THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 265, No. 7, Issue of March 5, pp. 4033-4040, 1990 Printed in U.S. A.

Incorporation of 2-Halogeno-2’-deoxyadenosine 5-Triphosphates into DNA during Replication by Human Polymerases a~ and ,8*

(Received for publication, May 25, 1989)

Patricia Hentosh, Rainer KoobS, and Raymond L. Blakley From the Department of Biochemical and Clinical Pharmacology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38101 and the Department of Pharmacology, University of Tennessee College of Medicine, Memphis, Tennessee 38163

Extension of synthetic primers by purified human polymerase cr (Hpol~) with the (+)-strand of M13mplS DNA as template encounters numerous specific pause sites on the Ml3 template. Some of these are regions of template secondary structure, at others the template codes for incorporation of the same base in multiple consecutive positions, but at some the responsible fea- ture in the sequence is not obvious. 2-Chloro-dATP (CldATP) substitutes efficiently for dATP in such chain extension, with 2-chloroadenine (CIA) incorpo- ration into many positions coding for A. However, there are more sites where extension is interrupted than with all four normal nucleotide substrates, partic- ularly (but not exclusively) at template secondary structure and sites of multiple consecutive CIA inser- tion. DNA synthesis from normal substrates by Hpol@ in this system shows less frequent and less marked pauses, but with CldATP substituted for dATP chain extension is limited because of marked slowing of ex- tension at sites of multiple consecutive CIA insertion. With either polymerase, the rate of extension is de- creased even more at such regions when bromo-dATP is used as substrate. Some misincorporation of ClA instead of G or T can occur at certain sites in absence of the corresponding normal substrate, but misincor- poration as C is rare. CldATP is a very weak inhibitor of chain extension by Hpola, but a somewhat better inhibitor of Hpol& These results may account in part for the inhibition of DNA synthesis in cells exposed to 2-chlorodeoxyadenosine or 2-bromodeoxyadenosine.

2-Chloro-2’-deoxyadenosine (CldAdo)’ and the correspond- ing bromo analog (BrdAdo) are adenosine deaminase resistant deoxyadenosine analogs (Montgomery, 1982) that are rapidly taken up by cells, converted to the triphosphates, and incor-

* This work was supported in part by United States Public Health Service Research Grant R01 CA 39242 and Cancer Center Core Grant P30 CA 21765 from the National Cancer Institute and by American Lebanese Syrian Associated Charities. The costs of publi- cation of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertke- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Present address: Dept. Anatomy and Cell Biology, University of Marburg, D-3550 Marburg, Federal Republic of Germany.

1 The abbreviations used are: CldAdo, 2-chloro-2’-deoxyadenosine; dAdo, 2’.deoxyadenosine; BrdAdo, 2-bromo-2’-deoxyadenosine; BSA, bovine serum albumin; CIA, 2-chloroadenine; BrA, 2-bromoad- enine; DTT, dithiothreitol; CldATP, 2-chloro-2’-deoxyadenosine tri- phosphate; BrdATP, 2-bromo-2’-deoxyadenosine triphosphate; Hpola, human polymerase cu; Hpol& human polymerase /3; SE primer 1, Sequenase-extended primer 1; ara-C, l-P-D-arabinofuranosylcyto- sine; ara-CTP, l-p-D-arabinofuranosylcytosine triphosphate; ara-5- ara-C, 1-P-D-arabinofuranosyl-5-azacytosine.

porated into DNA (Carson et al., 1980; Blakley et al., 1986; Griffig et al., 1989). They are highly toxic to human T and B lymphoblastic cell lines, human myeloid cells, and human melanoma lines (Huang et al., 1981, 1986; Seto et al., 1985; Carson et al., 1980,1983; Parsons et al., 1986), and specifically inhibit DNA synthesis (Carson et al., 1980; Huang et al., 1986; Hirota et al., 1989). In mice they have therapeutic effects against L1210 leukemia, B16 melanoma, and M5076 ovarian carcinoma (Carson et al., 1980; Huang et al., 1984, 1986). CldAdo is presently in Phase II adult (Piro et al., 1988) and Phase I pediatric trials’ for patients with hematologic malig- nancies.

Inhibition of DNA synthesis in cells exposed to the nucle- osides is in part due to inhibition of ribonucleotide reductase (Blakley et al., 1986; Parker et al., 1988; Hirota et al., 1989; Griffig et al., 1989), but some evidence suggests that other mechanisms are also operative (Parker et al., 1988; Griffig et al., 1989).

In this study, we have investigated effects of CldATP and BrdATP on in vitro extension of synthetic primers by Hpola and -p with phage DNA (M13mp18 (+)-strand) as template. Incorporation of ClA or BrA into the primed strand instead of A and misincorporation as G, C, or T have been investi- gated, as well as inhibitory effects when limiting dATP is present.

