in vitro analysis of the self-cleaving satellite rna of
TRANSCRIPT
Retrospective Theses and Dissertations Iowa State University Capstones, Theses andDissertations
1993
In vitro analysis of the self-cleaving satellite RNA ofbarley yellow dwarf virusStanley Livingstone SilverIowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd
Part of the Biochemistry Commons, Molecular Biology Commons, and the Plant PathologyCommons
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact [email protected].
Recommended CitationSilver, Stanley Livingstone, "In vitro analysis of the self-cleaving satellite RNA of barley yellow dwarf virus " (1993). Retrospective Thesesand Dissertations. 10274.https://lib.dr.iastate.edu/rtd/10274
_ U M I
MICROFILMED 1993 |
INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI
films the text directly from the original or copy submitted. Thus, some
thesis and dissertation copies are in typewriter face, while others may
be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins,
and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete
manuscript and there are missing pages, these will be noted. Also, if
unauthorized copyright material had to be removed, a note will indicate
the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, begiiming at the upper left-hand corner and continuing from left to right in equal sections with small overlaps. Each
original is also photographed in one exposure and is included in
reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white
photographic prints are available for any photographs or illustrations
appearing in this copy for an additional charge. Contact UMI directly to order.
University Microfilms International A Bell & Howell Information Company
300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 313/761-4700 800/521-0600
Order Number 9335023
In vitro analysis of the self-cleaving satellite RNA of barley yellow dwarf virus
Silver, Stanley Livingstone, Ph.D.
Iowa State University, 1993
U M I 300 N. ZeebRd. Ann Arbor, MI 48106
In vitro analysis of the self-cleaving satellite RNA of
barley yellow dwarf virus
by
Stanley Livingstone Silver
A Dissertation Submitted to the
Graduate Faculty in Partial Fulfillment of the
Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Department: Plant Pathology Interdepartmental Major; Molecular, Cellular, and
Developmental Biology
Approved:
In Charge of Major Work
or/the InterdeHartmental Major
For the
De^rtapiept
dM^^Co^ege
Iowa State University Ames, Iowa
1993
Signature was redacted for privacy.
Signature was redacted for privacy.
Signature was redacted for privacy.
Signature was redacted for privacy.
ii
DEDICATION
This dissertation is dedicated to my parents,
Stewart and Jean Silver
iii
TABLE OF CONTENTS
Page GENERAL INTRODUCTION 1
Group I Intron Splicing 1 Ribonuclease P; The First True RNA Enzyme 4 Group II Intron Splicing 6 Nuclear, Pre-mRNA Splicing 6 Small Catalytic RNAs 8 Reaction Mechanism 15 Target-specific Ribozymes 16 Barley Yellow Dwarf Virus 19 Satellite RNAs 20 Satellite RNA of Barley Yellow Dwarf Virus 2 6 Project Goals 27 Explanation of Dissertation Format 27
PAPER I. ALTERNATIVE TERTIARY STRUCTURE ATTENUATES SELF-CLEAVAGE OF THE RIBOZYME IN THE SATELLITE RNA OF BARLEY YELLOW DWARF VIRUS 3 0
ABSTRACT 32
INTRODUCTION 33
MATERIALS AND METHODS 38
Synthesis of wildtype and mutant self-cleavage structures 38
Self-cleavage assays 39 Synthesis of end-labeled RNA 41 Nuclease digestion 42
RESULTS 43
Self-cleavage of wildtype and mutant RNAs 43 Nuclease sensitivity 46
iv
Page
DISCUSSION 53
Effects of mutations on self-cleavage rate 53 Nuclease sensitivity 54 Comparison with other hammerheads 57
REFERENCES 61
PAPER II. NONCONSENSUS BASES IN THE sBYDV (+) RNA RNA AFFECT THE RATE OF HAMMERHEAD FORMATION AND SELF-CLEAVAGE EFFICIENCY 64
INTRODUCTION 66
MATERIALS AND METHODS 70
Synthesis of wildtype and mutant self-cleavage structures 70
Self-cleavage assays 72 Synthesis of end-labeled RNA and nuclease digestion 73
RESULTS 74
Self-cleavage of mutant RNAs 74 Nuclease sensitivity 79
DISCUSSION 84
Effects of mutations on self-cleavage rate 84 Nuclease sensitivity 86 Other hammerheads 88
REFERENCES 91
PAPER III. REPLICATION OF TRANSCRIPTS FROM A cDNA CLONE OF BARLEY YELLOW DWARF VIRUS SATELLITE RNA IN OAT PROTOPLASTS 94
ABSTRACT 96
INTRODUCTION 97
V
Page
Self-cleavage of dimeric sBYDV RNA 100 Dependence of sBYDV RNA replication on BYDV
genomic RNA 100 Replication of both strands of sBYDV RNA by a rolling
circle mechanism 105
REFERENCES 109
PAPER IV. BIMOLECULAR CLEAVAGE REACTION AND THE DESIGN OF TARGET-SPECIFIC RIBOZYMES 113
INTRODUCTION 115
MATERIALS AND METHODS 123
Construction of ribozymes 123 In vitro transcriptions and cleavage assays 126
RESULTS AND DISCUSSION 129
Bimolecular cleavage 129 Gene targeted ribozymes 132
REFERENCES 138
GENERAL SUMMARY
LITERATURE CITED
140
143
1
GENERAL INTRODUCTION
A ribozyme is defined as an RNA molecule that has the
inherent ability to catalyze cleavage or ligation of covalent
bonds (Kruger et al., 1982). The term ribozyme was coined
initially to describe the mechanism by which the intervening
sequence (IVS) of Tetrahymena thermophilia processes the
pre-rRNA to form mature rRNA. However, the IVS RNA is not
truly an enzyme since it does not exhibit turnover ability or
remain unchanged during the splicing reaction. Since the
initial discovery of ribozymes in 1982, many other RNAs have
been observed to exhibit autocatalysis. Such varied RNAs as
Group II mitochondrial introns, pre- tRNAs, nuclear mRNA
introns, several small, pathogenic RNAs, transcripts of
Neurospora plasmid DNA, and transcript II from newt all
demonstrate the capability of autocatalysis.
Group I Intron Splicing
Group I introns were the first RNA molecules demonstrated
to have at least quasi-catalytic activity (Kruger et al.,
1982). The splicing mechanism involves two
transesterifications (Cech et al., 1981; Fig. 1). The first
involves a free guanosine or a 5'- phosphorylated form of
guanosine serving as the nucleophile that attacks the
phosphorous atom at the 5' splice site, resulting in the
2
A. Group I intron splicing pQqh
Exon Intron Exon
B. RNase P cleavage
5—J 1—3" iWtRNA
i Ujp —Gpi ? < UIOH + pQp—Qp[
i V|P| k + pQp—QQH Excised intron
- c{ ̂5- _0H J L_3'
C. Group II intron self-splicing, nuclear pre-mRNA splicing
r~ IpQU A PI J I I OH ^A^p[ C3,
D. Self-cleaving, small pathogenic RNAs
—p §• SL A+ OH 2'-3'-cyclic phosphate
A^p Lariat structure
3'
Figure l. Four major types of RNA-catalyzed RNA cleavage. The rectangles with one jagged end represents a less-than-full- length exon. The pre-mRNA and Group II intron splicing mechanisms are shown together; even though both RNAs most likely use a different mechanism to form an efficient cleavage structure (Symons, 1991b).
3
formation of a 3' 5' phosphodiester bond between the
nucleotide cofactor and the 5' end of the intron. The free 3'
OH of exon 1 then attacks the 3' end splice site displacing
the intron and ligating exon 1 and 2 (Cech, 1990).
Efficient Group I intron splicing, in addition to the
nucleotide cofactor, requires specific secondary and tertiary
interactions within the RNA. The secondary structure consists
of a complex of nine stem-loops collectively called the
Michel-Davies model (Davies et al., 1982; Michel et al.,
1982) . Molecular modelling analysis, sequence comparisons,
mutational analysis, and enzymatic probing have verified
several of the proposed secondary features of the IVS RNA
(Been & Cech, 1986; Cech, 1988; Ehrenmann et al., 1989). The
tertiary structure is believed to form a cavity which
facilitates GTP binding, whereas the primary structure of the
IVS RNA confers RNA specificity via an internal guide sequence
located near the splice site (Davies et al., 1982; Waring
et al., 1986). In addition to RNA secondary and tertiary
interactions, proteins called mRNA maturases enhance RNA
splicing in Neurospora crassi (Garriga & Lambowitz, 1986) and
yeast mitochondria (Lazowaska et al., 1980).
Finally, the IVS RNA also undergoes a secondary
reaction that involves the cleavage of 19 nucleotides from the
5' end to form the molecule L-19 IVS (Zaug et al., 1986). The
4
L-19 IVS has recently spurred great interest in the concept of
using RNA molecules as target-specific endonucleases.
Ribonuclease F: The First True RNA Enzyme
Ribonuclease P (RNase P) was the first and only RNA
molecule shown thus far to have true catalytic activity
without prior modification (Zaug et al., 1986). In
prokaryotes a single gene may code for several copies of a
tRNA; therefore, excision of a single, mature tRNA requires an
endoribonucleolytic cleavage on both the 5' and 3' sides of
each pre-tRNA. This discussion will be limited only to the
events involved with the 5' pre-tRNA cleavage since the
enzymes(s) involved in 3' processing have not been identified
clearly. The 5' pre-tRNA sequence that undergoes cleavage is
not conserved and thus, RNase P must recognize a structure
common to all tRNA molecules. After recognition, the enzyme
specifically cleaves the RNA by base hydrolysis to produce the
5' terminus (Fig. IB). The RNase P holoenzyme consists of one
basic protein with a molecular mass of 14 kilodaltons (kD) and
one single-stranded RNA of 377 nts in Escherichia coli (Baer
et al., 1990) or 401 nts in Bacillus subtilis (Pace & Smith,
1990). Absence of either the protein or RNA component of
RNase P inhibits pre-tRNA cleavage under physiological
conditions (Baer et al., 1990). At high ionic strength,
however, the RNA component alone can efficiently cleave the
5
pre-tRNA. This observation led to the suggestion that the RNA
acts as the catalytic subunit and the protein serves to
stabilize RNA/tRNA interactions (Baer et al., 1990).
Using phylogenetic comparison of RNase P from B.
megaterium and E. coli, the putative secondary structure was
determined (Altmann, 1987). Structures within the RNA
component of RNase P include a pseudoknot (Pace & Smith, 1990)
and several nucleotides dispersed throughout the RNA that act
collectively to provide the RNA secondary structure required
for efficient pre-tRNA cleavage. Mutagenic analysis
identified specific regions within the RNA that associate with
the protein component (Shiraishi & Shimura, 1988). Finally,
UV-cross-linking experiments have revealed two widely
separated regions within RNase P that interact during the tRNA
splicing reaction (Burgin & Pace, 1990).
RNase P specificity for the pre-tRNA comes from an
external guide sequence (E6S) composed of the 3' sequence of
the tRNA acceptor stem (Fig. IB). The EGS of the pre-tRNA
binds RNase P adjacent to the cleavage site (Forster &
Altmann, 1990). For efficient cleavage, the EGS and a second
conserved sequence within the pre-tRNA -NCCA- must reside on
opposite strands. It has been proposed that a ribonuclease
that will cleave RNA in a site-specific manner could be
designed by modifying the EGS (Forster & Altmann, 1990).
6
Group II Intron Splicing
Group II intron splicing has been observed only in the
organelles of fungi and plants. To date, 70 Group II introns
have been characterized (for review see Michel et al., 1989).
Similar to pre-mRNA splicing. Group II intron splicing
involves a two-step transesterification (see discussion
below). Group I and Group II intron splicing differ with
respect to the chemical species that initiates the first
transesterification. A 3' OH from a free guanosine initiates
group I intron splicing, whereas, Group II intron splicing
results from an attack by a 2' OH from an adenosine located
within the intron (Fig. IC; Jacquier, 1990). The result of
the first nucleophilic attack in Group II intron processing is
a lariat structure consisting of the intron and exon 2. The
3' OH of exon 1 then attacks the 5' end of exon 2 resulting in
release of the intron and ligation of exon 1 and 2.
Currently, Group II intron splicing is believed the result of
specific folding of the RNA without a requirement for
proteins, trans-acting factors or adenosine (for review see
Michel et al., 1989).
Nuclear, Pre-mRNA Splicing
To translate active proteins from an mRNA template, cells
must have a highly specific mechanism to excise introns and
ligate the resulting exons. The mechanism evolved to perform
7
this function is both the most complex and least understood of
all the known RNA splicing reactions. Pre-mRNA splicing
involves formation of a lariat intermediate and proceeds via a
two-step transesterification reaction similar to Group II
intron splicing (Cech, 1990; Jacquier, 1990; Fig. IC). In the
pre-mRNA reaction, sequences adjacent to the 5' and 3' splice
sites and the branch point are required but not sufficient for
splicing (Ruby & Abelson, 1991). In addition to sequence
requirements, several small, nuclear RNAs (snRNAs) called Ul,
U2, U4, US, and U6 associate with the pre-mRNA along with
trans-acting factors and other proteins in a temporally and
spatially specific manner (for review see Ruby & Abelson,
1991; Zieve & Sauterer, 1990). ATP is also a required
component for the protein/nucleic acid interaction.
Presently, many other as yet unidentified proteins and
splicing factors are believed to be required for efficient
pre-mRNA processing (Ruby & Abelson, 1991).
It has been proposed that pre-mRNA splicing evolved from
the less complex Group II intron splicing mechanism (Jacquier,
1990). In pre-mRNA processing, the snRNAs are believed to
facilitate the folding of the pre-mRNA into a structure
capable of splicing. Group II introns, on the other hand, do
not require proteins for correct folding of the RNA (Jacquier,
1990). Determination of whether or not pre-mRNA processing
evolved from the Group II intron splicing reaction, will
8
require an answer to the question: is pre-mRNA splicing an
RNA- or protein- catalyzed reaction.
Small Catalytic RNAs
Another type of ribozyme, first observed in a small
pathogenic RNA of tobacco (Prody et al., 1986) results in the
production of RNA fragments with 2'-2' cyclic phosphate and 5'
OH termini (Fig. ID). The self-cleavage reaction occurs most
efficiently at pH 7.5 in the presence of MgClg and is
independent of a protein requirement (Prody et al., 1986).
There are four distinct classes of this small ribozyme based
on the primary and secondary structure at the cleavage site.
The first class of ribozyme was first observed in the
satellite RNA of tobacco ringspot virus (sToBRV RNA) (for
review of satRNAs see below). Terminal analysis of sToBRV RNA
cleavage fragments revealed the presence of a 5' hydroxyl and
a 2'-2' cyclic phosphate instead of the 5' phosphate and 3' OH
termini observed in Group I intron splicing. Since different
termini result from the small catalytic ribozyme, the cleavage
mechanism responsible for self-cleavage most likely uses a
different reaction pathway than either Group I intron or
pre-tRNA splicing. Furthermore, Mg'^^, which is specifically
required for Group I intron cleavage, can be replaced with
Mn^^, Pb®^, Zn^^, or even spermidine in the sToBRV cleavage
reaction. Finally, unlike Group I intron splicing, sToBRV RNA
9
cleavage occurs efficiently without GTP (Prody et al., 1986).
The mechanism proposed for sToBRV RNA cleavage involves a
phospho-transfer reaction (Fig. 2) using the ribosyl 2' OH on
the 5' side of the cleavage site as the nucleophilic species
that attacks the partially positive phosphate center (Prody et
al., 1986).
Figure 2. Phospho-transfer mechanism proposed for the small, catalytic ribozyme cleavage reaction (Symons, 1991b).
Comparison of six virusoid sequences and one satellite
RNA sequence revealed a highly conserved region that folded
into a hammerhead-shaped structure (Forster & Symons, 1987).
Table 1 lists all the known RNAs that form the hammerhead
motif. The hammerhead contains three helical domains (I, II
and III) and a central core of eleven highly conserved, mainly
single-stranded nucleotides (Forster & Symons, 1987) (Fig.
3A). Mutational analysis of the eleven conserved nucleotides
t o o
Table 1
Small RNAs capable of self-cleavage in vitro
RNA and cleavage structure Size SNA. strand Reference
I. Cleavage bj the hammerhead A. Viroid# Avocado sunblotch viroid (ASBVd) Carnation stunt associated viroid (CarSAVd) Peach latent mosaic viroid (PLHVd)
246--251 275 337 1
1 1 Hutchins et al., 1986
Hernandez et al., 1992 Hernandez, 1992
B. Encapsidated linear satellite RNAs of: Barley yellow dwarf virus (sBYDV) Tobacco ringspot virus (sToBRV) Arabis mosaic virus (sArBV)
359 322 -360 300
(+)/{-) (+) {+)
Miller et al., 1991 Prody et al., 1986 Bruening, 1989
C. Encapsidated circular satellite RNAs of: Lucerne transient streak virus,(vLTSV) Solanum nodlflorum mottle virus (vSNHV) Subterranean clover mottle virus (vSCMoV) Velvet tobacco mottle virus (vVTMoV)
324 378
3325388 366
(+)/(-) (+) (+) ( + )
Forster & Symons, 1987 Symons, 1989 Davies et al., 1990 Symons, 1989
D. RNA transcript of newt satellite II DNA 300 (+) Epstein & Gall, 1987
II. cleavage by hairpin/bent paperclip Encapsidated linear satellite RNA of ToBRV 359 -360 (-) Breuning, 1989
III. cleavage not fully defined Hepatitis delta virus RNA (HDV RNA) 1700 (+)/{-) Perotta S Been, 1990
IV. Cleavage by completely undefined structure Neurospora, linear and circular mitochondrial 800 (+) Saville & Collins, 1990 RNAs
11
A. ConMHMN hamtiMrtiMd OlMVIM
5 Œi'
NNNNN-
B. Htlrp(ne«ttlytlomocM
Catalytic RNA \
ciMvae* Substrats RNA
u AIM AC A QUO du uu cuoau m AOUC 40 JOAC euauu CO / U 1 111 II II nut 1 III 1*1111
CO /
CAO CA AO OACW
IV III II
c. HDV Moondary Mnielur*
S'— u
Figure 3. Structures of the three partially-characterized self-cleavage sites of small, pathogenic RNAs. (A) Hammerhead motif employed by the majority of small, self-cleaving RNAs. Nucleotides conserved among the known hammerheads are in boxes. (B) The hairpin structure at the cleavage site of sToBRV (-) strand RNA. (C) The proposed structure of the catalytic site of HDV.
12
demonstrated that all are critical for efficient ribozyme
activity (Ruffner et al., 1990; Sheldon & Symons, 1989). From
these observations the conserved nucleotides are believed to
be directly involved in the formation of the correct secondary
and tertiary structure required for cleavage. Mutations
involving the non-conserved bases of the hammerhead decreased
the cleavage rate by inducing hammerhead instability (Ruffner
et al., 1990). Mutation analysis of the hammerhead
corroborates the prediction that as the stability of the
hammerhead increases, so does the transition state stability
with the end result being a faster cleavage rate (Ruffner et
al., 1989; Ruffner et al., 1990). However, recent studies of
an intermolecular-type ribozyme reaction suggested the
possibility that the transition state, i.e. the hammerhead,
should be sufficiently unstable to decrease the activation
energy needed for cleavage (Fedor & Uhlenbeck, 1992).
Therefore, the fastest cleaving RNAs will form a hammerhead
with the least amount of energy.
A second type of ribozyme was observed in the sToBRV RNA
(-) strand (Table 1). This class utilizes a "hairpin"
structure to achieve efficient site-specific cleavage (Hampe1
et al., 1990; Fig. 3B). Site-directed mutagenesis identified
the nucleotides instrumental in hairpin structure (Hampe1
et al., 1990; Haseloff & Gerlach, 1989). Two discrete regions
of RNA are required for efficient sToBRV (-) strand cleavage.
13
One region maps to a 12 nucleotide sequence in the proximity
of the cleavage site, whereas the second maps to a position
approximately 124 bases downstream of the cleavage site
(Haseloff & Gerlach, 1989). The hairpin motif contains four
helical domains that, when disrupted, result in loss of
activity (Hampel et al., 1990). Sequences within the sToBRV
RNA basepair to form the four helices that permit efficient
self-cleavage. In addition to the sToBRV (-), the nucleotides
of the pre-mRNA splicing component U6 snRNA can be envisioned
to fold into the hairpin structure. Whether or not U6 snRNA
catalyzes the cleavage step in pre-mRNA splicing will require
further study (Tani et al., 1992).
Hepatitis delta virus (HDV) (+) and (-) sense RNA
represents a third class of ribozyme associated with a small,
pathogenic RNA (Table 1). The HDV RNA is approximately 1700
nts in length and by far larger than any of the self-cleaving
RNAs that infect plants. The only requirements for cleavage
are a neutral pH and Mg^^ (Kuo et al., 1989; Sharmeen et al.,
1988).
Computer modelling and mutation analysis of the
full-length HDV RNA indicated four helical domains form
during the cleavage reaction (Been et al., 1992; Fig. 3C).
Mutations that partially disrupt the helical domains result in
decreased cleavage rates. A putative tertiary interaction
involves the formation of a pseudoknot between stem I and stem
14
II that may facilitate HDV RNA cleavage (Perrotta & Been,
1991). Deletions of the HDV RNA demonstrated that a minimum
of 88 nts was sufficient for cleavage (Wu et al., 1990).
