in vivo tolerability and efficacy of parp inhibitors abbvie, inc ......2015/07/27 · 9 donald j....

1

1

2

Title: Mechanistic Dissection of PARP1 Trapping and the Impact on in vivo 3 Tolerability and Efficacy of PARP Inhibitors 4

5

Authors: Todd A. Hopkins, Yan Shi, Luis E. Rodriguez, Larry R. Solomon, Cherrie 6 K. Donawho, Enrico L. DiGiammarino, Sanjay C. Panchal, Julie L. 7 Wilsbacher, Wenqing Gao, Amanda M. Olson, DeAnne F. Stolarik, 8 Donald J. Osterling, Eric F. Johnson, David Maag 9

10

Author affiliations: AbbVie, Inc., North Chicago, Illinois, USA 11

Running title: PARP trapping: impact on in vivo activity of PARP inhibitors 12

Keywords: PARP, DNA damage, veliparib, olaparib, talazoparib 13

Financial support: This work was financially supported by AbbVie, Inc. 14

Corresponding author: David Maag, Oncology Discovery, AbbVie, Inc., 1 N. Waukegan Road, 15 North Chicago, Illinois, USA 60064. Phone: 847-937-3969; E-mail: 16 [email protected]. 17

Disclosure: All authors are employees of AbbVie. The design, study conduct, and 18 financial support for this research were provided by AbbVie. AbbVie 19 participated in the interpretation of data, review, and approval of the 20 publication. 21

Word count: 5729 22

Total number of figures and tables: 15 (7 plus 8 supplemental) 23

24

on July 6, 2021. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 27, 2015; DOI: 10.1158/1541-7786.MCR-15-0191-T

http://mcr.aacrjournals.org/

2

Abstract 25

Poly (ADP-ribose) polymerases (PARP1, -2 and -3) play important roles in DNA damage repair. 26

As such, a number of PARP inhibitors are undergoing clinical development as anti-cancer 27

therapies, particularly in tumors with DNA repair deficits and in combination with DNA 28

damaging agents. Pre-clinical evidence indicates that PARP inhibitors potentiate the cytotoxicity 29

of DNA alkylating agents. It has been proposed that a major mechanism underlying this activity 30

is the allosteric trapping of PARP1 at DNA single-strand breaks during base excision repair; 31

however, direct evidence of allostery has not been reported. Here the data reveal that 32

veliparib, olaparib, niraparib and talazoparib (BMN-673) potentiate the cytotoxicity of alkylating 33

agents. Consistent with this, all four drugs possess PARP1 trapping activity. Using biochemical 34

and cellular approaches, we directly probe the trapping mechanism for an allosteric 35

component. These studies indicate that trapping is due to catalytic 36

inhibition and not allostery. The potency of PARP inhibitors with respect to trapping and 37

catalytic inhibition is linearly correlated in biochemical systems but is non-linear in cells. High-38

content imaging of γH2Ax levels suggests that this is attributable to differential potentiation of 39

DNA damage in cells. Trapping potency is inversely correlated with tolerability when PARP 40

inhibitors are combined with temozolomide in mouse xenograft studies. As a result, PARP 41

inhibitors with dramatically different trapping potencies elicit comparable in vivo efficacy at 42

maximum tolerated doses. Finally, the impact of trapping on tolerability and efficacy is likely to 43

be context specific. 44

Implications: Understanding the context-specific relationships of trapping and catalytic 45

inhibition with both tolerability and efficacy will aid in determining the suitability of a PARP 46

inhibitor for inclusion in a particular clinical regimen. 47




3

INTRODUCTION 48

Poly(ADP-ribose) polymerase I (PARP1) is an abundant nuclear enzyme that catalyzes 49

the formation of ADP-ribose polymers (PAR) on a host of protein substrates, including its own 50

automodification domain (1). Extensive research has revealed numerous PARP1 functions 51

spanning a diverse array of nuclear processes, including DNA damage repair (2-5), chromatin 52

remodeling (6), transcriptional regulation (6), telomere maintenance (7) and cell death (8). 53

Owing primarily to the role of PARP1 (and the related but less abundant PARP2 and PARP3) in 54

DNA damage repair, a number of PARP inhibitors are undergoing clinical development as anti-55

cancer agents with a focus on tumors with impaired homologous recombination (HR) capability 56

and on combination regimens with DNA-damaging chemotherapy or radiation (9). The function 57

of PARP1 in DNA damage repair is complex and multifaceted, and includes contributions to 58

multiple repair pathways including HR, base excision repair (BER), nucleotide excision repair 59

(NER) and both classical and alternative non-homologous end-joining (C-NHEJ and A-NHEJ) 60

(4,10,11). Pre-clinical studies have revealed combination activity of PARP inhibitors with DNA-61

alkylating agents, platinums, topoisomerase I inhibitors and ionizing radiation (9). As the 62

primary repair pathways for the lesions caused by each of these classes of agents differ, the 63

mechanisms underlying their potentiation by PARP inhibitors is likely to be class-specific. 64

An early step in BER is the high-affinity binding of PARP1 to a single-strand break, which 65

causes a 500-fold increase in its catalytic activity (12). This stimulates the production of PAR, 66

the majority of which is covalently attached to PARP1 itself in a process called automodification 67

(13). PAR synthesis recruits repair factors to the lesion and also electrostatically destabilizes 68

the PARP1-DNA interaction, leading to rapid dissociation and allowing BER machinery access to 69

the DNA break (14). Recent evidence indicates that PARP inhibitors potentiate the cytotoxicity 70

of DNA alkylating agents such as methyl methanesulfonate (MMS) and temozolomide (TMZ) at 71

least in part by preventing this destabilization, thereby trapping PARP1 at sites of DNA damage 72

(15-20). A comparison of different PARP inhibitors revealed a lack of correlation between 73

catalytic inhibition and trapping potency leading to the proposal of two non-mutually exclusive 74

trapping mechanisms (17). The first is related to the inhibition of catalytic activity, wherein 75




4

prevention of automodification leads to complex stabilization. In the second mechanism, 76

inhibitors allosterically enhance the affinity of PARP1 for damaged DNA independent of 77

catalytic inhibition. 78

It has been proposed that veliparib is mechanistically distinct from olaparib, niraparib 79

and talazoparib in that it is unable to engage an allosteric trapping mechanism; however, direct 80

evidence for this mechanism has not been reported for any PARP inhibitor. In addition, the 81

impact of potent trapping activity on in vivo efficacy and tolerability has not been explored. In 82

this study we probe the mechanism of PARP1 trapping by veliparib, olaparib, niraparib and 83

talazoparib and find no evidence of allostery, indicating that trapping is due primarily to 84

catalytic inhibition. Moreover, our data reveal an inverse relationship between in vivo 85

tolerability and trapping potency. As such, potent trapping activity is not associated with 86

superior efficacy when PARP inhibitors are combined with TMZ at maximum tolerated doses 87

(MTDs) in HeyA8 xenografts. These observations have important implications for the 88

translational relevance of differences in trapping activity observed in vitro. 89

MATERIALS AND METHODS 90

Cell culture 91

HeyA8 cells purchased from M.D. Anderson were maintained in RPMI 1640 with 10% 92

FBS at 5% CO2, 37°C. Cells were authenticated in October of 2013 using the Promega GenePrint 93

10 system immediately prior to freezing aliquots. Cells were used within 40 passages after 94

thawing. Isogenic DLD1 and DLD1-BRCA2-/- cells with homozygous deletion of exon 11 of BRCA2 95

were licensed from Horizon Discovery, Ltd. (Cambridge, UK) and maintained in RPMI 1640 with 96

10% FBS (Gibco #10082-147) at 5% CO2, 37°C. HeyA8 cells for in vivo studies were grown to 97

passage 3 in vitro in DMEM (Life Technologies Corp) containing 10% FBS (Hyclone) and 98

harvested while in log phase. 99

Cellular trapping assays 100

Cellular trapping assays were performed essentially as described (17), with minor 101

modifications. Chromatin fractions were prepared using Thermo Scientific subcellular protein 102




5

fractionation kits (cat. 78840) per manufacturer protocol. Inhibitors were included throughout 103

fractionation to minimize dissociation. Samples were normalized for protein concentration and 104

analyzed by immunoblotting (anti-PARP1 cat# 9542, anti-H3, cat# 3638; Cell Signaling). 105

