytas, D. 2001. Agarose gel electrophoresis. Curr.Protoc. Mol. Biol. 51:2.5A.1-2.5A.9.

Watanabe, K., Ueno, M., Kamiya, D., Nishiyama,A., Matsumura, M., Wataya, T., Takahashi, J.B.,


5B.1.34


Nishikawa, S., Nishikawa, S., Muguruma, K.,and Sasai, Y. 2007. A ROCK inhibitor permitssurvival of dissociated human embryonic stemcells. Nat. Biotechnol. 25:681-686.

Xu, R.H., Peck, R.M., Li, D.S., Feng, X., Ludwig,T., and Thomson, J.A. 2005. Basic FGF andsuppression of BMP signaling sustain undiffer-entiated proliferation of human ES cells. Nat.Methods 2:185-190.

Yasunaga, M., Tada, S., Torikai-Nishikawa, S.,Nakano, Y., Okada, M., Jakt, L.M., Nishikawa,S., Chiba, T., Era, T., and Nishikawa, S. 2005. In-duction and monitoring of definitive and visceralendoderm differentiation of mouse ES cells. Nat.Biotechnol. 23:1542-1550.

Ying, Q.L., Stavridis, M., Griffiths, D., Li, M.,and Smith, A. 2003. Conversion of embryonicstem cells into neuroectodermal precursors inadherent monoculture. Nat. Biotechnol. 21:183-186.

Zwaka, T.P. and Thomson, J.A. 2003. Homologousrecombination in human embryonic stem cells.Nat. Biotechnol. 21:319-321.

imaging neural stem cell fate in mouse

Documents