Further deletions of the HDV RNA made using an alkaline
degradation method showed an even smaller molecule could
self-cleave in vitro. The minimum sequence required for
cleavage includes one nucleotide upstream of the cleavage site
and the 84 nts downstream of the cleavage site (Perrotta &
Been, 1991) (Fig. 3C). This shortened version of the HDV RNA
still has the potential to fold into a structure with two
stem-loops. Using HDV RNA molecules of varying lengths,
site-directed mutagenesis and computer modelling experiments
provide equivocal data on the relative importance of the
helical structures and single-stranded regions (Perrotta &
Been, 1991; Thill et al., 1991; Wu et al., 1989; Wu et al.,
1992) . The helices possibly serve indirectly in the formation
and stability of the cleavage structure under various in vivo
conditions (Perrotta & Been, 1991).
The last known type of small catalytic RNA was isolated
from mitochondria of the Varkud-lc strain of Neurospora
(VSRNA). VSRNA is approximately 800 nts in length and exists
in either a circular and/or linear form (Saville & Collins,
1990; Table 1). Both forms exist as long multimers in vivo.
RNA transcribed from a VSDNA clone and incubated in the
presence of Mg'^^ at neutral pH underwent a site-specific
15
cleavage with the formation of 5' OH and a 2'-3' cyclic
phosphate fragments (Saville & Collins, 1990). A search of
the VSRNA did not uncover any conserved sequences present in
the other small, self-cleaving RNAs motifs. Presently, the
secondary and tertiary interactions required for efficient
Neurospora VSRNA self-cleavage are unknown.
Reaction Mechanism
The one underlying theme of all RNAs that undergo
self-cleavage is the importance of secondary and tertiary
interactions that permit a particular phosphodiester bond to
become sufficiently labile to cleave in the absence of a
protein catalyst. Thus far, proteins involved in
RNA-catalyzed RNA cleavage reactions seem to serve as
stabilizers for the RNA secondary structure required for
cleavage. RNAs that self-cleave using the hammerhead motif do
so by a phospho-transfer mechanism similar to base hydrolysis
(Fig. 2). Computer modelling studies of the hammerhead
suggest: (i) the base at the cleavage site does not interact
with other bases, (ii) the ribose-phosphate backbone at the
cleavage site makes a sharp turn and (iii) the conformation of
the ribose at the cleavage site becomes 2' endo (Mei et al.,
1989). Collectively, these changes ensure that a specific
phosphodiester bond is cleaved via an "in-line" attack by the
16
2' OH of the ribose on the 3' P to form the products with 2',
3' P, and 5' OH termini (Mei et al., 1989).
The role plays in RNA-catalyzed RNA cleavage is still
unclear. In Group I introns and the hammerhead ribozymes, Mg^*
coordinates with one specific Pro-R oxygen (Dahm & Uhlenbeck,
1991; Slim & Gait, 1991; Uchimaru et al., 1993). By changing
which Pro-R oxygen Mg^"*" binds, Uchimaru
et al. (1993) observed cleavage of normally resistant
phosphodiester bonds. Therefore, it seems RNA secondary and
tertiary structure determines which Pro-R oxygen Mg^^ binds and
ultimately specifies which phosphodiester bond is cleaved.
Whether Mg^"*" serves a similar role in the hammerhead-type
ribozyme cleavage will require further study.
Target-specific Ribozymes
Soon after RNA molecules were shown to self-cleave in
vitro, the concept of targeting the catalytic portion of these
self-cleaving molecules against a given substrate RNA was
proposed (Haseloff & Gerlach, 1988; Uhlenbeck, 1987; Zaug
et al., 1986). Of the known RNA ribozymes, the hammerhead
type is by far the smallest and best characterized.
Subsequently, the hammerhead ribozyme currently is most widely
used for targeting cleavage of a specific RNA. The first step
in constructing a target-specific ribozyme was to determine
whether or not the catalytic domain of the hammerhead would
17
function in an intermolecular fashion. The first
intermolecular reaction involved the sequences from the
avocado sunblotch viroid (ASBV) hammerhead (Uhlenbeck, 1987).
The ribozyme (Rz) was composed of all the conserved hammerhead
nts with the exception of the sequence GAAA and the U at the
cleavage site which were made part of the substrate RNA (S)
(Uhlenbeck, 1987; Fig. 4A). When the S and Rz were combined
at neutral pH in the presence of Mg^"*", cleavage of the
substrate RNA was observed. This result proved conclusively
that the hammerhead ribozyme could effectively cleave RNA in a
bimolecular manner if a minimum sequence (in this case only 43
nts) which contained all 11 conserved nts of the hammerhead
motif were present (Uhlenbeck, 1987).
Haseloff and Gerlach (1988) constructed a similar
bimolecular system to test the Rz sequence from the sToBRV (+)
strand hammerhead. In their system, the substrate sequence
had only one conserved base from the hammerhead and the
CUGANGA and GAAA sequences were part of the Rz (Fig. 4B).
Target arms complementary to the substrate RNA were then
combined with the catalytic domain of sToBRV to produce the
complete ribozyme. When targeted against the chloramphenicol
acetyltransferase (CAT) mRNA, they observed specific and
efficient cleavage (Haseloff & Gerlach, 1988). Since this
initial account, many ribozymes have been successfully
targeted against a host of RNAs (for review see Symons,
18
A. C C G
Substrate
pppGÇGÇÇ® hoC Q C G G ^ gAGCUCGGppp
U4® Ribozyme
B.
5> Substrate xxxxxx
I
3' xxxxx
f
II
C-G U AU G'C G'C
A G G U
3' lyyyyOxxxxxx xxxxxx
Ribozyme
Figure 4. (A) Division of the ASBV hammerhead into substrate and catalytic domains (adapted from Uhlenbeck, 1987). Conserved bases of hammerhead are in bold italics. Arrow indicates cleavage site. (B) Gene-targeted ribozyme as proposed by Haseloff and Gerlach (1988). (I) indicates the one conserved nt in the substrate RNA. (II) identifies the target-arms which give specificity to the ribozyme. (Ill) is the catalytic domain of the ribozyme. Arrow indicates cleavage site, (adapted from (Haseloff & Gerlach, 1988).
19
1991b). RNAs successfully cleaved in vivo by a gene-targeted
ribozyme include U7 snRNA, c-fos mRNA, HIV-1 RNA and the
a-sarcin domain of 28S RNA (Gotten et al., 1989; Sarver
et al., 1990; Saxena & Ackerman, 1990; Scanlon et al., 1991).
Unfortunately, many of the gene-specific ribozymes, when
tested in vivo, do not cleave their substrate RNA effectively.
Parameters such as in vivo reaction conditions, length and
composition of the ribozyme target arms and alternative
conformations within the target arms all can dramatically
affect the ribozyme's ability to cleave in vivo (see Section
IV for further details). Further work will be required in
order to design a rational approach to ribozyme design.
Barley Yellow Dwarf Virus
Barley yellow dwarf virus (BYDV), the type member of the
luteovirus group of plant viruses, was classified as a new
virus in 1951 (Oswald & Houston, 1951). From the historical
record, however, symptoms of the virus were observed as early
as the late 1800s. BYDV is now recognized as the most
destructive virus capable of infecting small grains including
oats, barley, and wheat (Plumb, 1983). In fact, grain yield
losses observed from intentional BYDV infections of some wheat
varieties have been greater than 60%. Even naturally
occurring infections can result in a greater than 25% grain
yield loss (Yamani & Hill, 1991). Symptoms of BYDV infection
20
include yellowing of plant tissue, moderate to severe stunting
of the plant and, in severely affected plants, heads with many
blasted or sterile spiklets. BYDV is phloem-limited and
aphid-transmitted in a circulative and persistent manner. The
virus particle consists of approximately 180 subunits of the
22kd coat protein (CP) arranged as an icosahedron with a
diameter of 24 to 30 (nm). Five different serotypes of BYDV
have been classified according to aphid specificity and
serological characteristics (Rochow, 1970). These serotypes
can be grouped into two subgroups based on their genome
organizations, cytopathological effects, and serological
relatededness. BYDV serotypes MAV, PAV and SGV belong to
subgroup I and RMV and RPV belong to subgroup II. The
complete nucleotide sequence of an Australian isolate of
BYDV-PAV was determined and the genome organization deduced
(Fig. 5A; Miller et al., 1988). The BYDV genome consists of a
single (+) sense RNA approximately 6kb long. Gene expression
strategies used by BYDV include a -1 ribosomal frameshift
(Brault & Miller, 1992), subgenomic RNA synthesis, and an
internal initiation and readthrough event (Dinesh-Kumar
et al., 1992).
Satellite RNAS
Several types of RNA exist that either by themselves or
with the aid of a helper virus, can infect plants and cause
disease. A short summary of each type is given below.
21
Frameshift
Readthrough
CP
mm# 39K
22KK ̂I7K
5* Leaky Scanning
6.7K
3'
•sgRNM sgRNA2
B 71K j 22K
m 72mmmm 17K
5' 3'
Figure 5. Genome organization of BYDV. Panel A is the genome organization of BYDV-PAV of subgroup I. Panel B depicts the genome organization of BYDV-RPV of subgroup II. Open reading frames are depicted by rectangles with the molecular mass of the putative translation product inside, abbreviation; sgRNA, subgenomic RNA (Miller et al., 1988; Vincent et al., 1991).
22
1. Satellite viruses are defective viruses that encode
the genetic information for their own coat protein. They
require a helper virus for replication.
2. Defective interfering RNAs (DI RNA) are viral RNAs
that have lost a portion of the virus genome. Replication
requires the presence of a full-length copy of the virus. DI
RNAs, by definition, interfere with normal virus replication.
3. Viroids are unencapsidated RNA molecules ranging from
246 to 375 nts in length that do not require a helper virus
for replication. Viroids exist as covalently closed,
circular molecules that have a high degree of basepairing and
thus are quite stable.
4. Satellite RNAs (satRNA) are defined as (i) completely
dependent on a helper virus for replication, encapsidation and
spread, (ii) having no known sequence homology with the plant
or viral genomes, and (iii) not being required by the helper
virus. SatRNAs range from 300 to over 1400 nts in length.
5. Virusoids are a type of satRNA that vary in size from
324 to 388 nts and are encapsidated primarily as circular
molecules. Thus far only the sobemovirus group of plant
viruses demonstrate the ability to support virusoid
replication.
6. Satellite-like RNAs are molecules that have qualities
of a satRNA but do not fit completely the classical definition
of a satRNA.
23
For the purpose of this discussion, only the satRNAs will
be discussed in detail.
SatRNAs can be divided into two groups based on their
length and coding capacity (Table 2). Large satRNAs
associated with the nepovirus group of plant viruses have the
ability to direct protein translation (Roossinck et al.,
1992). At present, the role if any these proteins play in
satRNA biology is unknown. The second group of smaller
molecular weight RNA molecules does not direct translation of
proteins in vivo.
The first small satRNA was found associated with tobacco
ringspot virus (sToBRV RNA) (Schneider, 1969). Further study
of sToBRV RNA revealed the presence of both multimeric and
circular forms in vivo (Schneider, 1977). Since the initial
discovery of sToBRV RNA, small satRNAs of the sobemovirus
(virusoids) and luteovirus groups have been found which also
form multimeric and circular molecules in vivo (Francki, 1985;
Keese & Symons, 1987; Miller, et al., 1991). These
observations led to the proposal that these RNAs replicate via
a rolling circle pathway (Branch & Robertson, 1984; Hutchins
et al., 1985). A general outline of the rolling circle
mechanism is depicted in Figure 6. After the virion enters
the plant, the satRNA is uncoated. The (+) strand then
circularizes followed by replication via the virally-encoded
RNA-dependent RNA polymerase to produce long multimers of (-)
24
Table 2
Summary of satellite RNAs. This list contains known RNAs that
fit the classical definition of a satellite RNA.
Abbreviations; NR. no report; <-) no translation products
detected; helper virus abbreviation in parentheses; kP.
kilodaltons ^adapted from Roossinck. et al.. 19921.
Mol Mass of Helper Virus # nts encoded proteins (kD)
Large satRNAs
Tomato blackring virus (TBRV) 1375 Chickory yellow mottle (CYMV) 1145 Arabis mosaic virus (ArMV) 1104 Strawberry latent ringspot (SLRV) 200 Myrobalan latent (MLRV) 1400 Grapevine Bulgarian latent (GBLV) 1500 Grapevine fanleaf (GFLV) 1114 Pea enation (PEMV) 900
Small saRMAs Cucumber mosaic virus (CMV) Peanut stunt virus (PSV)
Tobacco mosaic virus (ToBRV) Arabis mosaic virus (ArBV)
Barley yellow dwarf (BYDV)
333-342 369-393
359 300
322
Virusolds Velvet tobacco mottle (VTMoV) 365 Solanum nodiflorum mottle (SNMV) 377 Lucerne transient streak (LTSV) 324 Subterranean clover mottle
48 40 39 38 45 NR 37 NR
2-3.9
NR
NR
(SCMoV) 332, 388 NR
25
strand satRNA. In sBYDV RNA, the (-) strand multimer cleaves
into monomers that act as templates for (+) strand synthesis.
Similar to the (-) strand, the (+) strand multimers undergo
cleavage to form the encapsidated monomer.
(•)
(•)
• • ##IW*av#g#
Virus partcle
(+)
\ (+)
(•)
- ©
• •
Figure 6. Rolling circle replication model. Arrows indicate cleavage sites (adapted from Symons, 1991a).
Demonstration of the autocatalytic capabilities of Group
I intron RNA (Kruger et al., 1982) and the ability of RNase P
to cleave pre-tRNA into a mature tRNA (Guerrier-Takada et al.,
1983) led Hutchins et al. (1985) to propose that these small,
pathogenic RNAs cleaved in a manner analogous to the
26
RNA-catalyzed RNA cleavage of Tetrahymena Group I introns.
Evidence for the autocatalytic cleavage of the multimeric
satRNA into monomers was provided by Prody et al. (1986), who
demonstrated the ability of sToBRV to cleave in vitro
(discussed previously).
Satellite RNA of Barley Yellow Dwarf Virus
Some isolates of BYDV-RPV contain a satellite RNA (Miller
et al., 1991). Labeled cDNA of sBYDV RNA hybridized to a
multimeric series of bands from purified virion RNA but not to
genomic BYDV-RPV RNA. The smallest and most abundant band
corresponded to an approximately 320 nt long RNA believed to
be the monomer. Detection of a multimeric series as well as
circular forms of RNA suggest the RNA replicates by a rolling
circle mechanism (Miller et al., 1991). The RNA sequence was
first determined by sequencing several overlapping cDNA
clones. Most clones contained a 321 base pair repeat,
consistent with the size estimated for the monomer by
electrophoresis. Direct RNA sequencing revealed an A residue
at the 3' end of the monomer that was absent from these
clones. Thus the satRNA is actually 322 nts long.
Several of these same clones were tested for cleavage
ability by in vitro transcription. The clones that contained
the extra adenosine cleaved efficiently, while those that
lacked the A cleaved poorly. Both the (+) and (-) strands of
27
the RNA have the conserved hammerhead self-cleavage motif at
the site of cleavage. Closer examination of the (+) strand
cleavage site revealed several sequence differences relative
to the other known hammerheads (see Fig. 7A).
In addition, the sequence at the (+) strand cleavage site
predicted a novel secondary structure which included a
putative pseudoknot due to basepairing between nts 6-10 and
34-30 (Fig. 7B).
Project Goals
This project addressed three major goals. The first goal
was to demonstrate the presence or absence of the proposed
alternative structure at the sBYDV RNA cleavage site, and
determine the significance of the nonconsensus bases present
in the sBYDV RNA hammerhead. The second goal was to prove
that the small molecular weight RNA associated with BYDV-RPV
is in fact a satRNA. The third goal of the project was to
design, construct, and test gene-targeted ribozymes predicted
to cleave BYDV genomic RNA.
Explanation of Dissertation Format
This dissertation contains three papers either published
or in preparation for publication and one manuscript not
expected to be submitted for publication at the present time.
Paper I contains work performed by myself and W. A. Miller.
28
dMvagt •ito
310 S20_ Tl AO F UAUUUC QUQQAB ̂ACAQ *0 > I I I .i.W I I I I a 3' MJOMa^CAOSilj^ iiniir>. a
daavagi •ity
110 »0_ Tl 6* UWUUÇ Quao ACAQ ÙàÙCi
y-AXg
I i I I i I Mill, 3' AUOAAOqC^CUI
B Hammerhead
*g:§ Aj®-0 ,^-Cao
.>3
stacked helices (pseudoknot)
Figure 7. Alternative structures for the self-cleaving ribozyme in sBYDV (+) strand RNA. Panel A is sBYDV (+) RNA folded in the hammerhead motif. Panel B is sBYDV folded as the alternative structure when basepairing occurs between nts 6-10 and 30-34. Boxed bases are conserved among all hammerheads. Bases that differ from consensus are shown in outlined text. Numbering of nucleotides is based on the full-length satellite RNA (Miller & Silver, 1991).
29
Even though Miller is the principal author of Paper I, it was
included in my dissertation since the work is so closely
related to Paper II.
Specifically, Miller constructed mutants Ml, M19, and
M20, and I constructed mutants M2, Ml/2, M/19/20, and M5.
Miller performed cleavage assays on all the mutant transcripts
with the exception of MS. All nuclease sensitivity analysis
was done by Miller.
Papers I and II are formatted for publication in Nucleic
Acids Research. Paper III is a paper submitted to the journal
Virology. Finally, Paper IV reports on research performed by
myself but not ready for publication. References cited in the
INTRODUCTION and the GENERAL SUMMARY are listed in the
LITERATURE CITED section that follows the GENERAL SUMMARY.
30
ALTERNATIVE TERTIARY STRUCTURE ATTENUATES SELF-CLEAVAGE OF THE RIBOZYME IN THE SATELLITE RNA OF BARLEY YELLOW DWARF VIRUS
31
Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus
Miller W.A., Ph.D.
Silver, S.L., M.S.
From the Department of Plant Pathology, Iowa State University, Ames, lA 50011
32
ABSTRACT
A self-cleaving satellite RNA associated with barley-
yellow dwarf virus (sBYDV) contains a sequence predicted to
form a secondary structure similar to catalytic RNA molecules
(ribozymes) of the "hammerhead" class (17). However, this RNA
differs from other naturally occurring hammerheads both in its
very slow cleavage rate, and in some aspects of its structure.
One striking structural difference is that an additional helix
is predicted that may be part of an unusual pseudoknot
containing three stacked helices. Nucleotide substitutions
that prevent formation of the additional helix and favor the
hammerhead increased the self-cleavage rate up to 400-fold.
Compensatory substitutions, predicted to restore the
additional helix, reduced the self-cleavage rate by an extent
proportional to the calculated stability of the helix.
Partial digestion of the RNA with structure-sensitive
nucleases supported the existence of the proposed alternative
structure in the wildtype sequence, and formation of the
hammerhead in the rapidly-cleaving mutants. This tertiary
interaction may serve as a molecular switch that controls the
rate of self-cleavage and possibly other functions of the
satellite RNA.
33
INTRODUCTION
Some viruses in the nepo-, luteo-, and sobemovirus groups
contain small satellite RNAs that replicate via a rolling
circle mechanism (reviewed in 1,2). Circular and multimeric
forms of these RNAs undergo self-cleavage at a specific site
to generate the monomeric form that predominates in the virus
particle. This self-cleavage is catalyzed by a subset of the
satellite RNA sequence (ribozyme) flanking the cleavage site
that is predicted to fold into a hammerhead-shaped structure
(3, 4; reviewed in 5). One viroid, avocado sunblotch viroid
(ASBV, 6), and the transcripts of satellite 2 DNA of newt also
self-cleave at a hammerhead structure (7). The consensus
hammerhead structure consists of three short helices, whose
sequences are not conserved, joined together by short single-
stranded regions, most of which are conserved at the primary
structure (sequence) level. In contrast, the loops connecting
the distal portions of the helices can be varied in sequence
(8), or removed altogether (9, 10), without loss of ribozyme
activity. Much effort has been devoted to elucidation of the
structure-function relationships of hammerhead ribozymes,
including mutagenesis of the helices and the conserved single-
stranded bases (11-16).
34
A self-cleaving satellite RNA was recently reported
associated with the RPV serotype of barley yellow dwarf virus
(sBYDV, [17] GenBank Accession number M63666). This is the
first known satellite of a member of the luteovirus group.
Encapsidated sBYDV RNA is a predominantly linear monomer, 322
nucleotides (nt) long, and it encodes no long open reading
frames. In being a linear molecule it more closely resembles
the satellite RNA of tobacco ringspot virus (sTobRV, 2) than
the satellites of the sobemoviruses (also known as virusoids)
in which the circular monomer is the most abundant form.
The (-) strands of some but not all of the self-cleaving
satellite RNAs also self-cleave, indicating variations in the
rolling circle mechanisms (1, 2). Both the encapsidated (+)
strand and the (-) strand of sBYDV RNA self-cleave (17). The
(-) strand self-cleaves extremely rapidly and contains a
perfect consensus hammerhead sequence flanking the self-
cleavage site (5, 14). The sequence flanking the cleavage
site in the encapsidated (+) strand of sBYDV fits most of the
consensus rules for formation of a hammerhead structure.
