inhibition of papillomavirus protein function in cervical cancer cells by intrabody targeting

doi:10.1016/j.jmb.2005.10.077 J. Mol. Biol. (2006) 355, 360–378

Inhibition of Papillomavirus Protein Function in CervicalCancer Cells by Intrabody Targeting

Heather Griffin1,2, Robert Elston1, Deborah Jackson1, Keith Ansell3

Michael Coleman1, Greg Winter2 and John Doorbar1*

1Division of Virology, NationalInstitute for Medical ResearchLondon NW7 1AA, UK

2MRC Centre, Hills RoadCambridge CB2 2GH, UK

3MRC Technology, BurtonholeLane, London NW7 1ADUK

0022-2836/$ - see front matter Crown C

Abbreviations used: HPV, humanhuman immunodeficiency virus; ELimmunosorbent assay; FACS, fluoresorting; aa, amino acid residue(s); Gtransferase.

E-mail address of the [email protected]

Papillomaviruses (HPVs) are a major cause of human disease, and areresponsible for approximately half a million cases of cervical cancer eachyear. HPVs also cause genital warts, and are the most common sexuallytransmitted disease in many countries. Despite their importance, there arecurrently no specific antivirals that are active against HPVs.

Papillomavirus protein function is mediated largely by protein–proteininteractions, which are difficult to inhibit using conventional approaches.To circumvent these problems, we have prepared an scFv library, and haveused this to isolate high-affinity binding molecules that may stearicallyhinder the association of E6 with p53 and prevent E6-mediated p53degradation in cervical cancer cells. One of the molecules isolated from thelibrary (GTE6-1), had an affinity for 16E6 of 60 nM, and bound within thefirst zinc finger of the protein. GTE6-1 was able to associate with non-denatured E6 following expression in mammalian cells and could inhibitE6-mediated p53 degradation in in vitro assays.

E6-mediated p53 degradation is essential for the continuous growth ofcervical cancer cells caused by HPV16. To examine the potential of GTE6-1as an inhibitor of E6 function in such cells, the molecule was expressed inscFv, diabody and triabody formats in a number of cell lines that are drivento proliferate by the HPV16 oncogenes E6 and E7, including the cervicalcancer cell line SiHa. In contrast to small E6-binding peptides containingthe ELLG E6-binding motif, GTE6-1 expression lead to changes in nuclearstructure, the appearance of apoptosis markers, and an elevation in thelevels of p53. No effects were seen with a control scFv molecule, or whenGTE6-1 was expressed in cells that are driven to proliferate by simian virus40 (SV40) T-antigen. Given the accessibility of HPV-associated lesions totopical therapy, our results suggest that large interfering molecules such asintrabodies may be useful inhibitors of viral protein–protein interactionsand be particularly appropriate for the treatment of HPV-associateddisease.

Crown Copyright q 2005 Published by Elsevier Ltd. All rights reserved.

Keywords: intrabodies; papillomavirus; cervical cancer; E6; apoptosis
*Corresponding author
Introduction

The use of intracellular antibodies (intrabodies)to inhibit protein function holds promise for thetreatment of human disease.1 Success of the

opyright q 2005 Published b

papillomavirus; HIV,ISA, enzyme-linkedscent activated cellST, glutathione-S-

ing author:

approach depends on the ability to target andinhibit proteins involved in the development andmaintenance of disease. Such targets includemutant versions of cellular proteins, such as p53or RAS,2,3 or proteins that are incorrectly folded,such as those that are found in neurodegenerativediseases.4 The difficulties associated with thedevelopment of intrabody-based therapies aresimilar to those that hamper the development ofprotein inhibitors in general, and reflect problems ingenerating reagents that are effective and specific.In many cases, the disease-associated proteinsresemble their normal cellular counterpart at all

y Elsevier Ltd. All rights reserved.

Papillomavirus Inhibition Using Intrabodies 361

but a few sites, making the discovery of moleculesthat can specifically target disease-associated formspotentially difficult.

By contrast, the use of intrabodies to combatintracellular parasites such as viruses appears morestraightforward. Viruses express proteins that aredistinct from those expressed by the cell, and whichare directly involved in causing disease. Theapplication of intrabody-technology to humanimmunodeficiency virus (HIV) infected cells hasbeen shown to block integration of the HIV genomeinto the host chromosome, to block reverse trans-cription, and to inhibit the assembly of viralenvelopes.5–9 At a practical level, however, the useof intrabodies is confounded by the need to ensureeffective delivery.1 For systemic infections, this maybe achieved more efficiently using small moleculeinhibitors which have a long half-life in the bloodstream, and which can be efficiently taken up by theinfected cell.

For viruses that cause only local infections, theintrabody approach may be more appropriate.Low-risk human papillomaviruses (HPV) causegenital warts, which are a major sexually trans-mitted disease in many countries. Despite consider-able effort, there are no specific antivirals availablefor the treatment of these lesions, which are difficultto manage, and which often recur followingsurgery.10 The high-risk papillomavirus types suchas HPV16 cause flat warts rather than papillomas,but these can progress to high-grade neoplasia andcancer.11 Approximately half a million cases ofcervical cancer occur each year, and nearly all ofthese are caused by HPV.12 Despite a clear andpressing need, there are as yet, no inhibitors ofpapillomavirus infection in routine therapy.

One reason for the difficulty in targeting HPVinfection lies in the fact that most papillomavirusproteins exert their effect by binding to cellularproteins rather than as a result of their intrinsicenzymatic activity.12 Thus E7, which is the majortransforming protein of the virus, binds to pRb anddisplaces the E2F transcription factor, so facilitatingS-phase entry. E7 also associates with p21, HDACsand certain cyclins, and alters their function as aresult.13–16 Similarly, the E6 protein inhibitsapoptosis by associating with p53 and the ubiquitinligase E6AP, which prevents apoptotic cell death asa result of E7-mediated cell cycle progression.17,18

E6 also plays a role in immune evasion by affecting

Figure 1. Library construction and the selection of scFv moltemplates for the preparation of the VH, Vk and Vl fragmendigestion, the Vk and Vl fragments were cloned into the phlibraries shown in (c). The VH fragments (b) were subsequentllibrary (d). Phage expressing scFv molecules were rescued byin Materials and Methods. Isolation of molecules with affinityfollowing three rounds of selection against immobilized proteiC12 scFv DNA fragments were transferred from pHEN (f) to tand C12 were cloned with or without Flag-tag sequences (taggbetween the VH and Vl fragments (shown in (h)), constructsscFv (16), a diabody (5) or a triabody (K1) (h). A comparable sto express E6-binding peptides (and jumbled peptide control

cytokine signalling through Tyk2,19 and by inter-fering with the expression of E-cadherin on the cellsurface.20 Several studies have shown that the lossof E6 from cervical cancer cells leads to apoptoticcell death.21–30 but few have aimed to developmolecules that can act as functional inhibitors of theE6 protein.31–33 The need to disrupt protein–proteininteractions within the cell makes HPV an idealtarget for intrabody-based therapy. In contrast tosmall binding molecules, which are often poorinhibitors of protein–protein interactions, there aremany examples where antibodies and antibodyfragments have been shown to serve as competitiveinhibitors of protein–protein interactions.34–36 Withthis in mind, we generated scFv-based intrabodies(scFv, diabody and triabody) that target the E6protein of HPV16, and have compared theireffectiveness with a series of synthetic peptidesthat have previously been shown to inhibit theassociation of E6 with E6AP in vitro.37,38 One of theselected clones (GTE6-1) bound E6 with an affinityof 60 nM, and was an effective inhibitor ofE6-mediated p53 degradation when expressed incervical cancer cells. Given that papillomavirus-associated lesions are amenable to topical treat-ment, our studies suggest that HPV infectionsprovide a medically important model in which toevaluate intrabody-based therapies.

Results

Library construction and the isolation of mol-ecules that bind to the E6 protein of HPV16

In order to identify molecules that can associatewith the E6 protein of HPV16, two libraries werescreened. The first was a synthetic single chain fv(scFv) phagemid library prepared from the Vk, Vland VH genes present in fdDOG-2loxVklib,fdDOG-2loxVllib and pUC19-2loxVHlib.39 A two-stage cloning procedure was used in which the Vkand Vl genes were first ligated into pHen2(Figure 1) to create the light chain libraries,pHen2-Vklib (1.8!107 clones) and pHen2-Vllib(3.8!107 clones). One-hundred colonies from eachlibrary were analysed by PCR, and all were found tocontain the light chain insert. The VH genes weresubsequently cloned into these libraries by repeatedelectroporation to produce a final library (Griffin

ecules that bind E6. Plasmids shown in (a) were used asts shown in (b) using primers described in the text. Afteragemid vector pHEN2 in order to create the light chainy cloned into these light chain libraries to create the Griffingrowth in the presence of helper phage KM13 as described

for either 16E6 (GTE6-1) or pre-Ta (C12) was carried outns purified from E. coli (e). After selection, the GTE6-1 andhe mammalian expression vector pTracer (g). Both GTE6-1ed clones shown in (g)). By varying the length of the linkerwere prepared that can direct expression of GTE6-1 as a

eries of expression plasmids were prepared that were able) with or without Flag tags (i).

Figure 1. (legend opposite)

362 Papillomavirus Inhibition Using Intrabodies


Library) of 2!109 individual clones (Figure 1). PCRscreening showed that 88% of the pHEN2VH-Vkliband 95% of the pHEN2VH-Vllib contained bothVH and VL genes.

