imprinting mechanisms

Proc. Natl. Acad. Sci. USAVol. 93, pp. 6371-6376, June 1996Genetics

Dynamic methylation adjustment and counting as part ofimprinting mechanisms

(differential methylation/genomic imprinting/dosage adjustment/preimplantation embryo development/imprinted genes)

RuTH SHEMER*, YEHUDIT BIRGER*, WENDY L. DEANt, WOLF REIKt, ARTHUR D. RIGGS§, AND AHARON RAZIN*§

*Department of Cellular Biochemistry, Hebrew University-Hadassah Medical School, P.O.B. 12272, Jerusalem, 91120, Israel; tLaboratory of DevelopmentalGenetics and Imprinting, Babraham Institute, Babraham, Cambridge, CB2 4AT United Kingdom; and iDivision of Biology, Beckman Research Institute ofthe City of Hope, 1500 East Duarte Road, Duarte, CA 91010

Communicated by Stanley M. Gartler, University of Washington, Seattle, WA, February 29, 1996 (received for review January 17, 1996)

ABSTRACT Monoallelic expression in diploid mamma-lian cells appears to be a widespread phenomenon, with themost studied examples being X-chromosome inactivation ineutherian female cells and genomic imprinting in the mouseand human. Silencing and methylation of certain sites on oneof the two alleles in somatic cells is specific with respect toparental source for imprinted genes and random for X-linkedgenes. We report here evidence indicating that: (i) differentialmethylation patterns of imprinted genes are not simply copiedfrom the gametes, but rather established gradually afterfertilization; (ii) very similar methylation patterns are ob-served for diploid, tetraploid, parthenogenic, and androgenicpreimplantation mouse embryos, as well as parthenogenic andandrogenic mouse embryonic stem cells; (iii) haploid parthe-nogenic embryos do not show methylation adjustment as seenin diploid or tetraploid embryos, but rather retain the ma-ternal pattern. These observations suggest that differentialmethylation in imprinted genes is achieved by a dynamicprocess that senses gene dosage and adjusts methylationsimilar to X-chromosome inactivation.

The abnormal phenotype and lethality of embryos that lackcomplementary sets of chromosomes from both parents andmuch additional evidence suggest that for normal embryodevelopment certain genes must be regulated by inactivation ofone allele in a parental specific manner (1, 2). Similarly,inactivation of one X chromosome and the resulting monoal-lelic expression of X-linked genes is necessary for normaldevelopment (3, 4). Although the mechanisms by which X-linked and imprinted genes are controlled is at present poorlyunderstood, it is widely accepted that DNA methylation playscentral roles in these processes. A function for DNA methyl-ation in the maintenance of the inactive state of genes on oneX-chromosome is well established (ref. 5; for review see ref. 3)and the differential methylation of several transgenes that aretransmitted methylated from the mother and unmethylatedfrom the father (6, 7) suggests that methylation may be involvedin the imprinting process. Methylation is an excellent candidatefor regulating imprinting because it accommodates all of themajor requirements for the imprinting process: stability, herita-bility, reversibility, and ability to affect gene function.

Perhaps the most convincing evidence for a role of meth-ylation in imprinting has been obtained by the analysis ofmethylation and expression of several imprinted genes inmethyltransferase-deficient mice (8). Igf2 and Igf2r, which aremethylated at some sites on their active paternal allele, aresilent in these mutant mice, whereas H19, which is normallyunmethylated and active on the maternal allele and methylatedand inactive on the paternal allele, is overexpressed in themethyltransferase-deficient mice. In addition, a strong corre-

lation exists between differential expression and differentialmethylation of imprinted genes. All human and mouse endog-enously imprinted genes isolated to date have regions thatexhibit allele specific methylation patterns (9-11) as illustratedin Fig. 1. The cloning of at least one novel imprinted gene U2af(12) has been achieved by a method based only on differentialmethylation.The experiments described here were designed to gain a

deeper insight into the mechanism involved in the establish-ment of the differential methylation patterns of imprintedgenes. Based on the observations made in this study, wehypothesize that establishment of differentially methylatedregions in imprinted genes may be influenced by a countingmechanism and guided by factors that discriminate the pater-nal and maternal alleles. The counting mechanism is proposedto keep one allele of each imprinted gene active per diploidchromosomal set. This similarity to X-chromosome inactiva-tion is intriguing and common mechanisms are proposed.