Cell viability assays 106

Cell viability was determined using CellTiter-Glo reagent (Promega, Inc.) per 107

manufacturer protocol. For synergism experiments, excess over Bliss additivity was determined 108

by standard methods (21). 109

DNA duplexes for biochemical studies 110

For TR-FRET experiments, a model single-strand break was generated by enzymatic 111

digestion of a fluorescently labeled synthetic DNA duplex (5'-Alexa488-112

ACCCTGCTGTGGGCdUGGAGAACAAGGTGAT-3') with APE1 and UDG as described (17). 113

For biolayer interferometry (BLI) experiments, two synthetic oligonucleotides (dRP-114

GGAGAACAAGGTGAT and Biotin-TEG-115

ATCACCTTGTTCACCAGCCCACAGCAGGGTCTCTACCCTGCTGTGGGC ) were annealed to generate a 116

biotinylated hairpin with a single-strand break and a 5’-deoxyribose-5-phosphate at the break 117

site. 118

Biochemical trapping assays 119

PARP1-DNA complexes were assembled by incubation of 1 nM terbium-labeled anti-His 120

antibody (Invitrogen), 2 nM full-length His-tagged PARP1 and 0.4 nM digested Alexa488-duplex 121

in 10 mM KPO4, pH 7.8, 50 mM NaCl, 1 mM EDTA, 0.05% pluronic F-68 and 1 mM DTT for 1 hour 122

at room temperature (RT). Where indicated, inhibitors were included during complex 123

assembly. For kinetic experiments, NAD+ (10 mM final) was added to complexes and time-124

resolved Förster resonance energy transfer (TR-FRET) was measured using an Envision plate 125

reader (Perkin Elmer). For dose-response experiments, TR-FRET was measured after 11 126

minutes. TR-FRET ratios were transformed into % dissociated by normalization to controls. 127




6

Kinetic and dose response data were fit with a single exponential and a four-parameter logistic 128

equation, respectively. 129

Equilibrium binding and kinetic studies of PARP1-DNA complexes 130

PARP1-DNA complexes were evaluated in a TR-FRET-based system similar to that 131

described above with the exception that NAD+ was omitted. For kinetic experiments, 132

complexes were assembled at a concentration of 0.8 nM fluorescent duplex until equilibrium 133

was reached, at which point un-labeled duplex was added (167 nM final) and TR-FRET was 134

measured as a function of time. 135

Alternatively, binding kinetics of PARP1-DNA complexes were analyzed via BLI (Octet 136

Red 384; ForteBio) at 25°C. The assay employed a 16 channel, 96-well plate format at a shake 137

speed of 1000 rpm. Prior to the assay, sensors were pre-wet in Buffer A (10 mM HEPES, pH7.5, 138

250 mM NaCl, 3 mM EDTA, 0.05% Tween 20, 5 mM DTT) for 15 minutes. Assay steps consisted 139

of 1) 60 second equilibration in Buffer A; 2) 120 second immobilization of DNA (0.5 μg/mL in 140

Buffer A); 3) 120 seconds of Buffer A for baseline determination; 4) 300 second association of 141

PARP1 in Buffer A as a 6-point, 3-fold concentration series (100nM-0.4nM); 5) 600 second 142

dissociation. Where indicated, Buffer A was formulated with 2 μM inhibitor for steps 3-5. 143

Responses were normalized to baseline and fit with a mass transport binding model to 144

determine ka (on-rate), kd (off-rate) and equilibrium dissociation constant (KD). 145

Equilibrium binding and kinetic studies of PARP1-PARP inhibitor complexes 146

The binding kinetics of PARP1-inhibitor complexes were assayed via Surface Plasmon 147

Resonance (SPR) (Biacore T200; GE Healthcare). A standard amine coupling protocol was 148

employed to immobilize PARP1 via primary amines to the carboxy-methyl (CM) dextran surface 149

of CM5 sensorchips (Biacore). During the assay primary referencing was against a blank (no 150

PARP) amine coupled surface. Kinetic measurements were performed at 80 μL/min using HBS-151

P+ Buffer (10 mM Hepes, 150 mM NaCl, 0.05% (vol/vol) surfactant P20, pH 7.4) containing 5 152

mM DTT and 3% DMSO. Compounds were assayed using single-cycle kinetics mode in 5-point, 153

3-fold concentration series from 0.62nM to 50nM. Cycles of buffer only injections were 154




7

included for secondary referencing. Data were processed and fit to a 1:1 binding model using 155

Biacore T200 Evaluation Software to determine the binding kinetic rate constants, ka (on-rate) 156

and kd (off-rate), and the equilibrium dissociation constant, KD. 157

Alternatively, the KDs of PARP1-inhibitor complexes were measured via a competitive 158

TR-FRET assay. PARP inhibitors were incubated to equilibrium at RT with 10 mM KPO4, pH 7.8, 159

50 mM NaCl, 1 mM EDTA, 0.05% Pluronic F-68, 1 mM DTT, 1 nM terbium-anti-His, 2 nM His-160

PARP1 and 20 nM OG488-labeled NAD+ binding site probe. TR-FRET ratios were normalized to 161

controls and fit with a 4-parameter logistic equation. Where indicated, DNA was included at 10 162

nM (20-fold above KD). 163

Michaelis-Menten kinetics 164

Initial rates were determined at different concentrations of NAD+ using a PARP1 assay 165

kit from BPS biosciences according to manufacturer protocol (Cat#: 80551). 166

Cellular PAR assays 167

Cellular PAR levels were measured by ELISA as described (22-24). 168

High-content imaging of γH2Ax levels 169

Cells were seeded on collagen-coated 96-well plates overnight, treated with compounds 170

for 4 hours and fixed with formaldehyde (2%) for 10 minutes at room temperature (RT). Cells 171

were washed twice with PBS, permeabilized with 0.1% Triton X-100 for 15 minutes at RT and 172

washed 3X with PBS. Plates were blocked in 1% BSA in PBS for 30 minutes at RT. Anti-phospho-173

Histone H2A.X (Ser139) antibody (EMD Millipore, Cat#: 05-636) diluted 1:1 in glycerol and then 174

further diluted 1:1,600 in antibody dilution buffer (0.3% BSA in PBS) was added overnight at 4 175

⁰C. Cells were washed 3X in PBS and incubated with Alexa Fluor 555-conjugated goat anti-176

mouse Ab (Life Technologies, Cat#: A21424) and Hoechst 33342 (Life Technologies, Cat#: 177

H5370) diluted 1:500 and 1:10,000, respectively in antibody dilution buffer for 1 hour at 178

RT. Plates were washed 3X with PBS and scanned within 24 hours. Images were acquired on a 179




8

CellInsight (Thermo Scientific) by automated image acquisition (12 fields per well) using a 10X 180

objective. Data analysis was performed using Cellomics View Software (Thermo Scientific). 181

In vivo pharmacology 182

HeyA8 xenograft models 183

1 x 106 HeyA8 cells in 0.1 mL of a 1:1 mixture of S-MEM (Life Technologies Corp) and 184

matrigel were inoculated subcutaneously into the right flank of female C.B.-17 SCID mice 185

(Charles Rivers Laboratories) on Day 0. 186

Efficacy studies 187

Two separate in vivo studies were conducted; in the first study mice were allocated into 188

study groups with mean tumor volume 439 ± 17 mm3 on Day 13 and dosing was initiated. In 189

the second study, mice were allocated into study groups with mean tumor size of 490 ± 27 mm3 190

on Day 15 and dosing initiated on Day 16. For single agent studies, PARP inhibitors were 191

administered orally (PO) once daily (QD) for 21 days. For combination studies TMZ was 192

administered alone or in combination with PARP inhibitors PO, QD for 5 days. Mice were 193

observed daily and measured twice weekly. Mice were euthanized when tumor volumes 194

reached a maximum of 2500 mm3 or when skin ulcerations occurred. Tumor length (L) and 195

width (W) were measured via electronic caliper and the volume was calculated according to the 196

following equation: V = L x W2/2 using Study Director version 3.1 (Studylog Systems, Inc., South 197

San Francisco). Animal research was approved and overseen by the AbbVie Institutional Animal 198

Care and Use Committee (AbbVie IACUC, in accordance with all ALAAC guidelines). 199

Compound formulation 200

TMZ and Veliparib were prepared as previously described (25). Olaparib, purchased 201

from Selleck Chemicals or synthesized at AbbVie, was dissolved in a vehicle containing: 1% 202