In addition to the scFv library described above(Griffin Library), a two-hybrid library was preparedbased on E6-binding peptides containing the motifELLG (E6-16mer library38). E6 associates withseveral of its cellular targets through a-helicalmotifs that contain the amino acid sequenceELLG, and can also interact with synthetic peptidesthat contain this motif.37 The E6-specific library wasbased on a peptide (ERWWEGVFYELLGLTE),which inhibits the association of E6 with E6-APmore efficiently than the ELLG peptide presentin E6AP.37,38 The 16mer library had a diversity of7!106 individual clones and encoded peptidescontaining an average of four amino acid residuechanges when compared to the sequence of theparental peptide P-1.38

To isolate scFv molecules that were able toassociate with the E6 protein of HPV16, selectionswere carried out on immunotubes coated witheither MBP or GST-16 E6. By using E6 proteinslinked to two different fusion partners, and byalternating these fusion proteins during selection, itwas possible to favour the selection of clonesencoding scFv molecules that are specific for E6over against those that associate with MBP or GST(Figure 1). This approach has been used previouslyto isolate high affinity Fabs against the E1Ê4protein of HPV16.40 After three rounds of selection,95% of the selected clones bound E6 in enzyme-linked immunosorbent assay (ELISA). The poly-clonal phage population from the third round ofselection was subsequently used to infect Escherichiacoli HB2151, and monoclonal scFv preparationswere prepared following cloning into 96 well plates.The E6-specific scFv clones (GTE6-1 to GTE6-10),which gave the strongest signal in ELISA,were selected for further analysis. The E6-specificpeptide library was similarly screened, and 40peptides were identified that were able to associatewith E6 better than the parental peptide P-1.38 Thebest of these (V-1 (EGWWEGVFDELLGMAG)) wasexamined alongside the anti E6 scFv GTE6-1 for itsability to associate with E6.

GTE6-1 detects 16E6 by Western blotting andby in situ immunofluorescence following E6expression in epithelial cells

E6-specific scFv molecules were expressed inE. coli and purified by virtue of their hexa-histidinetag as described.40 When compared with other scFvmolecules selected during the library screen, one ofthe scFv clones (GTE6-1) was expressed particularlywell, and could readily be obtained at concen-trations of 500 mg/ml following purification bynickel chelate chromatography. To assess thespecificity of GTE6-1, the E6 proteins of six HPVtypes were expressed as GST fusion proteins andseparated by SDS/gel electrophoresis (Figure 2(a)).

Of the E6 proteins tested, GTE6-1 bound only to theE6 protein of HPV16, and in Western blottingexperiments, was more efficient in detecting 16E6than C1P5 (Figure 2(a)), which was raised to the E6protein of HPV18.41 Following immunofluores-cence staining of COS-7 cells transfected with aCMV-16E6 expression vector (pcDNA.16E6sd),GTE6-1 identified 16E6 as a predominantly nuclearprotein, although some cytoplasmic staining wasalso apparent (Figure 2(b)). The cytoplasmic patternwas consistent with the localization of a fraction ofthe E6 protein to the Golgi as reported. An identicalstaining pattern was obtained when flag-tagged E6was expressed from pcDNA.16E6sdFLAG anddetected using antibody M2 (which is specific forthe Flag peptide), and when the E6 protein wasdetected using C1P5 (Figure 2(b)). No staining wasapparent on non-transfected cells or on cellstransfected with a 16E1Ê4 expression vector(MV11.16E1Ê4).42 Our results show that scFvGTE6-1 binds specifically to the E6 protein ofHPV16, and suggest that association can occurirrespective of whether the protein is partiallydenatured (Western blotting), or is present in itsnative conformation (immunostaining in situ).

GTE6-1 associates with sequences in theN-terminal half of 16E6 with high affinity,and inhibits the degradation of p53

To identify the binding site of GTE6-1 on E6, threepGEX constructs were used. These expressed eitherthe 158 amino acid full length E6 protein(pGEX.16E6), or truncated versions representingeither the first 16E6 zinc finger (pGEX.16E6zf1,amino acid residues 1–83) or the portion of E6 presentin 16E6*I (pGEX.16E6*I, amino acid residues 1–43)(Figure 3(a)). In Western blotting experiments,GTE6-1 associated with full length E6, and 16E6zf1,but did not recognize 16E6*I (Figure 3(b)), suggestingthat the recognition site for GTE6-1 lies betweenamino acid residues 43 and 83. The same E6fragments (16E6, 16E6zf1 and E6*I) were alsoexpressed as Gal4 BD fusions in yeast in order toidentify the binding site for V-1. In this case, anassociation was seen with all three constructs, inagreement with reports that E6*I can associate withE6AP.43,44 When added to degradation assays at aconcentration of 1 mM, peptide V-1 inhibited thedegradation of p53. Inhibition was less effectivewhen the peptide was added at lower concentrations(!0.1 mM),38 suggesting that while V-1 can bind E6specifically, it is unlikely to bind strongly. A similarconcentration dependence has also been reported forthe related peptide, P-1.37

Following expression in E. coli, the GTE6-1 scFvwas obtained at a concentration of 20 mM (500 mg/ml,(scFv molecular mass 26,500)). At concentrationsgreater than this, the scFv tended to aggregate afterpurification, making it difficult to carry out directcomparisons with V-1 and P-1, which were soluble atconcentrations of 1 mM and higher.38 In order toexamine the inhibitory activity of GTE6-1 therefore,

Figure 2. GTE6-1 recognizes 16E6 by Western blotting and immunofluorescence. (a) GST-E6 fusion proteins from sixdifferent HPV types are shown in the Coomassie blue-stained gel at the top of the Figure. The GST-E6 monomer anddimer bands are arrowed, along with the contaminating heat-shock protein dnaK. Molecular mass markers are shownon the right of the Figure. The two lower panels show Western blots of the GST-E6 fusion proteins following detectionusing GTE6-1 or C1P5. GTE6-1 specifically detects the E6 protein of HPV16, but does not recognize the E6 protein ofrelated HPV types (central panel). Monoclonal C1P5 binds most strongly to the E6 protein of HPV18 (lower panel). (b) Byimmunofluorescence, GTE6-1 detects 16E6 (green) in the nuclei of COS-7 cells following transient transfection with a16E6 expression vector (upper panels). A similar staining pattern is seen following the expression of Flag-tagged 16E6(green) and detection with an anti-Flag antibody (lower panel). Nuclear 16E6 (green) was also seen following staining oftransfected cells with C1P5 (bottom panel). DAPI staining was carried out to show the cell nuclei, and is shown on theright of the Figure.


degradation assays were set up in the presence of 0.2,2 and 20 mM GST.16E6 (E6 molecular mass 19,187),with GTE6-1 being added to the reaction mix at aconcentration of 10 mM (Figure 4). Even at such lowmolar concentrations, E6-mediated degradation ofp53 was inhibited by GTE6-1, with the effect beingmost evident when GTE6-1 was present in molarexcess (Figure 4). No inhibition of E6-mediated p53degradation was apparent when an irrelevant scFvmolecule selected from the same library was used(i.e. scFv C12, see Figures 1 and 4). The ability ofGTE6-1 to inhibit p53 degradation at low molar

concentrations (10 mM) is in contrast to the resultsobtained with peptides V-1 and P-1, which had littleeffect on p53 degradation at concentrations lowerthan 100 mM.

GTE6-1 binds 16E6 with greater affinity thanELLG-containing peptides

To compare ability of the different E6-bindingmolecules to associate with E6, absolute affinitieswere established by Biacore analysis (Amersham/Pharmacia). To do this, E6-MBP fusion protein was

Figure 3. GTE6-1 binds 16E6within the first zinc finger butdoes not recognize E6*. (a) E6fragments corresponding to16E6*, 16E6 zinc finger 1 (ZF1),16E6 zinc finger 2 (ZF2) or full-length 16E6 were expressed asGST fusion proteins in E. coli. Theposition of the two zinc fingers,and the region of E6 that constitu-tes 16E6* are indicated using boldlines. (b) Full length 16E6, 16E6ZF1and 16E6* were purified fromE. coli and visualized followinggel electrophoresis and stainingwith Coomassie blue (left panel).Full-length 16E6 and 16E6ZF1were detected by GTE6-1following Western blotting,whereas 16E6* was not (rightpanel). 16E6ZF2 and 11E6 werealso present on the Western blot,but were not detected by GTE6-1.


coupled to the surface of a sensor chip by aminecoupling, and purified GTE6-1 was passed over it(at concentrations ranging between 200 to 500 nM;see Figure 5(a)). The affinity of binding wasdetermined from a simultaneous fit of associationand dissociation kinetics (Biacore analysis package;Langmuir 1:1 model, Biaevaluation v. 3.0.1). GTE6-1had an affinity for E6 in the order of 6.4!10K8,which is typical of the affinity of other antibodiesisolated from the Griffin library, and is compar-able to the affinity of antibodies prepared bystandard hybridoma technology. Although theELLG-containing peptides gave a strong signalin the yeast two-hybrid system,38 their affinityas free peptides was not measurable under theconditions used to establish the affinity of GTE6-1(Figure 5(b)). The V-1 Biacore trace was similar tothat obtained with a negative-control (jumbled)peptide that is not able to associate with E6(Figure 5(b)), suggesting a sub-micromolar affinity.Such affinity differences may explain the differentabilities of V-1 and GTE6-1 to inhibit p53degradation in in vitro assays.

Intracellular expression of molecules basedon GTE6-1 in cells stimulated to proliferateby E6 and E7

The E6 and E7 proteins of HPV16 can immorta-lize primary human keratinocytes,45–47 and theircontinued expression is required for the growth ofHPV16-associated cervical cancer cells.21–26,31

As intrabody expression can inhibit protein func-tion,3,48–50 we sought to examine whether GTE6-1could be used to inhibit E6 function in cells. Toinvestigate this, the GTE6-1 VH and VL genefragments were DNA sequenced (Figure 5(c)) in

order to facilitate their cloning into pTracer-CMV2(Invitrogen, USA; see Figure 1). pTracer-CMV2directs expression of inserted genes from a CMVpromoter, and encodes a super-GFP marker(expressed from an EF-1a promoter) to allow theidentification of transfected cells (Figure 1). Threetypes of construct were made which differed in thelength of the linker between the VH and VL genefragments, so as to allow the expression of GTE6-1as a scFv molecule comparable to that expressed inE. coli (above), or as a diabody51 or triabody.52 Thesubsequent clones were termed pGTE6-scFv,pGTE6-dia and pGTE6-tria (which encodeuntagged antibody molecules), and pGTE6-scFv/flag, pGTE6-dia/flag and pGTE6-tria/flag (whichencoded antibody molecules tagged with a flagepitope tag at their C terminus; Figure 1). In eachcase, the intracellular expression of GTE6 wasconfirmed by immunostaining (using anti Flagantibody M2), following the transfection of epi-thelial cells expressing either the HPV16 E6 and E7proteins (132145 and SiHa53,54), or simian virus 40(SV40) T antigen (SV40-T and COS-7). Intracellularexpression of the scFv molecules correlated withexpression of the super GFP marker in all the celllines tested including SiHa and 1321 (results for1321 shown in Figure 6(a)). As expected, theparental vector (pTracer-CMV2), gave rise to GFP-positive cells that did not stain with antibodies tothe M2 epitope (Figure 6(a)). Western blottingconfirmed that the different antibody molecules(scFv, diabody and triabody) were expressed atsimilar levels (data not shown).