MATERIALS AND METHODS

Materials-T7 Sequenase (a modified form of T7 DNA polymerase with low 3’ + 5’ exonuclease) was obtained from United States Biochemical Corp.; M13mp18 single-stranded DNA, Ml3 specific 16- and l7-mer primers (primers 1, 2, and 4, see Fig. l), and formamide stop solution from New England Biolabs; molecular biology grade normal dNTPs, hybridization probe primer (primer 3), and acrylam- ide from Bio-Rad, Kodak XAR and Du Pont Cronex film from Med Cor Xray Systems; [oI-~*P]~ATP, [T-~*P]ATP, and Nensorb columns from Du Pont-New England Nuclear. and T4 nolvnucleotide kinase from Bethesda Research LaboratorieS. Primers 2,“3, and 4 were also synthesized on an Applied Biosystems 380B DNA synthesizer in the Molecular Resource Center, St. Jude Children’s Research Hospital. Synthesis of CldAdo and BrdAdo was carried out as described (Huang et al., 1981) and the triphosphates were synthesized by standard techniques. Hpola and Hpolp were both essentially homogeneous preparations with high spe&fic activity. Hpollv obtained from-Molec- ular Biology Resources (Milwaukee, WI) is DreDared from HeLa cells and has aspecific activity of 10,200 nmol 0; nbcleotide incorporated into DNA per h/mg. This may be compared with a literature value (Gronostajski et al., 1984) of 3,300 (similar units) for Hpola Durified from the same source, and 96,600 for enzyme purified from KB cells, but assayed with a different DNA substrate (Wang et al.. 1984). The Molecular Biology Resources Hpola preparation 3 reported to con- tain five major polypeptides corresponding in molecular weight to those reported by Wang et al. (1984). HpolP was recombinant enzyme expressed and purified as described by Abbotts et al. (1988a) and with a specific activity of about 100 pmol of dNMP incorporated per h/

* V. M. Santana and R. L. Blakley, unpublished results.

4033

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4034 CldATP and BrdATP Effects on Human DNA Polymerases

mg. The Hpol@ was the generous gift of Dr. Samuel Wilson, Labora- tory of Biochemistry, National Cancer Institute, National Institutes of Health.

Extension of 5’-End-labeled Primers by DNA Polymerases- Ml3mpl8 specific primers 2 or 3 (Fig. 1) (100 ng, 20 pmol; final concentration, 0.2 PM), were 5’-end-labeled by the forward kinase reaction (Chaconas and van de Sande, 1980). P&mers were incubated at 37 “C for 1 h with T4 polynucleotide kinase (20-40 units) and [y- 32P]ATP (150 &i; 50 pmol) in 100-~1 reaction volume containing 50 mM Tris-HCl. DH 7.5.10 mM M&l.. 5 mM DTT. and 50 &ml BSA. The reaction’was teiminated b’y heating at 75’“C for it min and extracted with 100 ~1 of phenol:chloroform (1:l). The aqueous layer was then extracted twice with 100 ~1 of water-saturated ether. Unin- corporated 32P-labeled ATP was removed from the aqueous layer by spin column centrifugation (1 min, 1000 rpm) through G50 Sephadex. The solution was evaporated to dryness and redissolved in 50 ~1 of HZO. Labeled primer (0.75 ng, 0.15 pmol) was annealed to Ml3mp18 (+)-strand DNA (0.25 fig, 0.1 pmol) in 2 ~1 of a solution containing the appropriate reaction buffer at three times the final concentration by heating the mixture at 90 “C for 3 min and slowly cooling to room temperature over 30 min. The final polymerization reaction mixture (volume, 6.5 ~1) contained 0.023 FM primer annealed to 0.015 PM template DNA, 0.32 mg/ml BSA, lo-20 PM unlabeled dCTP, dGTP, and dTTP, 60 mM Tris-HCl, pH 8.0, and 1 mM DTT. In addition, Hpola reaction mixtures also contained 5 mM magnesium acetate and 1.73 units (170 ng) of enzyme, whereas HpolP reaction mixtures also contained 5 mM M&l*, 50 mM NaCl, and 8.7 units (87 ng) of enzyme. A unit is defined as activity incorporating 1 nmol of nucleo- tide/h under standard assay conditions. For both enzvmes. CldATP. BrdATP, or dATP (l-20 ;M) was added as the fo&h nucleotide: Reactions were performed at 37 “C for 1 h for both polymerases and were terminated by the addition of 4 ~1 of stop solution (deionized formamide containing 0.3% xylene cyan01 FF, 0.3% bromphenol blue, 0.37% Na2EDTA, pH 7.0). All terminated reactions were heated at 90 “C for 3 min, quickly cooled in an alcohol ice bath, and 2-5 ~1 were loaded onto an 8% polyacrylamide gel (35 x 42.5 cm, 0.4-mm thick) prepared in 7 M urea and 100 mM Tris-HCl, 89 mM boric acid, 10 mM Na2EDTA, pH 8.4. DNA sequences were confirmed by using 2’,3’- dideoxynucleoside triphosphates and Sequenase with the same tem- plate-primer duplex @anger et al., 1977). Gels were electrophoresed at 1600-1800 volts for 2 h and autoradiograms were obtained by 4- 16-h exposures of Kodak XAR or Du Pont Cronex film at -70 “C without intensifying screens.

Measurement of DNA Polymerase Activity with Sequenase-ekm- gated Primers (SE Primers) of Varying Length-The minus DNA sequencing method originally introduced by Sanger and Coulson (1975) and applied by others to base analog incorporation studies (Toorchen and Toual. 1983: Huff and ToDal. 1987: Reid et al.. 1988) was also utilized ti examine polymerase-activity with CldATP and BrdATP. In this method, the original synthetic oligonucleotide primer (in this case primer 1) is extended by Sequenase in the presence of the four normal dNTPs at low concentration (0.2 PM). Under these conditions Sequenase produces DNA strands of varying lengths (Ta- bor, 1987) ranging in size from elongation of primer by several to about 200 nucleotides. This mixture of differing length DNA frag- ments will be referred to as SE primers. The procedure for generation of extended primers was modified as follows. Annealing was per- formed between 5 ng (1 pmol) of primer 1 (Fig. l), and 1.5 gg (0.6 pmol) of M13mp18 (+)-strand DNA in 10 ~1 of 40 mM Tris-HCl, pH 7.5,20 mM MgCl*, 50 mM NaCl by heating at 90 “C for 3 min followed by cooling to room temperature over 30 min. The primer-template DNA duplex was first partially extended and simultaneously radio- labeled & provide variable le@th DNA fragments by using a modi- fication of the Sequenase protocol of United States Biochemical Corp. as follows. The annealed DNA was mixed with dGTP, dTTP, and dCTP (each at a final concentration of 0.2 uM). 6 UM DTT. 15 rrCi of [u-32P]dATP (3000 Ci/mmol, 0.30 PM), and 3 &its of Seqienase enzyme in a volume of 16.5 ~1. The reaction mix was incubated at room temperature for 5-10 min. One-half the mixture was then removed and the reaction terminated by the addition of 4 ~1 of ice- cold 60 mM Na,EDTA. The remaining solution was reincubated at room temperature with a second portion of dNTPs, [a-32P]dATP, and Sequenase enzyme as above for 5-10 min. This reaction was also terminated with 60 mM Na2EDTA. The two labeling mixtures were combined, diluted with 300-400 ~1 of Reagent A (100 mM Tris-HCl, pH 7.6, 10 mM triethylamine, 1 mM Na*EDTA), and applied to a Nensorb column to remove protein and unincorporated nucleotides from the duplexes of template and the mixture of 32P-labeled extended

