Integrated DNA Technologies

Mark Behlke MD, PhD Chief Scientific Officer

Ootemachi First Square Conference July 30, 2013

MBL/IDT Next Gen Sequencing Symposium

Improved Reagents & Methods for Target Enrichment in Next Generation Sequencing

General NGS Workflow

2

DNA DNA ShearingAdaptor and Barcode [opt] Attachment

Enrichment [optional] Template/Library Preparation

Sequencing Analysis

Why enrich?

Detecting rare variants requires enrichment + cost/time savings

3

1. Achieve many times greater coverage than with whole genome sequencing2. Multiplex many samples on 1 lane

Less cost per sampleMany samples analyzed in a single run

Enrichment Methods

4

Hybrid Capture Amplicon

PCRMicro droplet PCR

Haloplex™

AmpliSeq™ Panels

TruSeq™ Custom Amplicon

Comparing enrichment methods

5

Hybrid Capture Amplicon Enrichment

WorkflowMore complex

Slower (1-2 days)New fast protocol …

Less complexFast (< 1 day)

Cost Higher upfront costLower cost per sample

Lower upfront costHigher cost per sample

Problems Sequence / GC content bias Amplicon failuresSNPs in primer sites

Input DNA needed Med to High Low

Capture size 5 KB to Whole Exome5 KB to 1 MB

New whole exome available

ApplicationsVariant analysis

Gene expression / CNVSplice variantsTranslocations

Variant analysis

Two different approaches to capture probes

6

• Agilent or NimbleGen whole exome kits• Low quality, low yield oligo probes made on microarray chips• Advantage = cheap to make a million probes (capture >50 Mb)

• Perfect way to make whole exome sets• Disadvantage = low quality probes, cannot QC, no idea about individual

probe concentration• Variable capture efficiency between target loci, big “GC” bias effect• Difficult, slow and costly to change content

• IDT xGenTM LockdownTM Probes• High quality, high yield oligos made individually• Advantage = QC each oligo, measure and normalize yield prior to pooling• Improved capture efficiency between many loci• Disadvantage = higher price per probe (but high yield)

• Use for small focused sets or to spike into whole exome sets• Easy to change content just make another oligo and add to pool!• High yield makes it cheaper when running lots of samples

IDT UltramerTM synthesis: the key to xGenTM LockdownTM probes

7

• Ultramers = ultra long oligos made on a specialized synthesis platform with custom supports and its own synthesis cycle

• Highest possible coupling efficiency = long oligos can be made that otherwise could not be made. For 120mers, no need to purify!

• 60-200mers sold to customers (size limit is set by our ability to perform ESI MS QC); within IDT, we use 60-300mers in our gene synthesis group

UltramersTM can be made with high GC content (unlike arrays)

8

Calc. mass 37786.3 DaMeasured 37789.6 Da

BioGCGGCGAGCGGAGATCCGGGGCCTGCGCTGCGCACTCGAGCCTGGCGGGCCGGCACGGTGCGGGCCATGAGCGGGGCGGTGCCCCAGGACCTAGCGGTGAGTGGCGGCCGAGTCGGGCAC

ESI-MS trace of an xGENTM LockdownTM probe with 78% GC content

Two ways to use xGenTM LockdownTM Probes

9

1. Make your own small focused sets with 5-2000 KB coverage

2. Spike into whole exome array oligo sets to improve performance of products you may already be using

1. NimbleGen2. Agilent

Improve Agilent SureSelectTM – example from Foundation Medicine

10

• Custom Agilent SureSelectTM 1.1 Mbp capture array for Foundation Medicine• Prototype in development for oncology medical re-sequencing panel

• Problems seen with getting complete coverage of desired exons

• Spike in 1100 IDT xGenTM LockdownTM probes (5’-biotin, 120mers)• 135 Kbp coverage, duplicates what should already be in tiled array

• Sequence on Illumina HiSeq2000 platform

Foundation MedicineBoston, Massachusetts

Improve performance of whole exome capture kits (spike-in)

11

Foundation MedicineBoston, Massachusetts

Before supplementation with xGenTM LockdownTM probes

After supplementation with xGenTM LockdownTM Probes

Replace SureSelectTM with custom xGenTM LockdownTM Probe Library

12

Foundation MedicineBoston, Massachusetts

Results from Foundation Medicine comparing results of a large set of IDT xGenTM LockdownTM probes with a focused Agilent SureSelectTM set.

IDT xGEN: 100% >150x coverageAgilent: 80.7% >150x coverage

# Reads

IDT

Agilent

xGenTM LockdownTM Probes show less GC bias

13

Foundation MedicineBoston, Massachusetts

IDT

Agilent

Design of capture probes

14

xGenTM LockdownTM probes are high quality UltramerTM synthesis. Each oligo gets mass spec QC and is OD260 measured with quantity normalized.

SureSelectTM and other low quality array oligos need large overlaps. You cannot QC each oligo so you need to have high overlap to help ensure coverage.

Do mutations in target hurt capture efficiency?

15

• Short oligos can distinguish a single SNP site based on hybridization. Since the goal is to capture variants and detect these by sequencing, do we risk missing SNPs due to hybridization failure?

• Long 120mers, however, are very tolerant to mismatch

• How tolerant?