Although expression was apparent in all cases,the triabody appeared to have a predominantlycytoplasmic distribution (see Figure 6(a)), whereasa diffuse distribution throughout the cell was

Figure 4. GTE6-1 inhibits the ability of 16E6 to mediatep53 degradation in vitro. (a) p53 expressed in an in vitrotranscription/translation system in the absence ofGST16E6 and GTE6-1 is shown in the left-most track(cont). In the presence of GST16E6 (at 0.2 mM, 2 mM and20 mM concentrations), the level of p53 was reduced as aresult of E6-mediated degradation (tracks marked K).Degradation was inhibited when the GTE6-1 scFv (tracksmarked C) was added to the reaction mixture. Theamount of p53 remaining following the addition of GTE6-1 and/or GST16E6 is shown beneath each track as apercentage of the total amount of p53 that is produced intheir absence. (b) The ability of GTE6-1 to inhibit E6-mediated p53 degradation (right panel) was comparedwith the C12 scFv (left panel), which does not associatewith E6. The C12 scFv had no significant effect on the E6-mediated degradation of p53. The relative level of p53remaining following the addition of either C12 or GTE6-1is indicated beneath the tracks. (c) The data obtained inreplicate experiments is illustrated graphically. Theamount of p53 prepared in an in vitro transcription/translation system in the absence of GST-E6 is shown as100%, whereas in the presence of 2 mM GST-E6, p53 wasundetectable (0%; left-most columns). The relative level ofp53 remaining when degradation assays were carried outin the presence of the GTE6-1 or C12 scFv (20 mM) isshown in the right-most columns (data from five replicateexperiments). The GTE6-1 scFv was found to consistentlyinhibit E6-mediated p53 degradation.


apparent when staining was carried out on cellsexpressing GTE6-1 scFv (Figure 6(a)). This patternwas apparent irrespective of whether the trans-fected cells expressed E6, and may reflect a greaterability of the smaller scFv molecule to access the

nuclear compartment. The diabody had an intra-cellular expression pattern that was intermediatebetween that of the scFv and that of the triabody,with some nuclear staining being apparent(Figure 6(a)). As with the antibody molecules,peptides V-1, P-1 and the ELLG peptide containedwithin E6AP (P-E6AP), were also expressed frompTracer as M2 epitope tag fusions (see Materialsand Methods). A jumbled peptide, which has thesame amino acid composition as V-1, was expressedas a control. In all cases, M2 staining confirmedintracellular expression of the peptides, which weredistributed throughout the nuclear and cytoplasmiccompartments. The results obtained with peptideV-1 in 1321 cells were typical of the results obtainedwith the other peptides, and are shown inFigure 6(a). With the exception of the GTE6-1 scFvand (to a lesser extent) the GTE6-1 diabody, none ofthe E6-binding molecules (peptides V-1, P-1 and theGTE6-1 triabody) appeared to have any obviouseffect on cell morphology when expressed frompTracer. Similarly, no obvious effect was noticedwhen V-1 and P-1 were linked to antennapedia ormembrane transport sequences, to allow theiruptake into cells (data not shown). In both 1321and SiHa cells, however, the expression of theGTE6-1 scFv (from pGTE6scFv or pGTE6scFv/flag)resulted in nuclear changes, with many cells losingadhesion to the plate by 48 h post-transfection (seeFigures 6 and 7). No obvious changes wereapparent when the GTE6-1 scFv was expressed inCOS-7 cells (Figure 6(b)) or SV40-T cells (data notshown).

Intracellular expression of GTE6-1 scFv in SiHacells leads to cellular changes associated withapoptotic cell death and to elevation in p53levels

Having established that the GTE6-1 scFv can beexpressed in 1321 and SiHa cells, and that thesecells appear to undergo changes as a result, we nextexamined the mechanism by which the GTE6-1scFv achieves its effect. As our analysis of constructsexpressing ELLG-based peptides (V-1 and P-1), andthe GTE6-1 triabody did not reveal any reproduci-ble effects, we decided to focus our efforts on thescFv. To determine whether the expression of scFvintrabodies may in its self be detrimental, anadditional plasmid (pC12-scFv; see Figure 1) wasconstructed for use as a control alongside pTracer.pC12-scFv expresses an scFv isolated from theGriffin library (C12) with affinity for preTa (seeFigure 1). The preTa antigen is specific to T cellprogenitors, and is not expressed in epithelialcells.55 pGTE6-scFv, pC12-scFv, and the parentalplasmid pTracer, were transfected into SiHa(HPV16 Cve) and C33a (HPV16 Kve) cells, priorto harvesting at 24, 48 and 72 h post-transfection.ScFv expression was confirmed using antibodies tothe M2 tag, and was found to correlate with theexpression of GFP, as shown above (see Figure 6).SiHa cells transfected with pGTE6-scFv contained

Figure 5. Biacore measurements show GTE6-1 to bind 16E6 more efficiently than the E6-binding peptide V-1. (a)Overlay of binding curves (sensograms) obtained after passing GTE6-1 over a Biacore chip coated with MBP-E6 fusionprotein as described in the text. GTE6-1 concentrations ranged from 200 nm (lowest curve) to 500 nm (upper curve)through four intermediate dilutions. The extent of binding is indicated in resonance units on the X-axis, against time inseconds on the Y-axis. Purified GTE6-1 was injected at 0 s and washing initiated at 150 s. The affinity of GTE6-1 wascalculated as 60 nM by analysis of the association and dissociation curves using BIAevaluation software (PharmaciaUK). (b) Binding curves carried out using the E6-binding peptide V-1, or the jumbled peptide described in the text. Bothpeptides were injected at time 0, at a concentration of 1 mM. Although V-1 bound 16E6 in a two-hybrid screen, its affinitywas not measurably greater than that of the jumbled peptide. (c) DNA sequence analysis revealed GTE6-1 to contain theVH-VH1 1–3 heavy chain framework and the VL-VL1 13-7 1c light chain framework domain. The amino acid sequencesof the CDR1, 2 and 3 loops that make up the E6 binding region show no obvious similarity to the E6 binding peptidesobtained during two-hybrid analysis.


a greater number of pyknotic nuclei than cellstransfected with the control plasmids irrespective ofthe time point examined (Figure 7). By 48 h post-transfection, over 60% of the SiHa cells containing

pGTE6-scFv showed evidence of pyknotic nuclei(Figure 7). A similar but less pronounced effect wasalso seen following transfection with pGTE6-dia(Figure 7). As suggested from previous studies,56–60

Figure 6. Intracellular locali-zation of GTE6-1 as scFv, diabodyand triabody following expressionin epithelial cells. (a) GTE6-1 wasexpressed as either an scFv, adiabody or a triabody in 1321cells, which are driven to prolifer-ate by E6 and E7. Intrabodyexpression is shown in red, withthe GFP marker expressed fromthe same plasmid shown in green.Transfection of the parental plas-mid pTracer lead to expression ofthe GFP marker alone. Peptide V-1,which binds 16E6 with low affinity,is shown at the bottom of theFigure (central panel), with theGFP marker shown on the right.The images are representative ofthe staining patterns seen in cellsexpressing the various E6-bindingmolecules. Merged images stainedwith DAPI are shown at the left ofthe Figure. (b) Expression of GTE6-1 scFv and triabody in COS-7 cells.Intrabody expression is shown inred (centre panels), with the GFPmarker expressed from the sameplasmid shown in green. The scFvand triabody were detected in thenucleus and cytoplasm. Transfec-tion with the parental plasmidpTracer, lead to expression of theGFP marker alone. Merged imagesincluding DAPI (nuclear counter-stain/blue) are shown at the left ofthe Figure.



nearly all pyknotic cells stained positive by TUNEL(91/99 cells counted), with most TUNEL-positivecells having pyknotic nuclei (89/96 cells counted).The close correlation between the two methods isparticularly apparent following treatment of SiHacells treated with 1 mM staurosporine (Figure 7(a)).As both detection methods identify cells in the latestages of apoptosis, the detection of cells withpyknotic nuclei was considered the best approachfor our initial analysis. In contrast to cells expres-sing GTE6-1 (as described above), less than 10% ofSiHa cells expressing the C12-scFv had pyknoticnuclei at 48 h (Figure 7), a figure similar to that seenwith both plasmids in C33a cells. Amongst the cellsthat were not expressing GFP, between 6% and 8%had pyknotic nuclei at 48 h post-transfection(Figure 7). When taken together, these resultssuggest that the intracellular expression of GTE6-1scFv may lead to the induction of apoptosis in SiHabut not C33a cells, as would be expected if GTE6-1affected E6 function within the cell. A broadlysimilar effect was observed when the experimentswere carried out using 1321 (HPV Cve) and SV40-Tcells (HPV Kve) cells (data not shown).

