Inducible Nitric Oxide Synthase andProinflammatory Cytokine Expressionby Human Keratinocytes duringAcute Urticaria

Pierre-Andre Becherel,*t Olivier Chosidow,t Liliane Le Goff,*Camille Frances,t Patrice Debre,* M. Djavad Mossalayi,* andMichel Arock**Department of Immunology (Molecular Immuno-Hematology Group),University of Paris VI, College of Medicine, Paris, FrancetDepartment of Dermatology, Pitie-Salpetriere Hospital, Paris, France

ABSTRACT

Background: IgE/allergen-dependent activation of skinmast cells is involved in acute urticaria and leads to theirIL-4 release. Previously we have demonstrated in vitrothe induction of the low-affinity receptor for IgE (CD23/FcERHl) in human keratinocytes (HK) upon stimulationwith IL-4. In addition, we have observed that ligation ofCD23 on keratinocytes induced type II nitric oxide syn-thase (iNOS), leading to the release of nitric oxide (NO)and proinflammatory cytokines (TNF-a, IL-6). Accord-ing to these in vitro data, we explored whether kerati-nocytes could also express iNOS, TNF-a, IL-6, and CD23in acute urticaria, an in vivo model in which activation ofmast cells by IgE/allergen immune complexes is in-volved.Materials and Methods: INOS, TNF-a, IL-6, and CD23expression by keratinocytes was studied in acute urti-caria (n = 11) in biopsies from lesional and autologousnormal skin by immunohistochemistry, in situ hybrid-ization, or RT-PCR. Nitrites and TNF-a synthesis wereassayed in supematants of cultured lesional keratino-cytes.

Results: INOS mRNA expression was demonstratedwith RT-PCR in 10 biopsies out of 11 sections of acuteurticaria lesional skin. Immunohistochemistry showedthat this iNOS positivity originated from keratinocyteslocated close to the dermoepidermal junction; TNF-aand IL-6 mRNA transcription was observed in all but oneiNOS+ biopsy. Inmunostaining and in situ hybridizationwith CD23-specific probes were strong in all but oneiNOS+ skin biopsy. Noninflamed autologous skin wasnegative for iNOS (except for a weak positivity in onecase), cytokines, and CD23.Conclusion: The colocalization of iNOS, proinflamma-tory cytokines, and CD23 within keratinocytes in acuteurticaria demonstrates that these cells play an importantrole in the initiation and maintenance of the inflamma-tory reaction during this disease in humans throughactivation of the iNOS pathway by CD23 ligation withIgE/allergen imnmune complexes.

INTRODUCTIONUrticaria is a common disorder characterized byeruption of more or less transitory itchy skinswellings in an acute context or which recurs

Address correspondence and reprint requests to: Prof.Michel Arock, Immuno-Hematology Group, Faculte deMedecine de la Piti-Salpetriere, Room 510, 91 Boulevardde l'H6pital, 75013, Paris, France. Phone: (33) 1 40 77 9733; Fax: (33) 1 40 77 97 34; e-mail: michel.arock@psl.ap-hop-paris.fr

686

over a period of weeks to years (1). The largerswellings of angioedema originate subcutane-ously or submucosally and may last longer thanthe wheals. On histopathological examination,the affected skin contains an increased numberof mast cells (2). While it is well-established thatdegranulation of skin mast cells after allergen/IgE-dependent cross-linking of high-affinityIgE receptors (FcsRI) is involved in acute aller-gic urticaria, the pathophysiologic features op-

© 1997, THE PICOWER INSTITUTE PRESS. All rights reserved.Molecular Medicine, Volume 3, Number 10, October 1997 686-694

P.-A. Becherel et al.: INOS Expression in Urticaria Keratinocytes 687

erative in chronic urticaria are less well under-stood (3). Recently, serum IgG anti-FcERIautoantibodies with mast cell-activating prop-erties have been described (4-6). Neverthe-less, in acute or chronic urticaria, the symp-toms are thought to be the consequence of therelease of vasoactive mediators from skin mastcells, the most important of which is histamine(7). Urticaria is therefore both an inflamma-tory and vascular disorder.