DMSO, 10% Ethanol, 30% PEG 400, 59% Phosal 53 MCT using a probe sonifier (Branson 450, 203

Danbury CT). Talazoparib was synthesized at AbbVie and kept frozen as a 3 mg/ml stock 204




9

solution in 100% DMSO; the stock solution was diluted to 0.0036 mg/mL in 0.5% HPMC prior to 205

dosing. 206

Determination of maximum tolerated doses (MTDs) 207

Tolerability studies were conducted in naïve CB-17 SCID female mice. PARP inhibitors 208

were administered PO, QD for 21 days as single agents; for combination studies compounds 209

were dosed PO, QD for 5 days. Doses resulting in

10

cases. Similar results were observed with TMZ, however the degree of synergism was more 231

modest in some cases and required somewhat higher concentrations (60-300 μM TMZ). 232

Examination of Bliss surface cross-sections (Figure 1) allows for a comparison of the 233

concentrations of PARP inhibitor required for comparable synergism. In HeyA8 cells at 20 μM 234

MMS, talazoparib elicited peak synergism at 5 nM, while much higher concentrations of 235

olaparib, niraparib and veliparib were required (1.5, 3 and 25 μM, respectively; Figure 1A). 236

Similar profiles were observed at 300 μM TMZ, albeit with a more modest degree of synergism 237

(Figure 1B). Similar results were observed in DLD1 cells, however the degree of synergism with 238

TMZ was greater than that in HeyA8 cells (Figure 1C-D). BRCA2 deletion in these cells resulted 239

in a decrease in the concentration of PARP inhibitor required for synergism (Figure 1E-F). While 240

the rank order of potency with respect to potentiation of alkylating agents was concordant with 241

catalytic inhibition potency in all three cell lines, the broad range of PARP inhibitor 242

concentrations required to elicit synergism did not reflect the much smaller differences in 243

cellular PAR IC50s, enzyme inhibition IC50s, KDs or binding kinetics (Table 1). As these agents 244

have been reported to vary widely in their PARP1 trapping activity (17,18), these results 245

support a role for trapping in the potentiation of alkylating agents in these cell lines. 246

Trapping of PARP1 in HeyA8, DLD1 and DLD1-BRCA2-/- cells 247

To further investigate the role of trapping in the potentiation of alkylating agents, we 248

compared the trapping activities of different PARP inhibitors in cells treated with MMS or TMZ 249

(Figure 2). Interestingly, the concentrations of alkylating agent required to observe trapping 250

greatly exceeded those required to elicit synergism. In HeyA8 cells at high doses of PARP 251

inhibitor, trapping began to exceed untreated controls at 100 μM MMS and was robust at 1 252

mM (Figure 2A). In contrast, synergism between MMS and PARP inhibitors was strongest at 20 253

μM MMS (Figure S1). Similarly, trapping was detectable only at high concentrations (1 mM) of 254

TMZ (Figure 2B). This exceeds the concentration required to observe synergism in vitro and is 255

>20-fold higher than plasma exposures observed in the clinic (32). Time-course experiments 256

indicated that trapping increases for 2 hours and then reaches a plateau (Figure 2C). 257




11

In agreement with previous reports (17,18), we observed that PARP inhibitors differ 258

significantly in trapping potency (Figure 2). In HeyA8 cells treated with 1 mM MMS, talazoparib 259

was the most potent trapping agent we investigated, with trapping detectable at sub-nM 260

concentrations (Figures 2D and 2E). Olaparib was of intermediate potency with significant 261

trapping observable as low as 10 - 100 nM, while veliparib and niraparib were the least potent 262

trapping agents requiring concentrations > 1 μM. The weaker trapping activity we observed 263

with niraparib is in contrast to a previous report (17), but is consistent with its relative potency 264

in the cytotoxicity and cellular PAR assays (Figure 1 and Table 1). Similar results were observed 265

in DLD1 and DLD1-BRCA2-/- cells (Figures 2F and 2G, respectively), however niraparib displayed 266

slightly increased trapping activity compared to HeyA8 cells. Interestingly, genetic deletion of 267

BRCA2 in DLD-1 cells had no significant impact on PARP1 trapping despite reducing the 268

concentrations of PARP inhibitors required to elicit synergy with alkylating agents. These 269

results suggest that HR mitigates the toxicity of PARP1 trapping as opposed to playing a direct 270

role in the resolution of trapped PARP1 complexes. Further investigation will be required to 271

test this hypothesis and further delineate the mechanism whereby trapped PARP1 leads to cell 272

death. 273

Strikingly, talazoparib was unique in that the concentration required for half-maximal 274

trapping was approximately concordant with its IC50 for cellular PAR inhibition (Table 1 and 275

Figure 2). In contrast, olaparib, veliparib and niraparib required concentrations that greatly 276

exceeded their cellular PAR IC50s to elicit half-maximal trapping. Similarly, talazoparib displayed 277

detectable trapping activity at concentrations similar to those required to potentiate the 278

cytotoxicity of alkylating agents (Figure 1), while other inhibitors displayed robust potentiation 279

at concentrations where PARP1 trapping was weak or undetectable. 280

Mechanistic evaluation of PARP1 trapping 281

We observed reasonable association between trapping potency and catalytic inhibition, 282

however these relationships were non-linear. For example, while veliparib and niraparib were 283

consistently less potent than talazoparib, this difference was approximately 10-fold with 284

respect to catalytic inhibition and 10,000-fold with respect to trapping. Similar observations led 285




12

to the proposal that PARP inhibitors with potent trapping activity are capable of allosterically 286

stabilizing the PARP1-DNA interaction (17,18). However, direct evidence of allosteric trapping 287

has not been reported. 288

A thermodynamic requirement of an allosteric PARP trapping model is that, if PARP 289

inhibitors stabilize the binding of PARP1 to DNA, DNA must stabilize the binding of PARP 290

inhibitors to PARP1. To test this, we determined the PARP1 equilibrium binding constants of 291

PARP inhibitors in the presence or absence of DNA using a competitive TR-FRET assay (Figure S2 292

and Table 1). These studies utilized a synthetic DNA duplex enzymatically digested with UDG 293

and APE1 to generate a single-strand break as described (17). This duplex bound to full-length 294

PARP1 with a KD of 0.5 nM (Figure 3D). Contrary to the prediction of an allosteric trapping 295

model, a saturating concentration of this nicked duplex (10 nM) did not stabilize inhibitor 296

binding to PARP1. 297

Next, we compared the trapping activity of the inhibitors in a biochemical system similar 298

to that reported previously (17,18,33). PARP1-DNA complexes were pre-incubated in the 299

presence or absence of PARP inhibitors after which NAD+ was added to initiate 300

automodification. In the absence of a PARP inhibitor, automodification led to the rapid 301

dissociation of PARP1 from the DNA with dissociation complete in approximately 10 minutes 302

(Figure 3A). As expected, high concentrations (10 μM) of veliparib, olaparib, niraparib or 303

talazoparib revealed PARP1 trapping activity, with significant decreases in the rate of PARP1 304

dissociation from DNA. Dose responses in this system (Figure 3B) revealed EC50s that were 305

well-correlated with PARP1 IC50s (Table 1). Notably, dramatic differences in cellular trapping 306

potency were not recapitulated in this system. 307

While these experiments allow for a quantitative analysis of PARP1 trapping, the 308

inclusion of NAD+ precludes determination of the relative contributions of allostery and 309

catalytic inhibition. To directly assess the ability of PARP inhibitors to allosterically trap PARP1 310

onto DNA, we utilized TR-FRET to explore the dissociation kinetics of PARP1-DNA complexes in 311

the absence of NAD+. In these studies, apparent PARP1 dissociation was initiated by addition of 312

a large excess of unlabeled nicked duplex. In these experiments, PARP inhibitors failed to 313




13

stabilize the complex (Figure 3C). Similarly, PARP inhibitors did not enhance the equilibrium 314

binding affinity of PARP1 for DNA (Figure 3D). These results agree with our observation that 315

nicked DNA does not enhance the affinity of PARP inhibitors for PARP1 and strongly suggest 316

that there is no allosteric component to the PARP trapping mechanism. 317

To further test this hypothesis in an orthogonal biochemical system, we evaluated the 318

binding kinetics of the PARP1-DNA interaction by bio-layer interferometry. These studies 319

employed a synthetic hairpin containing a single strand break with a 5’-dRP. The purpose of the 320

hairpin was to prevent PARP1 from binding to the blunt duplex ends. As we observed in the TR-321