To provide support for the hypothesis thatGTE6-1 was able to stimulate an apoptotic responsein SiHa cells, staining was carried out using

Figure 7. GTE6-1 expression correlates with theappearance of pyknotic nuclei specifically in SiHa cells.(a) Cells showing pyknotic nuclei as revealed by DAPIstaining (left) were also found to stain positive by TUNEL(green; image shown on the right), indicating that the twodetection methods are broadly equivalent. The field ofview contains 24 cells, of which over half contain pyknoticnuclei. Two examples of cells with pyknotic nuclei arearrowed in the DAPI image. (b) SiHa cells expressing theGTE6-1 scFv typically showed evidence of pyknoticnuclei 48 h post-transfection. Transfected cells wereidentified by virtue of their GFP surrogate marker (rightpanels), with the DAPI nuclear counterstain being shownon the left. Cells containing pyknotic nuclei wereapparent following transfection with the GTE6-1 scFvand with the GTE6-1 diabody. Pyknotic nuclei were notapparent following the transfection of SiHa cells with thecontrol scFv, C12. The images shown represent typicalstaining patterns following transfection with the differentexpression plasmids. (c) In order to examine the extent ofGTE6-1-mediated effects, the frequency of pyknotic nucleiin cells expressing GTE6-1 was compared with thefrequency amongst the untransfected cells. In eachgraph, the percentage of cells with pyknotic nuclei isindicated on the X-axis, with the various time points (24,48 and 72 h) being shown on the Y-axis. The proportion ofcells with pyknotic nuclei in untransfected SiHa and C33acells (white columns) was typically around 5%. Transfec-tion of scFv-expressing plasmids (C12/GTE6-1 (greycolumns)) lead to a slight increase in the number ofpyknotic nuclei in C33a cells (grey columns, lowergraphs). A similar increase was seen following theexpression of C12 in SiHa cells (grey columns, upperrightmost graph). Only when GTE6-1 was expressed inSiHa cells did the number of cells with pyknotic nucleidramatically increase (grey columns, upper leftmostgraph). At 48 h post-transfection, approximately 60% ofthe GFP-expressing cells displayed pyknotic nuclei.


monoclonal M30 (Roche), which detects cells inwhich keratin 18 has been cleaved as a result ofcaspase 3 activation. The M30 epitope is an earlymarker of apoptosis in epithelial cells61,62 andprecedes annexinV reactivity and TUNEL staining.

Figure 8. Expression of GTE6-1 in SiHa cells coincides witcaspase 3 in epithelial cells. (a) SiHa cells expressing the GTEGFP marker (green). Cell nuclei were visualised using DAPI ((red) was primarily restricted to the GFP-positive cells. The cecell expressing GFP contains a pyknotic nucleus. M30 staininbut could be seen in some cells expressing GTE6-1 diabody.present in the population. The merged image is shown on thefollowing transfection with GTE6-1 was compared with the fThe % of M30-positive cells amongst the transfected (grey coluon the X-axis, with time points post-transfection (24 h, 48 h anof pyknotic nuclei (see Figure 7), the frequency of cells expresin SiHa cells expressing C12 (grey columns, upper graphs). Ntransfection of C33a cells (grey lower graphs).

M30 immuno-fluorescence was present in over 90%of the GFP-positive cells following transfection withpGTE6-1, and was apparent before the appearanceof pyknotic nuclei (see arrow at the 24 h time pointin Figure 8(a) and data presented in Figure 8(b)).

h the appearance the M30 epitope, a marker of activated6-1 scFv were identified by the presence of the surrogate

blue) and are shown in the right-most panel. M30 stainingll arrowed has a non-pyknotic nucleus. The non-arrowed

g was not apparent in SiHa cells expressing the C12 scFv,The cells illustrated are typical of the GFP-positive cellsleft. (b) The frequency of cells displaying the M30 epitope

requency of M30 display amongst the untransfected cells.mns) and untransfected cells (white columns) is indicated

d 72 h) being shown on the Y-axis. As with the appearancesing M30 was higher in SiHa cells expressing GTE6-1 thano stimulation of M30 staining was apparent following the


Stimulation of caspase activity was also apparent incells expressing the GTE6-1 diabody (Figure 8(a)),but was not apparent in cells expressing the GTE6-1triabody, in agreement with the pyknotic nucleicounting data (Figure 7(a)). No staining wasapparent in cells expressing C12 scFv at the sametime point (Figure 8(a)). p53 levels were alsoelevated at early time points, and by 48 h post-transfection, over 60% of the GFP-expressing cells

Figure 9. p53 levels are elevated specifically in SiHa cells expcells expressing the GTE6-1 scFv were examined for p53 exprapparent in the majority of GTE6-1 scFv-expressing cells (grappearance of pyknotic nuclei (blue). The images shown are rnot detectable in SiHa cells expressing the C12 scFv, but wasexpressing the GTE6-scFv, GTE6-1 diabody and the GTE6-1 trblotting with tubulin as a loading control. Relative to the levelcells expressing the GTE6-1 diabody and the GTE6- scFv. Thethe lower number of cells expressing the GTE6-1 scFv recoverC12 scFv showed no difference in p53 levels. The scFv, diabodisruption in SDS followed by gel electrophoresis.

were double-positive as predicted from the in vitrodata (Figure 4). The elevation in the levels of p53seen by immunofluorescence (Figure 9(a)) wassubsequently confirmed by Western blotting(Figure 9(b)). Because SiHa cells do not transfectat high efficiency, however (typically between 3%and 7%), we first enriched the transfected cellpopulation by fluorescent activated cell sorting(FACS) on unfixed cells. From a population of

ressing the GTE6-1 scFv and the GTE6-1 diabody. (a) SiHaession at 48 h post-transfection. Detectable p53 (red) waseen), with p53 accumulation coinciding closely with theepresentative of the patterns seen with each scFv. p53 wasapparent in cells expressing the GTE6-1 diabody. (b) Cellsiabody, were enriched by FACS and examined by Westerns of tubulin, the levels of p53 were consistently elevated inlower levels of tubulin in the GTE6-1 scFv sample, reflectsed by FACS. Cells expressing the GTE6-1 triabody and thedy and triabodies all migrate at a similar size following


1!107 cells, approximately 5!105 were obtainedthat expressed the GFP marker and whichalso expressed the transgene (GTE6-1 scFv, diabody,triabody, or the C12 scFv). In the case of thepGTE6-1 scFv, the number of GFP-positive cellsobtained at 48 h post-transfection was typicallylower than that obtained following transfectionwith the other plasmids, which may reflect theincreased induction of cell death in these cells.Tubulin was used as a loading control and theexpressed antibody molecules were detected byvirtue of their myc tag (using monoclonal 9E10).When compared to the tubulin loading control andto cells expressing C12, cells expressing the GTE6-1scFv and the GTE6-1 diabody showed evidence ofan elevation in p53 levels, in agreement with dataobtained by immunofluorescence. Only low levelsof p53 were apparent in cells expressing the GTE6-1triabody and the C12-scFv (Figure 9(b)).

Discussion

In the present study, we have isolated an scFvantibody fragment (GTE6-1) using an in vitroselection approach, which specifically targets theE6 protein of HPV16 and inhibits its capacity tomediate p53 degradation. GTE6-1 binds 16E6within its first zinc finger (amino acid residues43–83), with an affinity comparable to that of in vivo-selected antibodies.39 The interactions betweenHPV16E6 and GTE6-1 isolated in this study werespecific, in that binding to other HPV types such asHPV18, was not observed.

HPV16 is the most frequent cause of cervicalcancer, with continued expression of the E6 proteinbeing essential for cancer cell survival. Downregulation of the HPV early promoter (p97 inHPV16), which drives the expression of E6 andE7, leads to growth inhibition and/or cell deathin cell lines derived from cervical tumours.21,22

This has been shown most dramatically in Helacells, which were derived from a HPV-associatedmalignancy in the 1950s, and which still requireexpression of E6 for their growth in tissue culturealmost 50 years later.22,29

Several studies have suggested that targetingHPV16 oncogenes may be an effective anti-cancertherapy,21,22,26,28,30–32,63,64 as the mechanism of viraltransformation is well established. Few haveattempted to produce functional inhibitors of theE6 protein. The E6 and E7 proteins co-operate instimulating S-phase progression, with the E6protein also providing protection from apoptoticcell death (HPV oncogene function65). Critical forthis function is E6s role in mediating the degra-dation of p53, which would otherwise rise as aresult of unscheduled entry into S-phase. AntisenseRNA strategies or ribozymes directed against thepolycistronic E6/E7 mRNAs produced partialgrowth inhibition of HPV-positive cancer cells dueto the concomitant reduction of both onco-genes.28,64,66 More recently, the use of siRNA was

shown to achieve growth arrest more effectively.26

As E6 and E7 are co-expressed in cancers from abicistronic mRNA, their specific inhibition is farfrom straightforward. Targeting E6 at the mRNAlevel appears to result in growth inhibitionrather than apoptosis, which may reflect changesin pro-apoptotic signals mediated by E7, as well asanti-apoptotic signals mediated by E6.

To inhibit E6 specifically it seems necessary toidentify molecules that specifically target E6 at theprotein level. Peptide aptamers have been used toeliminate HPV-positive cancer cells31 althoughwhether the peptides will work when removedfrom their scaffold has not been reported. OurELLG-containing peptides were found to be in-effective as intracellular inhibitors of E6 function,despite inhibiting p53 binding and degradation inin vitro assays,37,38 which may reflect their relativelylow affinity for E6 as compared to GTE6-1.Although other groups have identified antibodiesto the N and C-terminal amino acids of the 16E6protein67,68 that are species-specific and whichblock the degradation of p53 in vitro, they did notreport any in vivo effects. The idea that the specificinhibition of E6 function (without attempting totarget the pro-apoptotic E7 protein), leads to theinduction of apoptosis, is supported by our dataand by the data of Butz.31