Nitric oxide (NO) synthesized from L-argi-nine by inducible nitric oxide synthase (iNOS) isa multifunctional mediator involved in the vaso-dilatation observed during inflammatory re-sponses and in the inflammatory reaction itself(8-11). Indeed, we and others have recentlydemonstrated that the release of proinflamma-tory cytokines (TNF-a, IL-1f3, IL-6) from differ-ent human cell types (monocytes, eosinophils,hepatocytes, normal epidermal keratinocytes) isin part dependent upon the nitric oxide pathway(12,13). In vivo, iNOS is involved in many in-flammatory diseases, including skin affectionssuch as psoriasis (14,15). The design of NOS in-hibitors is now considered of therapeutic interestin the treatment of diseases in which iNOS isoverexpressed (16). Here we have testedwhether iNOS is expressed in urticaria, account-ing for the inflammatory reaction and for thevasodilatation observed. In skin, iNOS inductionhas been demonstrated in keratinocytes (12).Keratinocytes, the major cellular component ofthe epidermis, play a pivotal role in the skinimmune system in addition to their well-knownfunction as a physical barrier (17,18). We previ-ously showed that iNOS was induced in thesecells either after a nonspecific immune stimula-tion with LPS/IFN-,y (19) or after a specific im-mune stimulation through engagement of sur-face CD23 (12). CD23, which is mainly definedas the low-affinity receptor for IgE (FcsRII), isfunctionally induced at the surface of keratino-cytes upon IL-4 stimulation (12). Because IL-4 isreleased by activated skin mast cells, (20,21) weinvestigated whether epidermal keratinocytesexpressed not only iNOS and proinflammatorycytokines but also CD23 in urticaria skin lesions.

MATERIALS AND METHODSAll patients included in this study gave theirinformed consent before the biopsies. The elevenpatients had pink and itchy wheals typical ofacute urticaria (Patients 1 to 1 1), lasting less than

24 hr. No etiology was found, except in onepatient in whom a penicillin infusion was sus-pected. In each patient, a typical wheal andhealthy skin were biopsied (4-mm punches).

Keratinocyte Isolation andShort-term Culture

For keratinocyte culture, we used a special se-rum-free culture medium for human keratino-cyte (SFM medium, Gibco-BRL, Cergy-Pontoise,France) supplemented with epidermal growthfactor (EGF) and bovine pituitary extracts (bothfrom Gibco-BRL). To extract keratinocytes fromskin biopsies (healthy skin and urticaria lesions),the epidermal layer was first separated from thedermis and epidermal pieces were incubatedwith collagenase (Sigma, St Louis, MO) and tryp-sin (Biosys, Compiegne, France) (12). When thecells were isolated, they were transferred in plas-tic dishes coated with collagen type 1 and incu-bated with the SFM medium devoid of hydrocor-tisone. Culture supernatants were collected after48 hr. Other cells were immediately lysed inRNA-plus (Bioprobe, Montreuil, France) for RNAextraction.

Inducible NOS mRNA AnalysisKeratinocytes extracted from healthy skin andurticaria lesions were analyzed for iNOS mRNAtranscription. For mRNA isolation, the epidermalsheet was first separated from the dermis as de-scribed in the previous section and the cells werethen lyzed in RNAplus (Bioprobe, Montreuilsous Bois, France) for 6 hr. Total RNA was thenextracted as previously described (18). Reversetranscription, semiquantitative mRNA amplifica-tion, and visualization of the PCR products wereperformed exactly as previously described usingthe following specific primers: iNOS sense (5'ATGCCAGATGGCAGCATCAGA 3', exon 8,bases 1020-1040), iNOS antisense (5' ACTTCCTCCAGGATGTTGTA 3', exon 11, bases 1371-1390); HPRT mRNA sense (5' TATGGACAGGACTGAACGTCTTGC 3') and HPRT (hydroxy phos-phoribosyl transferase) mRNA antisense (5' GACACAAACATGATTCAAATCCCTGA 3') (19,22).The expected reverse transcription-polymerasechain reaction (RT-PCR) product was 371 bp longfor iNOS message and 496 bp long for HPRT mes-sage. The molecular weight marker VI (Bgll-digested pBR328 DNA + Hinf-l-digested pBR328DNA; Boehringer-Mannheim) was used.