primers. The duplex DNA was eluted with 200-300 ~1 of 50% ethanol, evaporated to dryness, and redissolved in either 120 mM Tris-HCl, pH 8.0, containing 10 mM magnesium acetate, 2 mM DTT, and 0.3 mg/ml BSA for use with Hpolcu, or in 120 mM Tris-HCl, pH 8.0 containing 10 mM MgC12, 2 mM DTT, and 0.3 mg/ml BSA for use with Hpola.

This-mixture of extended primers was then used to investigate further extension bv HDO~~ or HpolB. either with four normal dNTPs. with CldATP rep&i& a normal &cleotide, or with one nucleotide omitted (minus reaction mixtures). Final reaction mixtures for Hpola contained, in a volume of 8 ~1, 0.02-0.025 pM primer, 0.015-0.02 pM template, 25 PM each of dCTP, dGTP, and dTTP, 0.13 mg/ml BSA, 0.85 mM DTT, 50 mM Tris-HCl, pH 8.0, and 4.25 mM magnesium acetate. Final reaction mixtures for Hpol@ contained, in a volume of 8 ~1, 0.02-0.025 PM primer, 0.015-0.02 PM template, 25 WM each dCTP. dGTP. and dTTP. 0.13 ma/ml BSA. 0.85 mM DTT. 50 mM NaC1,‘50 mM Tris HCl, pi-I 8.0, and 5 mM IVigCl,. CldATP, &ATP or dATP (0.25-25 PM) was added as the fourth nucleotide. After addition of polymerase (Y (l-2.5 units, loo-250 ng) or polymerase /3 (8.7-17.5 units, 0.087-0.175 rg) reactions were incubated at 37 “C for 60 min. All reactions were terminated with 4 J of stop solution. To identify DNA bands on the gel, sequencing was performed by the dideoxynucleotide method (Sanger et al., 1977) with T7 Sequenase, M13mpl8 DNA and primer 1 in a separate labeling reaction. Gel electrophoresis of reaction products was carried out as for the 5’-end- labeled primer extension method.

RESULTS

Primer-Template Duplexes Utilized--In Fig. 1 the upper sequence (with 5’ to 3’ numbering) represents a portion of the (+)-strand of M13mp18 DNA that was used as template in these experiments. The primers used are shown below the template sequence at their respective annealing positions. Primer 1 was used only in the form of SE primers, that is, the mixture of primers obtained by a preliminary extension of primer 1 with Sequenase (see “Materials and Methods”). Bases 6172-6206 of the template strand contain an inverted repeat of 13 base pairs that are capable of forming a stable duplex hairpin (Fig. 1). Primer 4 was constructed to anneal to 14 bases of the 5’ side of this region of the template. However, under the experimental conditions used, there was no extension of primer 4 by Hpolcu, Hpol& or Sequenase even when a lo- to 20-fold excess of primer over template was used (data not shown).

In Vitro Polymerization by Hpola in the Presence of Normal dNTPs-The DNA chains synthesized by Hpola by extension of 5’-32P-labeled primer 2 or 3 are shown in Fig. 2, A and B, respectively. Since the dideoxynucleotide sequence informa- tion shown represents the newly synthesized (-)-strand, the numbering (which is based on the template) decreases in the 5’ to 3’ direction for the growing strand. The maximum extension of both primer 2 and 3 in the presence of all four dNTPs in 1 h is about the same, but the distribution of chain lengths is different for the two primers due to the different pause sites encountered in the sequences (Fig. 2 and Table I). Extension of primer 2 with 1 pM dATP results in a consider- able proportion of shorter chains most of which are arrested one nucleotide prior to an A insertion site. However, in the presence of 10 pM dATP most extension of primer 2 is arrested at the beginning of the region of secondary structure (site 6206), 85 bases from the 3’-end of the primer (Fig. 2A), although small amounts of longer DNA chains are formed that are arrested after addition of 163, 174, or 199 bases. Similar results (not shown) were obtained with 20 pM dATP. In addition, at all dATP concentrations, there is a consider- able slowing of extension at position 6245 (Table I).

Primer 3 is complementary to the last two bases of the 3’- end of the secondary structure region (Fig. l), and annealing of the primer to the template obviates to a large degree hindrance of extension by the secondary structure. The pro-

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

CldATP and BrdATP Effects on Human DNA Polymerases

Hairpin

6170 6180 6190 6200 6210 6220 6290 6300 6310 6320

4035

. . . . . . . . . . 5’ TCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA/ /CTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACC 3’

CAACACACCTTAACAC GTCCTTTGTCGATACTG TGACCGGCAGCAAAATG CAGCACTGACCCTTTTG Primer 84 Primer #3 Primer #2 Primer #l

FIG. 1. M13mp18 (+)-DNA template in the region of interest indicating the positions of primers used in this study. The region of secondary structure is also indicated.