The antibody fragment isolated here was wellexpressed in mammalian cells when expressed aseither a scFv molecule, or when converted todiabody or triabody format, but only in the scFvformat did it have a significant effect on cellmorphology. The diabody was less robust in itsactivity than the scFv, with the GTE6-1 triabodybeing largely ineffective as a stimulator of apopto-sis. Although the reasons for these differences havenot been fully established, they may reflect thelarger size of the triabody (45,000) and diabody(30,000) as compared to the scfv. In this case, theGTE6-1 scFv (which is small enough to diffusethrough the nuclear pore) may be expected to havebetter access to the nuclear compartment where E6is found. In support of this, the triabody had alargely cytoplasmic distribution when expressed ina number of cell types, whereas the scFv was bothnuclear and cytoplasmic. The effect of GTE6-1 scFvwas specific for cells expressing the E6 protein, andwas not seen when another scFv was used, or whenthe cells were transfected with the empty vector.Importantly, the GTE6-1 scFv had no effect on cellsthat were driven to proliferate by SV40 T-antigen,which shares no sequence homology with E6, butwhich stimulates cell-cycle progression in a similarmanner to the HPV oncogenes. Intracellularlyexpressed antibody fragments, especially scFv, canact as potent inhibitors of HIV-1-encoded proteinfunction,6,69 and have been used for targeting otheroncoproteins to achieve phenotypic effects andgrowth inhibition.70–72 One of the main limitationsof this approach is believed to be functional foldingand specific recognition of the antigen by the scFvin the intracellular context of human cells.73


The reducing environment in the cell cytoplasmprevents the formation of intra-chain disulphidebonds of the variable domains of the heavy andlight chains.74 Some workers have advocatedintracellular selection strategies to isolate reagentssuitable for intracellular activity,75 however, we didnot use such strategies to isolate our antibodyfragment. Both chains possess cysteine residuescapable of producing disulphide bonds. We assumethat the overall stability of the variable domains inthe GTE6-1 scFv (but possibly not the triabody)must be good enough to preserve antigen bindingwithin the cell, or that the scFv structure issufficiently stabilized by binding to antigen.76

Cattaneo & Biocca75 reported intracellular aggrega-tion of scFv and target antigen, which mayrepresent an intermediate state in the foldingprocess. We also observed some aggregation in thecytoplasm although the majority of the scFvappeared in the nucleus, which is where E6expression has been reported.67,68 Interestingly, theGTE6-1 epitope has been mapped to amino acidresidues (aa) 43–83 on E6, which does not coincidedirectly with the nuclear export sequence (NES) inE6 (FreedmanCLevine) aa12–21 but may hinderrecognition of the NES and subsequent transport tothe cytoplasmic proteosome. This could lead to thestabilization of ubiquinated p53, as suggested bysome of our experiments (data not shown). It ispossible that the scFv does not act solely bypreventing the binding of E6AP or p53 to E6, butalso by affecting the movement of E6 complexes.

Intracellular expression of GTE6-1 inducesapoptotic changes in HPV-positive cervicalcarcinoma cells, regardless of the presence of otherpro-apoptotic agents. Induction of apoptosis, ratherthan growth inhibition, is particularly desirable fortherapeutic agents, since the former may notrequire continuous application. It will be interestingto elucidate the structure of GTE6-1 bound toHPV16E6, as this should be useful in the design ofpeptides and other active agents that specificallytarget HPV-positive dysplasias and cancers, as wellas their precursors.

Materials and Methods

Library construction

A semi-synthetic scFv library was constructed in thephagemid vector pHen2, which contains restrictionenzyme sites for cloning the VH and VL fragments aswell as a linker region to ensure their correct spacing. Theplasmid also encodes a hexa-histidine tag and a myc-tagto allow scFv purification by nickel chelate chromato-graphy and detection of the purified scFv in immuno-assays. The vector pHen2 was constructed from scFvpHen1X as described by Finnern et al.77 The synthetichuman Fab libraries fdDOG-2loxVklib, fdDOG-2loxVlliband pUC19-2loxVHlib contain a diverse repertoire ofrearranged VL and VH genes built in vitro.39,78 The GriffinscFv library was constructed from these parental Fablibraries using a two-step cloning process.

In the first stage, the kappa and lambda light chainvariable regions from the fdDOG-2loxVklib andfdDOG-2loxVllib constructs were amplified separatelyby PCR using the primers L1/FOR and FdPCR/BAK39 (seeTable 1 for primer sequences, and Figure 1 for cloningoverview). The DNA was then cut with ApaLI and NotI,and ligated into pHEN2. The ligation mixtures werethen electroporated into E. coli TG179,80 to create thelibraries pHEN2-Vklib (1.175!107 clones) and pHEN2-Vllib (3.8!107 clones). The frequency of inserts waschecked by PCR and found to be 100% in both libraries.Library diversity was confirmed by BstNI fingerprinting.81

Plasmid DNA from the two libraries was subsequentlydigested with SfiI or NcoI and XhoI in preparation forinsertion of the VH genes (summarized graphically inFigure 1).

In the second stage, the synthetic VH regions were PCRamplified from pUC19-2loxVHlib using primers LMB3and CH1.LIBSEQ.39 After digestion, the VH regions wereligated into the pHEN2 light chain library vectors(described above), and the ligation mixtures wereelectroporated into E. coli TG1 (amber suppressor strain)to create the libraries pHEN2VH-Vk and pHEN2VH-Vl.The library was made larger by performing severalhundred electroporations into E. coli TG1, producing atotal library size of 2!109. The frequency of VH to VLinserts was checked by PCR, and showed that 88% of thepHen2VH-Vklib, and 95% of the pHen2VH-Vllib con-structs contained both VH and VL inserts. Librarydiversity was confirmed by BstN1 fingerprinting. Afterpooling the libraries, phage particles were rescued withhelper phage KM13 (a gift from Peter Kristensen, Centrefor Protein Engineering, Cambridge).82 The cloningstrategy is summarized diagrammatically in Figure 1.

Library selections

Phage selection was carried out in immunotubes (Nunc,Maxisorp) that had been coated overnight with 10 mg/mlantigen at 4 8C in PBS (phosphate buffered saline: 25 mMNaH2PO4, 125 mM NaCl (pH 7.0)).83 The HPV16 E6antigen was expressed as a fusion to either maltose bindingprotein (MBP) or glutathione-S-transferase (GST) asdescribed.37,38,84 Antigen-coated tubes were blocked atroom temperature for 2 h in PBS/2% (w/v) Marvel (driedskimmed milk powder) prior to incubation in the presenceof 1011 phage using a blood tube rotator. After each bindingreaction, the immunotubes were washed ten times withPBS/0.1% (v/v) Tween 20, and the bound phage wereeluted by the addition of Trypsin (as described by de Wildtet al.85) before being reintroduced into E. coli TG1 cellsaccording to standard methods.40

Screening and nucleotide sequence analysis

After three rounds of selection, polyclonal phagepopulations from each round of selection were screenedby ELISA against MBP-16E6, GST-16E6, or controlantigens (GST, MBP, BSA).40 Individual colonies weresubsequently isolated from the polyclonal populationsafter plating on agar, and the secreted phage used to infectan E. coli amber non-suppressor strain (HB2151) in orderto allow the expression of soluble scFv fragmentsfollowing induction with IPTG.81 Binding specificitywas checked by ELISA using MBP-16E6 and GST-16E6as antigens.

The diversity of the selected scFvs was assessed by BstN1DNA fingerprinting,83 and nucleotide sequence analysis by

Table 1. Oligonucleotide primers used for library construction and for the preparation of expression constructs

Primer name Sequence

Library constructionL1/FOR GAGTCATTCTCGACTTGCGGCCGCACGTTTGATTTCCASCTTGGTCCC (Not1)FdPCR/BAK GCGATGGTTGTTGTCATTGTCGGCLMB3 CAGGAAACAGCTATGACCH1.LIBSEQ GGTGCTCTTGGAGGAGGGTGC

Sequence analysisFOR-LinkSEQ GCCACCTCCGCCTGAACCPHEN-SEQ CTATGCGGCCCCATTCA

Construction of mammalian expression vectors expressing scFv, diabodies and triabodiesPTracerE6/BAK CAGAATTCGCCACCATGGCCCAGGTGCAGCTGGTGCAGTCTGGG (EcoR1)PTracerC12/BAK CAGAATTCGCCACCATGGAGGTGCAGCTGGTGGAGTCTGGG (EcoR1)Ptracer/FOR CGTCAGCGGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCACCTAGGACGGTCAGCTT

(Not1)Dialink GTCACCGTCTCGAGTGGTGGAGGGTCGACGCAGTCTGTGCTGACT (Xho1)

Construction of mammalian expression vectors expressing peptidesPepV1DNA (RCE51) CAGAATTCGCCACCATGGAGGGCTGGTGGGAGGGCGTGTTCGACGAGCTGCTGGG-

CATGGCCGGCTGAGCGGCCGCTGACG (EcoR1/Not1)

PepP1DNA (RCE53) CAGAATTCGCCACCATGGACCGGTGGTCCGAGGGCGTGCTGGACGAGCTGCTGGGCCT-GACCGAGTGAGCGGCCGCTGACG (EcoR1/Not1)

PepE6APDNA (RCE55) CAGAATTCGCCACCATGCCCGAGTCCTCCGAGCTGACCCTGCAGGAGCTGCTGGGC-GAGGA GCGGTGAGCGGCCGCTGACG (EcoR1/Not1)

PepJumbledDNA (RCE59) CAGAATTCGCCACCATGTTCGAGCGGGACGAGGGCGTGCTGTGGCTGCTGTGGGGCTAC-GAGGAGT GAGCGGCCGCTGACG (EcoR1/Not1)

PEP-amp/FOR (RCE61) CAGAATTCGCCACCAT (EcoR1)PEP-FLAGamp/FOR RCE63 CAGAATTCGCCACCATGGACTACAAGGACGACGATGACAAGCCCGCCGGC (EcoR1)PEP-amp/BAK (RCE62) CGTCAGCGGCCGCTCA (Not1)

Construction of mammalian expression vector expressing 16E616E6/FOR CAGAATTCGCCACCATGGCCCAGGTGCAGCTGGTGCAGTCTGGG (EcoR1)16E6-FLAG/BAK CGTCAGCGGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCACCTAGGACGGTCAGCTT

(Not1)Where SZC or G


the dideoxy chain termination method, using FOR_Link-SEQ and pHEN-SEQ (Table 1) as the heavy and light chainprimers, respectively. Samples were run on an AppliedBiosystems 373A automated DNA sequencer, andsequences analysed using SeqEd (Applied Biosystems).The VH and VL genes were assigned to a germline segmentusing MacVector (IBI) and the antibody database, V-BASE†.