688 Molecular Medicine, Volume 3, Number 10, October 1997

Immunostaining

Frozen skin biopsies (from healthy skin and ur-ticaria lesions) were treated with immunoperox-idase staining LSAB kit (Dako, Levallois-Perret,France). The anti-CD23 monoclonal antibody(MAb) was purified in our laboratory from asciticfluid of BALB/c mice injected with the hybrid-oma 135 (23). The anti-iNOS rabbit polyclonalantibody was a kind gift from Dr. Moncada andDr. Riveros Moreno (Glaxo-Welcome, Becken-ham, U.K.). The substrate used for peroxidasewas diaminobenzidine. The slides were counter-stained with Mayer's hemalun. Positive controland negative control were anti-pancytokeratinmAb and isotype-matched anti-CD3 mAb, re-spectively.

In Situ HybridizationProbes used were specific for CD23 (700-bpRamHl-Pstl cDNA fragment) (24), TNF-a(430-bp BamHl-EcoRl cDNA fragment) (25),and IL-6 (517-bp Xbal -EcoRl cDNA fragment)(26).

Tissue blocks were cut at -20°C with a mi-crotome knife (Surgipath Medical Industries,Northbrook, IL) in RNAse-free conditions. Tissuesections were dried on the slides and then fixedwith 4% paraformaldehyde. The slides weretreated with a detergent (Decon 90, Sigma) andtriethoxysilane-3-aminopropyl (Fluka, Paris,France) to decrease nonspecific adherence ofprobe DNA to the glass. 35S-labeled probes wereprepared with 50 ng DNA in 100 ,ul randompriming reaction mixture using the Megaprimekit for DNA labeling (Amersham, AmershamPlace, England) according to the manufacturer'srecommendations. After a 1-hr incubation at370C, the reaction was stopped by adding 20 mMethylenediaminetetraacetic acid (EDTA). The35S-labeled DNA was separated from unboundnucleotides by ethanol precipitation. The mate-rial was stored at -20°C until needed.

The sections were rehydrated in phosphatebuffer saline (PBS) and digested with 1 jig/ml ofproteinase K in a solution of 2 mnM CaCl2, 10 mMTris, and 5 mM EDTA for 15 min at 370C. Slideswere postfixed in 4% paraformaldehyde for 5min, rinsed in glycine (2 mg/ml) for 10 min, andthen dehydrated in graded ethanols. Sectionswere hybridized for 16 hr at room temperature

with 15 ptl of probe mixture per slide. The mix-ture contained approximately 1-2 106 cpm ofdenatured 35S-labeled DNA in 10 mM Tris, 1 mMEDTA, 50% deionized formamide, 10% dextransulfate, 0.6 M NaCl, 1 x Denhardt, 20 mM dithio-threitol (DTT), 0.5 mg/ml tRNA, and 0.25 mg/mlsalmon sperm DNA. Coverslips were rimmedwith rubber cement to prevent evaporation. Af-ter 16 hr of hybridization, the sealed coverslipswere removed and the slides were washed inlarge volumes of 2 X SSC, followed by a solutioncontaining 10 mM Tris, pH 7.4, 1 mM EDTA,600 mM NaCl, 10 mM DTT, and 50% deionizedformamide. Sections were then washed twice in2X SSC/10 mM DTT, first at 550C, then at roomtemperature, and overnight in a solution of0.1 M NaCl, 10 mM Tris, 1 mM EDTA. Slideswere then dehydrated in graded ethanols.