MATERIALS AND METHODSPreparation of Biological Material. Parthenogenic preim-

plantation embryos. Oocytes were collected from oviducts of(C57BL x BALB/c)F1 unmated females 20 hr followingsuperovulation. The unmated females were superovulated byintraperitoneal injection of 5 units of pregnant mare serumgonadotropin followed by an injection of 5 units of humanchorionic gonadotropin 45 hr after the first injection. Thecollected oocytes were rinsed in PBS containing 1 mg/mlhyaluronidase and 10 mg/ml polyvinylpyrrolidone by repeatedsuctioning into a drawn-out pipette to remove attached gran-ulosa cells. Parthenogenic embryos were prepared by activat-ing the unfertilized oocytes by a brief exposure to 7% ethanolin M2 buffer (Sigma) (13). Exposure to ethanol yields ahaploid parthenogenous embryo that develops a single haploidpronucleus following extrusion of the second polar body.Diploidation of this class of oocytes was achieved by suppres-sion of the formation of the second polar body by incubatingin M16 medium (Sigma), containing 5 mg/ml cytochalasin Bfor 4 hr. Oocytes were washed twice in M16 and cultured in thismedium (without cytochalasin B) under paraffin oil at 37°C inhumidified 5% C02/95% air and embryos at various stageswere collected.Androgenones. Fertilized one-cell eggs were collected from

superovulated F1 (C57BL6 x CBA) females mated with eitheran F1 or F1 male congenic for the distal region of chromosome7 derived from M. spretus. Hereafter these embryos arereferred to as SD7.

Diploid heterozygous androgenic (AG) eggs were con-structed by nuclear transplantation (13) using a Leitz micro-manipulator in phosphate-buffered medium (PB1) with 0.4%

Abbreviations: AG, androgenic; ES, embryonic stem.§To whom reprint requests should be addressed.

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

6371

Proc. Natl. Acad. Sci. USA 93 (1996)

bovine serum albumin (BSA) supplemented with 5 ,ug/mlcytochalasin B and 1.5 ,ug/ml nocodazole (Sigma). UnfusedAG haploid eggs were washed six times in PB1 and placed intoembryo culture medium KSOM for at least 1 hr beforeelectrofusion (14).To achieve reconstitution of the diploid AG egg, haploid AG

egg and karyoplast (SD7) were equilibrated in 0.3 M glucosecontaining 50 ,uM CaCl2 and 100 JIM MgSO4 (GCM) plus0.3% BSA and placed into a BTX-450 slide electrofusionchamber containing GCM without BSA. Embryos were man-ually aligned such that the karyoplast/recipient oocytes wereoriented at 90 degrees to the electrodes. Embryos weresubjected to a brief 5 V AC pulse before the application of theelectrofusing DC pulse of 2 x 70 ,usec at 1.5 KV/cm (15).Embryos were washed six times in PB1 to remove GCM.Embryos were transferred to equilibrated microdrops ofKSOM and checked for fusion 30-45 min later. Embryos wereconsistently fused at a rate of 100%. Fused embryos werecultured from 5 to 6 days, to the blastocysts stage, under oil inhumidified 5% C02/95% air at 37°C. AG blastocysts werecollected and the DNA was extracted as described below.

Tetrapolid embryos. To produce tetraploid embryos, two-cellstage embryos (F1 x F1), were electrofused following equili-bration in GCM with manual alignment of 5.2 V ac and 3 times50 ,usec pulses dc of 1.5 KV/cm in a standard BTX-450electrofusion chamber. Embryos were washed out of fusionmedium, placed in KSOM, and cultured an additional 48-72 hrto the blastocyst stage. Embryos were observed 45-60 min afterfusion, at which time >95% had returned to a one-celled embryo.Normal preimplantation embryos were cultured in vitro

from fertilized eggs of (C57BL/BALB/c)Fl females that hadbeen mated with M. musculus males following superovulation.Embryos were collected at various stages of development asdescribed (16).DNA Preparation. Genomic DNA samples were prepared

using the following DNA extraction mixture: 150mM NaCl/15mM Tris-HCl, pH 7.4/3 mM EDTA/0.4% SDS/70 mg/mlproteinase K/20 mg/ml pancreatic RNase. When DNA wasextracted from a small number of cells (oocytes or preimplan-tation embryos), FX174 DNA (10,ug/ml) was added ascarrier. The mixture was incubated overnight at 37°C, phenolchloroform extracted, and the DNA was ethanol precipitated.

Southern Blot Analysis. Restricted DNA was electropho-resed on 0.8% agarose gels, transferred to Zeta probe filters(Bio-Rad) by alkaline blotting and hybridized to the appro-priate probes, which were labeled by primer extension (Boeh-ringer Mannheim) to a level of 2-3 x 108 cpm/mg DNA.Prehybridization and hybridization were performed at 65°C ina solution containing 10% polyethylene glycol/7% SDS/0.3 MNaCl/15 mM NaH2PO4/1.5 mM Na2EDTA. Prehybridizationwas for 5-10 min, and hybridization was in the presence of 250,ug/ml denatured salmon sperm DNA for 15 hr.