-,=-6279

GCTA 0 110

A.

--

dATP (PM)

--L3- m- e--6000 $,-+6025

55s =imr- i-,6071 &-w/-6078 zz- -6086 -a=- - 6100 ---

=.fZ =---r = -_ ~6125

-- -6129 -II- I .~. w-0 = z - -6145

I -6150 ---- m - -6158 ,- - -6164 -- -

-‘-s-6171

ZB =

-==I-6181

-a --6104

-- - =

x--6192 - -

z

GCTA

B.

0 120 dATP

b-W

a e- 5982 8 y-6071

G-16117 --6129

7i z ;:g

e 0

m-6200

=- 6210

z-6228

r-6235

~-6241 --6245

d-6255 d

o-6265

R -6271

- - 6279

I

-6286 -6287

A

C.

----6035

-6057 - ..a-6070

- 6092 . - . .

-,b- 6143

, . . . -6150

-- 6156

3

Y / .

i Y

0 2.5 20 dATP

(PM)

--6172

'-6162

.- 6192

--6200 P-

A 0 2.5 20 dATP (PM)

D.

FIG. 2. Extension of Ml3mplSspecific primers by Hpola and Hpolj3 in the presence of normal substrates. 5’-Labeled primers were : A and C, primer 2; B and D, primer 3. The concentration of dCTP, dCTP, and dTTP was 20 PM and that of clATP is shown below each lane. Results for Hpolcv in A and B and for HpolP in C and D. Sanger-Coulson @anger et al., 1977) dideoxynucleotide sequencing results with each primer appear to the left of the experimental autoradiograms in A and B. Results with 2’,3’-dideoxy-ATP are at the left in C and D. For other details see “Materials and Methods.”

portion of longer chains is consequently greater than for primer 2 (Fig. 2B). In the presence of 1 pM dATP about 134 bases are added to primer 3, together with formation of some shorter chains. With 5-10 pM dATP a maximum of over 180 bases are added to the primer. The heavy bands in Fig. 2B correspond to major arrest points which are listed in Table I. At two of the arrest points the template codes for incorpora- tion of three consecutive A residues and at others the code requires insertion of consecutive T or C residues. However, the major arrest site is at 6126,6125 where there is no multiple consecutive base insertion.

When SE primer 1, the mixture of DNA chains obtained by extending primer 1 to lengths of about 25-220 bases (see “Materials and Methods”), was incubated with Hpola in a reaction mixture lacking dATP, the chains were further ex- tended up to the next sequence position requiring A incorpo- ration. Oligonucleotides in this mixture consisted of primer 1 extended by 20 to ~240 bases. If 0.25 PM dATP was present

during the incubation with Hpola, some chains, particularly the shorter ones, were extended beyond sites of A incorpora- tion (results not shown). Higher dATP concentrations per- mitted the total extension of primer 1 to be increased to 500 bases or more, with a decrease or disappearance of shorter chains. In this system also, extension is retarded at positions 6206,6125, and 6086 (Table I).

In Vitro Polymerization by HpoQ-Regardless of the con- centration of dATP or which primer is used, in the presence of all four normal nucleotide substrates HpolP at the level of activity used extends primers by more than 200 bases in 1 h, with very little accumulation of shorter chains (Fig. 2, C and D). The autoradiogram of products obtained using primer 2 (Fig. 2C) shows dark bands near the top that correspond to DNA fragments containing at least 300 nucleotides. Only at low dATP concentration (2.5 pM) is there accumulation of shorter DNA chains (90-300 nucleotides) with pausing at sites of insertion of two of three consecutive A residues (Table

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4036 CldATP and BrdATP Effects on Human DNA Polymerases

TABLE I Arrest sites of chain extension by Hpolol and Hpolp in the presence of dATP, CldATP, or BrdATP

Fourth Hpolu RpclB nucleotide Primer Arrest site sequence Primer Arrest site Sequence

dATP 2 6245” GTACC b 2, SEl’ 6206” Hairpin 2 6200-6198”d GAAAT 3 6145-6143” TAAAG 2 6129,612@ CTAAT -- 3, SE1 6126, 6125 TGAGT 2 6117, 6116d CTAAC 3 6100,6099 CETG 2 6071-606gd GAAAC 3, SE1 60886086 GCEG 3 6071-6069” GAAAC

CldATP 2 6255 GGATC 2 6287,6628 CAAGC 2 6245” GTACC 2 6265 CGACT 2 6235,6234 GAATT 2, SE1 6255 GGATC 2 6228,6227 GTtiT 2, SE1 6241 CGAGC 2, SE1 6206” Hairpin 2, SE1 6235,6234 CGAAT 3, SE1 6200-6197 GAAAT SE1 6228,6227 TAATC 3 6172,617l CAACA 3, SE1 6200-6198” GG AT 3 6152-6149 TAAAG -- 3, SE1 6145-6143” TAAAG 3, SE1 6129,6128 CTAAT 3 6116,6115 TA@T SE1 6071-6069” GAAAC

BrdATP 2 6287,6286 CCAAG 2 6287,6286 CCAAG - 2 6279 GC&TG 2 6271 GCGG 2 6255 GGATC 2 6265 CGkT 2 6245 GTkC 2 6258 AGAGG 2 6235,6234 GA&TT 2 6255 GGATC

3 6200-6198 GAAAT - a Arrest sites with either dATP or CldATP. * Sequences are in the 5’ + 3’ direction for the growing (-)-strand. Residues underlined are at the 3’-end of the

growing strand at termination. ’ SEl, Sequenase-extended primer 1. d At low dATP concentration.