FRET experiments, saturating concentrations (2 μM) of PARP inhibitors had no impact on the 322

kinetics or equilibrium binding affinity of the PARP1-DNA complex (Figures 3E and S3). 323

All of the PARP inhibitors included in this study are based on nicotinamide-like 324

pharmacophores and are thought to bind to the NAD+ binding pocket within the catalytic 325

domain of PARP1 and inhibit the enzyme competitively (34). However, most of the direct 326

evidence supporting this mode of inhibition is from crystallographic studies which have been 327

limited to the catalytic domain. To further investigate the mode of inhibition, we conducted a 328

Michaelis-Menten kinetic analysis using full-length PARP1 (Figure S4). All four inhibitors in this 329

study displayed kinetic behavior consistent with a purely competitive mode of inhibition, 330

eliciting significant increases in the apparent Km for NAD+ with no significant changes in Vmax. 331

Moreover, the Kis determined from this analysis were in very good agreement with cellular PAR 332

IC50s as well as the trapping EC50s in the TR-FRET assays (Table 1). Consistent with the DNA 333

binding data, these results did not reveal evidence of an allosteric interaction for any of the 334

four PARP inhibitors. 335

Collectively, the data from purified biochemical systems support the conclusion that 336

PARP inhibitors do not allosterically stabilize the PARP1-DNA complex and that PARP1 trapping 337

is entirely attributable to inhibition of automodification. To confirm that trapping is driven by 338

inhibition of automodification in cells, we utilized the potent, selective nicotinamide 339

phosphoribosyltransferase (NAMPT) inhibitor FK866 to deplete cellular NAD. As FK866 is 340

known to be broadly cytotoxic to cancer cells (35,36), careful optimization of treatment 341




14

conditions was necessary. Treatment of HeyA8 cells with 1 μM FK866 for 24 hours was 342

sufficient to deplete cellular total NAD (NAD+ plus NADH) and PAR by 90 and 95% respectively, 343

while sparing cellular ATP and preserving cell viability (Figure 4A). After depletion of cellular 344

NAD, treatment with MMS resulted in PARP1 trapping to an extent comparable to co-treatment 345

of cells with MMS and PARP inhibitors (Figure 4B). Addition of the NAMPT reaction product, 346

nicotinamide mononucleotide (NMN), prevented NAD depletion by FK866 (Figure 4C) and 347

reversed the trapping effect. This confirmed that FK866-induced trapping was due to NAD 348

depletion and not off-target effects such as direct PARP inhibition or DNA damage. These 349

results indicate that inhibition of PARP catalytic activity is sufficient to account for the 350

maximum trapping activity associated with any of the four PARP inhibitors. Furthermore, if 351

PARP inhibitors were capable of allosterically trapping PARP1, additive trapping activity 352

between FK866 and PARP inhibitors may be expected. Even at high doses, PARP inhibitors were 353

not capable of enhancing trapping after cellular NAD depletion (Figure 4B). These results are in 354

agreement with our observations in biochemical systems and indicate that PARP1 trapping in 355

cells is not allosteric in nature and is instead mediated by inhibition of catalytic activity. 356

Comparison of DNA damage induction by different PARP inhibitors 357

It has been reported that talazoparib has extremely potent DNA damaging activity as a 358

single agent in HeLa cells and that it is at least 100-fold more potent than olaparib in this 359

respect (37). Much like the stark differences in trapping activity, this difference is greater than 360

expected based on comparisons of catalytic potency. Given that we were unable to 361

demonstrate an allosteric PARP trapping mechanism, we considered the alternative hypothesis 362

that differences in observed cellular trapping activity may be in part due to differences in the 363

extent of DNA damage under the conditions of the PARP trapping experiments. 364

To test this, we determined the levels of γH2Ax in HeyA8 cells co-treated with PARP 365

inhibitors and MMS for four hours to reflect the conditions of the PARP trapping experiments. 366

All four PARP inhibitors significantly increased γH2Ax levels compared to MMS alone (Figure 367

5A). Similar to PARP1 trapping activity, the compounds spanned a broad range of potency 368

(Figure 5B) with 3 nM talazoparib eliciting γH2Ax signal comparable to 4 μM veliparib, 2 μM 369




15

olaparib and 4 μM niraparib. Treatment of HeyA8 cells with PARP inhibitors alone for four 370

hours resulted in minimal γH2Ax signal (Figure 5C), indicating that γH2Ax observed after such 371

short treatments is due entirely to potentiation of MMS-induced damage. 372

It is thought that PARP inhibition leads to double-strand breaks via replication fork 373

collapse at sites of unrepaired single-strand breaks. Our observation that co-treatment of cells 374

with MMS and PARP inhibitors led to significant induction of γH2AX in nearly 100% of cells in an 375

asynchronous population within 4 hours suggested that the treatments employed for PARP 376

trapping assays cause double strand breaks by a more direct mechanism. To investigate this, 377

we extracted cell cycle profiles from our high-content imaging data and determined the mean 378

intensity of γH2AX staining as a function of cell cycle phase (Figure S5). Strikingly, we observed 379

robust γH2AX staining in G1, S and G2/M after a four hour treatment with 1 mM MMS alone. 380

This signal was potentiated by all four PARP inhibitors in all phases of the cell cycle to a similar 381

extent. These data indicate that the high concentrations of MMS required to detect PARP 382

trapping cause double strand breaks in the absence of PARP inhibition and that replication fork 383

collapse cannot alone account for the potentiation of this damage by PARP inhibitors. 384

In vivo efficacy of different PARP inhibitors in combination with TMZ 385

To establish the relationship between potent PARP trapping activity and in vivo efficacy, 386

we first determined the MTDs of veliparib, olaparib and talazoparib in naïve C.B-17 SCID mice 387

alone or in combination with 50 mg/kg/day (mkd) of TMZ. This dose of TMZ was selected 388

because it is well-tolerated and comparable to the clinically recommended dose of 150 mg/m2. 389

The monotherapy MTDs for veliparib, olaparib and talazoparib were 200, 200 and 0.33 mkd, 390

respectively (QD, 21 days). When combined with TMZ (QD, 5 days) in HeyA8 xenograft tumor-391

bearing mice, MTDs were reduced to 75, 25 and 0.033 mkd for veliparib, olaparib and 392

talazoparib, respectively (Table S1). These data demonstrate a strong inverse relationship 393

between PARP trapping activity and tolerability which results in significant differences in 394

achievable plasma and tumor exposures (Table S2). 395




16

We next designed a comparative efficacy study in a HeyA8 xenograft model (Figure 6). 396

Although all three PARP inhibitors significantly reduced tumor PAR levels at monotherapy doses 397

(Figure S6A-C), they did not slow tumor growth in this setting (Figure 6A). In contrast, 50 mkd 398

of TMZ demonstrated significant monotherapy activity, with tumor outgrowth beginning on day 399

43. The combination of 75 mkd of veliparib with 50 mkd of TMZ resulted in significant 400

combination efficacy and delayed tumor outgrowth for 20 days (Figure 6B). Similarly, the 401

combination of 25 mkd of olaparib or 0.033 mkd of talazoparib with TMZ delayed tumor 402

outgrowth by 13 days and 9 days, respectively. All three PARP inhibitors resulted in a highly 403

significant advantage in survival to 1 cm2 relative to TMZ alone (p < 0.0001; Figure 6C-D). The 404

veliparib/TMZ group displayed a statistically significant survival advantage relative to both the 405

olaparib/TMZ and talazoparib/TMZ groups (p < 0.045 and 0.02, respectively) despite veliparib 406

being the least potent trapping agent of the three. These results were correlated with 407

differences in the durability of the reduction in tumor PAR levels elicited by these inhibitors at 408

these doses (Figure S6D-F). The Cmax for all three PARP inhibitors significantly exceeded the 409

respective PAR IC50s in HeyA8 cells consistent with the robust tumor PAR inhibition observed at 410

Cmax. At Cmin (24 hours after dosing), veliparib, olaparib and talazoparib were at concentrations 411

approximately equal to 15X, 4X and 2X their respective PAR IC50s. The pharmacokinetic data 412

are thus well correlated with the rate of recovery of tumor PAR levels after dosing. 413

DISCUSSION 414

Several recent reports have established PARP trapping as an important mechanism 415

whereby PARP inhibitors potentiate the cytotoxicity of DNA alkylating agents (15-18). 416