Methylation Analysis by PCR. The methylation status ofindividual sites was established by PCR analysis as described(16). By this method a PCR product is visualized on an agarosegel if the site is methylated. The assay is linear over a 50-foldrange of DNA concentrations so that 10-100 molecules couldeasily be analyzed. Most of our samples contained between20-50 molecules. The degree of modification is quite accuratein the range of 0-50% methylation but accurate quantitationis more problematic above 50% methylation. Partial methyl-ation and full methylation are distinguishable, however.

Primers used for PCR were as follows: Igf2 site 3: 5' primer,CCTTGAGCCACACTTTGACT; 3' primer, CCAGAGAT-GAGCAAGGTTCT. Igf2 site 4: 5' primer, GCCTAATCT-GGCCTCACAAGGACTA; 3' primer, GGTGATGTTCCT-CATTCCAGGGAG. Igf2r site 3: 5'primer, AACCCTCG-GAACCCTGCCCTT; 3' primer, TAGCACAACTCCAAT-TGTGCTGCG. Igf2r site 4: 5' primer, TCAGAACACTG-GTGAGCACTGGG; 3' primer, GAGGGTAGGATTCCGT-

TGCAAGG. Snrpn site 3: 5' primer, TTGGACTTCCCCCT-GCTCGTG; 3' primer, GCAGTAAGAGGGGTCAAAAGC.H19 site 1: 5' primer, ATCCAGGAGGCATAAGAATTC; 3'primer, CACAAAGGATTCTTTGCAGAG; H19 site 9: 5'primer, TTGGACTTCCCCCTGCTCGTG; 3' primer, GCA-GTAAGAGGGGTCAAAAGC. 3'globin/HpaII: 5' primer,CATACCATCATGCCTGCACAGT; 3' primer, ACTGTAC-CAGAGAGTAGCGT. ApoAI/HpaII: 5' primer, GATGG-TGCAACTGCCTTA; 3' primer, ATTCTGTTCTCTGT-GCCC.

RESULTSEstablishment of Differentially Methylated Patterns in

Normal Preimplantation Embryos Is a Dynamic Process.Previous experiments employing the PCR methylation analysismethod have established that imprinted genes in the blastocystare monoallelically methylated (17). Here we report on theestablishment of methylation at specific sites in four imprintedgenes (Fig. 1) during development of the preimplantationmouse embryo (Fig. 2).The rationale of the PCR method is as follows: If a specific

methylation-sensitive restriction site in a target region ismethylated, the amplification following restriction enzymedigestion will proceed normally and a PCR product will bevisible on the gel. On the other hand, the presence of anunmethylated site will result in digestion of the fragment andthe subsequent failure to visualize the amplification product.When properly calibrated, this assay is linear over a wide rangeof DNA concentrations and can be used to measure the degreeof DNA methylation at specific sites (16). Therefore thereduction in the band intensity of HpaII-digested DNA ascompared with undigested DNA (Figs. 2 and 3) indicatespartial methylation of the site. Based on previously publishedwork (17), we interpret this partial methylation to reflectmonoallelic methylation.

IgfZrIgf2

3kbUSR

egin Z7kbregion 1

Snrpn

exon 7

ApoAl

ILL

3 4

region2

H19

_., .

Globin

_~~ M~

FIG. 1. Genomic maps of the genes and the studied sites. Positionsof the studied sites (vertical arrows) are given by the distance inkilobases from the corresponding transcription start sites (horizontalarrows). The differentially methylated regions in the imprinted genesare designated by shaded boxes; USR, the upstream region of Igf2 (17,18). Differentially methylated regions 1 and 2 in Igf2r and thedifferentially methylated region of H19 were previously reported (17,19, 20). Site 2 in exon 7 of Snrpn has been shown to be differentiallymethylated (R.S., unpublished). The solid black boxes in the 83-globingene and in ApoAl designate exons. The site tested in,B-globin is anHpaII site reported previously to be methylated in the oocyte andsperm and unmethylated in the blastocyst (16). Site 1 in ApoAl is anHpaII site studied before and found to be methylated in sperm andunmethylated in oocytes (21).

6372 Genetics: Shemer et al.

Proc. Natl. Acad. Sci. USA 93 (1996) 6373

Sperm Occyte Zygote 2CeI 4CeI 8Cel Morub

Igf2site3

_ ,_

.... '.

-wns40* - :: .a .:

.bw

FIG. 2. Methylation changes at differentiallymethylated sites in imprinted genes during preim-plantation development. DNA from gametes anddifferent embyronic stages were digested with HpaII(+) or uncut (-) and subjected to PCR with appro-priate no DNA controls (not shown). All analyseswere repeated at least five times with similar results.Preparation of DNA and PCR analyses were asdescribed in Materials and Methods. The sites arespecified in Fig. 1. Note that H19 site 9 was reportedpreviously to be unmethylated in the morula (17). Inthis study, due to more rigorous analyses, we find thissite to be partially methylated throughout develop-ment of the preimplantation embryo.