Preparation of scFv and its use in p53 degradationassays

For large scale purification, scFv expression wasinduced in a 1 litre culture of E. coli HB2151 for 3 h at25 8C. Periplasmic extracts were prepared as described byGriffiths et al.39 and His-tagged scFv was purified onnickel agarose (Qiagen) by batch incubation of the pooled“periplasmic” and “osmotic shock” fractions.39 The Ni-NTA beads were washed (three times) with 50 mMsodium phosphate buffer (pH 7.5), 500 ml NaCl contain-ing 10 mM imidazole, and the protein was eluted byapplying 50 mM sodium phosphate buffer (pH 7.5),500 ml NaCl containing 100 mM imidazole. The elutedprotein was dialysed against 4 l of PBS for w24 h. Thedialysed fractions were then analysed by SDS-PAGE86

and the concentration of purified scFv determinedspectrophotometrically (assuming A280 of 1.0Z0.7 mg/ml). p53 degradation assays were carried outessentially as described by Sterlinko et al.38 but in thepresence of purified scFv at concentrations ranging from200 nM to 20 mM.

† http://vbase.mrc-cpe.cam.ac.uk

Affinity measurement of E6 binding molecules

The affinity of E6-specific scFv molecules and peptideswas determined by Biacore analysis essentially asdescribed.40 MBP-16E6 was coupled to the surface ofthe sensor chip (CM5) using an amine coupling kit(Amersham/Pharmacia). Briefly, dextran on the chipsurface was activated by derivatisation with N-hydro-xysuccinimide (NHS) and N-ethyl-N 0-(dimethylamino-propyl) carbodiimide (EDC). MBP-16E6 was then dilutedin 10 mM acetate buffer (pH4.0) and injected (35 ml at10 ml/min) over the activated surface for coupling. Afterimmobilisation of the ligand, un-reacted NHS-esters weredeactivated by injection of 35 ml of 1 M ethanolamine(pH 8.5) at 5 ml/min. Peptides and scFv fragments weredissolved at the concentrations shown (see Figure 5; scFv200 nM–500 nM, peptides 1 mM) in 10 mM Hepes buffercontaining 150 mM NaCl, 3 mM EDTA and 0.005% (v/v)surfactant p20 (Amersham/Pharmacia) before beingpassed over the chip at a flow rate of 30 ml/min.Affinity constants were determined from a simultaneousfit of association and dissociation kinetics using theBiacore analysis package (langmuir 1:1 model, BIAeva-luation v. 3.0.1).

Western blotting, immunofluorescence and flowcytometry

Samples were subjected to SDS-PAGE and electro-blotted on to a nitrocellulose membrane using standardprocedures.87 Proteins were detected using monoclonalscFv as follows: filters were blocked for 2 h at roomtemperature in 3% (w/v) bovine serum albumin (BSA)C0.1% (v/v) Tween 20. Periplasmic preps of scFv

http://vbase.mrc-cpe.cam.ac.uk


(diluted 1:50) were added and incubated for 1 h at roomtemperature. After washing five times for 10 min with 3%BSA C0.1% Tween 20, binding of scFv was detected withanti-myc-HRP (Invitrogen) or anti-human l chain anti-body (The Binding Site, Birmingham, UK). Peroxidaseactivity was detected using an ECL kit from Amersham(Amersham, UK). Immunofluorescence was carriedout on monolayer cells that had been fixed in 5% (v/v)formaldehyde for 5 min as described.40 For flow cyto-metry, approximately 1!107 living cells were sortedusing a FACScan (Becton Dickinson, UK) according to theextent of their green fluorescence (488 nm). Sorted cells(typically 5!105) were subsequently dissolved in SDSsample buffer and examined by Western blotting asdescribed above.

Intracellular expression of E6-binding moleculesin mammalian cells and apoptotic assays

The cervical carcinoma cell lines C33a and SiHa (whichcontains HPV16 DNA) were maintained in DMEMsupplemented with 10% (v/v) foetal calf serum (FCS).The keratinocyte cell line, 1321, which was preparedin vitro by transfection with a CMVE6/E7 expressionconstruct,88 was maintained in Keratinocyte GrowthMedium (KGM) in the absence of feeder cells usingstandard keratinocyte culture conditions (Clonetics, US).The SV40 transformed cell line (which is driven toproliferate by SV40 T-antigen) was a kind gift from LouLaimins, (NorthWestern University, Chicago) and wasalso grown in KGM.

The selected antibody fragments were recloned into thepHEN2 vector as diabodies and triabodies in order toincrease the avidity of binding. The VL domains werePCR amplified using the oligonucleotides Dialink andpHENseq, and after digestion with the enzymes Xho1and Not1, the VL domain was ligated back into thepHEN2E6VH construct to produce a diabody.51,89–91 Sal1digestion and subsequent ligation produced a triabodyconstruct.91 To construct expression vectors capable ofexpressing antibody fragments in mammalian cellsin vitro, the VH-VL cassette from pHEN2 scFv, diabodyand triabody were PCR amplified using the primerspTracer/FOR and pTracerE6/BAK or pTracerC12/BAK(see Table 1), and digested with EcoR1 and Not1 prior toligation into the mammalian expression vector pTracer(Invitrogen). The encoded antibody molecules containeda Flag tag at the 3 0 end in order to allow their detection. Toprepare constructs able to direct the expression ofpeptides, PCR amplification was carried out usingforward primers PEP-amp/FOR or PEP-FLAGamp/FOR, along with the reverse primer PEP-amp/BAK.Synthetic oligonucleotides (listed in Table 1) were usedas templates for the PCR amplification of peptide-encoding sequences (PepV1/DNA, PepP1/DNA,PepE6AP/DNA, Pepjumbled/DNA). Amplified frag-ments were digested with EcoR1 and Not1 and werecloned into pTracer.

DNA for transfection was prepared using an EndoFreePlasmid Maxi Kit (QIAgen) and transfected into exponen-tially growing cells using Effectene (QIAgen). Aftertransfection, cells were grown for 24, 48 or 72 h oncoverslips, before immunofluorescence was performedin situ. Fixation was carried out in one of several waysdepending on the antibody being used. Total cellular DNAwas counterstained with 1 mg mlK1 of 40,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals,USA). For p53 detection, fixation was carried out using5% formaldehyde in PBS for 5 min with the p53 protein

being visualised using the monoclonal antibody DO-1(Calbiochem, USA). For M30 staining, cells were fixed inice-cold methanol at K20 8C for 30 min. The mouseantibody M30 binds to a caspase-cleaved formalin-resistant epitope of the cytokeratin 18 cytoskeletal protein(Boehringer Mannheim, Germany). Flag tagged scFv andE6 expression was detected with the monoclonal antibodyM2 (Sigma, USA) after fixing in methanol for 6 min. E6expression was detected using monoclonal antibody C1P5(Abcam, UK) following fixation in 5% formaldehyde for5 min. When necessary, GFP fluorescence was enhanced bystaining with an anti-GFP monoclonal (ab5450; Abcam,UK). DAPI, M30, Flag and GFP were visualised bytransmission epifluorescence microscopy.

Acknowledgements

We thank John Skehel for actively supporting thiswork, and Jonathan Stoye for his encouragementand advice. The work was funded by the UnitedKingdom Medical Research Council, and MedicalResearch Council Technology (MRCT).

References

1. Lobato, M. N. & Rabbitts, T. H. (2003). Intracellularantibodies and challenges facing their use as thera-peutic agents. Trends Mol. Med. 9, 390–396.

2. Tanaka, T. & Rabbitts, T. H. (2003). Intrabodies basedon intracellular capture frameworks that bind theRAS protein with high affinity and impair oncogenictransformation. EMBO J. 22, 1025–1035.

3. Cohen, P. A., Mani, J. C. & Lane, D. P. (1998).Characterization of a new intrabody directed againstthe N-terminal region of human p53. Oncogene, 17,2445–2456.

4. Lecerf, J. M., Shirley, T. L., Zhu, Q., Kazantsev, A.,Amersdorfer, P., Housman, D. E. et al. (2001). Humansingle-chain Fv intrabodies counteract in situ hun-tingtin aggregation in cellular models of Huntington’sdisease. Proc. Natl Acad. Sci. USA, 98, 4764–4769.

5. Marasco, W. A., LaVecchio, J. & Winkler, A. (1999).Human anti-HIV-1 tat sFv intrabodies for genetherapy of advanced HIV-1-infection and AIDS.J. Immunol. Methods, 231, 223–238.

6. Mhashilkar, A. M., Biswas, D. K., LaVecchio, J.,Pardee, A. B. & Marasco, W. A. (1997). Inhibition ofhuman immunodeficiency virus type 1 replicationin vitro by a novel combination of anti-Tat single-chainintrabodies and NF-kappa B antagonists. J. Virol. 71,6486–6494.

7. Mhashilkar, A. M., Bagley, J., Chen, S. Y., Szilvay, A. M.,Helland, D. G. & Marasco, W. A. (1995). Inhibition ofHIV-1 Tat-mediated LTR transactivation and HIV-1infection by anti-Tat single chain intrabodies. EMBO J.14, 1542–1551.

8. Maciejewski, J. P., Weichold, F. F., Young, N. S.,Cara, A., Zella, D., Reitz, M. S., Jr & Gallo, R. C. (1995).Intracellular expression of antibody fragmentsdirected against HIV reverse transcriptase preventsHIV infection in vitro. Nature Med. 1, 667–673.

9. Levy-Mintz, P., Duan, L., Zhang, H., Hu, B.,Dornadula, G., Zhu, M. et al. (1996). Intracellularexpression of single-chain variable fragments to


inhibit early stages of the viral life cycle by targetinghuman immunodeficiency virus type 1 integrase.J. Virol. 70, 8821–8832.

10. Lacey, C. J. (2005). Therapy for genital humanpapillomavirus-related disease. J. Clin. Virol. 32,S82–S90.

11. Munoz, N., Bosch, F. X., de Sanjose, S., Herrero, R.,Castellsague, X., Shah, K. V. et al. (2003). Epidemio-logic classification of human papillomavirus typesassociated with cervical cancer. New Engl. J. Med. 348,518–527.