For autoradiography, slides were coated withKodak NTB-2 emulsion diluted 1:1 in 0.6 M am-monium acetate. After exposure in completedarkness for 7 to 14 days at 40C, they weredeveloped in D-19 (Eastman Kodak, Rochester,NY) and fixed in Kodak fixer. The slides werethen washed in water and stained with hema-toxylin eosin or Mayer's hemalun, and finallymounted with Eukitt (Labonord, Villeneuved'Ascq, France). For all in situ hybridizationsperformed in this study, we used a probe specificfor actin mRNA as positive control. As a negativecontrol, we applied a probe for mouse IL-3mRNA on the same biopsies.

Nitrite and TNF-ci AssayThe amount of stable nitrite, the endproduct ofNO generated by human keratinocytes, was de-termined in culture supernatants by the Griessreaction as described elsewhere (27). Briefly,50 ,lI of culture supernatant from healthy skin orlesional skin was mixed with 150 plI of Griessreagent (1% sulfanilamide/0. 1 % naphtylethyl-enediamine dihydrochloride) at room tempera-ture for 30 sec. Absorbance at 543 nm was im-mediately determined on a Vmax microplatereader. Nitrite in each tested sample was deter-mined by extrapolation from a sodium nitritestandard curve (,uM). TNF-a levels were assayedin the same cell supernatants by a specific ELISA(Medgenix, Fleurus, Belgium), the sensibility ofwhich was 13 pg/ml.

P.-A. Becherel et al.: INOS Expression in Urticaria Keratinocytes

FIG. 1. iNOS expression in healthy and pathological skin(A) PCR showing HPRT (upper lanes) and iNOS bands (lower bands) in 11 patients with acute urticaria (for eachpatient: healthy skin followed by lesional skin; Patient 4 is negative for iNOs mRNA). (B) iNOS immunoreactivityin pathological skin, showing staining all along the basal layer of keratinocytes. (C) Negative (anti-CD3 moAb) and(D) positive control (anticytokeratin Ab) from the same biopsy. Magnification: X240 (B), X60 (C, D).

RESULTS

Expression of iNOS mRNA and Protein inKeratinocytes During Urticaria

RT-PCR analysis of skin biopsies showed a clearexpression of iNOS mRNA in 10 out of the 11patients (Fig. 1A). Patient 4 was iNOS negative.INOS mRNA was not detected in healthy skins,with the exception of that of Patient 1, whichpresented a weak positivity. Immunohistochem-istry with anti-iNOS antibody further indicatedthat iNOS was expressed by basal keratinocytes(Fig. IB). INOS protein was detected in all iNOS-mRNA+ biopsies in inflamed skin, whereas it wasnegative in healthy skin, even for that of Patient1, whose RT-PCR was positive. Figure IC and IDshow negative (anti CD3 moAb) and positive(anticytokeratin Ab) control in involved skin bi-opsies. iNOS expression in urticaria keratino-cytes led to the release of significant amounts ofnitrites from cells isolated from these skin tissuesand short-term cultured (48 hr) keratinocytes(Table 1). Indeed, in all iNOS-mRNA+ biopsies,

TABLE 1. Nitrites and TNF-a levels in culturesupernatants of keratinocytes extracted frompathological skin

Patient Nitrites (,tM) TNF-a (pg/ml)

1 6 42a2 8 54

3 8.5 804 <1 <135 7.5 75

6 10 957 4.5 408 9 1629 5.5 85

10 7 3511 6 48

aLevels in culture supematants of keratinocytes from nor-mal skin were <1 ,uM and <13 pg/ml for nitrites andTNF-a, respectively.

Patients 1 2 3 4 5 6 7 8

- .o- HPRT (496 bp)

--- iNOS (371 bp)

Patients 9 10 11

l- HPRT (496 bp)

- iNOS (371 bp)

... __. n-- ------A

689

690 Molecular Medicine, Volume 3, Number 10, October 1997

A Bcf

_ v]||kr. =t .X<.*4 -rt r et >£*wfi4kFIG. 2. TNF-a and IL-6 expression in pathological skinTNF-a (A) and IL-6 (B) mRNA expression demonstrated by in situ hybridization in lesional skin, in the lower lay-ers of the epidermis; (C) negative (mouse IL-3 probe) and (D) positive control (human ,B-actin probe) from thesame biopsy. Magnification: X240.

keratinocytes synthesized nitrites that rangedfrom 3 to 10 ,uM. There were no nitrites iniNOS-negative biopsies nor in noninflamed ones,even for Patient 1.