The results presented in Fig. 2 show the dynamic changes inmethylation of individual sites of imprinted genes during thedevelopment of the preimplantation embryo. Igf2 site 3, whichis methylated in mature oocytes and sperm, undergoes dem-ethylation on both alleles promptly after fertilization followedby de novo methylation prior to the morula stage. As evidencedby Brandeis et al. (17,) methylation is monoallelic. Differentialmethylation of Igf2r site 3 is acquired by demethylation priorto the four-cell stage followed by de novo methylation by the8-16 cell stage. In contrast, Igf2r site 4, which is unmethylatedin the oocyte and sperm, becomes methylated following fer-tilization and prior to syngamy. Methylation of other sites, suchas site 2 in the Snrpn gene and sites 1 and 9 in H19, remainsthe same throughout development as in the gametes where thesites are methylated in sperm but unmethylated in oocytes.These results suggest that the process leading to the estab-

lishment of a differentially methylated pattern begins in thegametes, or soon after fertilization before syngamy, but thefinal differential methylation pattern is gradually completedduring development of the embryo. The timing of demethy-lation/remethylation is not the same for each gene or site.

Differential Methylation Patterns in Various Types of Pre-implantation Embryos. The methylation status of several sitesin differentially methylated regions of four imprinted geneswas examined in blastocysts of normal diploids, tetraploids,parthenogenic diploids, parthenogenic haploids, and andro-genic diploids. It has previously been shown that all of thesesites are allele specifically methylated in normal blastocysts(17). The results presented in Fig. 3 show that regardless of thestatus of methylation of these sites in the gametes they arepartially methylated to the same extent in all diploid andtetraploid blastocysts. In contrast, sites in nonimprinted genessuch as 13-globin andApoAI are unmethylated in all blastocystsincluding haploids.These results imply that, even in embryos with two alleles of

the same parental origin, methylation changes take place thatresult in the same level of methylation as in normal embryos.The fact that these methylation changes are specific to differ-entially methylated sites in imprinted genes and are notobserved on sites located on nonimprinted genes arguesagainst the possibility of an artifact that stems from the factthat we study abnormal embryos. That these changes are

dependent upon the addition of a second chromosome or

chromosome set is implied by comparing the data obtainedwith diploid and haploid. parthenogenic blastocysts. Whilemethylation adjustments in parthenogenones imitate the dy-namic methylation processes observed in normal embryos, thesame sites are either fully methylated or completely unmethy-lated in haploid blastocysts reflecting the methylation ob-

BlastocystsNormal Parthenogenic

Diplold HaploldAndrogenic Tetraploid

+- +- +- +-

lgf2site3

am

lgftr _;

_ _

--

Snrpnsie2

H19ske9

H19 _sitel

.i..

pGIobin3'SIte

ApoAlSitel

FIG. 3. Methylation status of differentially methylated sites indiploid and tetraploid normal embryos and in parthenogenic andandrogenic blastocysts. DNA samples were obtained from normaldiploid blastocysts, parthenogenic diploid and haploid blastocysts, andfrom diploid androgenic as well as tetraploid blastocysts. Samples weredigested with HpaII (+) or left uncut (-) DNA. No DNA controlswere included and all samples were subjected to PCR as described inthe Materials and Methods. Two sites in nonimprinted genes, one in the,B-globin gene and the other in ApoAI, were analyzed to examine thespecificity of the methylation dosage adjustmnent phenomenon. Theexamined sites are those designated in Fig. 1.

Igf2rsite3

Igf2rsite4

Snrpnsite2 *1*E-:....

H19site9

Hi9sitel

.:..:7,..4lllllw.:..-.

.:V,,:", .ii.

Genetics: Shemer et al.

f, 1. 1. 1. 1.1.111-11.. I:E zz:PM.11:. i.r:s:.,: :ii


Spretus Musculus Musculus x Spretus

+ +

Z20bp-170bp-

Hpall

5'220bp

Normal Androgenic

+ - +

oft w-A 48bi ago-

Dral

-I -3'170bp

FIG. 4. Counting and random adjustment in androgenic embryos.DNA samples were isolated from blastocysts of spretus, Fl, and normaland androgenic hybrids. The samples were divided and digested withHpaII (+) or uncut (-) and subjected to PCR using primers flankingIgf2 site 4. The PCR products were digested with DraI and separatedon a 3% agarose gel. DraI is a polymorphic site existing on the spretusIgf2 allele but not on the musculus Igf2 allele. DNA from the F1maternal strain (M. musculus) shows the intact 220 bp band, uncut byDraI, whereas the DraI digestion product of 170 bp characterizes thepaternal allele (M. spretus). In the androgenic hybrids both bands aredetected. Because a polymporphic site at the region covered by the 3'primer results in one mismatch, the 170-bp PCR product is lessabundant than expected. Therefore the ratio of the 220-bp to 170-bpbands is not 1:1 in the hybrid androgenones.