• Studied Tm of hybridization of a single 120mer bait oligo to different targets having 0-7 bases mismatch (either permissive G:T pairing or more disruptive T:T pairings)

• Also studied targets with 1, 3, or 7 base insertions (indels)

Design of 120mer Tm experiment

16

DTm with 1-7 base mismatches (SNPs)

17

Mismatches Tm oCMeasured

D Tm oCMismatch

Tm oCPredicted

0 85.7 -- 87.6

1 T-T 85.6 - 0.1 87.1

1 T-T 85.0 - 0.7 86.9

3 T-T 84.2 - 1.5 85.7

7 T-T 80.9 - 4.8 82.9

7 T-G 81.6 - 4.1 85.8

DTm with 1, 3, or 7 base insertions (indels)

18

Bulge Tm oCMeasured

D Tm oCMismatch

None 85.7 --

1 T 85.3 - 0.4

3 T 84.8 - 0.9

7 T 83.9 - 1.8

7 T + 7 T 82.3 - 3.4

7 C + 7 C 82.4 - 3.3

Conclusions from Tm studies

19

• 1-7 base mismatches had < 5oC DTm

• 1 or 2 1-7 base insertions had < 4oC DTm

• These small changes in Tm should not affect capture

• Thus use of 120mer capture probes is sufficient and should be effective in capturing targets even when a significant level of polymorphism is present

Blocking oligos – another critical component of enrichment/capture

20

Two classes of blocking oligos are needed:

1) Cot1 DNA = Alu, LINE repeat elements

2) linkers/adaptors

Importance of using Human Cot1 blocking DNA

21

Example: Merkel Cell Polyomavirus study:

Capture hyb with 1 ug Cot1 DNA Total Reads 7,603,264 Capture specific 520,304 Match to virus 6.8%

Capture hyb without Cot1 DNA Total Reads 2,313,487 Capture specific 57,967 Match to virus 2.5%

New product: xGen® Blocking Oligos

22

Two classes of blocking oligos are needed:

1) Cot1 DNA = Alu, Line repeat elements

2) linkers/adaptors

A new generation of blockers to improve this step in the enrichment process

New xGen® Blocking Oligos

23

In early experiment, simple DNA blockers proved to be effective. By adding excess blocker, ‘mass action’ drives hybridization in favor of the blocker-adaptor instead of the undesired blocker-blocker pairing.

However, in most experiments done today, either one or both adaptors contains an “index” or “bar code” sequence of 6-8 bases. Highly multiplexed experiments now have mismatched blockers binding to adaptors, and on-target capture rates dropped.

IDT offers a new solution to this problem: xGen® Blocking Oligos .The new generation of blockers incorporates Inosine bases to pair with index domains, so a single blocker can be used with all index variants. Further, the new blockers have additional improvements which increase effectiveness and give higher on-target capture rates.

Example of Inosine incorporation in one specific adaptor

24

TruSeq P7 Index 6 x I (also have 8 x I) CAAGCAGAAGACGGCATACGAGAT(IIIIII)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTx

TruSeq P5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTx

Note: Inosine is not a universal pairing base, as indicated by the decreasing stability (I·C > I·A > I·T ≈ I· G > I·I), it is most stable in a G-C base pair. However it does offer advantages over a N degenerate base, especially with longer indices.

Norman E. Watkins, Jr and John SantaLucia, JrNucleic Acids Res. 2005; 33(19): 6258–6267

In addition to Inosine, the blockers have proprietary changes made which improve performance.

Performance of xGen® Blocking Oligos with an 11,000 probe capture set

25

The IDT xGen LockdownTM Cancer Panel bait set (264 genes, 11,738 probes, 1.2 Mbp coverage) was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was performed in a multiplex hybridization reaction

with standard 48 hour hybridization.

Improved depth of coverage using xGen® Blocking Oligos

26

The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent libraries with unique index adaptors. The libraries were mixed and capture was

performed in a multiplex hybridization reaction with standard 48 hour hybridization.

New rapid 4 hour hybridization/capture reaction

27

The IDT xGen LockdownTM Cancer Panel bait set was used to enrich 4 independent libraries with unique index adaptors. The libraries were

mixed and capture was performed in a multiplex hybridization reaction using new buffers and protocols with only a 4 hour hybridization step.

Benefits of the new blockers: Foundation Medicine

28

Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon capture experiment using a focused set covering ~2Mb

StandardStandard Blockers xGen® Blocking Oligos

Foundation MedicineBoston, Massachusetts

Benefits of the new blockers: Washington University

29

Standard blockers and new IDT xGen® Blocking Oligos were compared in an exon capture experiment using a NimbleGen whole exome array (44Mb)

The Genome Institute, Washington UniversitySt. Louis, Missouri, USA

UnMod #1 Mod #2 Mod #3 Mod #4UnmodStandardBlockers

xGen® Blocking Oligos

Thanks to all the scientists who contributed to these studies!

30

Foundation MedicineMirna JaroszZac ZwirkoMichele Nahas

The Genome InstituteWashington UniversityElaine MardisBob FultonVince MagriniRyan Demeter

Integrated DNA TechnologiesScott RoseAshley DvorakKatie PoppBailey ClarkStephen GroenewoldRichard Owczarzy

LockdownTM Probe Technology Development Group

31

Ashley DvorakBailey Clark Katie Popp