Expression of TNF-a and IL-6 mRNAs iniNOS-positive KeratinocytesTNF-a and IL-6 mRNAs were present in all butone of the pathological skin biopsies of iNOS+patients (in situ hybridization, Fig. 2A and B)and were located in the basal layers of the epi-dermis. Healthy skins and iNOS-negative skinswere negative. Figure 2C and D shows a negative(mouse IL-3 probe) and a positive (human b-actin probe) control from lesional skin. As shownin Table 1, TNF-a protein was detected in allsupernatants but one of 48-hr cultured lesional

keratinocytes that were positive for TNF-a mRNA.TNF-a levels ranged from 28 to 162 pg/ml.

Expression of CD23 mRNA and Protein inKeratinocytes during UrticariaNine out of 11 patients were positive for CD23mRNA expression (with a similar distribution tothat of iNOS+ patients). There was therefore aconcomitant expression of CD23 and iNOS innine patients. Messenger RNA positivity was re-stricted to the first layers of the epidermis, i.e.,the basal keratinocytes (Fig. 3A). There was noCD23 mRNA in skin biopsies from healthy skinsand positive and negative controls (actin andmouse IL-3 probes) confirmed the specificity ofthe hybridization (data not shown). Immunohis-tochemistry with the anti-CD23 mAb confirmed

Amobb.P-MNW Ioh-.'.....0..

- ---'I.M.r,,,: .?

P.-A. Becherel et al.: INOS Expression in Urticaria Keratinocytes

G. 3. .n.o d...

s as it bi iz ti

I?.

FIG. 3. CD23 expression in normal andpathological skin(A) CD23 is expressed at the mRNA level in patho-logical skin as shown by in situ hybridization with aspecific probe for human CD23. (B) Immunohisto-chemistry with anti-CD23 moAb confirms CD23 ex-

pression in pathological skin of a patient with acuteurticaria. (C) Negativity of the healthy skin of thesame patient. Magnification: X60 (B), X240 (A, C).

the results at the protein level, showing stainingmainly on the two first layers of the epidermis(Fig. 3B). Because most of the epidermal cellsare keratinocytes, and because our stainingwas continuous, it is likely that CD23+ popu-

lation is mainly constituted of keratinocytes.Healthy skin from the same subjects was neg-

ative (Fig. 3C). Positive and negative controls

confirmed the specificity of the results (datanot shown).

DISCUSSIONThe finding of strong immunoreactivity for iNOSand its colocalization with TNF-a, IL-6, andCD23 in keratinocytes from patients with urti-caria, may be relevant to the pathogenesis of thisdisease.

Activation of dermal resident mast cellsthrough high-affinity receptor for IgE (FcsRI) iswidely implicated in the pathogenesis of urticaria(1). Indeed, many allergens can form immunecomplexes with IgE in acute urticaria-as infec-tious agents (bacteria, fungus, parasites), foodadditives, and antibiotics. In chronic forms, thecause cannot be determined in most cases and itis considered idiopathic. Recently, the presenceof autoantibodies against the a-chain of FcsRIhave been identified in up to 25% of patientssuffering from chronic urticaria (6). Whateverthe triggering element, the release of vasoactivemediators from activated mast cells, histaminebeing the most important one, is responsible forthe vasodilatation and the dermal edema (7).

Urticaria is actually both an inflammatoryand a vascular disease. Nitric oxide is known tohave both properties, and among cutaneouscells, keratinocytes seem to be the main target foriNOS induction (12). In this study, we tested thein vivo expression of the NO-synthase pathwayin skin during acute urticaria. RT-PCR clearlyshowed iNOS mRNA expression in lesional skinfrom 10 out of 11 patients. Furthermore, immu-nostaining with anti-iNOS antibody was positivein all skin biopsies for which RT-PCR was alreadypositive. It further confirmed that iNOS wasmainly expressed in keratinocytes, but not inendothelial cells. INOS mRNA was absent in allhealthy skin biopsies except one, which pre-sented a weak positivity. We think that the prox-imity of the two biopsies in that case (healthyand lesional skin) might explain this paradoxicalpositivity.

