information theory of dna sequencing

33
Information Theory of DNA Sequencing David Tse Dept. of EECS U.C. Berkeley LIDS Student Conference MIT Feb. 2, 2012 Research supported by NSF Center for Science of Information. Guy Bresler Abolfazl Motahari

Upload: sef

Post on 24-Feb-2016

20 views

Category:

Documents


1 download

DESCRIPTION

Information Theory of DNA Sequencing. David Tse Dept. of EECS U.C. Berkeley LIDS Student Conference MIT Feb. 2, 2012 Research supported by NSF Center for Science of Information. Abolfazl Motahari. Guy Bresler. TexPoint fonts used in EMF: A A A A A A A A A A A A A A A A. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Information Theory of DNA Sequencing

Information Theory of DNA Sequencing

David Tse Dept. of EECSU.C. Berkeley

LIDS Student ConferenceMIT

Feb. 2, 2012

Research supported by NSF Center for Science of Information.

Guy Bresler Abolfazl Motahari

Page 2: Information Theory of DNA Sequencing

DNA sequencing

DNA: the blueprint of life

Problem: to obtain the sequence of nucleotides.

…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…

courtesy: Batzoglou

Page 3: Information Theory of DNA Sequencing

Impetus: Human Genome Project

1990: Start

2001: Draft

2003: Finished3 billion basepairs

courtesy: Batzoglou

Page 4: Information Theory of DNA Sequencing

Sequencing Gets Cheaper and Faster

Cost of one human genome• HGP: $ 3 billion• 2004: $30,000,000• 2008: $100,000• 2010: $10,000• 2011: $4,000 • 2012-13: $1,000• ???: $300

courtesy: Batzoglou

Page 5: Information Theory of DNA Sequencing

But many genomes to sequence

100 million species(e.g. phylogeny)

7 billion individuals (SNP, personal genomics)

1013 cells in a human(e.g. somatic mutations

such as HIV, cancer) courtesy: Batzoglou

Page 6: Information Theory of DNA Sequencing

Whole Genome Shotgun Sequencing

Reads are assembled to reconstruct the original DNA sequence.

Page 7: Information Theory of DNA Sequencing

Sequencing Technologies • HGP era: single technology

(Sanger)

• Current: multiple “next generation” technologies (eg. Illumina, SoLiD, Pac Bio, Ion Torrent, etc.)

• All provide massively parallel sequencing.

• Each technology has different read lengths, noise profiles, etc

Page 8: Information Theory of DNA Sequencing

Assembly Algorithms

• Many proposed algorithms.

• Different algorithms tailored to different technologies.

• Each algorithm deals with the full complexity of the problem while trying to scale well with the massive amount of data.

• Lots of heuristics used in the design.

Page 9: Information Theory of DNA Sequencing

A Basic Question

• What is the minimum number of reads needed to reconstruct with a given reliability?

• A benchmark for comparing different algorithms.

• An algorithm-independent basis for comparing different technologies and designing new ones.

Page 10: Information Theory of DNA Sequencing

Coverage Analysis

• Pioneered by Lander-Waterman

• What is the minimum number of reads to ensure there is no gap between the reads with a desired prob.?

• Only provides a lower bound.

• Can one get a tight lower bound?

Page 11: Information Theory of DNA Sequencing

Communication and Sequencing: An Analogy

Communication:

Sequencing:

Page 12: Information Theory of DNA Sequencing

Communication: Fundamental Limits

Cchannel = channel capacityHsource = sourceentropy rate

Shannon 48

Asymptotically reliable communication at rate R source symbols per channel output symbol if and only if:

R < C channelH source

Given statistical models for source and channel:

Page 13: Information Theory of DNA Sequencing

DNA Sequencing: Fundamental Limits?

S1;S2; : : : ;SG R 1;R 2; : : : ;R N

• Define: sequencing rate R = G/N basepairs per read

• Question: can one define a sequencing capacity C such that:

asymptotically reliable reconstruction is possible if and only if R < C?

Page 14: Information Theory of DNA Sequencing

A Simple Model

• DNA sequence: i.i.d. with distribution p.

• Starting positions of reads are i.i.d. uniform on the DNA sequence.

• Read process is noiseless.

Will extend to more complex source model and noisy read process later.