I). With primer 3 (Fig. 20) and SE primer 1, similar trends were observed. In contrast to Hpol~v there is no evidence of a decreased rate of chain extension at the region of template secondary structure (positions 6206-6172) (Fig. 2C).

CldATP and BrdATP as Substrates for Hpola-Hpola is able to use the analogs as substrate instead of dATP and after incorporation of ClA at most sites extension of DNA strands is able to continue (Fig. 3, A and B), but extension is less than with dATP because of numerous arrest points. Primer 2 was extended by approximately 85 bases in the presence of 1 PM CldATP (Fig. 3A). Higher CldATP concentration (10 PM) does not increase the maximum chain length, but increases the proportion of longer chains. The limitation of extension is due to a number of major arrest points (Table I, and Fig. 3A), some of which are also observed in replication with normal nucleotide substrates (Fig. 2A). Several additional arrest points occur where two or three consecutive ClA resi- dues must be inserted in the (-)-strand (Table I). Arrest occurs after 1, 2, or 3 of these residues are inserted or after the next base is inserted, depending on the site.

In the presence of 1 FM BrdATP, Hpola is able to incor- porate BrA at the first of two consecutive A sites in the (-)- strand (6287) but with no further extension. With 5 or 10 FM BrdATP, BrA incorporation at position 6286 also occurs and a small proportion of chains is extended further, but the maximum extension was only by 64 bases. Arrest points in longer chains are similar to those observed with CldATP (Table I).

Compared with extension in the presence of all four normal

substrates (Fig. 2B), there is much less extension of primer 3 by Hpola past the triplet A site 6200-6198 when CldATP replaces dATP as substrate (Fig. 3B). At low CldATP (1 PM) there is little extension beyond 6199. At higher CldATP chains are extended to 6198 and 6197 (Table I), but only a small proportion of chains are extended further, with a max- imum addition of 135 bases. Among these longer chains, the pattern of arrest differs significantly from that with dATP as substrate (Table I). Although extension proceeds normally through most single CL4 insertions and a few sites of multiple insertions (e.g. 6182,618l and 6158,6157), major arrest occurs at other sites of two or three ClA insertions (Table I).

Although extension of SE primer 1 by Hpola is negligible with 0.25 ELM CldATP, it is significant at higher concentra- tions (results not shown). However, even with 25 I.LM CldATP considerable arrest occurs at 6206 (beginning of secondary structure) and at sites where three consecutive ClA residues must be inserted (Table I). When BrdATP replaces dATP for extension of SE primer 1 by Hpola, chain extension is less than with CldATP (data not shown).

CldATP and BrdATP as Substrates for Hpol&-In contrast to the above results with Hpola, efficient extension does not occur with HpolP when CldATP replaces dATP (Fig. 3, C and D). Primer 2 is extended to only a limited extent (~55 bases) and at all CldATP concentrations major arrest occurs at three sites (6255, 6241, and 6235) (Fig. 3C). There was even less extension of primer 2 by Hpolfi when BrdATP replaced dATP as substrate, with arrest of most chains after insertion of BrA at site 6287,6286. A small proportion of chains were extended

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

H F&i iii c E -6200

-6206

= -6216 -a

-. 3 5-6226 a r-6235 13 .

=:g: # m

- -6255

2

ay

-6260 Sk

m-6265 - !

o-6271 -

CldATP and BrdATP Effects on Human DNA Polymeruses

- - 6071

- - 6145 ,#

z - 6152 -*I

- - 6156

z -6172 - =

- - 6162

- -6279 = -- 6192 _ _

A 1 10 CldATP 1 10 BrdATP A 1 20 CldATP

(!JW (14 (PM) A. B.

- -6200 a.-

= -6216

c - 6227

u-6234 w ; -6150 - - 6241

- -6245

rl :

- 6167 ‘. ‘- --

- - -6176

- -6265 PI -C -. - -6164

1 -6271 - . ATI _ 6192

- -6279 -1

A

C.

2.5 20 CldATP 2.5 20 BrdATP A 2.5 20 CldATP

(VW (PW (VW D.

FIG. 3. M13mp18 primer extension by Hpol~~ and Hpol@ with CldATP or BrdATP replacing dATP as substrate. The concentration of dGTP, dCTP, and dTTP was 20 pM and that of CldATP (or BrdATP) is shown below each lane. Other details as in Fig. 2. Results for Hpolcr in A and B and for HpolP in C and D. Sanger- Coulson sequencing results with 2’,3’-dideoxy-ATP are shown at the left of each panel.

beyond these sites, but significant additional chain arrest occurred at all BrA insertion sites except 6279 and 6260 (Table I). Extension of primer 3 by HpolP was even more severely curtailed with virtually complete arrest of extension after incorporation of two or three CIA residues at sites 6200- 6198 (Fig. 30).

The tendency for chain extension by Hpol@ to arrest at many sites of CIA insertion was confirmed using SE primer 1 (data not shown). With lower concentrations of CldATP, little chain extension occurs, and even with 25 pM CldATP, the maximum chain length increases by only 55 bases. CldATP increases arrest at several of the major arrest sites with -A reactions, and several are identical with those seen in primer 2 extension (Fig. 3C). However, extension continues through other sites of CIA insertion including some sites where con- secutive ClA residues are inserted.

Time Courses of Primer Extension-In the experiments described above, reactions were all for 1 h at arbitrarily selected enzyme concentrations. Although no detailed kinetics were performed, it was of interest to determine the shape of progress curves, since this giyes some idea whether a pause in extension, as indicated by accumulation of chains of a specific length, implies complete termination of extension of a certain fraction of chains or merely a pause in extension at the relevant point in the sequence. Primer 3 was used for Hpoloc extension because of the major problem caused for Hpolol extension of primer 2 by secondary structure in the 6172- 6206 region of the template. Primer 2 was used for Hpol/3 extension because of very short extension of primer 3 with CldATP as substrate.