However, the (+) polarity sBYDV hammerhead differs from other
naturally occurring hammerheads in at least three features
(Fig. 1). First, the trinucleotide at the 5' side of the
cleavage site is AUA, instead of GUC, which is found in all
naturally occurring hammerheads except that of lucerne
transient streak virus satellite (sLTSV) that cleaves at GUA
35
320, dMvage
%-sli 9' AÛàÀAàoCÂCCW^ I'lni'ie. Q
310 f UAUUucouaaA 11 1111 II III
c-a A-U
rou-A A-U
s::%a c-a CigHli
""QQ"
Hammerhead
dMvac
310 ILSa S20_ tllidU '̂Q-C 5* UAUuucauaaA^ACAa^c-3' ÀÙÔÀMtC^ ®-
L2c
ik 1-1®
-CSG A"
B
'̂ 1
Stacked helices (pseudoknot)
Figure l. Proposed alternative structures for the self-cleaving ribozyme in sBYDV (+) strand RNA. Boxed bases are conserved among all hammerheads (5). Bases that differ from consensus are shown in outlined text. Numbering of nucleotides is based on the full-length satellite RNA (17). Numbering of the three major helices (HI, H2, H3) of the hammerhead is as in (4, 5). Single-stranded regions (loops) are prefixed with L. The individual helices and loops within compound stem-loop 2 are labeled as lettered subsets. Bases in loops LI and L2a expected to form the additional helix are in italics. Cleavage structure is drawn as a hammerhead (A) without Ll-L2a base pairing, and in the alternative conformation (B), in which LI and L2a base pair without disruption of other helices to form a pseudoknot with three stacked helices. Because of difficulties in two dimensional representation, lines indicating phosphodiester bonds have been added as necessary. Note the coaxial alignment of three helices in B with the helix derived from LI and L2a in the center.
36
(4). However, functional hammerheads have been constructed
with many variations from GUC (7, 14). Second, an unpaired
cytosine (C-24) is present immediately 3' to the conserved
single-stranded CUGANGA sequence, and an unpaired adenine
(A-73) occurs immediately 5' of the conserved GAAAN sequence.
In almost all other cases, bases in these positions are
hydrogen bonded to form the first pair of the vertical helix 2
(5, 14). No others have an unpaired base analogous to A-73.
The third and most striking, unusual feature is the
subject of this paper: the "loop" (LI) connecting strands of
helix 1 (HI) would be expected to pair with a sequence (L2a),
which is drawn as a single-stranded loop in the hammerhead
conformation in compound helix 2 (Fig. 1). The calculated
stability of the helix formed by Ll-L2a base pairing
(AG = -10.1 kcal/mol) is the strongest in the entire satellite
RNA. Thus, structures containing the Ll-L2a helix may be
energetically preferred, and loops LI and L2a would not be
expected to remain single-stranded as shown in the hammerhead
conformation in Fig. lA. Because the formation of the Ll-L2a
helix does not replace any of the base pairing involved in
hammerhead formation, it may be possible for all helices to
remain intact, giving the unusual pseudoknot-like structure
shown in Fig. IB. This structure contains an interesting set
of three coaxially stacked helices, the central one being the
37
Ll-L2a helix. Although such a structure may not be possible
due to torsional constraints, we sought to determine if it
could form by observing the effects of mutagenesis of the
putative Ll-L2a helix on the self-cleavage rate, and on
overall secondary and tertiary structure.
38
MATERIALS AND METHODS
Synthesis of Wildtype and Mutant
Self-cleavage Structures
RNA molecules were synthesized by in vitro transcription
of sequences in phagemid pGEM3Zf(-) (Promega, Madison, WI).
Mutations were introduced by the method of Kunkel (18), using
a kit from Biorad (Richmond, CA). Plasmid pSSl contained the
wildtype (+) strand sBYDV hammerhead sequence: bases 310-322
and 1-89 of the satellite sequence (Fig.s 1 and 2). Cleavage
occurs between bases 322 and 1. pSSl was derived from the
slightly larger plasmid pPCSl (17) by site-directed
mutagenesis with the primer:
5' GTTATCCACGAAATAGGA'ICCTATAGTGAGTCGTATTAC 3'. Bases 5' of
the apostrophe are complementary to satellite RNA sequence.
The complement of the T7 RNA polymerase promoter is shown in
italics. This resulted in deletion of 25 vector-derived bases
and 11 satellite RNA bases not involved in formation of the
hammerhead structure. Transcripts of Xjbal-linearized pSSl
and mutants contained vector bases G6A and CUCUAG at the 5'
and 3' ends, respectively. The following plasmids containing
mutant sBYDV self-cleavage structures were constructed with
39
the indicated primers. (See maps and sequence alterations in
Fig. 2.)
pMl: 5' CGTCGTCAGACAGTAGGGCCTCTGTTATCCACGAA 3';
pM2: 5' CCAGCCTTCTAGTCCGGCCCGATACGTCGTCAGAC 2';
pM19; 5' AGACAGTACGAGCTCTGTTATC 3'; pM20; 5'
TTCTAGTCCGCTCGGATACGTCG 3'; pM5: 5'
GGATTTCTGTATCTATT'GATACGTCGTCAGAC 3'. Underlining indicates
base changes, and the apostrophe indicates site of deletion.
All plasmids were sequenced in the transcribed regions by the
dideoxy method with Taq polymerase (Promega). In our
nomenclature, a plasmid and its transcript are named similarly
except that the "p" of the plasmid name is omitted in
designating the transcript.
Self-cleavage Assays
[a-^'pjUTP-labeled RNAs were transcribed in vitro as
described previously (17) from XJbal-linearized plasmids.
Uncleaved transcripts were purified by elution (19) after
electrophoresis of transcription products on an 8%
polyacrylamide, 7M urea gel. Self-cleavage reactions
contained approx. 10,000 cpm gel-purified, uncleaved
transcription product, 1 mg/ml tRNA, 50 mM Tris, pH 7.5, and
10 mM MgClg. Reactions were started by addition of the MgCl^.
To stop the reaction, 5 /il aliquots were removed at designated
time points, added to an equal volume of 7 M urea, 30 mM EDTA
40
pSSI and mutant leti I and II
aawaga product!: ' le ; j 101
PM5 , f — 77 aio T LI M Xbm\
nzzzzzzzzzB^ OMwaga , products; is 07
B 881
(wlldtyp*)
Au/y_yoii!i LC
M19/20
?• ~2000
NA kcalAnol 11 mln
Figure 2. A. Maps of inserts in transcription plasmids. Large bold box represents sBYDV RNA sequence; shaded regions (flanking bases 310 and 89) are not required for hammerhead formation. Horizontal arrow marks the transcription start site; vertical arrowhead indicates self-cleavage site. Expected cleavage products of transcripts generated by T7 polymerase-catalyzed transcription of XJbal-linearized DNA are shown as bold lines below map. Sizes of transcripts (in nt) are indicated below each one. Specific changes in LI and L2a (shaded with diagonal lines) in mutant sets I and II are shown in panel B. Dashed lines indicate region (bases 30-63) of pSSl that was deleted in pM5. B. Schematic representations of mutants with base changes (outlined text) in the putative Ll-L2a helix. Mutants are grouped into sets I and II as described in the text. Only the sequences of LI and L2a are shown. Their positions in the hammerhead are shown in SSI (wildtype) at left. Empty box in mutant M5 represents deletion of L2a sequence. The name of each mutant (above) and free energies (below) of potential Ll-L2a helices are indicated. Helices were identified and free energies calculated by using the RNA Structure Editor (RNASE) computer program (23) which used the parameters in (40). NA = not applicable. The bottom line shows the half-lives (tj/a) of uncleaved RNAs calculated from graphs in Fig. 3.
41
and immediately frozen at -SO^C. Samples were thawed and
denatured by boiling for one min immediately prior to
electrophoresis on 8% polyacrylamide, 7 M urea sequencing-type
gels. Bands were cut out and radioactivity determined by
liquid scintillation counting.
Synthesis of End-labeled RNA
Each of the steps below was terminated by making
solutions 50 mM in EDTA, extracting once with phenoliCHClg
(1:1), and ethanol precipitation in 2M ammonium acetate pH
6.2. Step 1: Unlabeled transcripts were synthesized as
described above except that the reactions contained: 5 -
15 mg of linearized template, 0.5 mM of all four NTPs, 100
units RNasin, in a 100 ml final reaction volume. Step 2:
Transcription products were treated with 5 units calf
intestinal phosphatase for 10 min in the absence of magnesium
as in (20). Step 3: End-labeling reactions (50 ml) contained
dephosphorylated transcript, 40 units RNasin, 100 mCi
[a-®^P]ATP (3000 Ci/mmole), 10 units polynucleotide kinase, 50
mM Tris, pH 8.0, 10 mM MgClg. To minimize self-cleavage
during labeling, MgClg was added last and reactions were
incubated only 5 to 10 min before addition of EDTA to stop the
reaction. Step 4: Uncleaved transcripts were purified by gel
electrophoresis as already described.
42
Nuclease Digestion
All nucleases except VI (Pharmacia, Milwaukee, WI) were
from BRL (Gaithersberg, MD). Nuclease digestions were under
the same conditions of temperature and solution used in the
self-cleavage assays. Reactions (5 fxl) contained approx.
10,000 cpm per reaction of gel-purified, end-labeled uncleaved
RNA, 1 mg/ml tRNA, 50 mM Tris, pH 8.0, 10 mM MgClg, and either
0.2 units VI nuclease, 0.1 units T2 nuclease, 0.2 units T1
nuclease, or water. Nuclease treatment was initiated 20 to 50
s after addition of MgClg. After 5 min at 37°C, reactions were
terminated by adding an equal volume of 7M urea, 30 mM EDTA
and freezing at -SO^C. Products were separated on 12%
polyacrylamide gels containing 7M urea. Sequencing reactions
(T1 and 0 M nucleases) under denaturing conditions (21, 22)
and ladder formation by partial alkaline hydrolysis were
performed by using a kit from BRL.
43
RESULTS
Self-cleavage of Wildtype and Mutant RMAs
Transcripts from a plasmid (pPCSl) spanning the (+)
strand cleavage site were shown previously to self-cleave
(17). However, the rate of cleavage and the effects of a
large number of extraneous bases were unknown. To allow
transcription of an RNA that contained the hammerhead sequence
with minimal vector-derived bases, 36 bases were deleted from
pPCSl to create pSSl (Fig 2). The RNA transcript (SSI) from
Xjbal-linearized pSSl contained only 3 vector-derived bases at
the 5' end and at most 6 at the 3' end (Figs. 2A, 5). Optimal
conditions for self-cleavage of SSI were 50 mM Tris-HCl, pH
7.5, 10 mM MgClg, at 37°C. The reaction showed a broad
magnesium optimum, and little sensitivity to temperature or
denaturation treatments such as boiling and snap cooling (4)
prior to addition of Mg'^^ (data not shown) . The cleavage
products of all the transcripts were as expected: a 120 nt
full-length fragment, a 101 nt 3' fragment, and a 19 nt 5'
fragment (Fig. 3). The intensity of the full-length band
decreased as the intensities of the fragments increased with
time.
Transcript SSI cleaved with an approximate half-life of
1500 to 2500 min as calculated by extrapolation of several
44
SS1 M1 MS M1/M2 SSI
0 30 60 90 120 150 IBO 210 140 270 jOO
SSI I\/I19 M20 M19/20 min (•—•) 0 60 120 180 240 jOO J60 420 480 540 600 1.00 a-" ' ^ MM M V SSl
0.50 va
il -a
0.10
MÎ9/20
M 20
( 1
10 15 20 25 30 35
min.(
SS1 MS
F
3'
• • ••• 5*
Figure 3. Self-cleavage of wildtype and mutant RNAs. Left: Autoradiographs of transcripts after incubation in self-cleavage conditions for times shown in graphs at right, and denaturing polyacrylamide gel electrophoresis. Mobilities of full-length (F) transcript, and 3' and 5' fragments are indicated. Right: Semilog plots of fraction of full-length transcript that remains uncleaved were calculated from radioactivity in bands of autoradiographs at left. In the middle graph, note that M19 and M20 are plotted against a different scale (bottom) than are SSI and M19/20 (top scale). SSI was included as a standard in all assays.
45
separate experiments (Figs. 2, 3). To determine if the slow
rate of cleavage was due to formation of the alternative base
pairing (Ll-L2a; Fig. 1), the potential to form this helix was
disrupted by mutagenesis. Two three-membered sets of mutants
were constructed (Fig. 2). Each set included transcripts with
alterations to LI, L2a, or to LI and L2a on the same molecule
such that potential base pairing, but not wildtype sequence
was restored in the double mutant. In an additional mutant
(M5), bases 30-63, including the L2a region, were deleted
(Fig. 2). This prevented formation of the Ll-L2a helix, and
resulted in a hammerhead similar in size to those of the
sobemovirus satellites (virusoids), sTobRV (5), and sBYDV RNA
(-) strand (17).
Mutant set I (mutants Ml, M2, and Ml/2), was designed to
conserve the 100% G+C content of LI and L2a. Three bases were
changed in either LI or L2a, or both LI and L2a. The half-
lives of mutant RNAs Ml and M2, in which the proposed Ll-L2a
base pairing was disrupted, were 310 and 48 min, respectively
(Figs. 2, 3). The double mutant Ml/2 did not self-cleave
detectably. In contrast to mutant set I, set II was chosen
after exhaustive computer searches (23) of many sequences
containing different mutations predicted that this set of
mutations should form no significant unintended base pairing.
Mutant set II (M19, M20 and M19/20) was constructed by
introducing only a single base change in either LI or L2a, or
46
both LI and L2a. Each of the single mutants, M19 and M20,
cleaved hundreds-fold more efficiently than wildtype (Figs. 2,
3). Seventeen percent of M19 RNA remained uncleaved after 10
hr, presumably because this proportion of the molecules folded
into an inactive conformation. The double mutant M19/20
cleaved 24- to 36-fold more slowly than either of the single
mutants, but at least 10-fold faster than wildtype. Mutant MS
also cleaved quite rapidly (Figs. 2, 3). The full-length
transcript (86 nt) and the 2' (67 nt) and 5' (19 nt) fragments
migrated as expected.
Nuclease Sensitivity
The next set of experiments employed structure-sensitive
nucleases to determine whether the overall tertiary structure
exists as predicted in Fig. IB. 5' end-labeled transcripts
were partially digested with nucleases T2 (cuts all single-
stranded bases [24]), T1 (cuts single-stranded guanosine
nucleotides), or VI (cuts double-stranded and some base-
stacked regions [25,26]), under conditions identical to those
used in the cleavage assays. To avoid misleading secondary
cleavages, enzyme concentrations were adjusted so that the RNA
was cleaved less than once per molecule, on average. The
digestion times were short enough (5 min) to allow analysis of
the RNA structure before it self-cleaved. The possibility
that the nuclease digestion reveals structures of the cleavage
47
products is eliminated in all bands greater than 19 nt long,
because self-cleavage of the 5' end-labeled RNA would remove
label from the 2' product. Products of nucleolytic digestions
of the wildtype and all the mutant transcripts were separated
on denaturing gels alongside cleavage products obtained with
nucleases T1 and ^ M (cuts after A and U residues) under fully
denaturing conditions (Fig. 4). A wide variation in nuclease
susceptibility of phosphodiester bonds under self-cleavage
conditions relative to denaturing conditions indicated regions
of strong structure. Nuclease T2 cut single-stranded G
residues only weakly, compared to its activity on the other
three bases. The prominent 19 base band in all samples
(including those lacking nuclease) except Ml/2, that were
digested in self-cleavage conditions is the 5' self-cleavage
fragment. It migrated exactly as expected on the basis of the
T1 and <p M sequencing ladders. Some minor nonspecific
degradation is visible in the untreated lanes (e.g., M19, M5)
that cause misleading bands that are not a result of nuclease
digestion in the nuclease-treated lanes.
The sites and frequency of nuclease cutting in all the
RNA molecules are shown in Fig. 5. In all transcripts,
predicted helix 3 was cleaved strongly by nuclease VI and not
by nucleases T1 or T2. Phosphodiester bonds in putative helix
1 were susceptible to both single- and double-strand-specific
nucleases in all instances. In contrast, loop LI was much
Figure 4. Autoradiographs after incubation of wildtype and mutant RNAs with the indicated nucleases. Products were analyzed on 12% polyacrylamide, 7M urea gels. Lanes are labeled for the enzyme treatment, except that lanes marked N had no enzyme added and L indicates partial alkaline hydrolysis ladder, f indicates fM digest which cut A residues slightly more strongly than U's. SEQ indicates nuclease digestions under denaturing (sequencing) conditions. Other digests were in self-cleavage conditions. Products of the VI digest ran one base more slowly than those in the other lanes due to the absence of a 3' phosphate (25,41). Readable sequences of SSI and M5 are indicated alongside the autoradiographs. Positions of bases in LI (lower set) and L2a (upper set) are indicated along side each autoradiograph. These helices are labeled beside the SSI autoradiograph only. Bands in lanes N and VI of M19 are shifted to the left slightly at the intense 19 nt cleavage product due to tearing of the gel.
' tn , • ; I i : i ( i H f î j s
* I » »•• • DoeoD fioocacî
«•I « (;
%
a »«UUttllll|lUBUKI ooooc) 60^00
Hi CO ' m
• I
### M'W# « til #*«' M # • I I I # 4
• I f I I I ( I I I U j l ' I II I » \ Hit l«
I X V V V V W V V V W ' A W V W V W . m . V A v v V V , ooeoo
i l
if 00^00
Oj Co .rccoocoo>c»o>o>ooQoooncococo>ao>ooc>co»^<n>oo>o»:^''
: • «•«•.1111%
00000
^ Co c>^ccnoccxa>c»o>o>ooooo^ooDcoco>OD>oc>c:>caoooonoc»ooD^
M U) < I Hf
I'.'. { u
J III11 M e #*#####«**#####
00000 00000
• ' *$% * It » « . I • 1
I I I 1 1 1 t I I I I II II t nn(IIiir.'!(iiumr.ît!i!Ri
I : lilt I I t l i llllf o@gSc^
1 It
vo
* « . ' # # * # I I t I V :
ti I 11 n mt m . 0 •••III •• • •»
/ t I t I I : M : i i : -u t i l t ê I I t « 4 $ I II I ' lilt II lltlftli th ^
^000 ^o@^
ft- /• /
têfi / // t Ê
t ! t I I • • f I i ll Hi iiitimitiiiiiiaiiiii • « tttt • • tit lit I s
0@S2)C^ @0g)5)0
Figure 5. Locations and relative susceptibilities of nuclease cleavage sites derived from Fig. 4. V = VI site, T = T1 or T2 site. The size of the V or T is proportional to the intensity of the band at that site. Because the digestion pattern of helix 3 was virtually identical in all constructs, it is shown only for wildtype (SSI) RNA. Mutant sets I and II are indicated. Vector-derived bases are in lower case. Mutations are in outlined font. For ease of comparison, the sequences are drawn as hammerheads regardless of whether nuclease sensitivity supported the existence of this structure.
51
Ï1.VV pcuagaaaugaa<^caccua
CpA
:s-c
f i Ac-Q^ c-q y:
^U-AÔÏ c-q c-g o
c a u râ
JÂ"
SSI
% °- ;
°*%s-^
& M1
/uaWI? s
...ua a -ê a
"a
JÂ" A g
@
c-g c-q
V M2
a "a
B JQ.
%# c%
..aua
..ua
L ^c : %C.Q°
8:g
c-q c-g
Mig
i
i V
/\ - t '^AC.G°
8:2
c-q c-q
V M20
m ..MA ...UÀ
a-u \-u:
iê:k
~8# G-% _C U-AÛO c-q c-q
<& Mig/20
u-%, Q.
t c-q' c-q,
Ml/2
..auaW'''̂
..aja juf -a
•s.,. s-
% M5
52
more susceptible to single-strand-specific nucleases in most
of the single mutants in which Ll-L2a base pairing was
expected to be disrupted (M2, M19, M20, M5), than in those in
which Ll-L2a base pairing was predicted (SSI, Ml/2, M19/20).
This is especially noticeable when the T1 digests under
cleavage and denaturing conditions are compared across all the
RNAs (Fig. 4). Concomitantly, in the double mutants,
nucleotides in L2a were digested somewhat more readily by
nuclease VI than were the L2a bases in the single mutants. In
all RNAs, loops L2b, L2c, and L2d were highly susceptible to
single-strand-specific nucleases. Predicted helix H2a was
generally more susceptible to VI, with the exception of Ml in
which it appeared highly single-stranded. H2b and H2c were
not cleaved well by any nucleases, except for H2b in M2 and
Ml/2 which were cleaved unexpectedly by single strand-specific
nucleases. The conserved CUGANGA loop was sensitive to
single-stranded nucleases in all but Ml. Thus, the nuclease
cleavage pattern of Ml RNA was radically different from that
expected, unlike the patterns generated by the other
transcripts.
53
DISCUSSION
Effects of Mutations on Self-cleavage Rate
By showing that disruption of the potential Ll-L2a helix
dramatically increased self-cleavage activity and that
restoration of the potential helix with a new sequence reduced
activity, we have provided strong evidence for the existence
of the helix in the self-cleavage structure of sBYDV (+)
strand RNA. Because disruption of this base pairing is
predicted to favor formation of a hammerhead RNA, the results
also support the proposal (3,4) that the hammerhead is indeed
the self-cleavage structure. That different disruptions to
the Ll-L2a helix have different cleavage rates implies that
other unpredicted folding may be taking place.