served in the oocytes. While it could be argued that the failureto adjust methylation in haploid embryos reflects abnormaldevelopment of these embryos, it is clear that the methylation/demethylation apparatus distinguishes imprinted from nonim-printed genes in haploid embryos as well. Sites in nonimprintedgenes that have previously been shown to be methylated in theoocyte, such as the 3' site in the ,B-globin gene (16), are subjectto demethylation even in haploid parthenogenones. The 5' sitein the ApoAl gene that is not methylated in the oocyte (21)maintains its unmethylated state throughout development ofall preimplantation embryos (Fig. 3).Taken together, the results suggest that the differential

methylation of imprinted genes is sensitive to gene dosage.This is intriguing because the dosage adjustment mechanismcould be based on counting one allele per genome and wouldthus be similar to the counting mechanism seen for theinactivation of the X chromosome (4).

A Xbal+ Hhal

lb XbaI C N Ag Pg

X1-X2 4.0-W

Methylation Adjustment Is a Stochastic Process. The ob-servation of a 50% methylation level in embryos with bothalleles of the same parental origin suggests a methylationadjustment mechanism of a stochastic nature. To test this weconstructed, by nuclear transfer diploid androgenic blastocystsin which the Igf2 alleles originate from two different mousestrains, one originating from M. spretus and the other from M.musculus. Using the Dral polymorphic site present only in M.spretus, we could distinguish between the two alleles of Igf2and test the methylation status of site 4, which is paternallymethylated throughout all stages of development of the pre-implantation embryo (data not shown). DNA from M. spretus,M. musculus, and normal and androgenic hybrid blastocystswas digested with HpaII and subjected to PCR using primersflanking Igf2 site 4. PCR products were digested with Dral andanalyzed on an agarose gel; As can be seen in Fig. 4, in thenormal hybrids only the digested 170-bp band is seen, indicat-ing that the site is methylated on the paternal allele (M.spretus), but not on the maternal allele (M. musculus). Incontrast, in the androgenic hybrids, both alleles are equallymethylated. Because the paternal allele inherits its methylatedstate from the gamete this result indicates that both alleles musthave undergone partial demethylation. Because site 4 is methy-lated in the oocyte as well, the same process of partial demethy-lation occurred when parthenogenetic embryos were used (datanot shown).

Methylation in Parthenogenic, Androgenic, and NormalEmbryonic Stem (ES) Cells. The methylation adjustmentmechanism was first suggested by our studies on the methyl-ation status of differentially methylated CpG sites in parthe-nogenic, androgenic, and normal murine ES cells. Three HhaIsites (H2, H3, and H4) positioned within a 7-kb region of thebody of the Snrpn gene (Fig. 5) are differentially methylatedon the paternal allele in normal blastocysts, whereas site Hi ismethylated on both alleles (R.S. unpublished). As can be seenin Fig. SA, the HhaI site in intron 1 (Hi) is fully methylated inparthenogenic, androgenic, and normal ES cells. In contrast,about 50% of the 7-kb Xbal fragment (X2-X3) is digested byHhaI in all ES cells, as judged by the intensity of the 2.8-kbband relative to the 7-kb band (Fig. SB), indicating that the H2and H3 sites are about 50% methylated in normal as well asparthenogenic and androgenic ES cells. Because the predom-inant bands seen in Fig. 5B correspond to the fully methylatedX2-X3 fragment and H2-H3 fragment, it can be concludedthat H2 and H3 are unmethylated on the same molecule.

B Xbal+ HhalXbal N Ag Pg

X2-X3 7.0- _oPqgp.

X2-8H4 5.2-

X2-H3 4.5-

H2-H4 3.6-

w

H2-H3 2.8- ___

xi X2

probe A

X3

H2probe B

H!3 H4

1 Kb

FIG. 5. Methylation status of the mouse Snrpn gene in normal, parthenogenic, and androgenic embryonic stem cells. (A) DNA samples fromnormal (N), androgenic (Ag), and parthenogenic (Pg) ES cells were digested with XbaI plus HhaI. pRS plasmid that contains the mouse Snrpngene was digested with XbaI or XbaI plus HhaI and served as a control (C). After digestion and electrophoresis, all samples were Southern blottedand hybridized to probe A. (B) Blots were hybridized to probe B. X-XbaI sites, H-HhaI sites, filled boxes designate exons 4-10. The XbaI site (Xl)is 14 kb downstream to the transcription start (R.S., unpublished).