12. Walboomers, J., Jacobs, M., Manos, M. M., Bosch, F.,Kummer, J., Shah, K. et al. (1999). Human papilloma-virus is a necessary cause of invasive cervical cancerworldwide. J. Pathol. 189, 12–19.

13. Longworth, M. S., Wilson, R. & Laimins, L. A. (2005).HPV31 E7 facilitates replication by activating E2F2transcription through its interaction with HDACs.EMBO J. 24, 1821–1830.

14. Jones, D. L., Thompson, D. A., Suh-Burgmann, E.,Grace, M. & Munger, K. (1999). Expression of the HPVE7 oncoprotein mimics but does not evoke a p53-dependent cellular DNA damage response pathway.Virology, 258, 406–414.

15. Jones, D. L., Alani, R. M. & Munger, K. (1997). Thehuman papillomavirus E7 oncoprotein can uncouplecellular differentiation and proliferation in humankeratinocytes by abrogating p21CIP1 mediated inhi-bition of cdk2. Genes Dev. 11, 2101–2111.

16. Funk, J. O., Waga, S., Harry, J. B., Espling, E., Stillman, B.& Galloway, D. A. (1997). Inhibition of CDK activityand PCNA-dependent DNA replication by p21 isblocked by interaction with the HPV16 E7 oncoprotein.Genes Dev. 11, 2090–2100.

17. Huibregtse, J. M., Scheffner, M. & Howley, P. M.(1991). A cellular protein mediates association of p53with the E6 oncoprotein of human papillomavirustypes 16 or 18. EMBO J. 10, 4129–4135.

18. Talis, A. L., Huibregtse, J. M. & Howley, P. M. (1998).The role of E6AP in the regulation of p53 proteinlevels in human papillomavirus (HPV)-positive andHPV-negative cells. J. Biol. Chem. 273, 6439–6445.

19. Li, S., Labrecque, S., Gauzzi, M. C., Cuddihy, A. R.,Wong, A. H., Pellegrini, S. et al. (1999). The humanpapilloma virus (HPV)-18 E6 oncoprotein physicallyassociates with Tyk2 and impairs Jak-STAT activationby interferon-alpha. Oncogene, 18, 5727–5737.

20. Matthews, K., Leong, C. M., Baxter, L., Inglis, E.,Yun, K., Backstrom, B. T. et al. (2003). Depletion ofLangerhans cells in human papillomavirus type16-infected skin is associated with E6-mediateddown regulation of E-cadherin. J. Virol. 77, 8378–8385.

21. Goodwin, E. C. & DiMaio, D. (2001). Inducedsenescence in HeLa cervical carcinoma cells contain-ing elevated telomerase activity and extended telo-meres. Cell Growth Differ. 12, 525–534.

22. Goodwin, E. C. & DiMaio, D. (2000). Repression ofhuman papillomavirus oncogenes in HeLa cervicalcarcinoma cells causes the orderly reactivation ofdormant tumor suppressor pathways. Proc. Natl Acad.Sci. USA, 97, 12513–12518.

23. Wells,S.I.,Francis,D.A.,Karpova,A.Y.,Dowhanick,J.J.,Benson, J. D. & Howley, P. M. (2000). PapillomavirusE2 induces senescence in HPV-positive cells viapRB- and p21(CIP)-dependent pathways. EMBO J. 19,5762–5771.

24. Nishimura, A., Ono, T., Ishimoto, A., Dowhanick, J. J.,Frizzell, M. A., Howley, P. M. & Sakai, H. (2000).

Mechanisms of human papillomavirus E2-mediatedrepression of viral oncogene expression and cervicalcancer cell growth inhibition. J. Virol. 74, 3752–3760.

25. Francis, D. A., Schmid, S. I. & Howley, P. M. (2000).Repression of the integrated papillomavirus E6/E7promoter is required for growth suppression ofcervical cancer cells. J. Virol. 74, 2679–2686.

26. Butz, K., Ristriani, T., Hengstermann, A., Denk, C.,Scheffner, M. & Hoppe-Seyler, F. (2003). siRNAtargeting of the viral E6 oncogene efficiently killshuman papillomavirus-positive cancer cells. Onco-gene, 22, 5938–5945.

27. Abdulkarim, B., Sabri, S., Deutsch, E., Chagraoui, H.,Maggiorella, L., Thierry, J. et al. (2002). Antiviral agentCidofovir restores p53 function and enhances theradiosensitivity in HPV-associated cancers. Oncogene,21, 2334–2346.

28. Cho, C. W., Poo, H., Cho, Y. S., Cho, M. C., Lee, K. A.,Lee, S. J. et al. (2002). HPV E6 antisense inducesapoptosis in CaSki cells via suppression of E6 splicing.Expt. Mol. Med. 34, 159–166.

29. Hietanen, S., Lain, S., Krausz, E., Blattner, C. &Lane, D. P. (2000). Activation of p53 in cervicalcarcinoma cells by small molecules. Proc. Natl Acad.Sci. USA, 97, 8501–8506.

30. Kamradt, M. C., Mohideen, N. & Vaughan, A. T.(2000). RU486 increases radiosensitivity and restoresapoptosis through modulation of HPV E6/E7 indexamethasone-treated cervical carcinoma cells.Gynecol. Oncol. 77, 177–182.

31. Butz, K., Denk, C., Ullmann, A., Scheffner, M. &Hoppe-Seyler, F. (2000). Induction of apoptosis inhuman papillomavirus positive cancer cells bypeptide aptamers targeting the viral E6 oncoprotein.Proc. Natl Acad. Sci. USA, 97, 6693–6697.

32. Beerheide, W., Sim, M. M., Tan, Y. J., Bernard, H. U. &Ting, A. E. (2000). Inactivation of the humanpapillomavirus-16 E6 oncoprotein by organic dis-ulfides. Bioorg. Med. Chem. 8, 2549–2560.

33. Liu, Y., Liu, Z., Androphy, E., Chen, J. & Baleja, J. D.(2004). Design and characterization of helical peptidesthat inhibit the E6 protein of papillomavirus.Biochemistry, 43, 7421–7731.

34. Grossberg, S. E. (2003). Perspectives on the neutral-ization of interferons by antibody. Neurology, 61,S21–S23.

35. Mascola, J. R. (2003). Defining the protective antibodyresponse for HIV-1. Curr. Mol. Med. 3, 209–216.

36. Magliani,W.,Conti,S.,Salati,A.,Arseni,S.,Ravanetti,L.,Frazzi, R. & Polonelli, L. (2003). Biotechnologicalapproaches to the production of idiotypic vaccines andantiidiotypic antibiotics. Curr. Pharm. Biotechnol. 4,91–97.

37. Elston, R., Napthine, S. & Doorbar, J. (1998). Theidentification of a conserved binding motif withinhuman papillomavirus type 16 E6 binding peptides,E6AP and E6BP. J. Gen.Virol. 79, 371–374.

38. Sterlinko, H., Weber, M., Elston, R., McIntosh, P.,Griffin, H., Banks, L. & Doorbar, J. (2004). Inhibition ofE6-induced degradation of its cellular substrates bynovel blocking peptides. J.Mol. Biol. 335, 971–985.

39. Griffiths, A. D., Williams, S. C., Hartley, O.,Tomlinson, I., Waterhouse, P., Crosby, W. L. et al.(1994). Isolation of high affinity human antibodiesdirectly from large synthetic repertoires. EMBO J. 13,3245–3260.

40. Doorbar, J.,Foo,C.,Coleman,N.,Medcalf,E.,Hartley,O.,Prospero, T. et al. (1997). Characterisation of events


during the late stages of HPV16 infection in vivo usinghigh affinity synthetic Fabs to E4. Virology, 238, 40–52.

41. Banks, L., Spence, P., Androphy, E., Hubbert, N.,Matlashewski, G., Murray, A. & Crawford, L. (1987).Identification of human papillomavirus type 18 E6polypeptide in cells derived from human cervicalcarcinomas. J. Gen. Virol. 68, 1351–1359.

42. Doorbar, J., Elston, R., Napthine, S., Raj, K., Medcalf, E.,Jackson, D. et al. (2000). The E1^E4 protein of humanpapillomavirus type 16 associates with a putative RNAhelicase through sequences in its C terminus. J. Virol.74, 10081–10095.

43. Pim, D., Massimi, P. & Banks, L. (1997). Alternativelyspliced HPV-18 E6* protein inhibits E6 mediateddegradation of p53 and suppresses transformed cellgrowth. Oncogene, 15, 257–264.

44. Pim, D. & Banks, L. (1999). HPV-18 E6*I proteinmodulates the E6-directed degradation of p53 bybinding to full-length HPV-18 E6. Oncogene, 18,7403–7408.

45. Sedman,S.A.,Barbosa,M.S.,Vass,W.C.,Hubbert,N.L.,Haas, J. A., Lowy, D. R. & Schiller, J. T. (1991). Thefull-length E6 protein of human papillomavirus type 16has transforming and trans-activating activities andcooperates with E7 to immortalize keratinocytes inculture. J. Virol. 65, 4860–4866.

46. Munger, K., Phelps, W. C., Bubb, V., Howley, P. M. &Schlegel, R. (1989). The E6 and E7 genes of the humanpapillomavirus type 16 together are necessary andsufficient for transformation of primary humankeratinocytes. J. Virol. 63, 4417–4421.

47. Romanczuk, H., Villa, L. L., Schlegel, R. & Howley, P. M.(1991). The viral transcriptional regulatory regionupstream of the E6 and E7 genes is a major determinantof the differential immortalization activities of humanpapillomavirus types 16 and 18. J. Virol. 65, 2739–2744.

48. Reinman, M., Jantti, J., Alfthan, K., Keranen, S.,Soderlund, H. & Takkinen, K. (2003). Functionalinactivation of the conserved Sem1p in yeast byintrabodies. Yeast, 20, 1071–1084.

49. Tse, E. & Rabbitts, T. H. (2000). Intracellular antibody-caspase-mediated cell killing: an approach for appli-cation in cancer therapy. Proc. Natl Acad. Sci. USA, 97,12266–12271.