It is noteworthy that the rates of cleavage of SSI and
mutants Ml/2 and M19/20 are inversely proportional to the
calculated stability of helix Ll-L2a (Fig. 2). Thus, we
propose that an equilibrium exists between the self-cleaving
hammerhead and the noncleaving stacked helix structure. Even
if the latter is favored, any brief formation of the
hammerhead would allow irreversible cleavage. This explains
the slow but steady rates of cleavage of SSI and M19/20. In
Ml/2, apparently the helix is so strong that the hammerhead
54
never forms. The situation is somewhat analogous to the self-
cleavage structure of hepatitis d virus (HDV) RNA. Although
HDV RNA shows no evident relationship to a hammerhead, it
seems to form a structure in which one helix inhibits self-
cleavage (27) . Denaturing conditions such as <1 mM Mg^"*", high
temperature, or presence of urea or formamide accelerate the
cleavage rate (28). However, unlike HDV RNA, the rate of
sBYDV RNA cleavage does not increase at elevated temperatures
such as 50°, nor does it increase at low magnesium
concentrations, or after boiling and snap-cooling. Perhaps
this is because the Ll-L2a helix is the most stable in the
molecule, and helices required for hammerhead formation (e.g.,
HI) would denature before Ll-L2a. Of the known hammerheads
(5), only the (+) and (-) strands of sLTSV have potential base
pairing between the distal loops of helices 1 and 2 like (+)
sBYDV. However, in that case, such base pairing is not
predicted to be as stable as that involved in hammerhead
formation.
Nuclease Sensitivity
The self-cleavage assays of wildtype and mutant sequences
do not distinguish between the following two possibilities:
(i) the three stacked helices form as proposed in the wildtype
ribozyme with no disruption of the hammerhead (HI, H2, H3)
helices (Fig. lb), and (ii) the Ll-L2a base pairing causes
55
major disruption of the hammerhead by preventing one or more
of the hammerhead helices from forming and perhaps allowing
many new helices to form. To distinguish between these
possibilities, the RNAs were probed with structure-sensitive
nucleases.
Nuclease sensitivity of the wildtype self-cleavage
structure (SSI, Fig. 5) is, for the most part, consistent with
the proposed structure. However, other than H3, predicted
helices are not clearly shown by VI digestion. This may be
due to the wide variation in ability of nuclease VI to act on
certain helical regions (25, 26, 29). Certain regions (e.g.,
putative helices H2b, H2c) were not cleaved by VI nuclease,
presumably due to steric hindrance in which the enzyme could
not interact with nucleotides in the interior of the RNA
molecule (30). In addition, some regions predicted to be
single stranded were partially cut by VI, perhaps due to the
ability of VI to cut at nonpaired but stacked bases (26, 29).
Helix HI was cleaved by single- and double-strand-specific
nucleases, perhaps because it "breathes" during the nuclease
treatment owing to its low stability (AG = -5.3 kcal/mol).
Thus the structural information derived from the VI digests is
somewhat limited.
Single-strand-specific nuclease digestions gave more
clear-cut results than the VI digestions. The observation
that loops L2b, L2c, L2d, and the conserved CUGANGA loop (with
56
one exception) remained sensitive to nucleases T1 and T2
provides strong evidence that the entire vertical stem-loop 2
region forms as in the proposed structures (Fig. 1).
Unexpected alterations to structures of RNAs in mutant set I
were observed (Fig. 5). The most unexpected changes were in
Ml which explains why it cleaves so much more poorly than the
other mutants that disrupt Ll-L2a base pairing. Indeed, a
computer search (23) revealed that many new helices may form
as a result of the three base changes in both Ml and M2 (not
shown), perhaps explaining why neither mutant cleaved as well
as M19 or M20. Although the nuclease sensitivity results do
not support the structure of Ml as drawn, the functional assay
shows that disruption of Ll-L2a still allowed the RNA to form
a functional cleavage structure at least a portion of the
time, causing it to cleave more readily than wildtype. Unlike
Ml, the nuclease sensitivity of M2 supports the existence of a
functional hammerhead. Note the striking increase in
sensitivity to single-stranded nucleases of loop LI in M2
versus SSI. The disrupted helix H2b in M2 is not predicted to
be essential for a functional hammerhead. Thus, it is not
surprising that this RNA cleaves much more rapidly than Ml.
The base changes in mutant set II resulted in no
significant changes in nuclease sensitivity outside the
predicted regions, with the exception of slight unexpected
cuts in LI by VI in M19 and M20. Finally, M5, in which most
57
of the entire vertical stem including L2a was deleted, behaved
as predicted. This is the first use of structure-sensitive
nucleases to show that hammerhead ribozymes indeed fold as
predicted by the model of Forster and Symons (4).
Comparison with Other Hammerheads
Even the fastest-cleaving mutants do not cleave as
rapidly as conventional hammerhead ribozymes such as sBYDV (-)
strand (17) or sTobRV (+) strand (8). This may be due to the
other deviations from consensus (Fig. 1). The AUA instead of
a GUC at the 5' side of the cleavage site is not likely to
significantly reduce the rate of cleavage relative to other
hammerheads. Ruffner et al. (14) showed that replacement of
the G or the C of the GUC with As at either position had only
minimal effect on cleavage by an ASBV-derived ribozyme.
However, when the bases of the proximal base pair of helix 2
were changed to C and A, analogous to C-24 and A-73 in sBYDV
RNA, cleavage by the ASBV-derived ribozyme was reduced over
one hundred-fold. Given this and similar observations with
sLTSV mutagenesis (15), it is perhaps surprising that mutants
M19, M20, and M5, all of which contain unpaired bases C-24 and
A-73, cleave as well as they do.
The results do not prove the existence of the three
stacked helices, but they support this model (Fig. IB). This
structure fits the definition of a pseudoknot (31) ; however.
58
it has three instead of the usual two coaxially stacked
helices. It is possible that helix HI would be pulled apart
due to torsional constraints when the Ll-L2a helix forms, but
the nuclease sensitivity does not correlate with this. It is
possible that yet another conformation exists within the
context of the full-length satellite RNA. Other examples of
alternative conformations for hammerhead domains have been
reported. The self-cleavage sequences in the (+) and (-)
strands of sLTSV may exist in equilibrium between the
hammerhead and as part of the rod-shaped full-length molecule
(4). The self-cleavage sites in newt satellite 2 transcripts
(32) and ASBV RNA (33) may fold differently in the context of
a dimer of the full satellite RNA, compared to the sequence
context of the isolated hammerhead. These RNAs have an
extremely short (2 or 3 base pair) helix 3. In the minimal
hammerhead context, cleavage can occur by a bimolecular
double-hammerhead structure (34), whereas dimeric satellite
RNA self-cleaves mostly via single-hammerheads (32, 33).
Thus, it will be interesting to determine the cleavage rate of
dimeric sBYDV RNA. However, the sBYDV situation is quite
different from the newt and ASBV in that we observed intra-
hammerhead conformational changes rather than inter-hammerhead
base pairing. Due to the length of helix 3, we have no reason
to invoke a bimolecular double-hammerhead mechanism (35). The
sLTSV alternative conformation is also unlike sBYDV in that it
59
involves base pairing to regions outside the hammerhead domain
(4). Finally, alternative conformations have also been
observed when the ribozyme and substrate are located on
separate molecules (13, 16). Because the Ll-L2a helix is the
strongest uninterrupted helix in the entire satellite, and the
strands are in such close proximity, we predict that the helix
exists even in the context of full-length and multimeric RNAs.
The biological role of the stacked-helix structure is
unknown. An intriguing possibility is that the Ll-L2a helix
may form left-handed Z-RNA (reviewed in 36). It contains the
alternating G-C sequence required for Z-RNA. Also, torque may
be imposed by the strands of the distal end of putative helix
HI on helix Ll-L2a because these strands would be expected to
join LI at opposite sides of the one-half turn, 5-base Ll-L2a
helix. This may confer negative supercoiling that is known to
favor Z-DNA (37) . Z-RNA has been shown to exist in living
cells (38, 39), but its identity and biological role are
unknown. Regardless of whether Z-RNA forms, it is possible
that the stacked helix structure performs a function different
from self-cleavage. Nearly half (153 nt) of the 322 nt sBYDV
RNA is involved in formation of either the (+) strand or
complement of the (-) strand cleavage structure. This leaves
only 169 nucleotides divided into two tracts of 104 and 65
bases (17) to perform all the other functions of the satellite
RNA, including an origin of replication, an origin of assembly
60
and probably other functions. Thus, it could be envisioned
that sequences within the self-cleavage structure contribute
to one of these other functions, compromising the ability to
self-cleave in the process. The stacked-helix may serve as a
molecular switch to modulate the transition between these two
functions.
61
REFERENCES
1. Symons, R. H. (1991) Molec. Plant-Microbe Interact. A, 111-120.
2. Bruening, G., Passmore, B. K., van Toi, H., Buzayan, J. M., & Feldstein, P. A. (1991) Molec. Plant-Microbe Interact. A, 219-225.
3. Forster, A. C., & Symons, R. H. (1987) Cell 50, 9-16.
4. Forster, A. C., & Symons, R. H. (1987) Cell 49, 211-220.
5. Bruening, G. (1989) Methods Enzvmol. 180, 547-558.
6. Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symons, R. H. (1986) Nucleic Acids Res. 14, 3627-3640.
7. Epstein, L. M., & Gall, J. G. (1987) Cell 48, 535-543.
8. Haseloff & Gerlach (1989) Gene 82, 43-52.
9. Uhlenbeck, O. C. (1987) Nature 328, 596-600.
10. Haseloff, J., & Gerlach, W. L. (1988) Nature 334, 585-591.
11. Koizumi, M., Iwai, S., & Ohtsuka, E. (1988) FEES Letters 228, 228-230.
12. Ruffner, D. E., Dahm, S. C., & Uhlenbeck, O. C. (1989) Gene 82, 31-41.
13. Fedor, M. J., & Uhlenbeck, O. C. (1990) Proc. Natl. Acad. Sci. USA 87, 1668-1672.
14. Ruffner, D. E., Stormo, G. D., & Uhlenbeck, 0. C. (1990) Biochemistry 29, 10695-10702.
15. Sheldon, C. C., & Symons, R. H. (1989) Nucleic Acids Res. 14, 5679-5685.
16. Heus, H. A., Uhlenbeck, O. C., & Pardi, A. (1990) Nucleic Acids Res. 18, 1103-1108.
18
19
20
21
22
23
24.
25.
26 .
27.
2 8 .
29.
30.
31.
32.
33.
62
Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991) Virology 183, 711-720.
Kunkel, T. A., Roberts, J. D., & Zakour, R. A. (1987) Methods Enzvmol. 154, 367-382.
Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Second edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
Conway, L., & Wickens, M. (1989) Methods Enzvmol. 180, 369-379.
Donis-Keller, H., Maxaiti, A. M., & Gilbert, W. (1977) Nucleic Acids Res. 8, 3133-3142.
Simoncsits, A., Brownlee, G. G., Brown, R. S., Rubin, J. R., & Guilley, H. (1977) Nature 269, 833-836.
Cedergren, R., Gautheret, D., Lapalme, G., & Major, F. (1988) CABIOS 4, 143-146.
Vary, C. P. H., & Vournakis, J. N. (1984) Nucleic Acids Res. 12, 6763-6778.
Lockard, R. E., & Kumar, A. (1981) Nucleic Acids Res. 9, 5125-5140.
Lowman, H. B., & Draper, D. E. (1986) J. Biol. Chem. 261, 5396-5403.
Perotta, A. T, & Been, M. D. (1991) Nature 350, 434-436.
Rosenstein, S. P., & Been, M. D. (1990) Biochemistry 29, 8011-8016.
Puglisi, J. D., Wyatt, J. R., & Tinoco Jr, I. (1988) Nature 331, 283-286.
Knapp, G. (1989) Methods Enzymol. 180, 192-213.
Pleij, C. W. A., Rietveld, K., & Bosch, L. (1985) Nucleic Acids Res. 13, 1717-1731.
Epstein, L. M., & Pabon-Pena, L. M. (1991) Nucleic Acids Res. 19, 1699-1705.
Davies, C., Sheldon, C. C., & Symons, R. H. (1991) Nucleic Acids Res. 19, 1893-1898.
63
34. Forster, A. C., Davies, C., Sheldon, C. C., Jeffries, A. C., & Symons, R. H. (1988) Nature 334, 265-267.
35. Sheldon, C. C., & Symons, R. H. (1989) Nucleic Acids Res. 14, 5665-5677.
36. Tinoco Jr., I., Davis, P. W., Hardin, C. C., Puglisi, J. D., Walker, G.T., & Wyatt, J. (1987) Cold Spring Harbor Svmp. Quant. Biol. 52, 135-146.
37. Singleton, K., Klysik, J., Stirdivant, S. M., & Wells, R. D. (1982) Nature 299, 312-316.
38. Zarling, D. A., Calhoun C. J., Hardin, C. C., & Zarling, A. H. (1987) Proc. Natl. Acad. Sci. USA 84, 6117-6121.
39. Zarling, D. A., Calhoun C. J., Feuerstein, B. G., & Sena, E. P. (1990) J. Mol. Biol. 211, 147-160.
40. Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Neilson, T., & Turner, D. H. (1986) Proc. Natl. Acad. Sci. USA 83, 9373-9377.
41. Schulz, V. P., & Reznikoff, W. S. (1990) J. Mol. Biol. 211, 427-445.
64
PAPER II. NONCONSENSUS BASES IN THE sBYDV ( + ) RNA AFFECT THE RATE OF HAMMERHEAD FORMATION AND SELF-CLEAVAGE EFFICIENCY
65
Nonconsensus bases in the sBYDV (+) RNA affect the rate of hammerhead formation and self-cleavage efficiency
Silver, S.L., M.S. Miller, W.A., Ph.D.
From the Department of Plant Pathology, Iowa State University, Ames, lA 50011
66
INTRODUCTION
Self-cleavage of a small molecular weight RNA was first
observed in the satellite of tobacco ringspot virus (sToBRV)
(+) strand (Prody et al., 1986). The self-cleavage reaction
has a requirement for Mg^"^, and unlike cleavage by RNase P
(Baer et al., 1990) and pre-mRNA splicing (Ruby & Abelson,
1991), does not require protein at physiological conditions.
Demonstration of self-cleavage in the satellite RNAs of luteo-
and sobemoviruses (Bruening, et al., 1991; Symons, 1991b), in
avocado sunblotch viroid (ASBVd; Hutchins et al., 1986), peach
latent mosaic viroid (Hernandez & Flores, 1992; PLMVd) and
carnation stunt associated viroid or satellite RNA (CarSAV;
Hernandez et al., 1992) and in the transcripts of satellite II
DNA of newt (Epstein & Gall, 1987) indicate the broad
occurrence of this phenomenon. These self-cleaving RNAs are
believed to replicate by a rolling circle mechanism which
results in long multimers that cleave into circular and/or
linear monomers (Bruening, et al., 1991; Symons, 1991a). The
nucleotides spanning the cleavage site of the above RNAs fold
into a structure referred to as a hammerhead. The hammerhead
consists of three helices, whose sequences are not conserved
and a central, predominately single-stranded region composed
67
of highly conserved bases (Forster & Symons, 1987b; Forster &
Symons, 1987c). Extensive mutagenic analysis of the
hammerhead confirmed the importance of the conserved
nucleotides and the structure during cleavage (Miller &
Silver, 1991; Ruffner et al., 1989; Ruffner et al., 1990;
Sheldon & Symons, 1989).
The first satellite RNA of a luteovirus was recently
discovered associated with barley yellow dwarf virus, serotype
RPV (sBYDV RNA) (Miller et al., 1991). sBYDV RNA is a 322
nucleotide long RNA that is encapsidated primarily as a linear
molecule. Both the (+) and (-) strands of sBYDV RNA contain
the hammerhead motif (Miller et al., 1991). The (-) strand
cleavage site closely resembles the hammerhead of the sToBRV
(+) strand cleavage site (Bruening, 1989); whereas, the sBYDV
(+) strand hammerhead has several additional structural
features not present in most other hammerheads (Fig. 1).
First, AUA is the trinucleotide on the 5' side of the cleavage
site in sBYDV (+) RNA, while all but one other known
hammerhead structure has the sequence GUC. The one exception
is the virusoid of lucerne transient streak virus (sLTSV),
which has the trinucleotide GUA in this position. Mutagenic
analysis, however, revealed that the trinucleotide need not be
totally conserved for efficient cleavage (Ruffner
et al., 1990; Sheldon & Symons, 1989). Second, mutagenic
analysis and nuclease sensitivity probing of sBYDV (+) RNA
68
demonstrated that stems-loops I and II of the hammerhead have
the potential to basepair and form an alternative structure
containing three coaxially stacked helices (Miller & Silver,
1991).
310
dMvags
5* uauuucquaqapâacaa^c I I I I I I I I I I t TC I I I I % 9' lloiie. P
K
dMvaaa rou-A
310 iLia aaa e UAUUUCaUQQA 3' AUdAAO^CACCU
& "UqqU
B Hammerhead
C_Q|G=SI
il® Wo-Ç
iM\
lAZPU-AlUQal
Stacked helices (pseudoknot)
Figure 1. Proposed alternative structure for the self-cleaving ribozyme in sBYDV (+) strand RNA. Boxed bases are conserved among all hammerheads (Bruening, 1989) . Bases that differ from consensus are shown in outlined text. Numbering of nucleotides is based on the full-length satellite RNA. The three major helices of hammerhead are labeled HI, H2, and H3. Loops present in the hammerhead are prefixed with L. Bases in loops LI and L2a expected to form the additional helix are in italics. Panel A is the hammerhead of sBYDV (+) RNA drawn without the putative basepairing between LI and L2a. Panel B is the alternative structure that forms when LI and L2a interact.
69
The third structural feature of sBYDV (+) RNA not
generally found in hammerhead ribozymes, and the one addressed
by the current study, is the occurrence of one unpaired
cytosine (C-24) immediately 3' to the conserved
single-stranded CUGANGA sequence and an unpaired adenine
(A-73) directly 5' of the conserved GAAAN sequence. Only two
other self-cleaving RNAs have unpaired nucleotides
corresponding to bases 24 or 73 of sBYDV RNA (+) hammerhead.
In sLTSV the (+) strand hammerhead has a uracil corresponding
to C-24 (Forster & Symons, 1987b) and recently the CarSAVd (-)
strand was found to have an unpaired cytosine and adenine
located at exactly the same sites within the hammerhead as the
sBYDV (+) RNA (Hernandez et al., 1992). This study determined
the effects of deleting nucleotides C-24 and A-73 on the rate
of cleavage and hammerhead formation. The data are consistent
with the hypothesis that formation of alternative structures
at the cleavage site disrupt the integrity of the hammerhead,
thus regulating the rate of cleavage.
70
MATERIALS AMD METHODS
Synthesis of Hildtype and Mutant
Self-cleavage Structures
RNA molecules were synthesized by in vitro transcription
of sequences in pGEM3Zf(-) (Promega, Madison, WI). Plasmid
pSSl contained the wildtype (+) strand sBYDV hammerhead
sequence: bases 310 to 322 and 1 thru 89 of the satellite
sequence (Figs. 1 & 2). Cleavage occurs between bases 322 and
1. Vector bases GGA and CUCUAG were present at the 5' and 3'
ends, respectively of wildtype and mutant transcripts from
Xbal-linearized pSSl. Each mutation was introduced by the
two-step PGR method of Herlitze and Koenen (1990). The
following derivatives of pSSl were made with the indicated
primers that are complementary to the satellite RNA (+)
sequence. pM3; 5' CGCGGATAC_*TCGTCAGACAG 3'; pM4:5'
GTGGATTTC_*GTATCTATTTG 3' and pM20: 5' TTCTAGTCCGCTCGGATACTCG
3'. Underlining indicates base changes and * indicates base
deletion. The first PGR involved 25 cycles of amplification
(Amplitaq, Perkin-Elmer-Cetus) using the M13 reverse primer
and the mutagenic oligomer. The purified double-stranded PGR
product and the M13 forward primer were used for the second
PGR using the same target DNA (pSSl). Products from the
71
T7
Cleavage
products:
310
-fl
19
i LI L2a 80 Xbal
%
101 .3'
Figure 2. Maps of inserts in transcription plasmids. Large bold box represents sBYDV RNA sequence; shaded regions (flanking bases 310 and 89) are not required for hammerhead formation. Horizontal arrow marks the transcription start site; vertical arrowhead indicates self-cleavage site. Expected cleavage products of transcripts generated by T7 polymerase-catalyzed transcription of Xbal-linearized DNA are shown as bold lines below the map. Sizes of transcripts (in nt) are indicated below each one. LI and L2a are indicated by hatched regions. Sites of mutations are indicated.
second PGR were digested with BamHI/Hindlll, gel-purified and
ligated into BamHI/Hindlll-cut pSSl. Synthesis of the double
mutant pM3/4 proceeded by first constructing pM3 followed by a
second PGR mutagenesis that used pM3 instead of pSSl as the
target DNA. The triple mutant, pM3/4/20, was synthesized
using pM3/4 as the target DNA. All base deletions and
alterations were confirmed by double-stranded DNA sequencing
(Promega). During the sequencing of the mutations, we
discovered a non-templated addition of an adenosine at the 5'
side of the site to which M20 annealed. The PCR-generated
conversion was circumvented by using "Hot Tub" DNA polymerase
(Amersham) for the first PGR amplification and Taq polymerase
72
for the second amplification. Generally, 50-75% of resulting
clones had the correct mutation without the base conversion.
In our nomenclature, a plasmid and its transcript are named
similarly except that the "p" of the plasmid name is omitted
in the transcript.