HI-X2 0.9-

Proc. Natl. Acad. Sci. USA 93 (1996) 6375

Because H2 and H3 sites are unmethylated in the oocyte,methylated in the sperm, and undermethylated on the mater-nal allele in the blastocyst (R.S. et al., unpublished), it is clearthat demethylation has occurred in the androgenic cells and denovo methylation has taken place in the parthenogenic cells.Similar observations have been reported for Igf2 and H19 (22,23). The fact that the methylation of H2 and H3 undergoesadjustment to 50% in both androgenic and parthenogeniccells, whereas Hi remains fully methylated testifies to thephysiological significance of our observations.

DISCUSSIONTo meet the requirements of a true, primary imprinting signala methylation mark must be established in the gametes andcopied to the early embryo. In a previous study we found thatmost of the sites in differentially methylated regions of im-printed genes in the postimplantation mouse embryo and adulttissues do not fulfill these criteria (17). Many sites that areunmethylated in both gametes become differentialy methyl-ated later in development. Others that are methylated in thesperm and/or the egg undergo demethylation in the preim-plantation embryo and both alleles are unmethylated in theblastocyst (17).Dynamic Methylation of Imprinted Genes in the Early

Embryo. Here we show that several sites, although differen-tially methylated in the blastocyst, undergo demethylation aswell as de novo methylation promptly after fertilization. Igf2site 3 undergoes demethylation on both alleles in the zygote;Igf2r site 3 undergoes demethylation before the four-cell stageand is then found methylated in the eight-cell embryo (Fig. 2).Other sites such as H19 sites 1 and 9, and Snrpn site 2, comedifferentially methylated from the gametes and this monoal-lelic methylation is maintained throughout development. Also,Igf2r site 4, although unmethylated in the oocytes and sperm,acquires its differential methylation promptly after fertiliza-tion prior to syngamy and remains methylated throughout thedevelopment of the preimplantation embryo (Fig. 2). Whilethese sites fulfill the requirements of an imprinting signal, it isclear that establishing the final differential methylation pat-terns of imprinted genes involves a gradual process thatcontinues throughout development of the early embryo. Thisprocess must be regulated separately from the process respon-sible for establishing the methylation pattern of nonimprintedgenes because all nonimprinted genes so far studied undergototal demethylation at the 16-cell stage followed by global denovo methylation at the pregastrula stage (16).

Methylation Adjustment and Gene Dosage. This dynamicprocess appears to be directed toward establishing differentialmethylation even if the initial methylation state of the twoalleles is identical. We show here for several imprinted genesthat very similar methylation patterns exist in normal, parthe-nogenic, and androgenic mouse embryos (Fig. 3), as well as inparthenogenic and androgenic embryonic stem cells (Fig. 5).Whereas diploid cells adjust and become differentially

methylated, even if both alleles are of monoparental origin,haploid, maternally-derived cells retain a maternal methyl-ation pattern. Although other differences between haploid anddiploid cells cannot be ruled out, an obvious difference ischromosome or gene dosage. Therefore, our results maysuggest that allele-specific methylation patterns are estab-lished by a process that involves a counting mechanism thatrequires two copies of some element. In addition, we show thatthe level of methylation of differentially methylated sites intetraploid embryos is around 50%, suggesting that the count-ing mechanism causes adjustment to a ratio of one allele pergenome. This model is obviously related to that of the X-chro-mosome inactivation, which is triggered by sensing two Xchromosomes, and suggests a likely evolutionary relationshipbetween X-chromosome inactivation and parental imprinting.

Such a relationship is consistent with the fact that even thoughX-chromosome inactivation in somatic cells is random withrespect to parental source, the paternal X chromosome ispreferentially inactivated in extraembryonic tissues (24). In-deed, while Xist expression is paternal in the preimplantationembryo, it is monoallelic, but random, in later stage somaticlineages (32). A counting mechanism thus seems to be one ofmany features shared by imprinting and X-chromosome inac-tivation (Table 1).The methylation adjustment observed here in parthenog-

enones is not necessarily accompanied by a comparable dosageadjustment at the transcriptional level (22, 33-36). It shouldtherefore be clearly understood that memory of the imprintand differential expression are conceptually separable pro-cesses. However, at later stages of differentiation, the expres-sion and methylation of imprinted genes in monoparental cellsis according to their parental origin (22, 23, 34). Similarly, themethylation of imprinted genes follows their parental origin indifferentiated tissues of mouse and human disomies (18, 37).Hence, the counting and adjustment mechanism that clearlyoperates in the early embryo must be modified by factors thatare expressed in more differentiated cells; these factors may beproducts of imprinted genes themselves (11).

It is critical for normal development in mammals that asubstantial number of genes on chromosome X and imprintedgenes on autosomal chromosomes be subject to gene dosageadjustment. The counting phenomenon that is a well-established part of X-chromosome inactivation and is shownhere to be part of genomic imprinting must therefore be afundamental element for normal development.