Observations that trapping activity is not linearly correlated with enzymatic inhibition potency 417

led to the proposal of a novel allosteric trapping mechanism (17). In this study, we have 418

thoroughly investigated the mechanism of PARP trapping by veliparib, olaparib, niraparib and 419

talazoparib and found no evidence of allostery. This is consistent with previous observations in 420

a fluorescence polarization assay where omission of NAD+ stabilized PARP1 binding to DNA as 421

effectively as talazoparib (18). These results demonstrate that PARP trapping is attributable to 422

the well-established mechanism whereby inhibition of automodification stabilizes DNA binding 423




17

(14). Recently, arguments in support of an allosteric trapping mechanism have been made on 424

the basis of molecular dynamics simulations (33) and structural studies of the PARP1 catalytic 425

domain in complex with talazoparib (38). However, crystal structures of PARP1 bound to PARP 426

inhibitors have been restricted to the catalytic domain and reveal that conformational 427

differences induced by different PARP inhibitors are rather minor. Currently there is no direct 428

evidence that PARP inhibitor binding alters the conformation of the DNA binding domain. If 429

subtle alterations in the conformation of the catalytic domain were indeed accountable for the 430

dramatic variance in cellular PARP trapping activity, this would be expected to manifest in the 431

biochemical trapping experiments in Figure 3. Instead, we observe much smaller differences 432

that are well correlated with catalytic potency. 433

Our data demonstrate that differential trapping activity is concordant with differences 434

in the potentiation of MMS-induced DNA damage. Taken alone, these results cannot distinguish 435

whether potent trapping activity leads to greater potentiation of DNA damage or differential 436

potentiation of DNA damage accounts for apparent differences in trapping activity in cells. Our 437

observation that trapping is not allosteric in nature and is very well correlated with catalytic 438

potency in purified biochemical systems is consistent with the latter hypothesis. The precise 439

role of trapping in the potentiation of DNA damage remains to be elucidated. We observe 440

significant γH2AX induction in all phases of the cell cycle by MMS alone and this signal is 441

potentiated by all four PARP inhibitors. These results indicate that double-strand breaks 442

induced by the extreme treatment conditions required for PARP trapping assays are not simply 443

the result of replication fork collapse at unrepaired single-strand breaks or trapped PARP 444

complexes. As PARP1 is well-established to bind to both single-strand and double-strand 445

breaks, it remains a possibility that PARP1 binding to double strand breaks contributes 446

significantly to the trapping observed in cells treated with high concentrations of MMS. 447

Strikingly, talazoparib is unique in that it potentiates γH2Ax at concentrations below its 448

cellular PAR IC50 in HeyA8 cells. In contrast, other inhibitors require concentrations greater 449

than their respective PAR IC50s to elicit a similar effect. Likewise, talazoparib is unique in that 450

its trapping activity is concordant with cellular PAR inhibition, while other inhibitors in the class 451




18

require concentrations significantly higher than those required to elicit reductions in cellular 452

PAR levels. The reasons for these differences remain unclear, however talazoparib is the most 453

potent PARP inhibitor reported and possesses a slow dissociation half-life (37). Previous studies 454

have suggested positive correlations between longer drug residency time, extent of DNA 455

damage and cytotoxic potency for the camptothecin family of topoisomerase I inhibitors, 456

another class of drugs in which trapping of the target enzyme onto DNA is central to the 457

cytotoxic mechanism (39). The relationship between these features and potent PARP trapping 458

activity warrants further investigation. 459

Previous characterization of PARP trapping has been limited to comparisons of potency 460

in vitro (15,17-19). Understanding the relevance of trapping to potential clinical benefit will 461

require a thorough understanding of the relationships between trapping activity, tolerability 462

and efficacy in vivo. It has been argued that trapping is likely to be clinically relevant because 463

the concentrations of PARP inhibitors required to detect trapping are within range of clinical 464

exposures in a monotherapy setting (17). However, trapping has yet to be demonstrated with 465

PARP inhibitors alone. It is most easily detected in combination with MMS, but this is not a 466

clinically approved agent. To date, the only clinically approved agent with which trapping has 467

been demonstrated is TMZ (Figure 2B and (19)). The high concentrations of TMZ required (> 468

300 μM) significantly exceed the maximum exposures observed in the clinic (32). This suggests 469

that either clinically tolerated regimens containing PARP inhibitors and TMZ cannot engage the 470

trapping mechanism or currently available assays are not sensitive enough to detect 471

physiologically relevant levels of trapping. In support of the latter, genetic evidence supports a 472

role for trapping in the potentiation of MMS activity by PARP inhibitors in vitro (17), yet we 473

observe robust synergism at MMS concentrations below those required to detect trapping (20 474

μM vs 100 μM; compare Figure 1A to Figure 2A). 475

Our data reveal that trapping activity and tolerability are inversely correlated in mouse 476

models when PARP inhibitors are combined with TMZ. As a result, PARP inhibitors differing by 477

up to 10,000-fold with respect to trapping potency elicit comparable efficacy when combined 478

with TMZ in a HeyA8 xenograft model at MTD. While this observation requires further 479




19

investigation in additional models, it suggests that a direct link between trapping and toxicity 480

may limit the potential positive impact of potent trapping activity on the therapeutic index of 481

PARP inhibitors in clinical regimens containing DNA alkylating agents. 482

In addition to combination with alkylating agents, PARP inhibitors are under clinical 483

investigation as monotherapies and in regimens containing other classes of DNA damaging 484

agents such as platinums, topoisomerase inhibitors and radiation. While the mechanisms 485

underlying the activities of these different therapeutic modalities are not fully understood, 486

recent evidence indicates that PARP trapping may be less relevant in some contexts such as 487

combination regimens including platinums or topoisomerase I inhibitors (19,40). Interestingly, 488

however, clinical evidence reveals that differences in the maximum tolerated exposures for 489

different PARP inhibitors in the monotherapy setting are greater than expected based on 490

relatively small differences in catalytic potency. Specifically, weaker trapping agents such as 491

olaparib, niraparib and rucaparib achieve micromolar exposures while the potent trapping 492

agent talazoparib has a Cmax of 50 nM and a Cmin of 10 nM at the recommended phase II dose 493

(41-44). This suggests that trapping may play a role in dose-limiting toxicities observed in the 494

clinic. Importantly, our results demonstrate that PARP inhibitors can differ in the resolution 495

between the concentrations required to elicit PARP inhibition and PARP trapping. The rational 496

selection of the most suitable PARP inhibitor to include with a particular regimen will require a 497

thorough understanding of the relative roles of trapping and catalytic inhibition in both the 498

efficacy and tolerability of that regimen. 499

500

ACKNOWLEDGEMENTS 501

The authors thank Guowei Fang, Vincent Giranda, Claudie Hecquet, Saul Rosenberg and 502

Kenneth Bromberg for helpful comments and discussion during the preparation of this 503

manuscript. 504

505




20

506

REFERENCES 507

508

1. Karlberg T, Langelier MF, Pascal JM, Schuler H. Structural biology of the writers, readers, and 509 erasers in mono- and poly(ADP-ribose) mediated signaling. Molecular aspects of medicine 510 2013;34(6):1088-108. 511

2. De Lorenzo SB, Patel AG, Hurley RM, Kaufmann SH. The Elephant and the Blind Men: Making 512 Sense of PARP Inhibitors in Homologous Recombination Deficient Tumor Cells. Frontiers in 513 oncology 2013;3:228. 514

3. Jelinic P, Levine DA. New Insights into PARP Inhibitors' Effect on Cell Cycle and Homology-515 Directed DNA Damage Repair. Molecular cancer therapeutics 2014. 516

4. Robert I, Karicheva O, Reina San Martin B, Schreiber V, Dantzer F. Functional aspects of 517 PARylation in induced and programmed DNA repair processes: preserving genome integrity and 518 modulating physiological events. Molecular aspects of medicine 2013;34(6):1138-52. 519

5. Sousa FG, Matuo R, Soares DG, Escargueil AE, Henriques JA, Larsen AK, et al. PARPs and the DNA 520 damage response. Carcinogenesis 2012;33(8):1433-40. 521

6. Kraus WL, Hottiger MO. PARP-1 and gene regulation: progress and puzzles. Molecular aspects of 522 medicine 2013;34(6):1109-23. 523

7. Beneke S, Cohausz O, Malanga M, Boukamp P, Althaus F, Burkle A. Rapid regulation of telomere 524 length is mediated by poly(ADP-ribose) polymerase-1. Nucleic acids research 2008;36(19):6309-525 17. 526