20 40 Reaction time (min)

FIG. 4. Progress of primer extension by Hpolr~ and Hpolfi. Hpola extension of primer 3 or HpolP extension of primer 2 was performed in the presence of 10 pM dGTP, dCTP, and dTTP together with either 10 /*M dATP or 10 pM CldATP.

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4038 CldATP and BrdATP Effects on Human DNA Polymeruses

FIG. 5. Effects of CldATP on chain extension by Hpolcv or Hpolfl in the presence of dATP. A, extension of primer 3 by Hpoln; B, extension of primer 2 by Hpolfi. Concentrations of CldATP and dATP are shown below each lane. Other details are the same as in Fig. 3.

A

i

s - 5982

f 5=?

- - 6071 . - -6086 _ _

-6100 L-z I --

- -6125

- -6145

Ea - -6154 m

-.- -6164 -

z

-

=r e-6184

O-6192

3- 6200

I A

=3 !!i - ._ - 5982

83 5 - 6070

- ~.. _.-

” .m

?II lr . f’ z I)

ws - -

- -6200

w=mmm!a m-62l8

--6228

“-6235

+-6241 --6245

- .

d-6255 - II

- - 6265

CI-““’

= -. - - 6279

The results (Fig. 4) illustrate the absence of arrest or pausing in the extension by Hpolp with normal substrate, but the almost total arrest of extension at 6235, 6234 when CldATP replaces dATP. In the case of Hpoloc the rate of extension with normal dNTPs falls off continuously as “pause” sites are encountered, but at none of these is the process of extension completely and irreversibly terminated. When CldATP replaces dATP for Hpola the slowing of extension at specific sites is more marked, but still does not become completely terminating.

CldATP as a Competitive Inhibitor-Since CldATP is clearly a less efficient substrate than dATP for both polym- erases, it seemed possible that the analog might act as a competitive inhibitor of dATP incorporation, but CldATP is a weak inhibitor of primer 3 extension by Hpola (Fig. 5A). In the presence of 1 PM dATP, inhibition by 1 pM CldATP is insignificant and even 20 pM CldATP caused only limited inhibition with increased accumulation of chains that are arrested at sites 6199,6198,6197,6144,6143, and 6128. These are also arrest sites when CldATP substitutes for dATP (Fig. 3B and Table I). In the presence of 5 pM dATP, even 20 pM

CldATP caused little inhibition. However, in reaction mixtures containing 2.5 ELM dATP,

CldATP caused marked inhibition of the extension of primer 2 by HpolP (Fig. 5B). The extension is decreased from 350 bases in the absence of CldATP to 220, 124, and 90 bases in the presence of 2.5,5, and 20 pM CldATP, respectively. Arrest of strand extension occurs at the same specific sites as when CldATP substitutes for dATP (Fig. 3C) and at higher CldATP

, 4m * .

: I

25 5 25 25 5 dATP 0 0 2.5 20 20 CldATP (PM1

concentrations the proportion of shorter chains increases. Inhibition by CldATP was also observed in the presence of 5 pM dATP, or with primer 3 (data not shown). Similar but smaller inhibitory effects were observed even in the presence of an g-fold excess (20 pM) of dATP. BrdATP inhibits chain extension by Hpolfi under similar conditions to about the same extent (data not shown).

Misincorporation of CldATP as dGTP and dTTP-To as- certain whether CIA can be misincorporated as G, T, or C, DNA chains produced by extension of SE primers by HpolP in -G, -T, and -C reaction mixtures were compared with the products of such mixtures supplemented with CldATP or BrdATP (Fig. 6). By comparison with the dideoxynucleotide sequence, it can be seen that in unsupplemented minus reac- tion mixtures most DNA chains terminate prior to a position where the missing base should be incorporated. Misincorpo- ration of CIA or BrA is indicated when a chain in the unsup- plemented reaction mixture is partially or completely replaced by a chain one or more nucleotides longer in reactions in supplemented mixtures.

CIA misincorporation as G occurs at six of the 16-G major termination sites (positions 6277, 6273, 6249, 6242, 6236, and 6230), as T at four of 19 -T termination sites (positions 6291, 6283, 6274, and 6263), but as C at only one of 17 -C termi- nation sites (position 6267). An identical pattern of misincor- poration was seen for BrdATP. Since in most cases, CIA incorporation results in a chain extended by only 1 base, misincorporation of ClA results in chain termination. Misin- corporation of CIA at different -G and -T sites occurs with

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

CldATP and BrdATP Effects on Human DNA Polymerases 4039

6205- - 6213-

se--- 6208-~~z” ;Ltia - e-e- =. ._ --- ----

9-m -_-. -M-e ---we

-. 6230- -e-w 6233--1-1- 6231 --G-~

6236- -

6242-d -

6249-e ’ 6246---,,,

, 6254--

Em,

- 6253-/o

6263- = ._ . . ..--

_^~” - WB-

6266- - -- 6268- -(I 6267- --a

=mmd L-I -_. --. 6273- - -

6274- - -.-- 6277- - =m

-&ID-- 628(,- - -. ..I _ -;

6283- =-p= _ _,___ W-M

6289- =-- - 6291- -. - ---

6292-, --- ddG -G -G -G ddT -T -T -T ddC -C -C -C

“c “s + T9 “c/“bp “c “s

99 + %7 FIG. 6. Misincorporation of CldATP or BrdATP by Hpolp

as dGTP and dTTP. SE primer 1 was incubated with Hpolp in reaction mixtures containing three normal dNTPs at 25 pM but lacking dGTP (-G), dTTP (-T), or dCTP (-C). CldATP or BrdATP was included as the fourth nucleotide at 8 pM. The corresponding dideoxynucleotide sequencing results are to the left of each series.

different facility as indicated by densitometer measurements of band intensity (data not shown).