Proinflammatory cytokine (TNF-a and IL-6)synthesis in keratinocytes is partly under thecontrol of the NO pathway (12). We thus inves-tigated whether iNOS+ keratinocytes could syn-thesize these cytokines. In almost all pathologicalskin of iNOS+ patients, TNF-a and IL-6 mRNAswere present and also localized in basal kerati-nocytes.

It is well established that in many different

691

692 Molecular Medicine, Volume 3, Number 10, October 1997

His

Allergen

_ g b High afflnir1eeptor

FIG. 4. Proposedscheme of intercellularinteractions in the skinduring acute urticariaIL-4 is synthesized and re-leased from dermal mastcells and induces expressionof CD23 (FcsRII) at the

tamine surface of keratinocytes.IgE/allergen immune com-plexes can trigger FcsRI on

qr IgE mast cells, leading to the(FceRA) release of histamine, and

CD23 on keratinocytes,leading to the release ofproinflammatory cytokines(TNF-a, IL-6). This processtakes place in part becauseof nitric oxide metabolism.Along with histamine andother vasoactive mediators,NO can also contribute to-ward the vasodilatation ofdermal microvasculature(+, stimulatory signals).

cells a combination of bacterial lipopolysaccha-ride and cytokines (IFN-,y and/or TNF-a and/orIL-1,(3) can induce iNOS expression. In a previousstudy, we demonstrated that ligation of the low-affinity receptor for IgE (FcsRII/CD23) at thesurface of keratinocytes was also able to inducethe iNOS pathway and subsequently, the releaseof proinflammatory cytokines from these cells(12). This antigen is induced at the surface ofkeratinocytes upon incubation with IL-4 (12).IL-4 appears then to be a key cytokine, as itpromotes the switch for IgE gene rearrangementin B cells (20) and induces CD23 in human ke-ratinocytes. Activated mast cells also release pre-

formed and newly synthesized IL-4 when stim-ulated (20). Coexpression of iNOS, TNF-a, IL-6,and CD23 in basal keratinocytes during urticariahas led us to propose that IL-4 released afterdermal mast cell activation is responsible for theinduction of the CD23 antigen at the surface ofvery close basal keratinocytes. Ligation of CD23by IgE/allergen immune complexes may thenpromote iNOS expression and the production ofvarious cytokines that could act on different skincell populations (Fig. 4). Further studies shouldbe designed to investigate the expression of iNOSin cases of chronic urticaria due to autoantibod-ies directed against the a-chain of the FceRI. Upuntil now, FceRI activation by itself has not beenshown to induce iNOS expression.

The physiopathological importance of iNOSexpression and its role in inflammatory diseasesis not limited to keratinocytes. Indeed, inductionof the NO pathway contributes to other acute or

chronic inflammations. Enhanced production ofNO has been demonstrated in patients withasthma (28), ulcerative colitis (29), and arthritis(30). More recently, evidence of iNOS and TNF-aexpression in dilated cardiomyopathy has beenprovided (31). Furthermore, treatment with in-hibitors of NO synthase reduces the degree ofinflammation and tissue damage in animal mod-els of acute inflammation (32).

The study presented here provides the firstevidence of the induction of iNOS in keratino-cytes during urticaria, and it further confirms theimportance of this enzyme in inflammatory sit-uations. Corticosteroids are used as treatment forsevere acute urticarias (33), and these com-

pounds inhibit both iNOS and CD23 expression(12). Other therapeutic agents, such as retinoids,decrease iNOS expression and inflammatory cy-tokine production in keratinocytes (34). In lightof the present data, the design and use of selec-tive inhibitors of the inducible isoform of thenitric oxide synthase enzyme, delivered eitherthrough a topical or systemic form, could repre-sent an alternative way of managing patientssuffering from severe acute urticaria or resistantchronic forms.