Mechanistically, there are several possible explanations,such as regional control sites in addition to local control sites.A distant imprinting control element (IC) has been suggestedto operate in imprinted regions of the genome in analogy to theX-chromosome inactivation center (XIC) (38, 39). The exis-tence of such an element is supported by the observation thatin certain Prader-Willi Syndrome and Angelman Syndrome

Table 1. Comparison of imprinting andX-chromosome inactivation

Monoallelic expressionSomatic inheritanceAlternate chromatin statesGametic inheritance of

parental originEvolutionary appearanceCis-acting center(s)Establishment in early embryoReplication differentialInactivation adjustment in

unusual casesMethylation involvedDifferential methylation ofCpG islands

Methylation adjustment inunusual cases

Counting mechanismDynamic methylation

X-chromosomeImprinting* inactivationt

Yes YesYes YesYes Yes

Insects; Mammals onlymammals

YesYesYesYesYes

YesYes

Yest

YestYest

YesYesYesYesYes

YesYes

Yes

YesYes§

*For reviews of parental imprinting see Solter (25), Reik et al. (26),Reik and Allen (27), and Razin and Cedar (9).tFor reviews of X-chromosome inactivation see Grant and Chapman(28), Riggs and Pfeifer (3), Lyon (29), and Migeon (4).*Data reported here.§To a certain extent de novo methylation and demethylation occurscontinuously, at least in tissue culture cells, at the CpG island ofX-linked PGK (phosphoglycerate kinase): Pfeifer et al. (30) andSinger-Sam and Riggs (31).

Genetics: Shemer et al.


families rearrangements in chromosome 15 were accompaniedby altered methylation at loci that are distal to the rearrange-ment location (40-42). Finally, replication timing studies ofimprinted genes have revealed that large chromosomal do-mains show nonsynchronous replication, with the paternalallele replicating earlier (43, 44). This observation lendsfurther support to the idea that both local and regionalmechanisms control imprinting.Taking all present results into account, we suggest that

genomic imprinting has, as one component, methylation ad-justments based on a dynamic, stochastic process, which nev-ertheless can have a bias for one of the parental alleles inimprinted genes. This bias may be directed by methylation atas yet unstudied sites or by methylation-independent, chro-matin-based information.

The contribution of Dr. Tal Kafri to the early stages of this work isstrongly acknowledged. We are grateful to Dr. Jeff Mann for providingus with parthenogenic and androgenic embryonic stem cells and to Dr.Haya Lorberboum-Galski and Dr. Shai Yarkoni for the humanteratoma tissue. Careful reading of the manuscript and helpful com-ments made by Dr. Robert Feil are acknowledged. This work wassupported in part by National Institutes of Health Grant GM20483 andby the Council for Tobacco Research (United States) Grant 3022R1to A. Razin. Early stages of this work were supported by NationalInstitutes of Health Grant GM50575 to A.D. Riggs. W.R. acknowl-edges support from the Biotechnology and Biological Sciences Re-search Council and the Ministry of Agriculture Fisheries and Food(United Kingdom).

1. Surani, M. A., Kothary, R., Allen, N. D., Singh, P. B., Fundele,R., Ferguson-Smith, A. C. & Barton, S. C. (1990) Development(Cambridge, UK), Suppl. 89-98.

2. Surani, M. A. (1993) Nature (London) 366, 302-304.3. Riggs, A. D. & Pfeifer, G. D. (1992) Trends Genet. 8, 169-174.4. Migeon, B. R. (1994) Trends Genet. 10, 230-235.5. Mohandes, T., Sparkes, R. S. & Shapiro, L. J. (1981) Science 211,

393-396.6. Surani, A., Reik, W. & Allen, N. D. (1988) Trends Genet. 4,

93-98.7. Chaillet, J. R., Vogt, T. F., Beier, D. R. & Leder, P. (1991) Cell

66, 77-83.8. Li, E., Beard, C. & Jaenisch, R. (1993) Nature (London) 366,

362-365.9. Razin, A. & Cedar, H. (1994) Cell 77, 473-476.

10. Tremblay, K. D., Saam, J. R., Ingram, R. S., Tilghman, S. M. &Bartolomei, M. S. (1995) Nat. Genet. 9, 407-413.

11. Reik, W., Feil, R., Allen, N. D., Moore, T. F. & Walter, J. (1995)in Genomic Imprinting, eds. Ohlsson, R., Hall, K., & Ritzen, M.(Cambridge Univ. Press, Cambridge, U.K.), pp. 157-169.

12. Hatada, I., Sugama, T. & Mukai, T. (1993) Nucleic Acids Res. 21,5577-5582.

13. Cuthbertson, K. S. R. (1983) J. Exp. Zool. 226, 311-314.14. Lawitts, J. A. & Biggers, J. D. (1993) Methods Enzymol. 225,

153-164.15. Cheong, H. T., Taniguchi, T., Takahashi, Y. & Kanagawa, H.