Examination of misincorporation of ClA by Hpol@ over a 220 base stretch of the M13mp18 (-)-strand indicated that misincorporation to varying extents can occur at 40-50% of G sites, 20-25% of T sites, and O-5% of C sites. Hpola shows potential to misincorporate CIA or BrA at about the same proportion of sites: 45% of G sites; 20% of T sites. In general misincorporation of CIA as G occurs at the same sites with both polymerases.

DISCUSSION

The interruption of primer extension by Hpola at specific sites on the M13mp18 template is consistent with the reported behavior of monkey, human, and bovine DNA polymerase a, T4 DNA polymerase (Weaver and DePamphilis, 1982), T7 DNA polymerase (Myers and Romano, 1988), and Escherichia coli DNA polymerase I large fragment (Abbotts et al., 1988b). Arrest of primer 1 or 2 extension is caused by template secondary structure at the inverted repeat of 13 base pairs at positions 6206-6172. A similar result was reported by Weaver and DePamphilis (1982). However, this structure did not arrest extension of primer 3 which anneals to a region includ- ing 2 bases of the hairpin (Fig. 1). Binding of Hpola to this duplex possibly has a “binding protein” effect, disrupting the secondary structure. When primer 3 was extended by Hpolcv to template positions 5974-5950, arrest also occurred at this inverted repeat of 9 base pairs (results not shown). Primer 4, which is designed to anneal almost entirely to the 6206-6172 hairpin, was not extended by Hpola or $3, presumably because even in 20-fold excess over template, it could not anneal in competition with the complementary region of the hairpin. During intracellular DNA replication, the effects of template

secondary structure are probably diminished by single strand binding proteins (Myers and Romano, 1988).

Pauses also occurred at positions on the template where no secondary structure was indicated by a computer-assisted search. No consensus sequence could be identified at these sites (Table I), but involved repetitions of the same base (e.g. CCC or TT), and strong stops occurred at two regions where three consecutive As are inserted. We were unable to confirm the suggestion (Weaver and DePamphilis, 1982) that these sites are associated with GC-rich sequences.

We have not performed sufficient kinetic studies to deter- mine how long a pause in extension occurs at any of these sites, but results clearly indicated that at some (e.g. 6145- 6143) the pause was of limited duration. At others (6126,6125 and 6088-6086) the pause appeared to be much longer, but was still not of unlimited duration.

Hpolfi displayed little sensitivity to template secondary structure or other sites under our experimental conditions, and primarily larger DNA products were synthesized (>240 bases in length). Short pauses at specific sites could be ob- served when shorter incubations periods were used (data not shown), in agreement with results of Abbotts et al. (1988a).

Because of the limitation that template secondary structure places on primer 2 extension by Hpola, a clear-cut comparison cannot be made of the relative efficiency with which this enzyme extends primers 2 and 3. However, the utilization of primer was approximately the same in the two cases. Simi- larly, Hpol@ appeared to utilize the two primers with about the same efficiency.

CldATP and BrdATP as Substrates for Hpola and P-Even under conditions favoring misincorporation (i.e. wher the normal dNTP was absent), misincorporation of CIA or BrA by either polymerase occurred at only a fraction of the sites where T or G should be inserted and at very few C sites. Where misincorporation did occur it was frequently incom- plete. This high fidelity for incorporation of the analogs as substitutes for A indicates that base pairing properties of CIA and BrA are very similar to those of A. Most misincorpora- tions of CIA as G or T caused interruption of chain extension.

In contrast to Parker et al. (1988), we found that Hpola is able to use CldATP with considerable efficiency as a substrate instead of dATP, incorporating CIA into many positions in the sequence with little or no pause in extension. Some of the points at which pauses did occur are the same as observed with dATP as substrate (Table I), including the template hairpin region (6206-6172). Most additional pause sites con- sist of sequence regions where two or three consecutive CIA residues are inserted into the sequence of the growing strand. Incorporation of BrA into such positions causes an even more lengthy interruption of extension. Similar effects have been observed for the incorporation of consecutive residues of ara- C or ara-5-aza-C by both Hpola and -fi (Townsend and Cheng, 1987; Ohno et al., 1988) and for consecutive incorporation of dihydrothymidine residues by E. coli DNA polymerase Kle- now fragment (Ide and Wallace, 1988).

HpolP is also capable of primer extension with CldATP as substrate instead of dATP, but extension is retarded even more at sites of consecutive CIA incorporation (Fig. 3 and Table I). In the case of BrdATP there was virtually no chain extension beyond the first site of consecutive BrA incorpo- ration.

CldATP and BrdATP as Competitive Inhibitors of DNA Polymerization-The analogs cause a detectable decrease in chain extension by Hpola only when present at a concentra- tion lo-20 times higher than that of dATP. Extension is then retarded at positions characteristics of ClA insertion. These

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4040 CldATP and BrdATP Effects on Human DNA Polymerases

observations, coupled with the fact that when CldATP re- places dATP as substrate higher concentrations of the analog are required to give the same degree of chain extension, suggests that the K,,, for CldATP is higher than for dATP. This may also reflect a higher dissociation constant for CldATP from the enzyme-DNA duplex-CldATP complex. A similar conclusion was reached by Parker et al. (1988). This weak inhibition contrasts with the ability of CldATP to become incorporated into DNA in intact cells, despite the presence of a more than lo-fold excess of dATP (Griffig et al., 1989). Similarly, a lo-fold excess of ara-CTP over dCTP is required to cause marked inhibition of chain extension by purified Hpolp (Ohno et al., 1988), whereas exposure of cells to 0.1 WM ara-C, generating about 50 PM intracellular ara- CTP (Fridland and Verhoef, 1987), causes over 90% inhibition of DNA synthesis (Graham and Whitmore, 1970; Griffig et al., 1989).