Self-cleavage Assays
[a-^^P] GTP-labeled RNA was transcribed from Xbal-
linearized plasmid DNA as described by Milligan and Uhlenbeck
(1989). Approximately 0.1 mg/ml of T7 RNA polymerase isolated
as described previously was used per standard transcription
(Grodberg & Dunn, 1988; Zawadski & Gross, 1991). Full-length
transcripts were purified from an 8% polyacrylamide, 7M urea
gel (Sambrook et al., 1989). Self-cleavage assays (80 ̂ ll)
contained approximately 20,000 counts per minute (cpm) of
gel-purified, uncleaved transcript, SOmM Tris, pH 7.5 and lOmM
MgClg. The assay was initiated by addition of the MgClg. The
reaction was incubated at 37° C and at indicated time points, 8
/il aliguots were taken and added to an equal volume of
"solution D" (10 M urea and 30 mM EDTA; BRL). Samples were
denatured by boiling for one minute immediately prior to
electrophoresis. Bands corresponding to the uncleaved
transcript and cleavage products were quantified using
Phosphorimage analysis (Molecular Dynamics). The half-life
(T.) of the uncleaved transcript was determined by computing
73
the slope of the best-fit line of the cleavage data and
solving for the X-intercept using the software CoPlot and
CoStat.
Synthesis of End-labeled RNA
and Nuclease Digestion
End-labeled uncleaved transcripts were prepared and
gel-purified as described previously (Conway & Wickens, 1989;
Miller & Silver, 1991) with the following modifications.
Unlabeled RNA was transcribed according to Milligan (1989)
with T7 RNA polymerase isolated in our laboratory and products
treated with 5 units of calf intestinal phosphotase for 20
minutes. Nuclease digestion was performed essentially as
described previously (Miller & Silver, 1991) with the
following changes. Nuclease digestion assays contained 20,000
cpm per reaction of gel-purified, end-labeled uncleaved RNA, 1
mg/ml tRNA, 50 mM Tris, pH8.0, 10 mM MgClg and either 0.1 U VI
nuclease, 0.1 U T1 nuclease, 0.1 U T2 nuclease or water. The
nuclease reaction was initiated by MgClg, incubated for 10
minutes and quenched by addition of solution D. For each
reaction, the RNA was denatured by boiling for 1 min and then
separated by electrophoresis on a 12% polyacrylamide, 7 M urea
gel. Cleavage products were visualized by autoradiography.
74
RESULTS
Self-cleavage of Mutant RNAs
RNA transcribed from Xbal-linearized pSSl (Miller &
Silver, 1991) produced a 120 nt long molecule that in the
presence of 10 mM MgClg and 50 mM Tris, pH 7.5, self-cleaves
to form a 101 nt 2' fragment and 19 nt 5' end fragment. The
Tx/2 of the uncleaved transcript determined from three separate
assays ranged from 1400 to 2100 min (Fig. 3). Similar rates
of cleavage were observed previously (Miller & Silver, 1991).
The unpaired cytosine (C-24) or the unpaired adenosine (A-73)
were deleted from pSSl resulting in pM3 and pM4, respectively.
The Ti/2 of M3 and M4 calculated from three separate assays
were not significantly different from the T1/2 of SSI (Fig. 3 &
4). The double mutant M3/4, however, had a much shorter T^/g
(39 min) than either of the single mutants or the wildtype
sequence (Fig. 3 & 4). In all transcripts with the M4
mutation, an unexpected C-83 to A-83 transversion was induced
by the PGR mutagenesis. The location of the transversion is
in stem III which is the most stable and least likely affected
of the three helices. Exhaustive computer searches revealed
little potential for alternative basepairing due to the
transversion.
Figure 3. Self-cleavage of wildtype and mutant RNAs. Left: Autoradiographs of transcripts after incubation in self-cleavage conditions for times shown in graphs at right, and after denaturing polyacrylamide gel electrophoresis. Mobilities of full-length (F) transcript, and 3' and 5' fragments are indicated. Right; Plots of fraction of full-length transcript that remained uncleaved were calculated from radioactivity in bands of autoradiographs at left.
Ê
• • " f f 5 Wii
fraction uncleaved
Figure 4 . Autoradiographs after incubation of wildtype and mutant RNAs with the indicated nucleases. Products were analyzed on 12% polyacrylamide, 7 M urea gels. Lanes are labeled for the enzyme treatment, except that lanes marked N had no enzyme added and L indicates partial alkaline hydrolysis ladder. ̂ indicates ̂ M digest which cut A residues slightly more than U's. SEQ indicates nuclease digestions under denaturing (sequencing ) conditions. Other digests were in self-cleavage conditions. Readable sequences of SSI are indicated alongside the autoradiographs. Left side of gel contains position of the CUGANGA region; whereas, the right side of gel, positions of bases in LI (lower set) and L2a (upper set) are indicated.
uouoy. çuoup
orà k. •riHT'rT""!'!'!!'!' V • r Spp.'l ) i 'M ' I I I I M I III 9 V;i # ## #*#' III 2Ë| I •• I## « '
' • ' ' • M II l»l I I #
CO H .
ypui^ (juDi^ RtMiMiililillinini I II •«
m tiinii! iiini i • / I I I
m um iflONH I I'll I %\\\ I*## III I • > n M 191 II
î ; ! "t
00
Mill z
a ^jdC^y jjuoi^
â w wwwv \ \ un » « ' *•'
1 • ; 1 I I I I * * f • MmU' I I II t #•« ' ( • ( ' I ! - Il II III M •
0<DU<OOUOWOWX50U<OU<OOUOOSVOOUOVO<0<U<0<OODOLO:
i mmninnnn i ti n I 1 I II l !
I l l I I I I #*##
«Il I II M III '
I
I I I llir 1
SJD<(^ DUOUO
r" 1 • • i—MmimBinwmmmi ii w# f t-1 Hi 0 I t t I I I ! I I I I I # # I t £11)) n i^J) )j J J 1111 I I I E f ' # I i'tÊ t: f ' I it mi >^i , ». 1,1 ,, #
youoy ououo •••••Mfinmn • M «» • » • M9 I Mill I# I I nil I II II# #
III lillU III I III I _ II I T 'i#y 11 « M •« ' t*-< «41 'I# *## ' »«'
» •
79
To look further at how the mutants M20 and M3/4 act to
enhance hammerhead formation by disrupting inactive,
alternative structures, the triple mutant M3/4/20 was
constructed. The first attempt at constructing the mutant by
PGR using pM3/4 DNA resulted in an unintended G to A
transition at G-44. The half-life of the resulting M3/4/20a
transcript was approximately 570 min which is significantly
faster than SSI but not nearly as fast as would be expected
from earlier M20 and M3/4 cleavage data. A modified PGR
mutagenesis protocol which uses "Hot Tub" polymerase resulted
in the M20 mutation without the PGR-generated transition. The
M3/4/20 transcript had a half-life of approximately 6 min
which is not significantly different from the 5 min half-life
of the M20 transcript determined previously (Miller & Silver,
1991).
Nuclease Sensitivity
To determine the tertiary structure of each RNA during
cleavage, structure-sensitive nucleases were employed. 5'
end-labeled transcripts were partially digested with nucleases
T2 (cuts all single-stranded nucleotides; Vary & Vournakis,
1984), T1 (cuts single-stranded guanosine nucleotides), or VI
(cuts double-stranded and some base-stacked regions; Lockard &
Kumar, 1981). For each enzyme, the reaction was performed in
standard cleavage conditions (10 mM MgGlg and 50 mM Tris,
80
pH 7.5 at 37° C). The digestion times were sufficiently short
(10-15 min) to study the RNA structure before complete
cleavage. Products of nucleolytic digestions of the wildtype
and all the mutant transcripts were separated on denaturing
polyacrylamide gels along with the products obtained from
nucleases T1 and ^ M (cuts after A and U bases) performed in
denaturing conditions. Products were visualized by
autoradiography (Fig. 4). The prominent 19 base band in all
samples carried out in self-cleavage assay conditions
(including the no enzyme control) with the exception of SSI
and M4, is the 5'-end cleavage product. It migrated as
expected on the basis of the T1 and 0 M sequencing ladders.
Minor, nonspecific RNA hydrolysis was detected in the no
enzyme control lane; none of which was as significant as the
nuclease-specific products.
A compilation of all sites and frequency of nuclease
digestion was constructed for each RNA (Fig. 5). In all
transcripts, including ones containing the PCR-generated base
conversion at position 88, helix 3 has a strong degree of
double-stranded character as shown by the frequency of VI
cutting and the absence of either T1 or T2 digestion. Helix
I, on the other hand, showed a high degree of single-stranded
character as evidenced by the frequency of T1 and T2
digestions. When all transcripts are compared at the sites
corresponding to LI and L2a, mutations expected to directly
81
disrupt basepairlng (M3/4/20 and M3/4/20a) show a higher
degree of single-strandedness than transcripts expected to
maintain this helix (SSI, M3, M4, and M3/4). Furthermore, M3
and M3/4 have an intermediate level of susceptibility to Tl
and T2 digestion in these loops (Fig 4, 5). In all the
mutants, loop L2d was highly susceptible to single strand-
specific nucleases. Loop L2c was generally observed as
single-stranded in the mutants with the exception of M3/4/20
and M3/4/20a which showed insensitivity to all enzymes. Loop
L2b was highly susceptible to single-strand-specific nucleases
in all the mutants but M3. Helices H2a and H2c were generally
not susceptible to nuclease Tl or T2; whereas this region was
highly susceptible to these enzymes in both M3/4/20 and
M3/4/20a. The conserved CUGANGA single-stranded region was
cut as expected, with the exception of M3/4/20 and M3/4/20a
which became highly resistant to nuclease digestion. Clearly,
the most significant change in cleavage pattern when all
mutants were compared occurred in the CUGANGA region
(Fig. 4 & 5).
Figure 5. Locations and relative susceptibilities of nuclease cleavage sites derived from Fig. 4. V = VI site, T = T1 or T2 site. The size of the T or V marker is proportional to the intensity of the band at that site. Helix III digestion pattern is nearly the same for all transcripts; therefore, it is shown only with the SSI map. The sequences are drawn as hammerheads regardless of whether nuclease sensitivity supported the existence of the structure. Base conversions are in italics. Base deletions are depicted by empty rectangles.
ve/tftn
-w'OOO
S.Vl' '(
n!°n at/*lt\/i
gW-n
D-OL
Ow nao
l^vXS >/' 't
Jf ovo-0
''iTi y?
. .oyoyvnv ' 'f
)
"tf ga
4 /%
m
I O', ff m w
BM
es
Q-0_
4̂ 5
1
M& 8-|<
îV'^-n
J)-0_
ISS
i
-n
A , YOPqYP^YYPOY^YW [/i^SîjA^^WAnPAOT/STo®"'".»
E8
84
DISCUSSION
Effects Of Mutations on Self-cleavage Rate
Fedor and Uhlenbeck (1992) outlined a kinetic pathway for
an intermolecular reaction involving a ribozyme and a
substrate RNA (Fig. 6). According to this model, cleavage is
limited by either formation of an active structure, i.e., a
hammerhead or by the rate at which products are released from
the ribozyme. kj describes the rate at which the two RNAs
interact and fold into a hammerhead, kg is the actual clevage
rate and kscharacterizes the rate of product release. In
general, the kinetic pathway proposed for the bimolecular
reaction can also describe what occurs in the intramolecular
cleavage reaction, except that the latter is zero order and
the bimolecular reaction is first order. Therefore, any
mutation that affects the cleavage rate of the sBYDV (+) RNA
hammerhead can be described by the reaction rates in the Fedor
and Uhlenbeck model. Any alternative structures within the
hammerhead should be discussed relative to how they affect the
formation of the hammerhead. Since actual phosphodiester bond
cleavage (kg) is believed to be instantaneous and virtually
irreversible, most if not all alternative structures that form
within the hammerhead will affect either ki or kg but not kg.
85
The basepairing between LI and L2a which disrupts
hammerhead formation in the sBYDV (+) RNA self-cleavage domain
is predicted to be the most stable helix (AG= -10.1 kcal/mol)
in the satellite RNA (Miller & Silver, 1991). The unpaired
nucleotides (C-24 and A-73) situated at the top of stem II of
the hammerhead may be crucial for the formation of the
alternative basepairing (Fig. 1). Deletion of both bases
results in a significant increase in the cleavage rate,
suggesting that C-24 and A-73 indeed play a role in making the
alternative, non-cleaving structure sterically possible.
E + S E - S E - P 1 - P 2 E + P 1 + P 2
E-P1+P2 ^3
Figure 6. Proposed reaction pathway for bimolecular cleavage (adapted from Fedor & Uhlenbeck, 1992).
Upon comparison, the mutant transcript that directly
inhibits basepairing between LI and L2a, M3/4/20, cleaves much
faster than M3/4. This is consistent with the idea that M3/4
acts indirectly to disrupt Ll/L2a helix formation and inhibits
but does not completely prevent helix formation. Finally,
86
M3/4/20 cleaved as fast as M20 (Miller & Silver, 1991); while,
the double mutant M3/4 cleaves significantly slower. We
concluded that deleting C-24 and A-73 in a transcript with
M20, has little additional positive effect on the cleavage
rate. Therefore, these data indicate the major alternative
structure in the SSI transcript that inhibits cleavage is the
putative basepairing between LI and L2a. In general, there
seems to be two ways in which the rate of SSI cleavage can be
increased: directly by changing nts so that the two regions
(LI and L2a) are no longer complementary, or by deleting C-24
and A-73. In either case, the kj of the cleavage reaction is
increased since alternative structure(s) other than the
hammerhead are less likely to form.
Nuclease Sensitivity
The phosphodiester bond cleavage of small molecular
weight RNAs is: (i) highly dependent on the formation of the
hammerhead structure (Forster & Symons, 1987b; Sheldon &
Symons, 1989) and (ii) instantaneous and essentially
irreversible (Fedor & Uhlenbeck, 1992). Furthermore, Haldane
(1930) proposed that the transition state intermediate of any
enzyme-catalyzed reaction must be unstable to successfully
lower the activation energy. Therefore, when using structure-
sensitive nucleases to look at a cleaving RNA, care must be
taken in the interpretation of the data. The slow-cleaving
87
transcripts SSI, M3, and M4 will exist, generally, as inactive
molecules and thus sensitivity probing will most likely
reflect the presence of these inactive forms. However, with
the fast-cleaving transcripts, the probing may reveal
structure of the minority of molecules that form inactive
structures, but would not detect the majority which will have
self-cleaved. For example, the very fast-cleaving transcript
(M3/4/20) and the significantly less active RNA (M3/4/20a)
have nearly the same nuclease probing map (Fig. 5). This
result indicates that nuclease probing can not always
discriminate between active and inactive molecules. Secondly,
in the case of transcripts that have the M20 mutation (M20,
M3/4/20 and M3/4/20a), the CUGANGA region becomes
significantly less accessible to single strand analysis. This
change in enzyme susceptibility was the most significant in
the entire RNA molecule. Because formation of the hammerhead
depends on this region to be single-stranded (Forster &
Symons, 1987a), and nuclease probing indicated some of the
fast cleaving transcripts to be double-stranded in this
region, we conclude that this is the structure of the fraction
of transcripts that do not cleave even with extended times of
incubation. Even though the LI and L2a basepairing is
disrupted (Fig 4 & 5), other alternative structures are also
possible. In fact, GCG software using the RNA secondary
structure analysis applications, MFOLD and PLOTFOLD, indicates
88
additional basepairing is possible in both M3/4/20 and
M3/4/20a between nts 20-29 and 48-57 that is not present in
any of the other mutant transcripts. Finally, in nearly all
the transcripts, helix I has a high degree of single-stranded
character (Fig. 4 & 5) and thus the cleavage site has an
"open" structure. For ASBVd self-cleavage, a double
hammerhead model was proposed that involved the binding of a
second ASBVd molecule to the first in a manner that extends
stem III thus in effect stabilizing the very short and
unstable helix III. It seems unreasonable to believe stem I
can be so unstable and still cleave efficiently. Therefore,
our data are consistent with the proposal that structures
observed with nuclease sensitivity probing are ones that occur
in RNAs that self-cleave more slowly than the nucleases cut.
These structures may reflect those parts of the RNA that
inhibit the formation of the active hammerhead structure.
These data might help explain the observation that purified
transcripts of sLTSV require a boiling/snapcooling step before
efficient cleavage is realized (Forster & Symons, 1987).
Other Hammerheads
Generally speaking, the cleavage rate observed for sBYDV
(+) RNA is slower than for other self-cleaving RNAs. Even the
(-) strand hammerhead of sBYDV RNA cleaves at a much faster
rate than its counterpart in the (+) sense (Miller et al..
89
1991). It was believed earlier that the alternative bases
found in the (+) strand hammerhead were responsible for the
slow cleavage rate. However, mutagenic analysis of the
trinucleotide 5' to the cleavage site (Ruffner, et al., 1990)
and the discovery of the self-cleaving RNA of CarSV (Hernandez
et al., 1992) seem to indicate that the decrease in cleavage
efficiency of sBYDV (+) RNA is not due to the alternative
bases. More likely the slow cleavage rate of sBYDV is the
result of all the non-conserved nts interacting to form stable
alternative conformations with themselves and with the
conserved nts that make up the hammerhead. This would be
analogous to the global effects seen in proteins where one
amino acid change not in the active site per se still
interferes with catalytic activity. On the other hand, bases
that are a long distance from the cleavage site may in effect
inhibit formation of alternative structures {Ll-L2a helix).
In this case, the cleavage rate would increase. For example,
a permuted dimeric clone of sBYDV RNA that is composed of a
greater number of wildtype nts on either side of the cleavage
site cleaves much more efficiently than the less-than full-
length monomers (Miller & Silver, 1991; Silver et al., in
preparation). In summary, the rate of hammerhead-mediated
self-cleavage is likely affected by not only the conserved
nucleotides but also by the non-conserved bases. It is the
90
global interaction of all the nucleolids within a self-
cleaving RNA that governs the actual rate of cleavage.
91
REFERENCES
Baer, M. F., Arnez, J. G., Guerrier-Takada, C., Vioque, A., & Altmann, S. (1990) . Preparation and characterization of RNase P from E. coli. Methods in Enzvmoloav. 181. 569-582.
Bruening, G. (1989). Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods in Enzvmoloav. 1980. 546-558.
Bruening, G., Passmore, B. K., Toi, H. v., Buzayan, J. M., & Feldstein, P. A. (1991). Replication of a plant virus satellite RNA: Evidence favors transcription of circular templates of both polarities. Molecular Plant-Microbe Interactions. 4, 219-225.
Conway, L., & Wickens, M. (1989). Modification interference analysis of reactions using RNA substrates. Methods in enzvmoloav. 180. 369-379.
Epstein, L. M., & Gall, J. G. (1987). Self-cleaving transcripts of satellite DNA from the newt. Cell. 48. 535-543.
Fedor, M. J., & Uhlenbeck, 0. C. (1992). Kinetics of intermolecular cleavage by hammerhead ribozymes. Biochemistry. 31. 12042-12054.
Forster, A. C., & Symons, R. H. (1987a). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49. 211-220.
Forster, A. C., & Symons, R. H. (1987b). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49, 211-220.
Forster, A. C., & Symons, R. H. (1987c). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell. 50. 9-16.
Grodberg, J., & Dunn, J. J. (1988). omp T encodes Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification. J. Bacterid. 170. 1245-1253.
92
Haldane, J. B. S. (1930). Enzymes. London: Longmans.
Herlitze, S., & Koenen, M. (1990). A general and rapid mutagenesis method using polymerase chain reaction. Gene. 91, 143-147.
Hernandez, C., Daros, J. A., Elena, S. F., Moya, A., & Flores, R. (1992). The strands of both polarities of a small circular RNA from carnation self-cleave in vitro through alternative double-and single-hammerhead structures. Nucleic Acids Research. 20.6323-6329.
Hernandez, C., & Flores, R. (1992). Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures. Proceedings of the National Academv of Sciences. USA. 89. 3711-3715.
Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symons, R. H. (1986). Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research. 14. 3627-3641.
Lockard, R. E., & Kumar, A. (1981). Mapping tRNA structure in solution using double-strand-specific ribonuclease Vi from cobra venom. Nucleic Acids Research. 9, 5125-5140.
Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991). A satellite RNA of barley yellow dwarf virus contains novel hammerhead structure in the self-cleavage domain. Virology. 183. 711-720.
Miller, W. A., & Silver, S. L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucleic Acids Research. 19, 513-520.
Milligan, J. F., & Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods in Enzvmology. 180. 51-62.
Prody, G. A., Bakos, J. T., Buzayan, J. M., Schneider, I. R., & Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science. 231. 1577-1580.
Ruffner, D. E., Dahm, S. C., & Uhlenbeck, O. C. (1989). Studies on the hammerhead RNA self-cleaving domain. Gene. 82/ 31-41.
Ruffner, D. E., Stormo, G. D., & Uhlenbeck, O. C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 29, 10695-10702.
93
Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: A laboratory manual (2nd ed.)« Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Sheldon, C. C., & Symons, R. H. (1989). Mutagenesis analysis of a self-cleaving RNA. Nucleic Acids Research. 17, 5679-5685.
Symons, R. H. (1991a). The intriguing viroids and virusoids: What is their information content and how did they evolve? Molecular Plant-Microbe Interactions. 4, 111-121.
Symons, R. H. (1991b). Ribozymes. Critical Reviews in Plant Sciences. 10. 189-234.
Vary, C. P. H., & Vournakis, J. N. (1984). RNA structure analysis using T2 ribonuclease:detection of pH and metal ion induced conformational changes in yeast tRNA ". Nucleic Acids Research. 12, 6763-6778.
Zawadski, V., & Gross, H. J. (1991). Rapid and simple purification of T7 RNA polymerase. Nucleic Acids Research. 19, 1948.
94
REPLICATION OF TRANSCRIPTS FROM A CLONE OF BARLEY YELLOW DWARF VIRUS SATELLITE RNA IN OAT PROTOPLASTS
95
Replication of transcripts from a cDNA clone of barley yellow dwarf virus satellite RNA in oat protoplasts
Silver, S.L., M.S.