(1992) Anim. Rep. Sci. 29, 307-317.

16. Kafri, T., Ariel, M., Brandeis, M., Shemer, R., Urven, L.,McCarrey, J., Cedar, H. & Razin, A. (1992) Genes Dev. 6,705-714.

17. Brandeis, M., Kafri, T., Ariel, M., Chaillet, J. R., McCarrey, J.,Razin, A. & Cedar, H. (1993) EMBO J. 12, 3669-3677.

18. Sasaki, H., Jones, P. A., Chaillet, J. R., Ferguson-Smith, A. C.,Barton, S. C., Reik, W. & Surani, M. A. (1992) Genes Dev. 6,1843-1856.

19. Stoger, R., Kubicka, P., Liu, C.-G., Kafri, T., Razin, A., Cedar,H. & Barlow, D. P. (1993) Cell 73, 61-71.

20. Bartolomei, M. S., Webber, A. L., Brunkow, M. E. & Tilghman,S. M. (1993) Genes Dev. 7, 1663-1673.

21. Shemer, R., Kafri, T., O'Connell, A., Eisenberg, S., Breslow, J. L.& Razin, A. (1991) Proc. Natl. Acad. Sci. USA 88, 11300-11304.

22. Szabo, P. & Mann, J. R. (1994) Development (Cambridge, UK)120, 1651-1660.

23. Feil, R., Walter, J., Allen. N. D. & Reik, W. (1994) Development(Cambridge, U.K) 120, 2933-2943.

24. Takagi, N. & Sasaki, M. (1975) Nature (London) 256, 640-642.25. Solter, D. (1988) Annu. Rev. Genet. 22, 127-146.26. Reik, W., Howlett, S. K. & Surani, M. A. (1990) Development

(Cambridge, U.K) 110, 99-106.27. Reik, W. & Allen, N. D. (1994) Curr. Biol. 4, 145-147.28. Grant, S. G. & Chapman, V. M. (1988) Annu. Rev. Genet. 22,

199-233.29. Lyon, M. F. (1993) Trends Genet. 9, 123-128.30. Pfeifer, G. P., Tanguay, R. L., Steigerwald, S. D. & Riggs, A. D.

(1990) Genes Dev. 4, 1277-1287.31. Singer-Sam, J. & Riggs, A. D. (1993) in DNA Methylation:

Molecular Biology and Biological Significance, eds. Jost, J. P., &Saluz, H. P. (Birkhauser, Berlin). pp. 358-384.

32. Kay, G. F., Barton, S. C., Surani, A. M. & Rastan, S. (1994) Cell77, 639-650.

33. Latham, K. E., Doherty, A. S., Scott, C. D. & Schultz, R. M.(1993) Genes Dev. 8, 290-299.

34. Walsh, C., Glasher, A., Fundele, R., Ferguson-Smith, A., Barton,S., Surani, M. A. & Ohlsson, R. (1994) Mech. Dev. 46, 55-62.

35. Rachmilewitz, J., Goshen, R., Ariel, I., Shneider, T., deGroot, N.& Hochberg, A. (1992) FEBS Lett. 309, 25-28.

36. Mutter, G. L., Stewart, C. L., Chaponot, M. L. & Pomponio,R. L. (1993) Am. J. Hum. Genet. 53, 1096-1102.

37. Driscoll, D. J., Waters, M. F., Williams, C. A., Zori, R. T., Glenn,C. C., Avidano, K. M. & Nicholls, R. D. (1992) Genomics 13,917-924.

38. Nicolls, R. D. (1994) Am. J. Hum. Genet. 54, 733-740.39. Lalande, M. (1994) Nat. Genet. 8, 5-7.40. Reis, A., Dittrich, B., Greger, V., Buiting, K., Lalande, M.,

Gillessen-Kaesbach, G. & Anvert, M. (1994)Am. J. Hum. Genet.54, 741-747.

41. Glenn, C. C., Porter, K. A., Jong, M. T. C., Nicholls, R. D. &Driscoll, D. J. (1993) Hum. Mol. Genet. 2, 2001-2005.

42. Sutcliffe, J. S., Nakao, M., -Christian, S., Orstavik, K. H., Tom-merup, N., Ledbetter, D. H. & Beaudet, A. L. (1994) Nat. Genet.8, 52-58.

43. Kitzberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, D.,Driscoll, D. J., Nicholls, R. D. & Ceder, H. (1993) Nature (Lon-don) 364, 459-463.

44. Knoll, J. H. M., Cheng, S. D. & Lalande, M. (1994) Nat. Genet 6,41-45.


imprinting mechanisms

Documents