8. Morales J, Li L, Fattah FJ, Dong Y, Bey EA, Patel M, et al. Review of poly (ADP-ribose) polymerase 527 (PARP) mechanisms of action and rationale for targeting in cancer and other diseases. Critical 528 reviews in eukaryotic gene expression 2014;24(1):15-28. 529

9. Curtin NJ, Szabo C. Therapeutic applications of PARP inhibitors: anticancer therapy and beyond. 530 Molecular aspects of medicine 2013;34(6):1217-56. 531

10. Ceccaldi R, Liu JC, Amunugama R, Hajdu I, Primack B, Petalcorin MI, et al. Homologous-532 recombination-deficient tumours are dependent on Poltheta-mediated repair. Nature 533 2015;518(7538):258-62. 534

11. Mateos-Gomez PA, Gong F, Nair N, Miller KM, Lazzerini-Denchi E, Sfeir A. Mammalian 535 polymerase theta promotes alternative NHEJ and suppresses recombination. Nature 536 2015;518(7538):254-7. 537

12. Langelier MF, Planck JL, Roy S, Pascal JM. Structural basis for DNA damage-dependent poly(ADP-538 ribosyl)ation by human PARP-1. Science 2012;336(6082):728-32. 539

13. Ogata N, Ueda K, Kawaichi M, Hayaishi O. Poly(ADP-ribose) synthetase, a main acceptor of 540 poly(ADP-ribose) in isolated nuclei. The Journal of biological chemistry 1981;256(9):4135-7. 541

14. Satoh MS, Lindahl T. Role of poly(ADP-ribose) formation in DNA repair. Nature 542 1992;356(6367):356-8. 543

15. Kedar PS, Stefanick DF, Horton JK, Wilson SH. Increased PARP-1 association with DNA in 544 alkylation damaged, PARP-inhibited mouse fibroblasts. Molecular cancer research : MCR 545 2012;10(3):360-8. 546

16. Liu X, Han EK, Anderson M, Shi Y, Semizarov D, Wang G, et al. Acquired resistance to 547 combination treatment with temozolomide and ABT-888 is mediated by both base excision 548




21

repair and homologous recombination DNA repair pathways. Molecular cancer research : MCR 549 2009;7(10):1686-92. 550

17. Murai J, Huang SY, Das BB, Renaud A, Zhang Y, Doroshow JH, et al. Trapping of PARP1 and 551 PARP2 by Clinical PARP Inhibitors. Cancer research 2012;72(21):5588-99. 552

18. Murai J, Huang SY, Renaud A, Zhang Y, Ji J, Takeda S, et al. Stereospecific PARP trapping by BMN 553 673 and comparison with olaparib and rucaparib. Molecular cancer therapeutics 554 2014;13(2):433-43. 555

19. Murai J, Zhang Y, Morris J, Ji J, Takeda S, Doroshow JH, et al. Rationale for Poly(ADP-ribose) 556 Polymerase (PARP) Inhibitors in Combination Therapy with Camptothecins or Temozolomide 557 Based on PARP Trapping versus Catalytic Inhibition. The Journal of pharmacology and 558 experimental therapeutics 2014;349(3):408-16. 559

20. Strom CE, Johansson F, Uhlen M, Szigyarto CA, Erixon K, Helleday T. Poly (ADP-ribose) 560 polymerase (PARP) is not involved in base excision repair but PARP inhibition traps a single-561 strand intermediate. Nucleic acids research 2011;39(8):3166-75. 562

21. Greco WR, Bravo G, Parsons JC. The search for synergy: a critical review from a response surface 563 perspective. Pharmacological reviews 1995;47(2):331-85. 564

22. Ji J, Kinders RJ, Zhang Y, Rubinstein L, Kummar S, Parchment RE, et al. Modeling 565 pharmacodynamic response to the poly(ADP-Ribose) polymerase inhibitor ABT-888 in human 566 peripheral blood mononuclear cells. PloS one 2011;6(10):e26152. 567

23. Kummar S, Chen A, Ji J, Zhang Y, Reid JM, Ames M, et al. Phase I study of PARP inhibitor ABT-888 568 in combination with topotecan in adults with refractory solid tumors and lymphomas. Cancer 569 research 2011;71(17):5626-34. 570

24. Kummar S, Kinders R, Gutierrez ME, Rubinstein L, Parchment RE, Phillips LR, et al. Phase 0 571 clinical trial of the poly (ADP-ribose) polymerase inhibitor ABT-888 in patients with advanced 572 malignancies. Journal of clinical oncology : official journal of the American Society of Clinical 573 Oncology 2009;27(16):2705-11. 574

25. Palma JP, Wang YC, Rodriguez LE, Montgomery D, Ellis PA, Bukofzer G, et al. ABT-888 confers 575 broad in vivo activity in combination with temozolomide in diverse tumors. Clinical cancer 576 research : an official journal of the American Association for Cancer Research 2009;15(23):7277-577 90. 578

26. Kikuchi R, Lao Y, Bow DA, Chiou WJ, Andracki ME, Carr RA, et al. Prediction of clinical drug-drug 579 interactions of veliparib (ABT-888) with human renal transporters (OAT1, OAT3, OCT2, MATE1, 580 and MATE2K). Journal of pharmaceutical sciences 2013;102(12):4426-32. 581

27. Palma JP, Rodriguez LE, Bontcheva-Diaz VD, Bouska JJ, Bukofzer G, Colon-Lopez M, et al. The 582 PARP inhibitor, ABT-888 potentiates temozolomide: correlation with drug levels and reduction 583 in PARP activity in vivo. Anticancer research 2008;28(5A):2625-35. 584

28. Donawho CK, Luo Y, Luo Y, Penning TD, Bauch JL, Bouska JJ, et al. ABT-888, an orally active 585 poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical 586 tumor models. Clinical cancer research : an official journal of the American Association for 587 Cancer Research 2007;13(9):2728-37. 588

29. Gupta SK, Mladek AC, Carlson BL, Boakye-Agyeman F, Bakken KK, Kizilbash SH, et al. Discordant 589 In Vitro and In Vivo Chemopotentiating Effects of the PARP Inhibitor Veliparib in Temozolomide-590 Sensitive versus -Resistant Glioblastoma Multiforme Xenografts. Clinical cancer research : an 591 official journal of the American Association for Cancer Research 2014;20(14):3730-41. 592

30. Horton TM, Jenkins G, Pati D, Zhang L, Dolan ME, Ribes-Zamora A, et al. Poly(ADP-ribose) 593 polymerase inhibitor ABT-888 potentiates the cytotoxic activity of temozolomide in leukemia 594 cells: influence of mismatch repair status and O6-methylguanine-DNA methyltransferase 595 activity. Molecular cancer therapeutics 2009;8(8):2232-42. 596




22

31. Lin F, de Gooijer MC, Roig EM, Buil LC, Christner SM, Beumer JH, et al. ABCB1, ABCG2, and PTEN 597 determine the response of glioblastoma to temozolomide and ABT-888 therapy. Clinical cancer 598 research : an official journal of the American Association for Cancer Research 2014;20(10):2703-599 13. 600

32. Diez BD, Statkevich P, Zhu Y, Abutarif MA, Xuan F, Kantesaria B, et al. Evaluation of the exposure 601 equivalence of oral versus intravenous temozolomide. Cancer chemotherapy and pharmacology 602 2010;65(4):727-34. 603

33. Marchand JR, Carotti A, Passeri D, Filipponi P, Liscio P, Camaioni E, et al. Investigating the 604 Allosteric Reverse Signalling of PARP Inhibitors with Microsecond Molecular Dynamic 605 Simulations and Fluorescence Anisotropy. Biochimica et biophysica acta 2014. 606

34. Penning TD. Small-molecule PARP modulators--current status and future therapeutic potential. 607 Current opinion in drug discovery & development 2010;13(5):577-86. 608

35. Bi TQ, Che XM. Nampt/PBEF/visfatin and cancer. Cancer biology & therapy 2010;10(2):119-25. 609 36. Hasmann M, Schemainda I. FK866, a highly specific noncompetitive inhibitor of nicotinamide 610

phosphoribosyltransferase, represents a novel mechanism for induction of tumor cell apoptosis. 611 Cancer research 2003;63(21):7436-42. 612