Miller, VI.A., Ph.D.
From the Department of Plant Pathology, Iowa State University, Ames, lA 50011
96
ABSTRACT
A small RNA associated with an isolate of barley yellow
dwarf virus (BYDV, RPV serotype) has been described which has
the physical properties of a satellite RNA (Miller et al.,
1991). Here, we demonstrate that this RNA has the biological
properties of a satellite RNA; it depends on helper virus
(BYDV genomic) RNA for replication and the helper RNA does not
depend on the satellite. To separate helper from satellite
RNA, a permuted dimeric clone was constructed from which
infectious satellite RNA could be transcribed in vitro. The
dimeric transcript self-cleaved to produce monomeric satellite
RNA. When this RNA was co-electroporated with BYDV genomic
RNA into oat protoplasts, replication of both RNAs was
detected by Northern hybridization. Satellite RNA was
incapable of independent replication. The presence of
discrete oligomeric forms of (+) and (-) sense satellite RNA
in infected protoplasts suggests that both strands replicate
by a rolling circle mechanism.
97
INTRODUCTION
Satellite RNAs of plant viruses are single-stranded
molecules that are completely dependent on a helper virus for
replication, encapsidation and spread (for review see
Roossinck et al., 1992). The helper virus is able to
replicate and spread in the absence of the satellite RNA.
Satellite RNAs have little sequence similarity with either the
helper virus RNA or host RNA. Virus disease symptoms can be
altered by the presence of the satellite RNA. In the majority
of cases, satellite RNAs attenuate symptoms with a concomitant
decrease in helper virus titer (Gerlach et al., 1986;
Roossinck et al., 1992; Waterworth et al., 1979).
One class that we call small satellite RNAs can form
circles and multimers that undergo a self-cleavage reaction
during replication. These include satellite RNAs of the
nepovirus, sobemovirus (virusoids) and luteovirus groups
(Francki, 1985; Keese & Symons, 1987; Miller et al., 1991;
Prody et al., 1986). The termini at the cleavage site include
a 5'-hydroxyl and a 2'-3'-cyclic phosphodiester (Buzayan
et al., 1986; Miller et al., 1991). It has been proposed that
the small satellite RNAs replicate by a rolling circle
mechanism in which large multimers are generated and then
98
cleaved into monomer-sized molecules (Branch & Robertson,
1984; Hutchins et al., 1985). This self-cleavage occurs with
a conserved hammerhead-shaped domain or less frequently a
hairpin structure (Forster & Symons, 1987a; Hampel et al.,
1990). The hammerhead is composed of three helical domains
(I, II, and III) and a central core of eleven conserved,
predominantly single-stranded nucleotides (Forster & Symons,
1987a) that are critical for self-cleavage (Ruffner et al.,
1990; Sheldon & Symons, 1989).
We described previously a satellite-like RNA associated
with barley yellow dwarf virus (sBYDV RNA) which has the above
physical properties of a small satellite RNA (Miller et al.,
1991). However, we had not demonstrated that this RNA is a
true satellite RNA by showing that it requires BYDV for
propagation and that BYDV does not require the satellite. To
pursue this question we first constructed a cDNA clone from
which full-length sBYDV RNA could be transcribed. This
allowed certain separation of helper and satellite RNA. The
in vitro-transcribed sBYDV RNA was then co-electroporated
along with BYDV virion RNA into oat protoplasts. The isolates
of BYDV we used for virion RNA isolation have been shown
previously not to have an associated satellite RNA. This is
similar to the approach of Gerlach et al.,(1986) who co-
inoculated tobacco plants with tobacco ringspot virus (ToBRV)
and the sToBRV RNA. Because BYDV is not mechanically
99
transmissible to whole plants (Oswald, 1951) we used a
protoplast system instead.
To construct an infectious sBYDV RNA transcript with
correct termini, we started with a permuted dimeric clone
(pBWS30) described previously (Miller et al., 1991). Both
copies of the dimer in this clone contain a deletion of the
3/-terminal base (nt 322) of monomeric sBYDV RNA (+) strand.
This deletion rendered (+) sense transcripts of pBWS30
extremely slow at self-cleavage. This is not surprising since
this resulted in deletion of the non-basepaired residue at the
5' side of the self-cleavage site required by the hammerhead
(Miller et al., 1991). Base 322 was restored to the pBWS30
sequence by site-directed mutagenesis at both cleavage sites.
The first mutagenesis reaction was according to Kunkel (1987)
using the oligomer 5'- TACGCGCTCTGT (ACGT)ATCCACGAAATAG-3'
which was degenerate at the site of base insertion. The
oligomer hybridizes on the dimeric insert in plasmid pBWS30
across each cleavage site (Figure lA). The resulting clones
were screened by double-stranded DNA sequencing (Promega).
For unknown reasons, only the 3' cleavage site was mutagenized
by this method. The 5' cleavage site was mutagenized
separately with the same primer by the PGR method of Herlitze
and Koenen (1990). The Hindlll-Bglll fragment of pBWS30 was
cloned into Bglll/Hindlll-cut pSLllSO (Pharmacia) to create
pHB-FL. The first PGR involved 25 cycles of amplification
100
(Amplitaq, Perkin-Elmer-Cetus) using the M13 reverse primer
and the above mutagenic oligomer. The purified PGR product
and the M13 forward primer were used for the second PGR using
the same target DNA (pHB-FL). Products from the second PGR
were digested with Bglll/Hindlll, gel-purified and ligated
into Bglll/Hindlll-cut pBWS30A that had been mutated
previously at the 3' cleavage site. Insertion of the
deoxyadenylate at both cleavage sites was confirmed by
sequencing. Other bases inserted at the cleavage site were
confirmed by sequencing but were not tested for cleavage.
Self-cleavage of Dimeric sBYDV RNA
The resulting permuted, dimeric wild type (pFL-WT) clone
was linearized with EcoRI and transcribed using SP6 RNA
polymerase (Promega) and [a-®^P] GTP (NEN/DuPont). An aliquot
of the transcription reaction was electrophoresed on a 6%
polyacrylamide gel and radioactive bands detected by
autoradiography.
Dependence of sBYDV RNA Replication
on BYDV Genomic RNA
A mixture of satellite-free isolates consisting of PAV-IL
and RPV-NY was propagated in oats (Avena sativa cv. Clintland
64) from which virus and viral RNA were extracted as described
by Waterhouse et al. (1986). Non-radiolabeled, permuted
101
dimeric sBYDV RNA was synthesized by in vitro transcription of
EcoJîJ-linearized pFL-WT using SP6 RNA polymerase (Ambion
Megascript kit, Austin, TX). The monomer obtained by self-
cleavage (as in Fig. IB), was gel-purified (Sambrook et al.,
1989). One hundred nanograms of this monomer and/or 100 ng of
viral RNA (17-fold molar excess of sBYDV RNA) were used as
inoculum. Protoplasts were prepared and electroporated as
described by Dinesh-Kumar et al. (1992). Total RNA was
isolated from protoplasts at various times after
A.
1 1 ^ 1 1 SP6 —
u Self-cleaved transcript:
nts:
B.
FL-WT M
269
4'
1 1 . .-.A#
322 122
Figure l. Map of permuted dimeric clone and transcripts of sBYDV RNA. Panel A shows the map of sBYDV RNA in the transcription vector, pBWS3 0A. Shaded regions indicate sequences involved in (+) strand cleavage. Arrows indicate cleavage sites. Expected cleavage product sizes for (+) strand are indicated. Abbreviations: R, EcoRI; S, Sau3AI; B, Bglll;, H, Hindlll. Panel B shows an autoradiograph of transcripts of in vitro transcribed (+) strand sBYDV RNA cleavage products after denaturing polyacrylamide gel electrophoresis.
102
electroporation, and analyzed by Northern hybridization (Fig.
2). In RNA from protoplasts inoculated with BYDV genomic RNA,
a (-) sense viral RNA probe complementary to the 5' end of the
BYDV-RPV genome, detected an approximately 5.5 kb band that
co-migrated with purified virion RNA (Fig. 2A). This was not
simply detection of inoculum RNA, because no viral RNA was
detected 5 min after inoculation (Fig. 2A, lane 1). Because
it spanned only the 5'-terminal 250 bases, this probe was not
expected to detect 3'-terminal subgenomic RNAs. A similar
pattern was detected when the blot was stripped and re-probed
with (-) sense BYDV-PAV genomic RNA (data not shown). Thus,
RNAs of both serotypes replicated in oat protoplasts. The
mixture of serotypes was used because such a mixture is known
to support sBYDV RNA replication in plants (Miller et al.,
1991) and the serotypes act synergistically (Baltenberger et
al., 1987) resulting in exacerbation of symptoms. Probes
specific for both the (+) and (-) strands of sBYDV RNA
hybridized to low molecular weight RNAs (Fig. 2B and C) that
accumulated by 30 hrs. post-inoculation. Neither probe
hybridized to RNA from protoplasts inoculated with sBYDV RNA
alone, indicating that it could not replicate in the absence
of BYDV genomic RNA. A slight decrease in BYDV-RPV genomic
RNA was observed consistently when sBYDV was co-electroporated
(Fig. 2A, compare lanes 2 and 3 with 5 and 6). This is
somewhat surprising because BYDV isolates that contain sBYDV
Figure 2. Northern hybridization of replication products in oat protoplasts. Five micrograms of total RNA isolated from protoplasts was electrophoretically separated on each lane of a 1% agarose gel and blotted to Genescreen (duPont/NEN) nylon membrane for hybridization with the probes indicated at right. After autoradiography, radioactive probe was removed from the blot by boiling for 15 min in O.lxSSC, 0.1% SDS, to allow for hybridization with a different probe. Protoplasts were inoculated with BYDV genomic RNA only (lanes 1-3), both BYDV genomic RNA and sBYDV RNA transcript (lanes 4-6), and sBYDV RNA transcript only (lanes 7-9). Protoplasts were harvested at 5 min (lanes 1, 4, 7), 30 hr (lanes 2, 5, 8) or 72 hr (lanes 3, 6, 9) after electroporation. Lane 10: 0.1 pg BYDV genomic RNA. Lane 11: 0.1 nq (+) sense monomeric sBYDV RNA transcript. Lane 12: 0.1 nq (-) sense sBYDV RNA transcript (including partial cleavage products) obtained by T7 RNA polymerase transcription from Hindlll-linearized pFL-WT. Mobilities of BYDV genomic RNA (G) and monomeric, dimeric and trimeric forms of sBYDV RNA (1, 2, 3) are indicated at left. A. Autoradiograph after probing with an a-[^^P]-labeled (-) sense transcript obtained by transcription of Apal-linearized pML5 with SP6 polymerase. pML5 contains an EcoRV fragment (bases 809-1191, R. Beckett, unpublished data) of the BYDV-RPV genome inserted in the EcRV site of pGEMSZ (Promega). B. After removal of RPV genomic RNA-specific probe, the blot was reprobed with a-[ P]-labeled (-) sense sBYDV RNA transcribed as described above. C. After removal of (-) sense sBYDV RNA probe, the blot was reprobed with a-[ P]-labeled (+) sense sBYDV RNA obtained by transcription as in Fig. 1.
104
Inoculum RNA: BYDV BYDV& sBYDV only sBYDV only
1 2 3 4 5 6 7 8 9 10 11 12 . Probe:
(-) BYDV-RPV RNA I
I
(-) sBYDV transcript
(+)sBYDV transcript
105
RNA in infected plants give high yields of virus (Miller
et al., 1991). Additional controls must be performed to
verify that the decrease in BYDV genomic RNA accumulation in
protoplasts is caused specifically by sBYDV RNA.
Replication of Both Strands of sBYDV RNA by a
Rolling Circle Mechanism
An oligomeric series of monomer through pentamer is
visible for (+) strand sBYDV RNA, and monomer through tetramer
for (-) strands. The higher molecular weight smear of (+)
sense satellite RNA may represent higher order multimers that
cannot be resolved on this gel system which was used to allow
detection of both genomic and satellite RNAs. In both
strands, the amount of multimer decreased with increasing
size. There was no cross-hybridization between satellite and
genomic RNA. (-) sense transcript hybridized weakly with
itself (Fig. 2B, lane 12), but (+) sense transcript did not
self-hybridize (Fig. 2C). Thus, the similarity of the (-)
sense pattern (Fig. 2C) to the (+) sense pattern (Fig. 2C) is
not due to cross-hybridization. The (-) strand pattern
differs from previous studies of satellite and viroid
replicative intermediates in infected plants (Branch et al.,
1982; Hutchins et al., 1985) by the relative ease of detection
and the distinct multimeric series of bands. The difficulty
in detection in previous cases was probably due to the excess
106
of (+) sense satellite RNA in infected tissue and dissociation
of bound, unlabeled RNA from the nylon membrane (Hutchins
et al., 1985). At least two factors may have contributed to
the ease of minus strand detection here. We bound the
extracted RNA to the nylon membrane by the more efficient
method of UV cross-linking rather than baking. Secondly, the
RNA was extracted from protoplasts which give synchronous
infection and vastly higher yields of RNA per weight of tissue
than do whole plants. Finally, the ratio of (+) to (-)
strands of sBYDV RNA may not be as great as with other
satellite RNAs.
The multimeric series of bands suggests that both strands
replicate by a rolling circle mechanism (Branch & Robertson,
1984; Hutchins et al., 1985; Kiefer et al., 1982). By this
symmetrical model of replication, the monomeric (+) sense RNA
circularizes to act as a template for production of multimeric
complementary strands which undergo self-cleavage to form
monomers which then circularize and the cycle is repeated to
produce (+) sense monomers. Although other models are
possible, the evidence with similar satellites such as sTobRV
(Bruening et al., 1991) strongly support this model. Thus
sBYDV RNA resembles sTobRV RNA, sLTSV RNA (Forster & Symons,
1987a), avocado sunblotch viroid (Hutchins et al., 1986) and
carnation stunt associated RNA (Hernandez & Flores, 1992) in
that both strands self-cleave during replication. This
107
contrasts with satellites of VTMoV, SCMoV and SNMV in which
only the (+) strand circularizes and self-cleaves. The (-)
strand forms a linear, multimeric (-)-stranded template for
(+) strand synthesis (Chu, 1983; Davies et al., 1990; Hutchins
et al., 1985) .
This construction of an infectious sBYDV RNA transcript
will allow us to determine its serotype-specificity and effect
on disease symptoms. sBYDV RNA was isolated from a mixture of
Australian PAY and RPV isolates of BYDV and from pure RPV
derived from this mixture (Miller et al., 1991). To determine
which BYDV serotypes are capable of supporting BYDV will
require rigorous separation of viral genomic RNAs, preferably
by construction of full-length clones. It is noteworthy that
the RNA-dependent RNA polymerase of the RPV serotype, but not
the PAV serotype, is related to those of the sobemoviruses
which are known to support similar satellite RNAs (Habili &
Symons, 1989; Vincent, 1991). Thus, helpers capable of
supporting sBYDV RNA replication may be limited to RPV-like
serotypes of BYDV. To study the effect of sBYDV RNA on
disease symptoms will require inoculation of plants with
aphids that acquired satellite-containing virus from
protoplasts (Young, 1991) or by agroinfection (Leiser et al.,
1992). Other satellite-like RNAs are associated with
luteoviruses. The ST9-associated RNA of BWYV may be a large
gene-encoding satellite (Chin et al, 1993), and a satellite
108
RNA has been shown to be associated with ground nut rosette
virus, a non-luteovirus that depends on ground nut rosette
assister luteovirus for transmission and disease (Murant,
1990). However, sBYDV RNA is the first luteovirus-associated
RNA shown to fulfill completely the definition of a satellite.
To understand how a satellite RNA affects symptom development
and how the helper virus and satellite RNA co-exist in vivo
demands defining more clearly the three-way relationship
between the satellite RNA, helper virus and host plant.
109
REFERENCES
Baltenberger, D. E., Ohm, H. W., & Foster, J. E. (1987). Reactions of oat, barley and wheat to infection with barley yellow dwarf virus isolates. Crop Sciences. 27, 195-198.
Branch, A. D., Robertson, H. D. (1984). A replication cycle for viroids and other small infectious RNAs. Science. 223. 450—455.
Branch, A. D., Robertson, H. D., Greer, C., Gegenheimer, P., Peebles, C., Abelson, J. (1982). Cell-free circularization of viroid progeny RNA by an RNA ligase from wheat germ. Science. 217. 1147-1149.
Bruening, G. (1989). Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods in Enzvmoloav. 180. 546-558.
Bruening, G., Passmore, B. K., Toi, H. v., Buzayan, J. M., & Feldstein, P. A. (1991). Replication of a plant virus satellite RNA: Evidence favors transcription of circular templates of both polarities. Molecular Plant-Microbe Interactions. 4, 219-225.
Buzayan, J. M., Gerlach, W. L., & Bruening, G. (1986). Satellite tobacco ringspot virus RNA: A subset of the RNA sequence is sufficient for autolytic processing. Proceedings of the National Academy of Sciences. USA. 83. 8859-8862.
Chin, L., Foster, J. L., Falk, B. W. (1993). The Beet Western Yellows Virus ST9- Associated RNA shares structural and Nucleotide sequence homology with Carmo-like viruses. Virology. 192. 473-482.
Chu, P. W. G., Francki, R. I. B., Randies, J. W. (1983). Detection, isolation and characterization of high molecular weight double-stranded RNAs in plants infected with velvet tobacco mottle virus. Virology. 126. 480-492.
110
Davles, C., Haseloff, J., & Symons, R. H. (1990). Structure, self-cleavage, and replication of two viroid-like satellite RNAs(virusoids) of subterranean clover mottle virus. Viroloav. 177. 216-224.
Dinesh-Kumar, S. P., Brault, V., & Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Viroloav. 187. 711-722.
Forster, A. C., & Symons, R. H. (1987a). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49. 211-220.
Forster, A. C., & Symons, R. H. (1987b). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell. 50. 9-16.
Francki, R. I. B. (1985). Plant Virus Satellites. Annual Review of Microbioloav. 39. 151-174.
Gerlach, W. L., Buzayan, J. M., Schneider, I. R., & Bruening, G. (1986). Satellite tobacco ringspot virus RNA: Biological activity of DNA clones and their in vitro transcripts. Viroloav. 151. 172-185.
Habili, N., & Symons, R. H. (1989). Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Research. 17, 9543-9555.
Hampel, A., Tritz, R., Hicks, M., Cruz, P. (1990). Hairpin catalytic RNA model: Evidence for helices and sequence requirement for substrate RNA. Nucleic Acids Research. 18, 299-304.
Herlitze, S., Koenen, M. (1990). A general and rapid mutagenesis method using polymerase chain reaction. Gene. 91/ 143-147.
Hernandez, C., & Flores, R. (1992). Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures. Proceedings of the National Academy of Sciences. USA. 89. 3711-3715.
Ill
Hutchins, C. J., Keese, P., Visvader, J. E., Rathjen, P. D., Mclnnes, J. L., & Symons, R. H. (1985). Comparison of multimeric plus and minus forms of viroids and virusoids. Plant Molecular Biology. 4, 293-304.
Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symons, R. H. (1986). Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research. 14. 3627-3641.
Keese, P., Symons, R. H. (1987). The structure of viroids and virusoids. Boca Raton: CRC Press.
Kiefer, M. C., Daubert, S. D., Schneider, I. R., Bruening, G. (1982). Multimeric forms of satellite tobacco ringspot virus RNA. Virology. 137. 371-381.
Kunkel, T. A., Roberts, J. D., Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods In Enzvmology. 154. 367-382.
Leiser, R. M., Ziegler-Graff, V., Reutenauer, A., Herrbach, E., Lemaire, O., Guilley, H., Richards, K., Jonard, G. (1992). Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus. Proceedings of the National Academy of Sciences. 89. 9136-9140.
Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991). A satellite RNA of barley yellow dwarf virus contains a novel hammerhead structure in the self-cleavage domain. Virology. 183. 711-720.
Murant, A. F. (1990). Dependence of groundnut rosette virus on its satellite RNA as well as on groundnut rosette assister luteovirus for transmission by Aphis craccivora. Journal of General Virology. 71, 2163-2166.
Oswald, J. W., Houston, B. R. (1951). A new virus disease of cereals, transmissible by aphids. Plant Disease Reporter. 35, 471-475.
Prody, G. A., Bakos, J. M., Buzayan, J. M., & Schneider, I. R., Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science. 231. 1577-1580.
Roossinck, M. J., Sleat, D., & Palukitis, P. (1992). Satellite RNAs of plant viruses; Structures and biological effects. Microbiological Reviews. 56. 265-279.
112
Ruffner, D. E., Stormo, G. D., & Uhlenbeck, O. C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 29. 10695-10702.
Sambrook, J., Fritsch, E. F., Maniatis, T. (1989). Molecular cloning: A laboratory manual (2nd ed.). Cold Spring Harbor: Cold Spring Laboratory Press.
Sheldon, C. C., & Symons, R. H. (1989). Mutagenesis analysis of a self-cleaving RNA. Nucleic Acids Research. 17. 5679-5685.
Vincent, J. R., Lister, R. M., Larkins, B. A. (1991). Nucleotide sequence analysis and genomic organization of the NY-RPV isolate of barley yellow dwarf virus. Journal of General Virology. 72. 2347-2355.
Waterhouse, P. M., Gerlach, W. L., Miller, W. A. (1986). Serotype-specific and general luteovirus probes from cloned cDNA sequences of barley yellow dwarf virus. Journal of Virology. §!_, 1273-1281.