ENDOTHELIUM

..-P Vasodilatation 4- _- _aft

/p

IL-4

II

NOi

Inflammation(IL-6 .4..TNF-a)

P.-A. Becherel et al.: INOS Expression in Urticaria Keratinocytes 693

ACKNOWLEDGMENTSWe thank Dr. Marc Benhamou for careful read-ing of the manuscript and helpful advice. Thisresearch was supported in part by funds from theSociete Francaise de Dermatologie (Fondation deRecherche en Dermatologie Rene Touraine) andthe Association de Recherche contre le Cancer(ARC).

REFERENCES1. Greaves MW. (1995) Chronic urticaria.

N. Engl. J. Med. 332: 1767-1772.2. Natbony S, Philips ME, Elias JM, Godfrey

HP, Kaplan AP. (1983) Histologic studies ofchronic idiopathic urticaria. J. Allergy Clin.Immunol. 71: 177-183.

3. Greaves MW, Kaplan AP. (1988) Urticariaand angioedema. In: Samter M (ed). Immu-nological Diseases, 4th ed., Vol. 2. Little, Brown,Boston, MA, pp. 1187-1204.

4. Hide M, Francis DM, Grattan CEH, Hakimi J,Kochan JP, Greaves MW. (1993) Autoanti-bodies against the high affinity IgE receptoras a cause of histamine release in chronicurticaria. N. Engl. J. Med. 328: 1599-1604.

5. Fiebiger E, Maurer D, Holub H, et al. (1995)Serum IgG autoantibodies directed againstthe a chain of FcsRI: A selective marker andpathogenetic factor for a distinct subset ofchronic urticaria patients? J. Clin. Invest. 96:2606-2612.

6. Niimi N, Francis DM, Kermani F, et al.(1996) Dermal mast cell activation by auto-antibodies against the high affinity IgE re-ceptor in chronic urticaria. J. Invest. Dermatol.106: 1001-1006.

7. Kaplan AP, Horakova Z, Katz SI. (1978) As-sessment of tissue fluid histamine levels inpatients with urticaria. J. Allergy Clin. Immu-nol. 61: 350-354.

8. Moncada S, Higgs EA. (1993) Nitric oxide, areview. N. Engl. J. Med. 329: 2002-2014.

9. Stuehr DJ, Griffith OW. (1992) Mammaliannitric oxide synthases. Adv. Enzymol. 65:287-293.

10. Stamler JS, Singel DJ, Loscalzo J. (1992)Nitric oxide biochemistry. Science 258: 1898-2014.

11. Moncada S, Palmer RMJ, Higgs EA. (1991)Nitric oxide: Physiology, pathophysiologyand pharmacology. Pharmacol. Rev. 43: 109-142.

12. Becherel PA, Mossalayi MD, Ouaaz F, et al.(1994) Involvement of cyclic AMP and nitricoxide in immunoglobulin-dependent activa-tion of FcsRlI/CD23 normal human kerati-nocytes. J. Clin. Invest. 93: 2275-2279.

13. Geller DA, Di Silvio M, Niissler AK, et al.(1993) Nitric oxide synthase expression isinduced in hepatocytes in vivo during he-patic inflammation. J. Surg. Res. 55: 427-435.

14. KolbBachofen V, Fehsel K, Michel G,Ruzicka T. (1994) Epidermal keratinocyteexpression of nitric oxide synthase in skinlesions of psoriasis vulgaris. Lancet 344: 139.

15. Rowe A, Farrel A, Kazmi SH, Bunker CB.(1994) Expression of an inducible nitric ox-ide synthase in dermal microvasculature inpsoriasis. Lancet 344: 1371.

16. Goldsmith PC, Leslie TA, Hayes NA, LevellNJ, Dowd PM, Foreman JC. (1996) Inhibi-tors of nitric oxide synthase in human skin.J. Invest. Dermatol. 106: 113-118.