37. Shen Y, Rehman FL, Feng Y, Boshuizen J, Bajrami I, Elliott R, et al. BMN 673, a novel and highly 613 potent PARP1/2 inhibitor for the treatment of human cancers with DNA repair deficiency. 614 Clinical cancer research : an official journal of the American Association for Cancer Research 615 2013;19(18):5003-15. 616

38. Aoyagi-Scharber M, Gardberg AS, Yip BK, Wang B, Shen Y, Fitzpatrick PA. Structural basis for the 617 inhibition of poly(ADP-ribose) polymerases 1 and 2 by BMN 673, a potent inhibitor derived from 618 dihydropyridophthalazinone. Acta crystallographica Section F, Structural biology 619 communications 2014;70(Pt 9):1143-9. 620

39. Tanizawa A, Fujimori A, Fujimori Y, Pommier Y. Comparison of topoisomerase I inhibition, DNA 621 damage, and cytotoxicity of camptothecin derivatives presently in clinical trials. Journal of the 622 National Cancer Institute 1994;86(11):836-42. 623

40. Das BB, Huang SY, Murai J, Rehman I, Ame JC, Sengupta S, et al. PARP1-TDP1 coupling for the 624 repair of topoisomerase I-induced DNA damage. Nucleic acids research 2014;42(7):4435-49. 625

41. Wainberg ZA, de Bono, J.S., Mina, L.A., Averett Byers, L., Chugh, R., Zhang, C., Henshaw, J. W., 626 Dorr, A., Rafii, S., Sachdev, J., Glaspy, J., Ramanathan, R. K. Update on first-in-human trial of 627 novel PARP inhibitor BMN 673 in patients with solid tumors [abstract]. In: Proceedings of the 628 2013 AACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics; 629 2013 Oct 19-23; Boston, Massachusetts. Philadelphia (PA): AACR. Molecular cancer 630 therapeutics 2013;12(11 Suppl):Abstract nr C295. 631

42. Fong PC, Boss DS, Yap TA, Tutt A, Wu P, Mergui-Roelvink M, et al. Inhibition of poly(ADP-ribose) 632 polymerase in tumors from BRCA mutation carriers. The New England journal of medicine 633 2009;361(2):123-34. 634

43. Shapiro G, Kristeleit, R., Middleton, M., Burris, H., Molife, L.R., Evans, J., Wilson, R., LoRusso, P., 635 Spicer, J., Dieras, V., Patel, M., Dominy, E., Simpson, D., Giordano, H., Allen, A.R., Jaw-Tsai, S.S., 636 Plummer, R. Pharmacokinetics of orally administered rucaparib in patients with advanced solid 637 tumors. [abstract]. In: Proceedings of the AACR-NCI-EORTC International Conference: Molecular 638 Targets and Cancer Therapeutics; 2013 Oct 19-23; Boston, MA. Philadelphia (PA): AACR. 639 Molecular cancer therapeutics 2013;12(11 Suppl):Abstract nr A218. 640

44. Sandhu SK, Schelman WR, Wilding G, Moreno V, Baird RD, Miranda S, et al. The poly(ADP-ribose) 641 polymerase inhibitor niraparib (MK4827) in BRCA mutation carriers and patients with sporadic 642 cancer: a phase 1 dose-escalation trial. The Lancet Oncology 2013;14(9):882-92. 643




23

644

645




24

FIGURE LEGENDS 646

Figure 1. In vitro synergism of PARP inhibitors with MMS or TMZ. Cells were treated with 2-647 dimensional dose-responses of PARP inhibitors and DNA alkylating agents for 5 days. Excess 648 over Bliss additivity was determined for each condition. For full response surfaces, see Figure 649 S1. To facilitate comparison of PARP inhibitors, cross-sections of response surfaces at the 650 concentrations of alkylating agent eliciting peak synergism are overlaid. In this analysis, values 651 of zero indicate no activity or additivity while higher values indicate stronger synergism. The 652 decreases observed at higher PARP inhibitor concentrations are due to a loss of synergism to 653 single-agent PARP inhibitor activity. A, HeyA8 cells with 20 μM MMS. B, HeyA8 cells with 300 654 μM TMZ. C, DLD1 cells with 100 μM MMS. D, DLD1 cells with 300 μM TMZ. E, DLD1-BRCA2-/- 655 cells with 20 μM MMS. F, DLD1-BRCA2-/- cells with 60 μM TMZ. Data represent means with 656 standard errors from at least 2 independent experiments run in duplicate. 657

Figure 2. PARP1 trapping in cells co-treated with alkylating agents and PARP inhibitors. 658 Unless otherwise indicated, cells were treated for four hours prior to chromatin fractionation 659 and immunoblotting. A, MMS dose response (3-fold serial dilutions, 1 mM top dose) in HeyA8 660 cells. B, TMZ dose response (3-fold serial dilutions, 1 mM top dose) in HeyA8 cells. C, Time-661 course of PARP1 trapping in HeyA8 cells treated with 1 mM MMS ± 50 μM PARP inhibitor. D, 662 Representative PARP inhibitor dose responses. HeyA8 cells were co-treated with 1 mM MMS 663 and 5-fold serial dilutions of PARP inhibitors (1 μM top dose for talazoparib, 100 μM top dose 664 for all others). E-F, Quantification of PARP1 trapping in human cancer cells. Densitometry was 665 performed on immunoblots such as those in D. PARP1 levels were normalized to histone H3 666 levels. Data represent means with standard errors from at least three independent 667 experiments. E, HeyA8. F, DLD1. G, DLD1-BRCA2-/-. 668

Figure 3. Mechanistic analysis of PARP1 trapping in biochemical systems. A-D, Analysis of 669 PARP1 trapping using TR-FRET. A, Dissociation curves of PARP1 from DNA in the presence of 670 DMSO or 10 μM veliparib, olaparib, niraparib or talazoparib. B, PARP1 trapping dose-responses 671 10 minutes after addition of NAD+ to preassembled PARP1-DNA complexes. Higher TR-FRET 672 ratios indicate that complex dissociation has been inhibited. C, Dissociation of PARP1-DNA 673 complexes in the absence of NAD+ following addition of a large excess of unlabeled DNA in the 674 presence of DMSO or PARP inhibitors (10 μM). D, Effects of PARP inhibitors (10 μM) on binding 675 of PARP1 to nicked DNA in the absence of NAD+. E, Analysis of PARP1 trapping using BLI. 676

Figure 4. The effects of NAD depletion on PARP1 trapping in cancer cells. A, Treatment of 677 HeyA8 cells with FK866 for 24 hours depletes total NAD (NAD+ + NADH) and PAR while sparing 678 ATP and cell viability. For the PAR ELISA control, cells were treated with 3 μM olaparib. B, 679 PARP1 trapping in HeyA8 cells treated with MMS and FK866. Cells were treated with 1 μM 680




25

FK866 (where indicated) for 24 hours prior to treatment with 1 mM MMS ± 50 μM of PARP 681 inhibitors for four hours. Treatments were also performed in the presence of 300 μM NMN 682 (the product of NAMPT). C, Total NAD levels in cells treated as in B. 683

Figure 5. Enhancement of MMS-induced DNA damage by PARP inhibitors. A, Representative 684 high-content images of HeyA8 cells treated for 4 hours with MMS and the indicated PARP 685 inhibitors and stained for DNA (Hoechst, blue) and γH2Ax (green). B, Quantification of images 686 such as those shown in A. Data are normalized to MMS alone and are presented as means and 687 standard errors of three independent experiments. C, Quantification of γH2Ax in HeyA8 cells 688 treated for 4 hours with PARP inhibitors alone. Data are normalized to untreated controls and 689 presented as means and standard errors of three independent experiments. 690

Figure 6. In vivo efficacy study of PARP inhibitors alone or in combination with TMZ in a 691 HeyA8 xenograft model. A, Monotherapy activity of TMZ, veliparib, olaparib and talazoparib. 692 TMZ was administered PO, QD for 5 days (d13-17). PARP inhibitors were administered PO, QD 693 for 21 days (d13-34). Data are presented as means with standard errors. B, Activity of PARP 694 inhibitors in combination with TMZ. Compounds were administered PO, QD for 5 days (d16-695 20). The numbers of partial responses (PRs) are shown for each PARP inhibitor combination. 696 PR is defined as at least 3 consecutive tumor measurements that are between 25 mm3 and 50% 697 smaller than the starting tumor volume on day 15. For these studies the evaluation of PRs 698 occurred starting on day 43. C, Cumulative survival of mice prior to tumor outgrowth to 1 cc vs. 699 time. Data were calculated from the study depicted in Figure 6B. D, Log-rank analysis (Mantel-700 Cox) of the statistical significance of differences between treatment groups. 701