50. Jendreyko, N., Popkov, M., Beerli, R. R., Chung, J.,McGavern, D. B., Rader, C. & Barbas, C. F., 3rd (2003).Intradiabodies, bispecific, tetravalent antibodies forthe simultaneous functional knockout of two cellsurface receptors. J. Biol. Chem. 278, 47812–47819.

51. Perisic, O., Webb, P. A., Holliger, P., Winter, G. &Williams, R. L. (1994). Crystal structure of a diabody, abivalent antibody fragment. Structure, 2, 1217–1226.

52. Pei, X. Y., Holliger, P., Murzin, A. G. & Williams, R. L.(1997). The 2.0-A resolution crystal structure of atrimeric antibody fragment with noncognate VH-VLdomain pairs shows a rearrangement of VH CDR3.Proc. Natl Acad. Sci. USA, 94, 9637–9642.

53. El Awady, M. K., Kaplan, J. B., O’Brien, S. J. &Burk, R. D. (1987). Molecular analysis of integratedhuman papillomavirus16 sequences in the cervicalcancer cell line SiHa. Virology, 159, 389–398.

54. Friedl, F., Kimura, I., Osato, T. & Ito, Y. (1970). Studieson a new human cell line (SiHa) derived fromcarcinoma of the uterus. Proc. Soc. Expt. Biol. Med.135, 543–545.

55. von Boehmer, H. (2005). Unique features of the pre-T-cell receptor alpha-chain: not just a surrogate. NatureRev. Immunol. 5, 571–577.

56. Darzynkiewicz, Z., Bedner, E., Traganos, F. &Murakami, T. (1998). Critical aspects in the analysisof apoptosis and necrosis. Hum. Cell, 11, 3–12.

57. Sgonc, R. & Gruber, J. (1998). Apoptosis detection: anoverview. Expt. Gerontol. 33, 525–533.

58. Otsuki, Y., Li, Z. & Shibata, M. A. (2003). Apoptoticdetection methods—from morphology to gene. Prog.Histochem. Cytochem. 38, 275–339.

59. Heatwole, V. M. (1999). TUNEL assay for apoptoticcells. Methods Mol. Biol. 115, 141–148.

60. Darzynkiewicz, Z., Bedner, E. & Traganos, F. (2001).Difficulties and pitfalls in analysis of apoptosis.Methods Cell Biol. 63, 527–546.

61. Caulin, C., Salvesen, G. S. & Oshima, R. G. (1997).Caspase cleavage of keratin 18 and reorganization ofintermediate filaments during epithelial cell apopto-sis. J. Cell Biol. 138, 1379–1394.

62. Leers, M. P., Kolgen, W., Bjorklund, V., Bergman, T.,Tribbick, G., Persson, B. et al. (1999). Immunocyto-chemical detection and mapping of a cytokeratin 18neo-epitope exposed during early apoptosis. J. Pathol.187, 567–572.

63. Jiang, M. & Milner, J. (2002). Selective silencing ofviral gene expression in HPV-positive human cervicalcarcinoma cells treated with siRNA, a primer of RNAinterference. Oncogene, 21, 6041–6048.

64. Tan, T. & Tring, R. C. Y. (1995). The in vitro and in vivoinhibition of human papillomavirus type 16 E6 and E7genes. Cancer Res. 55, 4599–4605.

65. Munger,K.,Baldwin,A.,Edwards,K.M.,Hayakawa,H.,Nguyen, C. L., Owens, M. et al. (2004). Mechanismsof human papillomavirus-induced oncogenesis. J. Virol.78, 11451–11460.

66. Venturini,F.,Braspenning, J.,Homann,M.,Gissmann,L.& Sczakiel, G. (1999). Kinetic selection of HPV 16 E6/E7-directed antisense nucleic acids: anti-proliferativeeffects on HPV 16-transformed cells. Nucl. Acids Res.27, 1585–1592.

67. Giovane, C., Trav, G., Briones, A., Lutz, Y., Wasylyk, B.& Weiss, E. (1999). Targetting of the N-terminaldomain of the human papillomavirus type 16 E6oncoprotein with monomeric ScFvs blocks the E6-mediated degradation of cellular p53. J. Mol. Recognit.12, 141–152.

68. Lagrange, M., Charbonnier, S., Orfanoudakis, G.,Robinson, P., Zanier, K., Masson, M. et al. (2005).Binding of human papillomavirus 16 E6 to p53 andE6AP is impaired by monoclonal antibodies directedagainst the second zinc-binding domain of E6. J. Gen.Virol. 86, 1001–1007.

69. Wu, Y., Duan, L., Zhu, M., Hu, B., Kubota, S.,Bagasra, O. & Pomerantz, R. J. (1996). Binding ofintracellular anti-Rev single chain variable fragmentsto different epitopes of human immunodeficiencyvirus type 1 rev: variations in viral inhibition. J. Virol.70, 3290–3297.

70. Deshane, J., Siegal, G. P., Alvarez, R. D., Wang, M. H.,Feng, M., Cabrera, G. et al. (1995). Targeted tumorkilling via an intracellular antibody against erbB-2.J. Clin. Invest. 96, 2980–2989.

71. Jannot, C. B., Beerli, R. R., Mason, S., Gullick, W. J. &Hynes, N. E. (1996). Intracellular expression of asingle-chain antibody directed to the EGFR leads togrowth inhibition of tumor cells. Oncogene, 13,275–282.

72. Cochet, O., Kenigsberg, M., Delumeau, I.,Virone-Oddos, A., Multon, M. C., Fridman, W. H.


et al. (1998). Intracellular expression of an antibodyfragment-neutralizing p21 ras promotes tumorregression. Cancer Res. 58, 1170–1176.

73. Wang-Johanning, F., Gillespie, G. Y., Grim, J.,Rancourt, C., Alvarez, R. D., Siegal, G. P. & Curiel,D. T. (1998). Intracellular expression of a single-chainantibody directed against human papillomavirustype 16 E7 oncoprotein achieves targeted antineo-plastic effects. Cancer Res. 58, 1893–1900.

74. Biocca, S., Ruberti, F., Tafani, M., Pierandrei-Amaldi, P.& Cattaneo, A. (1995). Redox state of single chain Fvfragments targeted to the endoplasmic reticulum,cytosol and mitochondria. Biotechnology (NY), 13,1110–1115.

75. Cattaneo, A. & Biocca, S. (1999). The selection ofintracellular antibodies. Trends Biotechnol. 17, 115–121.

76. Tsumoto, K., Nishimiya, Y., Kasai, N., Ueda, H.,Nagamune, T., Ogasahara, K. et al. (1997). Novelselection method for engineered antibodies using themechanism of Fv fragment stabilization in thepresence of antigen. Protein Eng. 10, 1311–1318.

77. Finnern, R., Pedrollo, E., Fisch, I., Wieslander, J.,Marks, J. D., Lockwood, C. M. & Ouwehand, W. H.(1997). Human autoimmune anti-proteinase 3 scFvfrom a phage display library. Clin. Expt. Immunol. 107,269–281.

78. Nissim, A., Hoogenboom, H. R., Tomlinson, I. M.,Flynn, G., Midgley, C., Lane, D. & Winter, G. (1994).Antibody fragments from a “single pot” phagedisplay library as immunochemical reagents. EMBOJ. 13, 692–698.

79. Dower, W. J., Miller, J. F. & Ragsdale, C. W. (1988).High efficiency transformation of E. coli by highvoltage electroporation. Nucl. Acids Res. 16,6127–6145.

80. Gibson, J. F., Poole, R. K., Hughes, M. N. & Rees, J. F.(1984). Filamentous growth of Escherichia coli K12elicited by dimeric, mixed-valence complexes ofruthenium. Arch. Microbiol. 139, 265–271.

81. Clackson, T., Hoogenboom, H. R., Griffiths, A. D. &Winter, G. (1991). Making antibody fragments usingphage display libraries. Nature, 352, 624–628.

82. Kristensen, P. & Winter, G. (1998). Proteolyticselection for protein folding using filamentousbacteriophages. Fold. Des. 3, 321–328.

83. Marks, J. D., Hoogenboom, H. R., Bonnert, T. P.,McCafferty, J., Griffiths, A. D. & Winter, G. (1991). By-passing immunization. Human antibodies fromV-gene libraries displayed on phage. J. Mol. Biol.222, 581–597.

84. Elston, R. C. (1996). Identification of cellular proteinswhich interact with the human papillomavirus E6proteins. PhD, University of Cambridge.

85. de Wildt, R. M., Mundy, C. R., Gorick, B. D. &Tomlinson, I. M. (2000). Antibody arrays for high-throughput screening of antibody–antigen inter-actions. Nature Biotechnol. 18, 989–994.

86. Laemmli, (1970). Cleavage of structural proteinsduring the assembly of the head of bacteriophageT4. Nature, 227, 680–685.

87. Sambrook, J. & Russell, D. W. (2001). MolecularCloning: A Laboratory Manual, Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

88. Hubbert, N. L., Sedman, S. A. & Schiller, J. T. (1992).Human papillomavirus type 16 E6 increases thedegradation rate of p53 in human keratinocytes.J. Virol. 66, 6237–6241.

89. Holliger, P., Manzke, O., Span, M., Hawkins, R.,Fleischmann, B., Qinghua, L. et al. (1999). Carcinoem-bryonic antigen (CEA)-specific T-cell activation incolon carcinoma induced by anti-CD3 x anti-CEAbispecific diabodies and B7 x anti-CEA bispecificfusion proteins. Cancer Res. 59, 2909–2916.

90. Holliger, P. & Winter, G. (1997). Diabodies: smallbispecific antibody fragments. Cancer Immunol.Immunother. 45, 128–130.

91. Tomlinson, I. & Holliger, P. (2000). Methods forgenerating multivalent and bispecific antibody frag-ments. Methods Enzymol. 326, 461–479.

Edited J. Karn

(Received 3 August 2005; received in revised form 19 October 2005; accepted 28 October 2005)Available online 14 November 2005

inhibition of papillomavirus protein function in cervical cancer cells by intrabody targeting

Documents