17. Bos JD, Kapsenberg ML. (1993) The skinimmune system: Progress in cutaneous biol-ogy. Immunol. Today. 14: 75-80.

18. Luger TA, Schwarz T. (1990) TNFa and skin.In: Bos JD (ed). Skin Immune System. CRCPress, New York, pp. 65-78.

19. Becherel PA, LeGoff L, Ktorza S, et al. (1995)Interleukin-10 inhibits IgE-mediated nitricoxide synthase induction and cytokine syn-thesis in normal human keratinocytes. Eur.J. Immunol. 25: 2992-2997.

20. Paul WE. (1991) Interleukin 4: A prototypicimmunoregulatory lymphokine. Blood 77:1859-1870.

21. Arock M, Merle-Beral H, Dugas B, et al.(1993) IL-4 release by human leukemic andactivated normal basophils. J. Immunol. 151:1441-149.

22. Becherel PA, Mossalayi MD, LeGoff L, et al.(1994) Mechanism of anti-inflammatory ac-tion of retinoids on keratinocytes NO-syn-thase activation. Lancet 344: 1570-1571.

23. Mossalayi MD, Arock M, Delespesse G, et al.(1992) Cytokine effects of CD23 are medi-ated by an epitope distinct from the IgEbinding site. EMBO J. 11: 3423-3428.

24. Luidin C, Hofstetter H, Sarfati M, et al. (1987)Cloning and expression of the cDNA codingfor a human lymphocyte IgE receptor. EMBOJ. 6: 109-114.

25. Held H, MacDonald HR, Weissman IL, HessMW, Mueler C. (1990) Genes encoding tu-mor necrosis factor a and granzyme A are

694 Molecular Medicine, Volume 3, Number 10, October 1997

expressed during development of autoim-mune diabetes. Proc. Natl. Acad. Sci. USA 87:2239-2243.

26. Bosseloir A, Hooghe-Peters EL, Heinen E, etal. (1989) Localization of interleukin 6mRNA in human tonsils by in situ hybrid-ization. Eur. J. Immunol. 19: 2379-2381.

27. Green LC, Wagner DA, Glogowski PL, Skip-per J, Wishnock JS, Tannenbaum SR. (1982)Analysis of nitrate and nitrite in biologicalfluids. Anal. Biochem. 126: 131-136.

28. Person MG, Zetterstrom 0, Agrenius V, IhreE, Gustafsonn LE. (1994) Single breath nitricoxide measurements in asthmatic patientsand smokers. Lancet 343: 146-148.

29. Boughton-Smith NK, Evans SM, HawkeyCJ, et al. (1993) Nitric oxide synthase activ-ity in ulcerative colitis and Crohn's disease.Lancet 342: 338-341.

30. Farrel AJ, Blake DR, Palmer RMJ, MoncadaS. (1992) Increased concentrations of nitrite

in synovial fluid and serum sample suggestincreased nitric oxide synthesis in rheumaticdiseases. Ann. Rheum. Dis. 51: 1219-1225.

31. Habib FM, Springall DR, Davies GL, OakleyCM, Yacoub MH, Polak JM. (1996) Tumournecrosis factor alpha and inducible nitric ox-ide synthase in dilated cardiomyopathy. Lan-cet 347: 1151-1155.

32. Moncada S, Higgs EA. (1995) Molecularmechanisms and therapeutic strategies re-lated to nitric oxide. FASEB J. 9: 1319-1330.

33. Monroe EW. (1985) Chronic urticaria: Re-view of drug management. In: ChampionRH, Greaves MW, Kobza Black A, Pye RJ(eds). The Urticarias. Churchill Livingstone,Edinburgh, pp. 205-211.

34. Becherel PA, LeGoff L, Ktorza S, et al. (1996)CD23-mediated nitric oxide synthase path-way induction in human keratinocytes is in-hibited by retinoic acid derivatives. J. Invest.Dermatol. 106: 1182-1186.

Communicated by S. Moncada. Accepted July 23, 1997.