702




Table 1. Summary of in vitro potency of PARP inhibitors used in this study

Veliparib Olaparib Niraparib Talazoparib IC50 (PARP1 Enzyme Activity, nM)† 3.0 ± 0.2 0.42 ± 0.02 5.0 ± 1.0 0.60 ± 0.18 Ki (nM, See Figure S4) 3.7 ± 0.2 1.3 ± 0.5 7.9 ± 1.2 0.5 ± 0.1 KD, No DNA (TR-FRET, nM) † 2.0 ± 0.2 0.86 ± 0.26 0.95 ± 0.09 0.47 ± 0.11 KD, Plus SSB DNA (TR-FRET, nM) † 3.3 ± 2.3 1.3 ± 0.7 1.0 ± 0.5 0.50 ± 0.26 ka (Biacore, M-1s-1) 1.8 x 106 2.5 x 105 4.1 x 105 3.6 x 105 kd (Biacore, s-1) 7.0 x 10-3 3.2 x 10-4 5.6 x 10-4 6.3 x 10-5 KD (Biacore, nM) 4.4 1.3 1.4 0.17 PAR IC50 (HeyA8, nM) † 39 ± 12 7.9 ± 2.2 150 ± 40 4.1 ± 0.9 PAR IC50 (DLD1, nM) † 19 ± 4 7.3 ± 2.5 79 ± 29 5.8 ± 1.9 PAR IC50 (DLD1 BRCA2 -/-, nM) † 26 ± 8 13 ± 5 91 ± 33 6.1 ± 0.5 Viability IC50 (HeyA8, μM) † 67 ± 24 2.9 ± 1.0 6.8 ± 1.0 0.27 ± 0.07 Viability IC50 (DLD1, μM) † >100 14 ± 0.6 17 ± 2 0.56 ± 0.06 Viability IC50 (DLD1 BRCA2 -/-, μM) † 0.70 ± .21 0.056 ± 0.020 0.83 ± 0.23 0.001 ± 0.0001 Trapping EC50 (TR-FRET, nM) † 19 ± 7 5.0 ± 1.2 14 ± 4 2.7 ± 0.6 †Data are presented as means and standard errors from at least 3 independent experiments.




Figure 1. In vitro synergism of PARP inhibitors with MMS or TMZ.

A B

C D

E F

HeyA8 + 20 mM MMS

DLD1 + 100 mM MMS

DLD1-BRCA2-/- + 100 mM MMS

HeyA8 + 300 mM TMZ

DLD1 + 300 mM TMZ

DLD1-BRCA2-/- + 60 mM TMZ




Figure 2. PARP trapping in cells co-treated with alkylating agents and PARP inhibitors.

A E

B

F

D G

MMS

No

Tre

atm

ent

PARP1

Histone H3

Vel

ipar

ib

Tala

zop

arib

0 h

r

0.5

hr

1 h

r

2 h

r

4 h

r

0.5

hr

1 h

r

2 h

r

4 h

r

0.5

hr

1 h

r

2 h

r

4 h

r

Veliparib + MMS

Talazoparib + MMS

PARP1

Histone H3

Veliparib + 1 mM MMS Talazoparib + 1 mM MMS MM

S O

nly

No

Tre

atm

ent

No

Tre

atm

ent

Vel

ipar

ib

Tala

zop

arib

MMS Alone

50 mM Veliparib + MMS

50 mM Talazoparib + MMS

PARP1

Histone H3

No

Tre

atm

ent

Vel

ipar

ib

Tala

zop

arib

TMZ Alone 50 mM Veliparib

+ TMZ 50 mM Talazoparib

+ TMZ

PARP1

Histone H3

C

PARP1

Histone H3

Olaparib + 1 mM MMS Niraparib + 1 mM MMS MM

S O

nly

No

Tre

atm

ent




Figure 3. Mechanistic analysis of PARP1 trapping in biochemical systems.

Time (min)

% D

isso

cia

ted

0 20 40 600

50

100

Time (min)

% D

isso

cia

ted

0 20 40 600

50

100

Log [Compound] (M)

TR

-FR

ET

Rati

o

-6 -4 -2 0 20

2

4

6

8

[Nicked Duplex] (nM)

% B

ou

nd

0.01 0.1 1 10 1000

50

100

A B

C D

E Biotinylated

Hairpin w/ 5’-dRP

Dextran Matrix

B

PARP1

Neutravidin

NH

C O

PARP Inhibitor k a (M-1s-1) k a S.D. k d (s

-1) k d SD KD (M) KD SD

Control 2.9E+06 1.0E+06 8.9E-03 2.9E-03 3.1E-09 1.4E-10

Plus olaparib 5.7E+06 3.2E+06 1.4E-02 8.1E-03 2.4E-09 7.5E-11

Plus niraparib 8.3E+05 1.4E+05 7.0E-03 8.9E-04 8.6E-09 6.1E-10

Plus veliparib 1.6E+06 6.0E+05 8.5E-03 2.9E-03 5.5E-09 2.3E-10

Plus Talazoparib 1.2E+06 4.0E+05 5.4E-03 1.7E-03 4.5E-09 6.9E-11

PARP-DNA Binding Kinetics Determined by BLI

Time (min)

% D

isso

cia

ted

0 20 40 600

50

100

OlaparibVeliparib Niraparib TalazoparibControl




Figure 4. The effects of NAD+ depletion on PARP1 trapping.

A

B

C

No

Tre

atm

ent

MM

S

FK8

66

MM

S +

FK8

66

Vel

ipar

ib

Tala

zop

arib

Ola

par

ib

Nir

apar

ib

Vel

ipar

ib

Tala

zop

arib

Ola

par

ib

Nir

apar

ib

Vel

ipar

ib

Tala

zop

arib

Ola

par

ib

Nir

apar

ib

PARP1

Histone H3

PARP1

Histone H3

MM

S

FK8

66

MM

S +

FK8

66

No NMN

NMN




Figure 5. Enhancement of MMS-induced DNA damage by PARP inhibitors.

A

C

MMS + 4 mM Veliparib MMS + 2 mM Olaparib

MMS + 4 mM Niraparib MMS + 3 nM Talazoparib

Untreated MMS Only B




Figure 6. Potent trapping activity does not enhance efficacy when PARP inhibitors are combined with TMZ in a HeyA8 xenograft model.

A

B

0

1000

2000

3000

4000

5000

10 15 20 25 30 35 40 45 50

VehicleTMZ (50 mkd)Veliparib (200 mkd)Olaparib (200 mkd)Talazoparib (0.33 mkd)

Mean

tu

mo

r v

olu

me (

mm

3)

Days

Max % weight loss

-4-9-3-8-9

0

500

1000

1500

2000

2500

3000

3500

10 20 30 40 50 60 70 80

VehicleTMZ (50 mkd)Veliparib/TMZ (75/50 mkd) Olaparib/TMZ (25/50 mkd)Talazoparib/TMZ (0.033/50 mkd)

Mean

Tu

mo

r V

olu

me (

mm

3)

Days

Max % weight loss

-4-10-11-10-10

10 PRs8 PRs6 PRs

C

D




Published OnlineFirst July 27, 2015.Mol Cancer Res Todd A. Hopkins, Yan Shi, Luis E. Rodriguez, et al. vivo Tolerability and Efficacy of PARP InhibitorsMechanistic Dissection of PARP1 Trapping and the Impact on in

Updated version

10.1158/1541-7786.MCR-15-0191-Tdoi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/07/29/1541-7786.MCR-15-0191-T.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2015/07/27/1541-7786.MCR-15-0191-TTo request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-15-0191-Thttp://mcr.aacrjournals.org/content/suppl/2015/07/29/1541-7786.MCR-15-0191-T.DC1http://mcr.aacrjournals.org/cgi/alertsmailto:[email protected]://mcr.aacrjournals.org/content/early/2015/07/27/1541-7786.MCR-15-0191-Thttp://mcr.aacrjournals.org/

Article FileTable 1Figure 1Figure 2Figure 3Figure 4Figure 5Figure 6

in vivo tolerability and efficacy of parp inhibitors abbvie, inc ......2015/07/27 · 9 donald j....

Documents