In the case of Hpolp, CldATP competes more successfully with dATP for the active site. When both nucleotides were present at the same concentration (2.5 FM), there was a significant decrease in chain extension, and extension de- creased even further when CldATP was in molar excess over dATP, with the points of arrest occurring as in the case of ClA incorporation,

Acknowledgments-We thank S. Furst, J. C. McCastlain, and F. Harwood for excellent technical assistance and Dr. Samuel Wilson for generously providing polymerase p. We are also indebted to Vicki Gray and Dolores Anderson for skillful typing.

REFERENCES

Abbotts, J., Sen Gupta, D. N., Zmudzka, B., Widen, S. G., Notario, V., and Wilson, S. H. (1988a) Biochemistry 27,901-909

Abbotts, J., Sen Gupta, D. N., Zon, G., and Wilson, S. H. (198813) J. Biol. Chem. 263,15094-15103

Blakley, R. L., Huang, M.-C., Ashmun, R. A., and Kooh, R. (1986) in Purine and Pyrimidine Metabolism in Man (Nyhan, W. L., Thomp- son, L. F., and Watts, R. W. E., eds) Vol. V, pp. 589-593, Plenum Publishing Corp., New York

Carson, D. A., Wasson, D. B., Kaye, J., Ullman, B., Martin, D. W., Jr., Robins, R. K., and Montgomery, J. A. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 6865-6869

Carson, D. A., Wasson, D. B., Taetle, R., and Yu, A. (1983) Blood 62,737-743

Chaconas, G., and van de Sande, J. H. (1980) Methods Enzymol. 65, 75-88

Fridland. A.. and Verhoef. V. (1987) Semin. Oncol. 14. 262-268 (Suppi. 3)

Graham, F. L., and Whitmore, G. F. (1970) Cancer Res. 30, 2627- 2635

Gronostajski, R. M., Field, J., and Hurwitz, J. (1984) J. Biol. Chem. 259,9479-9486

Griffig; J., Koob, R., and Blakley, R. L. (1989) Cancer Res. 49,6923- 6928

Hirota, Y., Yoshioka, A., Tanaka, S., Watanabe, K., Otani, T., Mi- nowada, J., Matsuda, A., Ueda, T., and Wataya, Y. (1989) Cancer Res. 49,915-919

Huang, M.-C., Hatfield, K., Roetker, A. W., Montgomery, J. A., and Blaklev. R. L. (1981) Biochem. Pharmacol. 30.2663-2671

Huang, M.-C., Avery,‘T. L., Blakley, R. L., Secrist, J. A., III, and Montgomery, J. A. (1984) J. Med. Chem. 27,800-802

Huang, M.-C., Ashmun, R. A., Avery, T. L., Kuehl, M., and Blakley, R. L. (1986) Cancer Res. 46, 2362-2368

Huff, A. C., and Topal, M. D. (1987) J. Biol. Chem. 262, 12843- 12850

Ide, H.. and Wallace, S. S. (1988) Nucleic Acids Res. 16.11339-11354 Montgomery, J. A. (1982) Cancer Res. 42,3911-3917 Mvers. T. W.. and Romano. L. J. (1988) J. Biol. Chem. 263. 17006-

17015 Ohno, Y., Spriggs, D., Matsukage, A., Ohno, T., and Kufe, D. (1988)

Cancer Res. 48, 1494-1498 Parker, W. B., Bapat, A. R., Shen, J.-X., Townsend, A. J., and Cheng,

Y.-C. (1988) Mol. Pharmacol. 34, 485-491 Parsons, P. G:, Bowman, E. P. W., and Blakley, R. L. (1986) Biochem.

Pharmacol. 35,4025-4029 Piro, L. D., Carrera, C. J., Beutler, E., and Carson, D. A. (1988) Blood

72,1069-1073 Reid, R., Mar, E.-C., and Topal, M. D. (1988) J. Biol. Chem. 263,

3898-3904 Sanger, F., and Coulson, A. R. (1975) J. Mol. Biol. 94,441-448 Sanger, F., Nicklen, S., and Coulson, A. (1977) Proc. Natl. Acad. Sci.

U. S. A. 74,5463-5467 Seto. S.. Carrera. C. J.. Kubota. M.. Wasson. D. B.. and Carson. D.

A.‘(1985) J. Clk. Iniest. 75,377:383 ’ Tabor, S. (1987) in Current Protocols in Molecular Biology (‘Ausubel,

F. M., Brent, R., Kingston, R. E., Moore, D. D., Siedman, J. G., Smith, J. A., and StruhI, K., eds), John Wiley and Sons, New York

Toorchen, D., and Topal, M. D. (1983) Carcinogenesis 4, 1591-1597 Townsend, A. J., and Cheng, Y.-C. (1987) Mol. Pharmacol. 32, 330-

339 Wang, T. S.-F., Hu, S.-Z., and Korn, D. (1984) J. Biol. Chem. 259,

1854-1865 Weaver, D. T., and DePamphilis, M. L. (1982) J. Biol. Chem. 257,

2075-2086

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

P Hentosh, R Koob and R L Blakleyreplication by human polymerases alpha and beta.

Incorporation of 2-halogeno-2'-deoxyadenosine 5-triphosphates into DNA during

1990, 265:4033-4040.J. Biol. Chem. 

  http://www.jbc.org/content/265/7/4033Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/265/7/4033.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on March 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from