Waterworth, H. E., Kaper, J. M., & Tousignant, M. E. (1979). CARNA5, the small cucumber mosaic virus-dependent replicating RNA, regulates disease expression. Science. 204. 845-847.
Young, M. J., Kelly, L., Larkin, P. J., Waterhouse, P. M., Gerlach, W. L. (1991). Infectious in vitro transcripts from a cloned cDNA of barley yellow dwarf virus. Virology. 180. 372-379.
113
BIMOLECULAR CLEAVAGE REACTION AND THE DESIGN OF TARGET-SPECIFIC RIBOZYMES
114
Biitiolecular cleavage reaction and the design of target specific ribozymes
Silver, S.L., M.S.
Miller, VI.A., Ph.D.
Department of Plant Pathology, Iowa State University, Ames 50011
115
INTRODUCTION
The first successful demonstration of a bimolecular
reaction involving an autocatalytic RNA was the ribozyme L-19
IVS derived from the pre-rRNA of T. thermophilia (Zaug et al.,
1986). As an endoribonuclease the L-19 IVS was directed
against a specific site within the a-globin mRNA (Zaug et al.,
1986). With a length of nearly 400 nts, the L-19 IVS RNA may
undergo changes in conformation resulting in formation of
inactive ribozyme structures in vivo. Additionally, the
kinetics of L-19 IVS RNA is characterized by Briggs-Haldane
kinetics, in which high affinity binding to the substrate and
the subsequent slow release of product is observed. The end
result is the propensity of the ribozyme to bind both
incorrect and correct substrate molecules equally well;
thereby cleaving a higher percentage of incorrect RNA
molecules (Herschlag, 1991). For these reasons, the potential
usefulness of the L-19 IVS ribozyme in vivo may be limited.
Uhlenbeck (1987) has suggested using the hammerhead
catalytic domain as a ribozyme since it is composed of only 50
nucleotides (Forster & Symons, 1987) which reduces the risk of
inactive ribozyme formation in vivo. In addition, the
116
hammerhead ribozyme is expected to cleave with Michaelis-
Menten kinetics; unlike the L-19 TVS ribozyme.
Uhlenbeck (1987), using the hammerhead of ASBV, dissected
the enzyme and substrate components into two separate
molecules (Fig lA). The substrate RNA contained a three-base
loop that connected the conserved nucleotides GAAA and U of
the hammerhead. The ribozyme component contained the
remaining conserved hammerhead nucleotides. After the
substrate and ribozyme RNAs were transcribed and annealed in
the presence of Mg^^, significant cleavage of the substrate RNA
into two fragments was observed (Uhlenbeck, 1987). The RNA
enzyme demonstrated turnover capability without undergoing
modification and thus was truly catalytic. This observation
was a significant development in the use of gene-targeted
ribozymes; since, now an RNA could potentially inactivate, not
only one copy of an RNA as in the case of an antisense
molecule, but several. Many examples of hammerheads now exist
that demonstrate bimolecular cleavage capability (Gerlach
et al., 1987; Jeffries & Symons, 1989; Koizumi et al., 1988).
In 1988 a more general acting hammerhead-derived ribozyme
was proposed which required the substrate RNA to contain only
the conserved U located one base upstream of the cleavage site
(Haseloff & Gerlach, 1988) (Fig IB). Since the catalytic
domain contained the majority of conserved nucleotides, almost
any substrate RNA could theoretically be targeted for
117
A. C C G A-U C-G /
Substrate^yi^-f^ ̂ pppQCQÇÇ® yÇÇAQÇoH hoCGCGG^ çAGCUCQGppp
Ribozyme
B.
5' Substrate f
xxxxxxyyyyyy xxxxxx
Glgcjyyyyy^xxxxxx DTMXXXXXX
II
III
lA A-U G-C
G U
II
Ribozyme
Figure 1. (A) Division of the ASBV hammerhead into substrate and catalytic domains. Conserved bases of hammerhead are in bold and italics. Arrow indicates cleavage site (Uhlenbeck, 1987) . (B) Gene-targeted ribozyme as proposed by Haseloff and Gerlach (1988). (I) indicates the one conserved nucleotide in the substrate RNA. (II) identifies the target arms which give specificity to the ribozyme. (Ill) is the catalytic domain of the ribozyme. Arrow indicates cleavage site (Haseloff & Gerlach, 1988).
118
cleavage. This ribozyme was constructed using 10 conserved
nucleotides of sToBRV (+) RNA connected by a 4 basepair helix
and a tetraloop. It was designed with "arms" that would base-
pair to the bacterial chloramphenical acetyl-transferase (CAT)
mRNA which included the U of the target. The CAT transcript
and ribozyme were incubated and significant cleavage of the
RNA was observed (Haseloff & Gerlach, 1988). Since the first
demonstration of a hammerhead-type ribozyme cleaving an
unrelated substrate RNA, other target-specific ribozymes have
been constructed (for review see Symons, 1991).
When designing gene-targeted ribozymes it is imperative
to consider the reaction pathway proposed for the
intermolecular cleavage reaction (Fedor & Uhlenbeck, 1992;
Fig. 2). The formation and dissociation of the enzyme-
substrate complex (E-S) is defined by the rate constants
and k.i respectively. The actual cleavage reaction is defined
by kgand dissociation of products from the ribozyme is defined
by kg and k^. Three main parameters must be
E-P2+P1
E + 8 E^ ̂ E-P1-P2 E+P1+P2
E-P1+P2
Figure 2. Proposed reaction pathway for bimolecular cleavage (Fedor & Uhlenbeck, 1992)
119
considered during ribozyme design. The first involves
selecting a ribozyme that has minimal sequence requirements.
As mentioned previously, the hammerhead catalytic domain is
excellent in this regard. The ribozyme described by Haseloff
and Gerlach (1988) has only 22 nts that are involved directly
in catalysis. Further deletions within the ribozyme, i.e.,
the short stem-loop connecting the two regions of conserved
bases in the ribozyme only decreases the cleavage rate (McCall
et al., 1992). Therefore, the 22 nt long sequence is likely
the shortest catalytic domain still capable of cleavage.
Secondly, alternative conformations within the target sequence
can pose significant difficulties for E-S formation. For
instance, some hammerhead ribozymes with a slow rate of
product formation have a low binding affinity for the
substrate RNA (Fedor & Uhlenbeck, 1992; Xing & Whitton, 1993).
It is believed this observation is the result of an
alternative secondary structure at the cleavage site.
Identification of target sites with a significant likelihood
of forming secondary structures can be accomplished using RNA
structure analysis software. A more time-consuming method by
which to find RNA secondary structures involves structure-
sensitive nucleases and chemical modification analysis.
The last consideration when designing a ribozyme is the
length and composition of the target arms. Changes in either
parameter result in dramatic effects on the rates of substrate
120
dissociation (k.j) and product release (kg and k^) (Fedor &
Uhlenbeck, 1992). By increasing the length of the target
arms, a corresponding increase in the stability of the E-S
complex occurs. A more stable E-S leads to a higher number of
incorrect RNAs binding to the ribozyme (lowered discrimination
index), because a few mismatches between ribozyme and target
will be tolerated and subsequently the cleavage of more
incorrect RNA molecules (Herschlag, 1991). Since the rate of
dissociation of small RNA duplexes is dependent on the length
and composition of the RNA (Tinoco, 1982), the rate of product
dissociation of the hammerhead ribozyme also depends directly
on the length and sequence of the target arms. This is a
major dilemma since both E-S complex formation and product
dissociation are dependent on the same parameters. This
dilemma is evident from mutagenic analysis of the target arms.
Base changes that increase kg and k^ also leads to an increase
in k.i. Haldane (1930) argued that instability of the E-S
complex is in fact the result of a lowering of the activation
energy between the E-S and E-P during enzyme catalysis.
Instability of the E-S complex is beneficial when attempting
to lower the activation energy. However, the E-S complex must
be sufficiently stable to allow cleavage. When designing a
ribozyme, therefore, the target arms must be long enough to
form a stable E-S complex but not so long as to lower the
121
discrimination index of the ribozyme or inhibit the release of
products from the ribozyme.
Presently, the optimal length and composition of the
target arms that results in the most efficient cleavage of a
substrate RNA in vivo is not known. However, many ribozymes
that cleave their substrate RNA efficiently have been
constructed. One of the best characterized ribozymes cleaves
c-fos mRNA (Scanlon et al., 1991). The ribozyme was shown to
significantly decrease the level of several proteins whose
translation is regulated by the c-fos mRNA product, whereas an
inactive form of the ribozyme had no influence on c-fos
regulated proteins. The accumulation of c-fos mRNA cleavage
products in vivo, however, was not determined. Therefore, as
is typical for most in vivo ribozyme studies, it is unclear
whether the ribozyme acts as a catalytic entity or simply as a
better antisense molecule than the inactive, mutated ribozyme.
To ascertain the efficacy of target-specific ribozymes, it is
imperative that the experimental approach allows one to
distinguish between cleavage of the target and mere antisense
inhibition.
In the present work, we dissect the sBYDV RNA hammerhead
into separate ribozyme and substrate transcripts and
demonstrate that a wildtype and a mutant catalytic domain have
the ability to associate with the substrate RNA in a manner
consistent with hammerhead formation. We also show that a
122
ribozyme targeted against the 5' end of BYDV-PAV is able to
specifically cleave a portion of the viral genomic RNA in
vitro.
123
MATERIAL AND METHODS
construction of Ribozymes
B19 and B5/19 ribozymes
To test whether the sBYDV RNA hammerhead can function in
an intermolecular fashion, the catalytic and substrate domains
of the (+) hammerhead were separated by placing bases 310 to
10 on one transcript (substrate) and bases 10 through 89 on a
second transcript (ribozyme). The first bimolecular enzyme
(B19) was constructed by cutting pSSM19 (Miller & Silver,
1991) and pGEM3Z (Promega, Madison, WI) with Sad and Drall.
The 2357 basepair (bp) vector fragment from the pSSM19
digestion was ligated to the 898 bp fragment from the pGEM3Z
digestion. The second bimolecular enzyme, 35/19 was
constructed from the clone pSSM5 (Miller & Silver, 1991).
SSM5 contains a 34 base deletion of nucleotides 30 to 63. The
M19 mutation containing the Sad site was introduced by site-
directed mutagenesis of pSSMS with the primer 5'
AGACAGTACGAGCTCTGTTATC 3' using the method of Kunkel et al.,
(1987). The resulting mutant pSSM5/19 (Fig. 3B) was divided
into catalytic and substrate domain as described above.
124
A. Substrate .310 MO
AUUUC aiOQA r BiBiBi^ùàÀÀàcËÀMÙ •••uj.MJiiii.w.ijaa tr
Ribozyme
"uqqu
B. Substrate
**^^UUUC (HJCKÏA^ACAQ'P®" 3' UauCAUGCU
TOU-A
3'
CGûGCt M lAAGCGG
Ribozyme
Figure 3. Bimolecular hammerhead formation of sBYDV (+) strand RNA. Boxed bases are conserved among all hammerheads.Numbering of nucleotides is based on the full-length satellite RNA. Cleavage sites indicated by an arrow. (A) B 19 and substrate RNA cleavage structure. (B) B 5/19 and substrate RNA cleavage structure.
125
Gene-targeted ribozymes
Sites within the BYDV genomic RNA containing the sequence
AUA were targeted for cleavage using the catalytic domain of
the sBYDV RNA (+) strand hammerhead. The ribozymes were
constructed by annealing complementary oligomers encoding the
ribozyme sequence to obtain a double stranded fragment with
sticky ends. The fragment was cloned into the transcription
vector pGEM3Z. Oligomers were synthesized using /3-
cyanoethylphosphoramidite chemistry (Nucleic Acids Facility,
Iowa State University). The subgenomic (SUBI) and upstream
(UPl) ribozymes (see below for specific target sites) were
cloned using the oligomers in Figure 4. Prior to cloning, the
oligomers were phosphorylated with T4 kinase. The oligomers
were annealed using a standard annealing buffer (40 mM Tris-
HCl, pH 7.4, and 4 mM MgClg) and approximately 1 /xg of each
oligomer (Ausubel et al., 1989). The annealing reaction was
heated to 95° C for 1 min followed by slow cooling to 22° C.
The annealed oligomers were ligated into BamHI-PstI digested
pGEM3Z. Successful transformation of E. coli (strain DH5aF')
with these ligation mixes required serial dilutions of the
ligation reaction; since high levels of DNA have been
implicated in decreased transformation efficiency.
126
Subgenomic Ribozyme Oligomers BarnH Prt
5' QArcCATACTAACCTQ(TA)CQACQTATCAATAQATACAaAAATAAACCCTATCCrGC/* 3' 3' 0TAT<SATTQQAC(AT)QCTQCATAQTTATCTATQTCTTTATTTQGQ^TA3 5'
Upstream Ribozyme Oligomers BwnH Pit)
5' QArCCTTGCTTTAQACTQ(TA)CQACQTATCAATAQATACAQAAATQTnTACTCTQCA 3' 3' GAACQAAATCTQAC(A'T7QCTQCATAGtrTATCTATQTCTTTACAAAATCWa 5'
Ribozyme 175 oligomer 3' ATATCACTCABCATAAT 5'
5' TAAAQCQQTTTCQTCCTCACQQACTCATCAQAAAQACTTCCTATAQTQAQTCQTATTA 3'
Figure 4. Oligonucleotides used in cloning the gene-targeted ribozymes or in the oligo-directed transcription of Rz 175. Bases involved in restriction enzyme sites are in italics. Bases in bold are the ribozyme target arms. Nucleotides in bold and underlined make up the T7 RNA polymerase promoter. Sequences involved in the catalytic domain of the ribozyme are boxed.
In Vitro Transcription and Cleavage Assays
B19 and B5/19 ribozymes
Transcripts of the bimolecular enzymes were synthesized
by digesting pB19 and pB5/19 with Hind III, extracting with
phenol/chloroform and ethanol precipitating for 3 0 min at
-80° C. The linearized DNA was resuspended in 0.1%
diethylpyrocarbonate (DEPC)-treated water and quantified by
determining the O.D.260nm* A typical ICQ nl transcription
127
reaction contained transcription buffer (40 mM Tris-HCl, pH
8.0, 6 mM MgClg, 5 mM DTT, 1 mM spermidine), 0.5-1.0 mM NTP,
100 units of RNasin, 10 jug of linearized template and 150
units of T7 RNA polymerase. The reaction was incubated at 37°
C for 1-3 hours. For a-[®^P]-labeled transcripts, 50 nCi of a-
[®^P]GTP (NEN/duPont) was added to the reaction. Substrate RNA
was transcribed from Sacl-linearized pSSM19 (Miller & Silver,
1991). Each RNA was run on a 6% polyacrylamide gel containing
7 M urea and full-length substrate and ribozyme molecules were
purified by excising the radioactive bands and eluting the RNA
from the gel by constant shaking in elution buffer (0.5 M
ammonium acetate, 1 mM EDTA, pH 8.0, and 0.1% SDS; Sambrook et
al., 1989). Radioactivity was determined by liquid
scintillation counting. Cleavage assays were performed as
described previously (see Material and Methods, Section I).
Gene-targeted ribozymes
Ribozymes UPl and SUBI were transcribed from Pst I-
linearized duplex DNA using T7 RNA polymerase. Full-length
ribozyme transcripts were gel-purified as above. Ribozyme 175
(Rz 175) was transcribed directly from an oligomer containing
the complement of the T7 RNA polymerase promoter (Fig. 4)
according to the method of Milligan and Uhlenbeck (1989). The
17-mer containing the T7 RNA polymerase promoter was combined
in an equal molar ratio with the synthetic template containing
the ribozyme and the complement of the T7 RNA polymerase
128
promoter (Fig. 4). Annealing of the two oligomers was
performed by heating to 95° C in Tris, pH 7.5, and 10 mM MgClg
followed by quick cooling to room temperature. The resulting
partially double-stranded oligomer was directly used for
transcription of Rzl75.
UPl substrate RNA was transcribed from EcoRI-linearized
pPA142 (Miller et al., 1988) and SUBI substrate was
transcribed from EcoRl-digested pSP-17 (Dinesh-Kumar et al.,
1992) . Substrate RNA for Rzl75 was transcribed from EcoRV-
digested pPAV-6 (Dinesh-Kumar et al., 1992). All substrates
were internally labeled using a-[®^P]-GTP and gel-purified from
a 6% polyacrylamide gel as described previously.
129
RESULTS AND DISCUSSION
Bimolecular Cleavage
The efficiency of the sBYDV (+) RNA hammerhead in a
bimolecular cleavage reaction was determined by dividing the
catalytic and substrate domains of pSS19 and pSSM5 into
separate transcripts (Fig. 3A & B). The cleavage assay
contained either B5/19 or B19 and a 5-fold molar excess of
substrate RNA. After incubating the ribozyme and substrate
for 1 hour at 3 0° C in 10 mM MgClg, the cleavage products were
separated on a 10% polyacrylamide gel containing 7 M urea
followed by quantification of fragments by phosphoryimage
analysis (Molecular Dynamics). B19 converted 4% of the
substrate into the expected 18 base and 8 base products
(Fig. 5). Incubation of B5/19 and S19 resulted in cleavage of
nearly 38% of the substrate RNA into products. Incubation of
the substrate and B5/19 transcripts at either 37° C or 45° C
resulted in approximately 65% of the substrate RNA being
converted into products (Fig. 6) .
The B5/19 cleavage rate is similar to other bimolecular
reactions that use the hammerhead catalytic domain of the
satellite RNA of tobacco ringspot virus (sToBRV RNA) (Haseloff
& Gerlach, 1988) and avocado sunblotch viroid (ASBVd)
(Uhlenbeck, 1987). The only sequence difference between B19
130
30°C 37t 45°C
z i A z i £ z o
A + o
Ë + o
(n A (0 (0 Ë CO (0 i!
#
3' PRODUCT
Figure 5. Bimolecular cleavage by ribozyme B19. Autoradiograph of transcripts subjected to denaturing polyacrylamide gel electrophoresis after incubation in cleavage conditions for 1 hour at 30| C. Mobilities of full-length substrate (S) and 5' and 3' products are indicated. Abbreviations: Rz, ribozyme; S, substrate.
131
m #
^ 3' PRODUCT
5' PRODUCT
Figure 6. Bimolecular cleavage by ribozyme B5/19. Autoradiograph of transcripts subjected to denaturing polyacrylamide gel electrophoresis after incubation in cleavage conditions for 1 hour at temperatures indicated. Mobilities of full-length (S) and 5' and 3' products are indicated. Abbreviations: Rz, ribozyme; S, substrate.
132
and B5/19 is the 34 base deletion in B5/19 (Fig. 3).
Secondary structure comparison of each ribozyme/substrate pair
using the software MFOLD and PLOTFOLD in the GCG package
(Zuker, 1989) revealed no significant alternative conformation
that could account for the poor cleavage efficiency of B19. A
significant difference, however, was observed in the
calculated -AG values of the two ribozyme/substrate complexes.
B19 forms a more stable hammerhead than does B5/19. According
to Fedor and Uhlenbeck (1992), increasing the stability of a
hammerhead above an optimal point could potentially cause an
actual decline in the rate of product release. The -AG of the
B19-S19 complex is -26.9 whereas the -AG of the B 5/19-S19
complex is significantly more positive with a value of -20.4.
Further deletions and base changes in the catalytic domain
along with nuclease probing experiments will be required to
fully characterize the chemistry of enzyme association and
product release.
Gene Targeted Ribozymes
Ribozymes designed to down-regulate a particular gene
have met with some success in vivo (for review see Gotten &
Birnstiel, 1989; Scanlon et al., 1991/ Symons, 1991; Xing &
Whitton, 1993). Thus we attempted to define ribozyme target
sites within the genome of BYDV-PAV. The first ribozyme
tested, UPl, was directed at a sequence in BYDV-PAV spanning
133
the nucleotides 1018 to 1039 of the 39K open reading frame
(ORF) (Fig. 7). UPl resulted in no detectable cleavage after
1 hour at 37° C (data not shown) . The second ribozyme tested
against the BYDV genome was SUBI. This ribozyme anneals at a
site extending over nucleotides 2769 to 2789. 2769 is the
exact start of subgenomic RNA 1 formed during BYDV infection
(Fig. 7) (Dinesh-Kumar et al., 1992). Similar to the UPl
ribozyme, SUBI resulted in no significant cleavage of BYDV
genomic RNA.
A survey of the UPl target sequence using the program,
RNASE did not reveal any obvious secondary structures within
the target site. Upon further analysis using GCG-MFOLD
(Zuker, 1989), the 3' end of the target sequence demonstrated
the potential to form duplex DNA that may interfere with
association of the ribozyme to the cleavage site sufficiently
to inhibit cleavage of the target sequence. A search of the
SUBI target sequence using nuclease probing analysis revealed
a significant conformation within the subgenomic promoter
sequence (Dinesh-Kumar et al., 1992) (Fig. 8). The target
sequence is bounded by the two arrows (Fig. 8) and forms a
stem-loop structure that clearly would inhibit the annealing
of ribozyme and substrate.
After the failure of two ribozyme constructs to cleave
genomic BYDV RNA in vitro, the third ribozyme we tested used
the catalytically-important nts from the sToBRV hammerhead.
134
5 '
Readthrough Frameshift
60K(POL) 1 mm
CP 22K (t7K
f Leaky Scanning
• 6.7K
3 '
Subitrat*
®A g®Aa®
y^A RJbozynw qIC
A A UA
ButwtrMi i s'aAUfOGajuuAmauuMUAi s-
M Rixsyini Q-C
A A UA
•
RbozytiM A a Q U
Figure 7. Sequences targeted for ribozyme-mediated cleavage. (A) Genome organization of BYDV-PAV. (B) For each ribozyme, the catalytic domain and the target site are given. Arrows indicate the cleavage site.