Page 15: Information Theory of DNA Sequencing

The read channel

• Capacity depends on

– read length: L

– DNA length: G

• Normalized read length:

• Eg. L = 100, G = 3 £ 109 :

read channelAGCTTATAGGTCCGCATTACC AGGTCC

¹L := LlogG

L ") C "

G ") C #

¹L = 4:6

Page 16: Information Theory of DNA Sequencing

Result: Sequencing Capacity

H2(p) = ¡ log4X

i=1p2i

Renyi entropy of order 2

C = 0

C = ¹L

Page 17: Information Theory of DNA Sequencing

Coverage Constraint

TL

Starting positions of reads ~ Poisson(1/R)

E [# of gaps]= N ¢P [T > L]= Ne¡ LR

R = GN

E [# of gaps] ! 0, R < ¹L

G

N reads

Page 18: Information Theory of DNA Sequencing

No-Duplication Constraint

E [# of duplicated pairs]¼N 2 ¢Ã 4X

i=1p2i

! L

L L L L

E [# of duplicated pairs] ! 0, ¹L > 2

H2(p)

= N 2e¡ L H 2(p)

The two possibilities have the same set of length L subsequences.

Page 19: Information Theory of DNA Sequencing

Achievability

coverage constraint

no-duplication constraint

achievable?

Page 20: Information Theory of DNA Sequencing

Greedy Algorithm

Input: the set of N reads of length L

1. Set the initial set of contigs as the reads.

2. Find two contigs with largest overlap and merge them into a new contig.

3. Repeat step 2 until only one contig remains or no more merging can be done.

Algorithm progresses in stages: at stage merge reads at overlap

`= L ¡ 1;L ¡ 2;: : : ;0`

Page 21: Information Theory of DNA Sequencing

Greedy algorithm: the beginning

gap

Most reads have large overlap with neighbors

Expected # of errors in stage L-1:probability two disjoint

reads are equal

Very small since no-duplication constraint is satisfied.

Page 22: Information Theory of DNA Sequencing

Greedy algorithm: stage

probability two disjoint reads appear to overlap

Expected # of errors at stage

This may get larger, but no larger than when¡Ne¡ L =R ¢2

Very small since coverage constraint is satisfied.

`= 0

Page 23: Information Theory of DNA Sequencing

Summary: Two Regimes

coverage-limitedregime

duplication-limitedregime

Page 24: Information Theory of DNA Sequencing

Relation to Earlier Works

• Coverage constraint: Lander-Waterman 88

• No-duplication constraint: Arratia et al 96

• Arratia et al focused on a model where all length L subsequences are given (seq. by hybridization)

• Our result: the two constraints together are necessary and sufficient for shotgun sequencing.

Page 25: Information Theory of DNA Sequencing

Rest of Talk

• Impact of read noise.

• Impact of repeats in DNA sequence

Page 26: Information Theory of DNA Sequencing

Read Noise

Model:

discrete memoryless channel defined by transition probabilities

ACGTCCTATGCGTATGCGTAATGCCACATATTGCTATGCGTAATGCGTTATACTTA

Page 27: Information Theory of DNA Sequencing

Modified Greedy algorithm

YX

This is a hypothesis testing problem!

We observe two strings: X and Y.

Are they noisy versions of the same DNA subsequence?

Or from two different locations?

Y

Do we merge the two reads at overlap ?

(merge)

(do not merge)

Page 28: Information Theory of DNA Sequencing

Impact on Sequencing Rate

MAP rule: declare H0 if

• Hypothesis test:

H0: noisy versions of the same DNA subsequence (merge)

H1: from disjoint DNA subsequences (do not merge)

Y

X Y

Two types of error:

• missed detection (new type of error)

• false positive (same as before)

Page 29: Information Theory of DNA Sequencing

coverage constraint

no-duplication constraint

obtained by optimizing MAP threshold

Impact on Sequencing Rate

Page 30: Information Theory of DNA Sequencing

More Complex DNA Statistics

• i.i.d. is not a very good model for the DNA sequence.

• More generally, we may want to model it as a correlated random process.

• For short-scale correlation, H2(p) can be replaced by the Renyi entropy rate of the process.

• But for higher mammals, DNA contains long repeats, repeat length comparable or longer than reads.

• This is handled by paired-end reads in practice.

H2 = lim`! 1

¡ 1` logP (x` = y`)

Page 31: Information Theory of DNA Sequencing

A Simple Model for Repeats

K

Model: M repeats of length K placed uniformly into DNA sequence

If repeat length K>> read length L, how to reconstruct sequence?

Use paired-end reads:

J reads come in pairs with known separationThese reads can bridge the repeats

Page 32: Information Theory of DNA Sequencing

coverage constraint

no-duplication constraint

Impact on Sequencing Rate

coverage of repeatsconstraint

If J > 2d + Kthen capacityis the same aswithout repeats

constant indep of K

K= repeat lengthJ = paired-end

separation

Page 33: Information Theory of DNA Sequencing

Conclusion

• DNA sequencing is an important problem.

• Many new technologies and new applications.

• An analogy between sequencing and communication is drawn.

• A notion of sequencing capacity is formulated.

• A principled design framework?