135
G G®°
A A U-G C-G A-U C-G C-G
A-U
u% ^ « G A90 CP ORF start
U-A^O y y C^
'°UU.A a'=AAU4°AGUU-AU
\ U-G G-C
;....G^"'-'AC»UUAGCUc'ty CAAAUCAAAAUGGC A... 3' ' 130
17K ORF Start
Figure 8. Proposed secondary structure of the subgenomic promoter sequence of BYDV-PAV. Arrows indicate start and end points of Rz-175 target site (Dinesh-Kumar et al., 1992).
136
With the sToBRV-derived ribozyme, the 5' side of the cleavage
site must now have a GUC trinucleotide instead of the AUA
trinucleotide. The target site in BYDV genome was chosen
after extensively searching the entire BYDV genome for a
cleavage site that had little opportunity for secondary
structure formation. A 5' end sequence was selected because
cleavage here should inhibit an early step in virus
replication. The cleavage assay contained 3 0 nM ribozyme and
100 nM substrate RNA. Approximately 25% of the substrate RNA
was converted into product after 180 min incubation in
standard cleavage conditions at 37° C (Fig. 9).
Future attempts to designing target-specific ribozymes
against BYDV genomic RNA will involve the careful selection of
numerous sites within the genomic RNA that do not form
predicted stable secondary structures. Nuclease probing
experiments along with determining the cleavage efficiency of
ribozymes at many sites within the BYDV RNA will give insight
into avoiding ribozyme inactivity due to alternative
conformations. In addition, the smallest, most efficient
ribozyme will need to be designed. This will entail
determining what role(s) the conserved and non-conserved bases
serve in the cleavage reaction and how changes within these
bases change the dynamics of hammerhead formation and product
dissociation.
137
SUBSTRATE
5' PRODUCT
3' PRODUCT
Figure 9. Rz-175 cleavage assay. Autoradiograph of transcripts after incubation for indicated times. Mobilities of full-length substrate (5' 258 bases of BYDV-PAV) and 5' and 3' products are given.
138
REFERENCES
Gotten, M., & Birnstiel, M. L. (1989). Ribozyme mediated destruction of RNA in vivo. The EMBO Journal. 8, 3861-3866.
Dinesh-Kumar, S. P., Brault, V., & Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Virology. 187. 711-722.
Fedor, M. J., & Uhlenbeck, O. C. (1992). Kinetics of intermolecular cleavage by hammerhead ribozymes. Biochemistrv. 31. 12042-12054.
Forster, A. C., & Symons, R. H. (1987). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell. 50. 9-16.
Gerlach, W. L., Llewellyn, D., & Haseloff, J. (1987). Construction of a plant disease resistance gene from the satellite RNA of tobacco ringspot virus. Nature. 328. 802-805.
Haldane, J. B. S. (1930) . Enzymes. London: Longmans.
Haseloff, J., & Gerlach, W. L. (1988). Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. 334. 585-591.
Herschlag, D. (1991). Implications of ribozyme kinetics for targeting the cleavage of specific RNA molecules in vivo: more isn't always better. Proceedings of the National Academy of Sciences. USA. 88. 6921-6925.
Jeffries, A. J., & Symons, R. H. (1989). A catalytic 13-mer ribozyme. Nucleic Acids Research. 17. 1371-1377.
Koizumi, M., Iwai, S., & Ohtsuka, E. (1988). Construction of a series of several self-cleaving RNA duplexes using synthetic 21-mers. FEB. 228. 228-230.
139
Kunkel, T. A., Roberts, J. D., & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods In Enzvmoloav. 154. 367-382.
McCall, M. J., Hendry, P., & Jennings, P. A. (1992). Minimal sequence requirements for ribozyme activity. Proceedings of the National Academy of Sciences. 89. 5710-5714.
Miller, W. A., & Silver, S. L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucleic Acids Research. 19, 513-520.
Miller, W. A., Waterhouse, P. M., & Gerlach, W. L. (1988). Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Research. 16, 6097-6111.
Milligan, J. F., & Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods in Enzvmoloav. 180. 51-62.
Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning; A laboratory manual (2nd ed.). Cold Spring Harbor: Cold Spring Laboratory Press.
Scanlon, K. J., Jiao, L., Funato, T., Wang, W., Tone, T., Rossi, J. J., & Kashani-Sabet, M. (1991). Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proceedings of the National Academy of Sciences. USA. 88, 10591-10595.
Symons, R. H. (1991). Ribozymes. Critical Reviews in Plant Sciences. 10. 189-234.
Uhlenbeck, O. C. (1987). A small catalytic oligoribonucleotide. Nature. 328. 596-600.
Xing, Z., & Whitton, L. (1993). An anti-lymphocytic choriomeningitis virus ribozyme expressed in tissue culture cells diminishes viral RNA levels and leads to a reduction in infectious virus yield. Journal of Virology. 67. 1840-1847.
Zaug, A. J., Been, M. D., & Cech, T. R. (1986). Tetrahymena ribozyme acts like an RNA restriction enzyme. Nature. 324. 429-433.
Zuker, M. (1989). On finding all suboptimal foldings of an RNA molecule. Science. 244. 48-52.
140
GENERAL SUMMARY
Barley yellow dwarf virus (BYDV) is the most widespread
and destructive plant virus disease of small grain cereals
(Plumb, 1983). Significant grain yield losses due to BYDV
have been observed in both deliberate and natural infections
(Yamani & Hill, 1991). Several methods have been employed to
control BYDV infestations. For example, (i) monitoring of
aphid populations to determine the best time for planting or
for application of insecticides, (ii) use of an aphid parasite
to decrease the aphid population, and (iii) breeding for
resistance cultivars using the Yd2 gene from Ethiopian barley,
have all been used in the past with varying degrees of
success. Less classical approaches to disease management have
also been implemented to control virus infestations.
Mechanisms such as coat protein-mediated resistance and the
use of satellite RNAs have been used with other plant viruses.
Since no one control strategy can be or has been proven
completely effective in eliminating yield losses due to BYDV,
it is necessary to further characterize BYDV and the recently
discovered satellite of BYDV with respect to pathogenesis.
This study was limited to the analysis of the self-cleavage
site within sBYDV (+) RNA, synthesis, initial characterization
141
of a full-length infectious sBYDV clone, and the design and
testing of target-specific ribozymes against BYDV genomic RNA.
In PAPER I and II, we attempted to further characterize
the hammerhead structure that is believed to be required for
self-cleavage of sBYDV (+) RNA. In addition to having the 11
conserved nts found in all hammerheads, the (+) strand
cleavage site of sBYDV has several novel features. First, the
trinucleotide at the 5' side of the cleavage site is AUA,
rather than the usual GUC. Second, two unpaired bases C-24
and A-73 are located at the top of stem II. Only one other
self-cleaving RNA has bases analogous to C-24 and A-73.
Finally, an additional helix not accounted for in the
hammerhead motif may form within the cleavage domain of sBYDV
(+) RNA. From site-directed mutagenesis and structure
sensitive probing of a less-than-full-length sBYDV RNA
transcript, we demonstrated that the alternative structure
does form and results in a very inefficient cleavage reaction.
These data are consistent with the proposal (Fedor &
Uhlenbeck, 1992) that all bases in and near the cleavage site
affect the rate of cleavage. Deletion of both of the
unpaired, nonconserved nts C-24 and A-73 had a positive
influence on the cleavage rate. This further underscores the
importance of many bases in the hammerhead in cleavage.
PAPER III involved the cloning of a full-length,
infectious sBYDV. Initial characterization of the construct
142
proved the small RNA found associated with BYDV-RPV is indeed
a true satellite RNA. Furthermore, preliminary results
suggest that the presence of the sBYDV with BYDV inhibits the
replication of the helper virus. More rigorous testing of
this observation should indicate whether this inhibition is
valid or due to experimental variation.
PAPER IV involved the use of the hammerhead motif of
sBYDV (+) RNA for the design of a target-specific ribozyme
against BYDV genomic RNA. Although we observed cleavage of
BYDV RNA in vitro, cleavage of BYDV RNA in vivo will be more
difficult to obtain. Such inhibitory effects as inability of
the ribozyme to find and anneal to the target RNA, slow rates
of product dissociation and less than optimal
concentrations within the cell will most probably decrease
cleavage efficacy and thus several additional ribozyme
constructs will need to be tested.
To effectively control yield losses imposed by BYDV
infestations, a better understanding of how BYDV and sBYDV
affect pathogenesis is mandatory. With full-length infectious
clones of the sBYDV and helper virus, questions concerning the
relationships between satellite RNAs, different helper virus
serotypes, host plant species, and environment can now be
addressed.
143
LITERATURE CITED
Altmann, S. (1987). Ribonuclease P: An enzyme with a catalytic RNA subunit. Advances in Enzvmoloav. 62. 1-36.
Baer, M. F., Arnez, J. G., Guerrier-Takada, C., Vioque, A., & Altmann, S. (1990). Preparation and characterization of RNase P from E. coli. Methods in Enzvmoloav. 181. 569-582.
Been, M. D., & Cech, T. R. (1986). Sequence specificity of Tetrahymena pre-rRNA self-splicing, trans-splicing and RNA enzyme activity. Cell. 47. 207-216.
Been, M. D., Prrotta, A. T., & Rosenstein, S. P. (1992). Secondary structure of the self-cleaving RNA of Hepatitis delta virus; Applications to catalytic RNA design. Biochemistry. 31. 11843-11852.
Branch, A. D., & Robertson, H. D. (1984). A replication cycle for viroids and other small infectious RNAs. Science. 223. 450-455.
Brault, v., & Miller, W. A. (1992). Translational frameshifting mediated by a viral sequence in plant cells. Proceedings of the National Academy of Sciences. 89. 2262 -2266 .
Bruening, G. (1989). Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods in Enzvmoloav. 180. 546-558.
Burgin, A. B., & Pace, N. R. (1990). Mapping of the active site of ribonuclease P RNA using a subunit containing a photoaffinity agent. EMBO J.. £, 4111-4115.
Cech, T. R., Zaug, A. J., Grabowski, P. J. (1981). In vitro splicing of the ribosomal RNA precursor of Tetrahymena: Involvement of a guanosine nucleotide in the excision of the intervening sequence. Cell. 27. 487-490.
Cech, T. R. (1990). Self-splicing of group I introns. Annual Review of Biochemistry. 59. 543-568.
144
Gotten, M., Schaffner, G., & Birnstiel, M. L. (1989). Ribozyme, antisense RNA, and antisense DNA inhibition of U7 small nuclear ribonucleoprotein-mediated histone pre-mRNA processing in vitro. Molecular and Cellular Bioloav. 9, 4479-4487.
Dahm, S. C., & Uhlenbeck, O. C. (1991). Role of divalent metal ions in the hammerhead RNA cleavage reaction. Biochemistrv. 30. 9464-9469.
Davies, C., Haseloff, J., & Symons, R. H. (1990). Structure, self-cleavage, and replication of two viroid-like satellite RNAs (virusoids) of subterranean clover mottle virus. Viroloav. 177. 216-224.
Davies, R. W., Waring, R. B., Ray, J. A., Brown, T. A., & Scazzocchio, C. (1982). Making ends meet: A model for RNA splicing in fungal mitochondria. Nature. 300. 719-724.
Dinesh-Kumar, S. P., Brault, V., & Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Viroloav. 187. 711-722.
Ehrenmann, K., Schroeder, R., Chandry, P. S., Hall, D. H., & Belfort, M. (1989). Sequence specificity of the P6 pairing for splicing of the group I td intron of phage T4. Nucleic Acids Research. 17, 9147-9163.
Epstein, L. M., & Gall, J. G. (1987). Self-cleaving transcripts of satellite DNA from the newt. Cell. 48. 535-543.
Fedor, M. J., & Uhlenbeck, 0. C. (1992). Kinetics of intermolecular cleavage by hammerhead ribozymes. Biochemistrv. 31. 12042-12054.
Forster, A. C., & Altmann, S. (1990). External guide sequence for an RNA enzyme. Science. 249. 783-786.
Forster, A. C., & Symons, R. H. (1987). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49, 211-220.
Francki, R. I. B. (1985). Plant virus satellites. Annual Review of Microbioloav. 39, 151-174.
Garriga, G., & Lambowitz, A. M. (1986). Protein dependent splicing of a group I intron in ribonucleoprotein particles and soluble fractions. Cell. 46. 669-680.
145
Guerrier-Takada, C., Gardiner, K., Marsh, T., Pace, N., & Altman, S. (1983). The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell. 35, 849-857.
Hampel, A., Tritz, R., Hicks, M., & Cruz, P. (1990). Hairpin catalytic RNA model: Evidence for helices and sequence requirement for substrate RNA. Nucleic Acids Research. 18, 299-304.
Haseloff, J., & Gerlach, W. L. (1988). Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. 334. 585-591.
Haseloff, J., & Gerlach, W. L. (1989). Sequences required for self-catalysed cleavage of the satellite RNA of tobacco ringspot virus. Gene. 82. 43-52.
Hernandez, C., Daros, J. A., Elena, S. F., Moya, A., & Flores, R. (1992). The strands of both polarities of a small circular RNA from carnation self-cleave in vitro through alternative double- and single-hammerhead structures. Nucleic Acids Research. 20. 6323-6329.
Hernandez, C., & Flores, R. (1992). Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures. Proceedings of the National Academy of Sciences. USA. 89. 3711-3715.
Hutchins, C. J., Keese, P., Visvader, J. E., Rathjen, P. D., Mclnnes, J. L., & Symons, R. H. (1985). Comparison of multimeric plus and minus forms of viroids and virusoids. Plant Molecular Biology. 4, 293-304.
Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symonds, R. H. (1986). Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research. 14, 3627-3641.
Jacquier, A. (1990). Self-splicing group II and nuclear pre-mRNA introns: How similar are they? Trends in Biochemical Sciences. 15, 351-354.
Keese, P., & symons, R. H. (1987). The structure of viroids and virusoids. Boca Raton; CRC Press.
Kruger, K., Grabowski, P. J., Zaug, A. J., Sands, J., Gottschling, D. E., Cech, T. R. (1982). Self-splicing RNA: Autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena. Cell. 31. 147-157.
146
Kuo, M., Sharmeen, L., Dinter-Gottlieb, G., & Taylor, J. (1988). Characterization of self-cleaving RNA sequences on the genome and antigenome of human hepatitis delta virus. Journal of Viroloav. 62. 4439-4444.
Lazowaska, J., Jacq, C., & Slonimski, P. P. (1980). Sequence of introns and flanking exons in wildtype and box3 mutants of cytochrome b reveals an interlaced splicing protein coded by an intron. Cell. 22. 333-348.
Mei, H. Y., Kaaret, T. W., & Bruice, T. C. (1989). A computational approach to the mechanism of self-cleavage of hammerhead RNA. Proceedings of the National Academy of Sciences. USA. 86. 9727-9731.
Michel, F., Jacquier, A., & Dujon, B. (1982). Comparison of fungal mitochondrial introns reveals extensive homologies in RNA secondary structure. Biochimie. 64. 867-881.
Michel, F., Umesono, K., & Ozeki, H. (1989). Comparison and functional anatomy of group II catalytic introns—A review. Gene, 5-30.
Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991). A satellite RNA of barley yellow dwarf virus contains a novel hammerhead structure in the self-cleavage domain. Viroloav. 183. 711-720.
Miller, W. A., & Silver, S. L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucleic Acids Research. 19, 513-520.
Miller, W. A., Waterhouse, P. M., & Gerlach, W. L. (1988). Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Research. 16, 6097-6111.
Oswald, J. W., & Houston, B. R. (1951). A new virus disease of cereals, transmissible by aphids. Plant Disease Reporter. 35. 471-475.
Pace, N. R., & Smith, D. (1990). Ribonuclease P; Function and variation. Journal of Biological Chemistrv. 265. 3587-3590.
Perrotta, A. T., & Been, M. D. (1991). A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature. 350. 434-436.
147
Plumb, R. T. (1983). Barley yellow dwarf virus—A global problem. London: Blackwell Sciences.
Prody, G. A., Bakos, J. T., Buzayan, J. M., Schneider, I. R., & Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science. 231. 1577-1580.
Rochow, W. F. (1970). Barley yellow dwarf virus: Phenotypic mixing and vector specificity. Science. 167. 875-878.
Roossinck, M. J., Sleat, D., & Palukitis, P. (1992). Satellite RNAs of plant viruses; Structures and biological effects. Microbiological Reviews. 56. 265-279.
Ruby, S. W., & Abelson, J. (1991). Pre-mRNA splicing in yeast. Trends in Genetics. 2» 79-85.
Ruffner, D. E., Dahm, S. C., & Uhlenbeck, O. C. (1989). Studies on the hammerhead RNA self-cleaving domain. Gene. 82, 31-41.
Ruffner, D. E., Stormo, G. D., & Uhlenbeck, O. C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 29. 10695-10702.
Sarver, N., M.Cantin, E., Chang, P. S., Zaia, J. A., Ladne, P.A., Stephens, D. A., & Rossi, J. J. (1990). Ribozymes as potential anti-HIV-1 therapeutic agents. Science. 247. 1222-1225.
Saville, B. J., & Collins, R. A. (1990). A site-specific self-cleavage reaction performed by a novel RNA in Neurospora mitochondria. Cell. 61. 685.
Saxena, S. K., & Ackerman, E. J. (1990). Ribozymes correctly cleave a model substrate and endogenous RNA in vivo. The Journal of Biological Chemistry. 28, 17106-17109.
Scanlon, K. J., Jiao, L., Funato, T., Wang, W., Tone, T., Rossi, J. J., & Kashani-Sabet, M. (1991). Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proceedings of the National Academy of Sciences. USA. 88, 10591-10595.
Schneider, I. R. (1969). Satellite-like particle of tobacco ringspot virus that resembles tobacco ringspot virus. Science. 166. 1627-1629.
Schneider, I. R. (1977). Defective plant viruses. Montclair: Allanheld, Osmun.
148
Sharmeen, L., Kuo, M. Y. P., Dinter-Gottlieb, G., & Taylor, J. (1988). Antigenomic RNA of human hepatitis delta virus can undergo self-cleavage. Journal of Virology. 62. 2674.
Sheldon, C. C., & Symons, R. H. (1989). Mutagenesis analysis of a self-cleaving RNA. Nucleic Acids Research. 17. 5679-5685.
Shiraishi, H., & Shimura, Y. (1988). Functional domains of the RNA component of ribonuclease P revealed by chemical probing of mutant RNAs. EMBO J.. 7, 3817-3821.
Slim, G., & Gait, M. J. (1991). Configurationally defined phosphorothioate-containing oligoribonucleotides in the study of the mechanism of cleavage of hammerhead ribozymes. Nucleic Acids Research. 19, 1183-1188.
Symons, R. H. (1989). Self-cleavage of RNA in the replication of small pathogens of plants and animals. Trends in Biochemical Sciences. 14 November. 445-450.
Symons, R. H. (1991a). The intriguing viroids and virusoids: What is their information content and how did they evolve? Molecular Plant-Microbe Interactions. 4, 111-121.
Symons, R. H. (1991b). Ribozymes. Critical Reviews in Plant Sciences. 10, 189-234.
Tani, T., Takahashi, Y., & Ohshima, Y. (1992). Activity of chimeric RNAs of U6 snRNA and (-) sTRSV in the cleavage of a substrate RNA. Nucleic Acids Research. 20, 2991-2996.
Thill, G., Blumenfeld, M., Lescure, F., & Vasseur, M. (1991). Self-cleavage of a 71 nucleotide-long ribozyme derived from hepatitis delta virus genomic RNA. Nucleic Acids Research. 19, 6519-6525.
Uchimaru, T., Uebayasi, M., Tanabe, K., & Taira, K. (1993). Theoretical analyses on the role of Mg2+ ions in ribozyme reactions. The FASEB Journal. 7, 137-142.
Uhlenbeck, O. C. (1987). A small catalytic oligoribonucleotide. Nature. 328. 596-600.
Vincent, J. R., Lister, R. M., & Larkins, B. A. (1991). Nucleotide sequence analysis and genomic organization of the NY-RPV isolate of barley yellow dwarf virus. Journal of General Virology. 72. 2347-2355.
149
Waring, R. B., Towner, P., Minter, S. J., & Davies, R. W. (1986). Splice-site selection by a self-splicing RNA of Tetrahymena. Nature. 321. 133-139.
Wu, H. N., Lin, Y. J., Lin, F. P., Makino, S., Chang, M. F., & Lai, M. C. C. (1989) . Human hepatitis delta RNA subfragments contain an autocleavage activity. Proceedings of the National Academy of Sciences. 86. 1831-1835.
Wu, H. N., Wang, Y. J., Hung, C. F., Lee, H. J., & Lai, M. M. C. (1992). Sequence and structure of the catalytic RNA of hepatitis delta virus genomic RNA. Journal of Molecular Biology. 223. 233-245.
Yamani, M. E., & Hill, J. H. (1991). Crop loss assessment and germplasm screening for resistance to barley yellow dwarf virus in west-central Morocco. Phvtopath. Medit. 30, 93-102.
Zaug, A. J., Been, M. D., & Cech, T. R. (1986). Tetrahymena ribozyme acts like an RNA restriction enzyme. Nature. 324. 429-433.
Zieve, G. W., & Sauterer, R. A. (1990). Cell biology of the snRNA particles. Critical Reviews of Biochemistry and Molecular Biology. 25. 1-46.